Embed Size (px)
Citation preview
REGULAR ARTICLE
Metabolic fingerprints in testicular biopsies from type 1 diabeticpatients
Marco G. Alves1 & Ana D. Martins1,5 &
Paula I.Moreira2,3 &Rui A. Carvalho3,4 &Mário Sousa5,6 &
Alberto Barros6,7 & Joaquina Silva6 & Soraia Pinto8 &
Teresinha Simões8 & Pedro Fontes Oliveira1,5
Received: 2 December 2014 /Accepted: 12 May 2015# Springer-Verlag Berlin Heidelberg 2015
Abstract Diabetes mellitus (DM) is a metabolic disease thathas grown to pandemic proportions. Recent reports havehighlighted the effect of DM on male reproductive function.Here, we hypothesize that testicular metabolism is altered intype 1 diabetic (T1D) men seeking fertility treatment. Wepropose to determine some metabolic fingerprints in testicularbiopsies of diabetic patients. For that, testicular tissue from
five normal and five type 1 diabetic men was analyzed byhigh-resolution magic-angle spinning (HR-MAS) nuclearmagnetic resonance (NMR) spectroscopy. mRNA and proteinexpression of glucose transporters and glycolysis-related en-zymes were also evaluated. Our results show that testes fromdiabetic men presented decreased levels of lactate, alanine,citrate and creatine. ThemRNA levels of glucose transporter 1(GLUT1) and phosphofructokinase 1 (PFK1) were decreasedin testes from diabetic men but only GLUT3 presented de-creased mRNA and protein levels. Lactate dehydrogenase(LDH) and glutamate pyruvate transaminase (GPT) proteinlevels were also found to be decreased in testes from diabeticmen. Overall, our results show that T1D alters glycolysis-related transporters and enzymes, compromising lactate con-tent in the testes. Moreover, testicular creatine content wasseverely depressed in T1D men. Since lactate and creatineare essential for germ cells development and support, thedata discussed here open new insights into the molecularmechanism by which DM promotes subfertility/infertility inhuman males.
Keywords Testes . Diabetes . Metabolism .
Spermatogenesis . Lactate
Introduction
Diabetes mellitus (DM) has grown to epidemic proportions inrecent years. Concerning male infertility, there is an increasingincidence of diabetic men diagnosed with the disease at anearly age. Indeed, the majority of diabetic men with type 1diabetes (T1D) are diagnosed before the age of 30 (Agbajeet al. 2007). Several sexual disorders have been consistently
* Marco G. [email protected]
* Pedro Fontes [email protected]
1 CICS – UBI – Health Sciences Research Centre, University of BeiraInterior, 6201-506 Covilhã, Portugal
2 Laboratory of Physiology, Faculty of Medicine, University ofCoimbra, 3000-548 Coimbra, Portugal
3 CNC – Center for Neuroscience and Cell Biology, University ofCoimbra, 3004-517 Coimbra, Portugal
4 Department of Life Sciences, Faculty of Science and Technology(FCTUC), University of Coimbra, 3004-517 Coimbra, Portugal
5 Department of Microscopy, Laboratory of Cell Biology, Institute ofBiomedical Sciences Abel Salazar (ICBAS) and MultidisciplinaryUnit for Biomedical Research (UMIB), University of Porto,4050-313 Porto, Portugal
6 Centre for Reproductive Genetics Prof. Alberto Barros,4100-009 Porto, Portugal
7 Department of Genetics, Faculty of Medicine, University of Porto,4200 - 319 Porto, Portugal
8 Center of Reproductive Medicine, Maternity Dr. Alfredo da Costa,Centro Hospitalar de Lisboa Central (CHLC),1069-089 Lisboa, Portugal
Cell Tissue ResDOI 10.1007/s00441-015-2217-5
reported in diabetic men, including sexual neuropathies, re-duction of sexual desire (Kolodny et al. 1974), erectile dys-function (Sexton and Jarow 1997) and retrograde ejaculation(Bourne et al. 1971; Fedele 2005). However, when analyzingfactors with a direct outcome for male fertility, such as spermparameters or DNA fragmentation, there are some conflictingresults (Dias et al. 2014). While some studies have reportedthat diabetic men present severe alterations in semen volume,sperm counts, motility and morphology (Bartak 1979; Bartaket al. 1975), others have reported only slight, non-significantdifferences in some of those parameters (Padron et al. 1984).Nonetheless, testicular biopsies from diabetic men have re-vealed anatomic, structural and morphological alterations,particularly in Sertoli cells (SCs), the main somatic compo-nent of the testicular seminiferous tubules (Cameron et al.1985), illustrating that the molecular alterations induced byDM occur mainly in testicular cells.
In vivo maintenance of spermatogenesis is highly de-pendent on glucose (Zysk et al. 1975), even though thissugar only exists at low levels in the seminiferous tu-bular fluid (Robinson and Fritz 1981). Within the testes,a strict metabolic cooperation occurs between testicularcells. The somatic SCs not only form the blood-testisbarrier regulating the ionic composition of the tubularfluids (see for review Bernardino et al. 2013; Rato et al.2010), but are also responsible for the uptake of glucoseand its metabolization into lactate that is then exportedand used as metabolic substrate by the developing germcells (see for review Alves et al. 2013c). The metabolicbehavior of SCs is very vulnerable to hormonal fluctu-ations (Boussouar and Benahmed 2004; Carosa et al.2005; Galardo et al. 2008; Martins et al. 2013; Meroniet al. 2002; Rato et al. 2012; Riera et al. 2001; Rochaet al. 2014; Ulisse et al. 1992), particularly insulin(Alves et al. 2012; Mita et al. 1985; Oliveira et al.2012; Oonk et al. 1985). In addition to a regulatory rolein the apoptotic signaling (Dias et al. 2013), insulin isreported to regulate glucose (Oliveira et al. 2012) andacetate metabolism (Alves et al. 2012) in SCs. Insulin isalso known to stimulate total nucleotides pools(Griswold and Merryweather 1982), glycine and lipidsmetabolism (Guma et al. 1997) and transferrin secretionin these somatic cells (Skinner and Griswold 1982).Moreover, it has been recently reported that insulin al-terations induced by diabetic conditions change the tes-ticular glycolytic metabolic profile in rat models (Ratoet al. 2013, 2014b). These studies provided compellingevidence that diabetic men, which present strong insulinderegulation, face a high risk for subfertility and diffi-culties in conceiving. Here, we hypothesize that testicu-lar metabolism is altered in diabetic men and we pro-pose to determine specific metabolic fingerprints in tes-ticular biopsies from diabetic patients.
Materials and methods
Chemicals
D2O (99.9 %) was purchased from Cambridge IsotopeLaboratories (Cambridge, MA, USA). Taq DNA polymeraseandMaxima SYBRGreen/Fluorescein qPCRMasterMix waspurchased from Fermentas Life Sciences (Ontario, Canada).Random primers, Moloney murine leukaemia virus reversetranscriptase (M-MLV RT) and deoxynucleotide triphos-phates (dNTPs) were purchased from NZYTECH (Lisbon,Portugal). All other chemicals were purchased from Sigma–Aldrich (St. Louis, MO, USA), unless specifically stated.
Patient selection, ethical issues and testis tissuepreparations
Testis tissue and the clinical study of the patients were per-formed at the Centre for Reproductive Genetics Prof. AlbertoBarros (Porto, Portugal) and Alfredo da Costa Maternity(Lisbon, Portugal) after approval by the Local EthicsCommittee (P.N. 12/12CES) and in accordance with theGuidelines of the Local, National and European EthicalCommittees. The testicular biopsies used in this study wereobtained from patients under treatment for recovery of malegametes and were only used after informed written consent.Moreover, only tissue left in the culture plates after patienttreatment was used. The tissue was collected and immediatelyfrozen in liquid nitrogen until further use. The studies wereperformed according to the Declaration of Helsinki forMedical Research involving Human Subjects. Ten patientswere selected for this study: five control individuals with con-served spermatogenesis (patients with psychological, vascularor neurologic anejaculation); and five type 1 diabetic patients,diagnosed for more than 8 years and following an insulintherapy to control blood glucose levels. The levels offollicle-stimulating hormone (FSH), luteinizing hormone(LH) and testosterone (T) were determined in an independentand certified laboratory of clinical pathology as part of theglobal evaluation of the patient.
HR-MAS analysis
Approximately 5 mm3 of tissue was cut and removed from thefrozen tissue and 1H high-resolution magic-angle spinning(HR-MAS) spectroscopy was performed. The tissue wasweighed and then transferred into a 40-μL zirconium HR-MAS rotor containing 10 mM of fumarate in deuterium oxide.The rotor was then assembled and placed into the spectrome-ter. 1H HR-MAS spectroscopy was performed at 9.4 T(Bruker Avance III 400 MHz), 4 °C with a 3000-Hz spin rateusing a 4-mm high-resolution triple resonance probe-headwith magic-angle spinning rotation (Bruker Biospin,
Cell Tissue Res
Karlsruhe, Germany), using standard methods (Salvaterraet al. 2013). Fully relaxed pulse-acquire spectra were attainedwith a 2-s presaturation delay, 2-s acquisition time, a 30° ra-diofrequency pulse, 40,000 points, 20,000-Hz spectral width,128 transients and four steady-state pulses. Continuous waveirradiation was used to suppress the water resonance. Themetabolite spin systems were assigned using the chemicalshifts found in the literature. Sodium fumarate was used asreference (singlet, 6.50 ppm.) to quantify the following me-tabolites, whenever present (multiplet, ppm): lactate (doublet,1.33), alanine (doublet, 1.45), acetate (singlet, 1.9), citrate(multiplet, 2.6), creatine (singlet, 3.0) and H1-α glucose (dou-blet, 5.22). The relative areas of 1H-NMR resonances werequantified using the curve-fitting routine supplied with theNUTSpro NMR spectral analysis programme (Acorn NMR,Fremont, CA, USA). After spectra acquisition, the testiculartissue was re-collected for further protein and mRNA analysis.
Quantitative real-time PCR (qPCR)
Total RNA (tRNA) extraction from tissue samples was per-formed using the SurePrep™ RNA/DNA/Protein PurificationKit (Fisher Scientific, Waltham, MA, USA) following themanufacturer’s instructions. RNA concentration and absor-bance ratios (A260/A280) were determined by spectropho-tometry (Nanophotometer™, Implen, Germany). The tRNAobtained for each sample was reverse-transcribed as previous-ly described (Alves et al. 2014). qPCR was performed to an-alyse the mRNA expression levels of phosphofructokinase 1(PFK-1), glutamate pyruvate transaminase (GPT), monocar-boxylate transporter 4 (MCT4), glucose transporters 1(GLUT1) and 3 (GLUT3) and lactate dehydrogenase A
(LDH-A). Specific primers were designed for the amplifica-tion of the target and housekeeping transcripts (Table 1).qPCR was carried out in an iQ5 system (Bio-Rad, Hercules,CA, USA) and efficiency of the amplification was determinedfor all primer sets using serial dilutions of cDNA as described(Alves et al. 2014). Amplification conditions were followed asdescribed (Vaz et al. 2012) with a specific annealing temper-ature for each primer set for 30 s (Table 1). β-2-microglobulintranscript levels were used to normalize the mRNA expressionof PFK-1, MCT4, GPT, GLUT1, GLUT3 and LDH-A. Thefold variation of the expression of target genes was calculatedfollowing the mathematical model proposed by Pfaffl usingthe formula: 2−ΔΔCt (Pfaffl 2001).
Protein expression
Protein extraction from tissue samples was performed usingthe SurePrep™ RNA/DNA/Protein Purification Kit (FisherScientific, Waltham, MA, USA) following the manufacturer’sinstructions. Protein expression was evaluated by the slot-blottechnique due to limited biological material. Moreover, allused antibodies only stain the specific proteins and their spec-ificity is well characterized by western blot analysis (Alveset al. 2014; Martins et al. 2013, 2014; Rato et al. 2013).Briefly, protein concentration of the samples was determinedby the Bio-Rad Bradford micro-assay (Bio-Rad, Richmond,USA) and 2.5 μg of total protein were diluted in phosphatebuffer saline (PBS) to a final volume of 100 μL. The slot-blotwas performed using a Hybri-slot manifold system (Biometra,Göttingen, Germany). Proteins were transferred to activatedpolyvinylidene difluoride (PVDF) membranes that were thenblocked by incubation with 5 % non-fat milk during 90 min.
Table 1 Oligonucleotides and cycling conditions for PCR amplification of glucose transporter 1 (GLUT1) and 3 (GLUT3), phosphofructokinase 1(PFK-1), lactate dehydrogenase A (LDH-A), glutamic pyruvic transaminase (GPT), monocarboxylate transporter 4 (MCT4) and β-2 microglobulin
Gene Primer sequence (5′-3′) AT(°C) Amplicon size (bp)
GLUT1 Sense: AGCAGCAAGAAGCTGACGGGTC 60 269Antisense: CGCCGGCCAAAGCGGTTAAC
GLUT3 Sense: TCAGGCTCCACCCTTTGCGGA 50 228Antisense: TGGGGTGACCTTCTGTGTCCCC
PFK-1 Sense: GGTGGACCTGGAGAAGCTG 68 142Antisense: GAGGAAGACTTTGGCACCCA
GPT Sense: GAGGAAGACTTTGGCACCCA 66 247Antisense: GATGTTGGCTCGGATGACCT
LDH-A Sense: ATTCAGCCCGATTCCGTTAC 54 131Antisense: GACACCAGCAACATTCATTCC
MCT4 Sense: CCGTGTCATTCCAGAGTG 54 121Antisense: CAGGTCCTTGAGCATAGC
β-2 microglobulin Sense: ATGAGTATGCCTGCCGTGTG 60 93Antisense: CAAACCTCCATGATGCTGCTTAC
AT annealing temperature
Cell Tissue Res
The resulting membranes were incubated with rabbit anti-GLUT1 (1:500, sc-7903; Santa Cruz Biotechnology, SantaCruz, USA), goat anti-GLUT3 (1:500, sc-7582; Santa CruzBiotechnology, Santa Cruz, USA), rabbit anti-PFK-1 (1:400,sc-67028; Santa Cruz Biotechnology, Santa Cruz, USA), rab-bit anti-MCT4 (1:1000, sc-50329; Santa Cruz Biotechnology,Santa Cruz, USA), rabbit anti-LDH (1:10000, ab52488;Abcam, Cambridge, MA, USA) and rabbit anti-GPT (1:250,sc-99088; Santa Cruz Biotechnology, Santa Cruz, USA).Mouse anti-actin (1:5000, A5441; Sigma-Aldrich, St. Louis,MO, USA) was used as protein loading control for testiculartissue. The immunoreactive proteins were detected separatelywith goat anti-rabbit IgG-AP (1:5000, sc-2004; Santa CruzBiotechnology, Santa Cruz, USA), rabbit anti-goat IgG-AP(1:5000, A4187; Sigma-Aldrich, St. Louis, MO, USA) or goatanti-mouse IgG-AP (1:5000, sc-2005; Santa CruzBiotechnology, Santa Cruz, USA). Membranes were reactedwith the ECF detection system and the densities from eachband were obtained using Quantity One Software (Bio-Rad,Hertfordshire, UK), divided by the respective actin band den-sity and then normalized against the respective control.
Statistics
The normality of data was evaluated using the Kolmogorov–Smirnov test. Statistical differences between the experimentalgroups were assessed by unpaired two-tail Student’s t test(GraphPad Software, San Diego, CA, USA). All experimentaldata are shown as mean±SEM (n=5 for each condition) andp<0.05 was considered significant.
Results
Patients’ selection and characterization
The patients selected were seeking for fertility treatment at theCentre for Reproductive Genetics Prof. Alberto Barros (Porto,Portugal) and Alfredo da Costa Maternity (Lisboa, Portugal).Control individuals were seeking for treatment due to psycho-logical, vascular or neurologic anejaculation. Diabetic individ-uals were diagnosed with conserved spermatogenesis but ret-rograde ejaculation. They presented a diagnosed diabetic sta-tus for more than 8 years. All patients were subjected to ther-apy and testicular sperm extraction (TESE), which is reportedto be suitable to obtain better and more sperm (Donoso et al.2007), was only performed under sedation as a last resort toobtain spermatozoa to be used in intra-cytoplasmic sperm in-jection (ICSI). The average age of the patients was 43.8±4.8 years for controls and 37.3±0.9 years for diabetic individ-uals (Table 2). Although all patients presented hormonal levelswithin the reference range, diabetic individuals presented, onaverage, significant lower levels of T and FSH (Table 2).
Diabetic individuals present lower testicular levelsof lactate and alanine
Glycolytic metabolism is a central process in the testes.Glucose was not detected in testicular biopsies from controland diabetic individuals, which suggests that glucose is notaccumulated in testicular tissue. Lactate metabolism assumesa determinant role in the testes since lactate is associated withsurvival of germ cells (Erkkila et al. 2002), stimulation ofprotein synthesis in round spermatids (Nakamura et al.1981) and improvement of spermatogenesis in vivo(Courtens and Ploen 1999). Therefore, we quantified thelevels of this metabolite in testicular biopsies from controland diabetic men. The lactate content in testicular biopsiesfrom control men was 130±17 nmol/mgww, while in testicularbiopsies from diabetic men it was 53±9 nmol/mgww (Fig. 1a).Alanine metabolism is closely associated with lactate pro-duction since it is derived from pyruvate, which is thecentral crossroads in the lactate/alanine pathway. Our re-sults show that the alanine levels in testicular biopsiesfrom control men were 15±5 nmol/mgww while in testic-ular biopsies of diabetic individuals the alanine levels de-te rmined were 1 .0 ± 0 .3 nmol /mgww (Fig . 1b) .Interestingly, the lactate/alanine ratio, which is often usedas a cellular and tissue redox index, did not reach signif-icant differences between the control group (20±11) andthe diabetic group (52±13) (Fig. 1c).
Testicular biopsies from diabetic men present decreasedlevels of citrate and creatine
Acetate has been reported to play a crucial role in the testes(Alves et al. 2012). Testicular biopsies from diabetic menpresented similar acetate content with control (3.0±1.3 and1.6±0.5 nmol/mgww , respectively) (Fig. 2a). However, sig-nificant differences were detected concerning citrate and cre-atine testicular content between normal and diabetic men.
Table 2 Characteristics of control and diabetic (DM) patients. The ageand hormonal levels, as well as fasting glycaemia and the number of yearswith the diagnostic for the disease are presented
Control DM
Age (years) 43.8±4.8 37.3±0.9
FSH (mUI/mL) 5.8±0.5 3.8±0.3*
LH (mUI/mL) 5.0±0.7 5.2±0.7
Testosterone (ng/mL) 5.4±0.4 4.1±0.4*
Fasting glycaemia (mg/dL) 79.2±3.6 227.0±20.8*
Years of DM NA 8.7±0.2
Results are expressed as means±SEM (n=5 for each condition)
*Significantly different relative to control (P<0.05)
Cell Tissue Res
Both metabolites can be used as energetic sources for testicu-lar cells (Kaiser et al. 2005). Testicular content of citrate was5.4±1.4 nmol/mgww in control individuals and 1.9±0.3 nmol/mgww in diabetic men (Fig. 2b). Our results show that diabeteshas an even more pronounced effect in testicular creatine con-tent since its levels significantly decreased in diabetic individ-uals compared to control men, from 34±6 nmol/mgww to 0.9±0.3 nmol/mgww (Fig. 2c).
Glucose transporters levels are downregulatedin testicular biopsies of diabetic men but only GLUT3protein expression is decreased
The testes are metabolically very active and do not accumulateglucose. Therefore, testicular cells metabolism is mainlysustained by glucose uptake from circulation. For this process,the glucose transporters (GLUT1 and GLUT3) are essentialand may be a rate-limiting step for glycolysis (Fink et al.
Fig. 1 Effect of type 1 diabetes in intratesticular lactate (a) and alanine(b) content as well as in lactate/alanine ratio (c). Results are expressed asmean±SEM (n=5 for each condition). Significantly different results(P<0.05) relative to control are indicated by an asterisk (*)
Fig. 2 Effect of type 1 diabetes in intratesticular acetate (a), citrate (b)and creatine (c) content. Results are expressed as mean±SEM (n=5 foreach condition). Significantly different results (P<0.05) relative tocontrol are indicated by an asterisk (*)
Cell Tissue Res
1992). Our results show that GLUT1 and GLUT3 mRNAlevels were downregulated in testicular biopsies of diabeticmen to 0.33±0.1- and 0.58±0.16-fold variation relative totesticular biopsies from control men, respectively (Fig. 3a).However, when analyzing the protein levels, there was onlya significant decrease of GLUT3 levels in testicular biopsiesof diabetic men to 0.83±0.04-fold variation relative to thecontrol (Fig. 3b). After entering the cells, glucose is metabo-lized via glycolysis. In this process, the enzyme that irrevers-ibly converts fructose 6-phosphate to fructose 1,6-bisphosphate, PFK, is known to be a rate-limiting step of thispathway. Our results show that testicular biopsies from dia-betic men presented a significant decrease in PFK-1 mRNAlevels to 0.46±0.04-fold variation relative to control men(Fig. 3a). However, no alterations were detected in PFK-1 pro-tein levels of testicular biopsies of diabetic men when com-pared with testicular biopsies from control men (Fig. 3b).
Testicular biopsies from diabetic men reveal a significantdecrease in LDH and GPT protein expression
The glycolytic metabolism of glucose yields pyruvate that caneither be converted to lactate or to alanine. Therefore and
since we have determined the testicular lactate and alaninecontents, we evaluated the mRNA and protein levels of theenzymes responsible for the conversion of pyruvate to lactate(LDH) and alanine (GPT). According to our results, the met-abolic fingerprints associated with testicular metabolism ofdiabetic individuals are linked with altered production andaccumulation of lactate. Thus, we determined the variationon LDH-A mRNA levels, since it has been shown thatLDH-A (rather than LDH-C), is deeply involved in the con-trol of energy metabolism in the testicular cells, being respon-sible for the production of lactate (Boussouar and Benahmed1999). In addition, alteration of LDH-A rather than of LDH-Cis a key mechanism for the effect of several factors in lactateproduction (Boussouar and Benahmed 1999). We detected asignificant increase of 2.4±0.5-fold of LDH-A mRNA levelsin testicular biopsies from diabetic men (relative to controlindividuals) (Fig. 3c). Nevertheless, when assessing LDH pro-tein expression levels in testicular biopsies from diabetic men,our results show that they decreased to 0.86±0.01-fold varia-tion relative to the control (Fig. 3d). The protein expressionlevels of GPT in testicular biopsies from diabetic men werealso significantly decreased with a 0.50±0.07-fold variationrelative to the control (Fig. 3d). We also measured the mRNA
Fig. 3 Effect of type 1 diabetes in glycolysis-related enzymes andtransporters. mRNA (a, c) and protein expression levels (b, d) ofGLUT1, GLUT3, PFK-1, LDH(-A), GPT and MCT4 in testicular biop-sies from type 1 diabetic individuals. Results are expressed as mean±
SEM (n=5 for each condition) and in fold variation relative to controlcondition. Significantly different results (P<0.05) relative to control areindicated by an asterisk (*)
Cell Tissue Res
and protein levels ofMCT4, which are known to play a crucialrole in lactate export by testicular cells. Our results show thatthere are no significant differences in MCT4 mRNA and pro-tein levels between testicular biopsies from diabetic and con-trol men (Fig. 3c, d).
Discussion
Diabetes induces several reproductive dysfunctions in males.Indeed, it is widely accepted that diabetic men face somedifficulties in conceiving. Not all diabetic men are infertileand there are conflicting results in different studies concerningsperm parameters or DNA integrity in diabetic men, hamper-ing a clear conclusion on the effect of DM in male reproduc-tive health. Yet, even when these parameters do not differ, themechanisms involved in glucose uptake and transport are ex-pected to be altered. This is a crucial aspect since testicularglucose metabolism is pivotal to the normal occurrence ofspermatogenesis. Here, we hypothesized that the testicularglucose metabolism was altered in diabetic men and that somemetabolic fingerprints could be identified in testicular biopsiesof diabetic men. It is known that testes are not able to accu-mulate glucose (Mallidis et al. 2009; Rato et al. 2013). Thus,as expected, we did not observe glucose in the testicular tissueof either control or diabetic men, confirming that this hexosedoes not accumulate in testes. Since testicular glucose metab-olism is critical to the progression of spermatogenesis andmaintenance of testicular cells functioning, our results providefurther evidence that glucose homeostasis in the bloodstreammay be required for regular male fertility.
Testicular cells, particularly SCs, respond to metabolicstimuli by modulating glycolysis-related transporters and en-zymes to ensure the production of crucial metabolites such aslactate (Alves et al. 2013b, 2014; Martins et al. 2013). Indiabetic individuals, hormonal and glucose fluctuations occur.Thus, testicular cells are expected to respond to those stimuli.In testicular cells, glucose uptake mainly occurs through theaction of GLUTs. Our results show that diabetic individualspresent a downregulation of GLUT1 and GLUT3 mRNAlevels, although only GLUT3 protein levels were found tobe decreased in testicular biopsies of diabetic men. In testicu-lar cells, alterations in mRNA of these glycolysis-relatedtransporters and enzymes occur on a different timeframe ofprotein levels (Alves et al. 2013b; Martins et al. 2013, 2014).In addition, it is possible that the alterations detected in theanalyzed mRNA contents occur at a transcriptional and/orpost-transcriptional level. Nonetheless, these results illustratethat diabetic men presented important alterations in testicularmechanisms of glucose uptake.
After entering the cells, glucose is metabolized through theglycolytic pathway. The action of PFK is usually reported as arate-limiting step of this process. Our results show that
diabetic men present a downregulation of PFK-1 mRNAlevels that is not followed by changes in protein levels, illus-trating that, again, the mRNA of glycolysis-related enzymesand transporters in testes is very sensitive to the diabetic con-dition. Once glucose enters the glycolytic pathway, it is con-verted to pyruvate, which is a central crossroads in intermedi-ary metabolism, leading not only to energy productionthrough oxidation in the Krebs cycle but also to alanine orlactate production. Our results show that DM decreases theprotein levels of LDH and GPT. LDH is responsible for theconversion of pyruvate to lactate and thus, concomitant withthe decrease levels of LDH, lactate accumulation in testiculartissue was significantly decreased in diabetic men. This is animportant finding since lactate regulates spermatocyte meta-bolic activity and survival (Jutte et al. 1982). In addition, lac-tate improves spermatogenesis (Courtens and Ploen 1999) andhas been reported to inhibit germ cells apoptosis in a dose-dependent manner (Erkkila et al. 2002). Interestingly, GPTprotein levels were also found to be decreased. GPT is respon-sible for the conversion of pyruvate to alanine and thus, con-comitant with the decrease of GPT levels, alanine accumula-tion in testicular tissue was also found to be decreased indiabetic men. In sum, the resulting pyruvate from glycolysisis probably being redirected to the Krebs cycle. This hypoth-esis is concomitant with the low levels of citrate detected intesticular biopsies of diabetic men since this metabolite is anintermediate of the Krebs cycle. Interestingly, creatine levelswere also found to be severely decreased. This metabolite iscrucial for regular testicular functioning. It has been reportedthat the testes are one of the major sources of creatine in thebody (Lee et al. 1998). Creatine is expected to play a key role,not only as an energetic source for testicular cells (Kaiser et al.2005) but also in antioxidant mechanisms (Lawler et al.2002). In addition, it has been proposed that creatine is essen-tial for germ cells development (Lee et al. 1998). Therefore,our results provide clear evidence that creatine metabolism iscompromised in the testes of diabetic men and may be respon-sible for the subfertility/infertility problems that arise in mostof them. Further studies will be needed to test this hypothesis.
There is compelling evidence that DM increases tissue andcellular oxidative stress (Tabak et al. 2011). Hyperglycemia-associated stimulation of reactive oxygen species productionis responsible for many clinical complications promoted byDM and other metabolic diseases (Brownlee 2001). Our re-sults show that creatine content is depressed in testicular tissuefrom diabetic men, which provides evidence for decreasedantioxidants and, thus, increased oxidative stress in the testesof diabetic men. Of note, the metabolic cues detected in tes-ticular biopsies of diabetic men, namely concerning lactateand alanine content, suggest a possible metabolic adaptationto maintain cellular redox state. The lactate/alanine ratio isoften used as an index of cellular redox state, as the conversionof pyruvate or its conversion into alanine is coupled to the re-
Cell Tissue Res
oxidation of NADH to NAD+ (Alves et al. 2013b, 2014; Ratoet al. 2013). DM induces a decrease in testicular tissue lactatecontent that is followed by a decrease in the alanine content,thus maintaining the lactate/alanine ratio. Testicular cells areknown for their metabolic plasticity (for review see Alveset al. 2013a, c; Oliveira et al. 2015); thus, it is possible thatthe metabolic alterations reported here are the cause or theconsequence of oxidative stress. Further studies will be need-ed to disclose the molecular mechanisms by which DM mod-ulates testicular cells metabolism and oxidative stress induc-ing male subfertility/infertility.
A limitation of the present study is the difficulty in follow-ing patient diet and treatment. DM is also often associatedwith several Bsilent^ comorbidities difficult to address (Ratoet al. 2014a). Since only tissue left in culture after infertilitytreatment was approved for use in this study and due to ethicalreasons that do not allow the collection of testicular tissue forstudies of this nature, the biological material available wasscarce. Nevertheless, to avoid major deviations, the samepiece of tissue was used for all the analysis performed in thisstudy, providing robust metabolic cues in testicular tissue fromdiabetic men. In addition, since diabetic men had retrogradeejaculation and control individuals had anejaculation, semenanalyses and histological assessment were not carried out.This study involves whole testis tissue that includes Sertoli,germ, peritubular, vascular and other cells. Thus, we reportan overall metabolic status of the testicular tissue instead ofa cell-only orientated fingerprint. Moreover, we selected me-tabolites that are well identified and of interest to glucose
metabolism in testicular tissue, which was the primary objec-tive of this study. Further studies to unravel the metabolicfingerprints of DM-associated infertility will be needed.
In sum, we report that DM alters glycolysis-related trans-porters and enzymes, compromising lactate content in the tes-tes. This decrease in testicular lactate content is followed by adecrease in alanine, which allows the maintenance of thelactate/alanine ratio. Moreover, our results suggest a stimula-tion of Krebs cycle, which can compromise testicular cells’normal functioning. Finally, our results show that diabeticmen present a strong depression in testicular creatine content.This report unravels some metabolic fingerprints associatedwith DM-induced testicular metabolic dysfunction (Fig. 4),which may determine the male subfertility/infertility pheno-type. Disclosing the chronic metabolic changes, beyond glu-cose uptake, induced by DM in testes may open new possi-bilities for a metabolic therapeutic intervention to counteractmale subfertility/infertility associated with DM.
Acknowledgments This work was supported by the ‘Fundação para aCiência e a Tecnologia’ – FCT (PTDC/QUI-BIQ/121446/2010 and PEst-C /SAU/UI0709 /2011) co- funded by Fundo Europeu deDesenvolvimento Regional – FEDER via ProgramaOperacional Factoresde Competitividade – COMPETE/QREN. M.G. Alves and P.F. Oliveirawere funded by FCT through SFRH/BPD/80451/2011 and FSE andPOPH funds (Programa Ciência 2008), respectively. The funding agencyhad no role in study design, in the collection, analysis and interpretationof data, in the writing of the report, or in the decision to submit the articlefor publication.
Fig. 4 Schematic representationof the major metabolicfingerprints found to be altered intesticular biopsies from diabeticindividuals. Our results provideclear evidence that lactatemetabolism is depressed, as wellas alanine production. The Krebscycle may be stimulated, whichmay be deleterious for testicularcells. Creatine, which is oftendescribed as a marker fortesticular condition, was alsofound to be severely decreased intesticular biopsies from diabeticindividuals. Of note, themechanisms of glucose transportappear to be decreased inresponse to possible glucosehomeostasis deregulation
Cell Tissue Res
References
Agbaje IM, Rogers DA, McVicar CM, McClure N, Atkinson AB,Mallidis C, Lewis SE (2007) Insulin dependant diabetes mellitus:implications for male reproductive function. Hum Reprod 22:1871–1877
Alves MG, Socorro S, Silva J, Barros A, Sousa M, Cavaco JE, OliveiraPF (2012) In vitro cultured human Sertoli cells secrete high amountsof acetate that is stimulated by 17beta-estradiol and suppressed byinsulin deprivation. Biochim Biophys Acta 1823:1389–1394
Alves MG, Martins AD, Rato L, Moreira PI, Socorro S, Oliveira PF(2013a) Molecular mechanisms beyond glucose transport indiabetes-related male infertility. Biochim Biophys Acta 1832:626–635
Alves MG, Neuhaus-Oliveira A, Moreira PI, Socorro S, Oliveira PF(2013b) Exposure to 2,4-dichlorophenoxyacetic acid alters glucosemetabolism in immature rat Sertoli cells. Reprod Toxicol 38C:81–88
Alves MG, Rato L, Carvalho RA, Moreira PI, Socorro S, Oliveira PF(2013c) Hormonal control of Sertoli cell metabolism regulates sper-matogenesis. Cell Mol Life Sci 70:777–793
Alves MG, Martins AD, Vaz CV, Correia S, Moreira PI, Oliveira PF,Socorro S (2014) Metformin and male reproduction: effects onSertoli cell metabolism. Br J Pharmacol 171:1033–1042
Bartak V (1979) Sperm quality in adult diabetic men. Int J Fertil 24:226–232
Bartak V, Josifko M, Horackova M (1975) Juvenile diabetes and humansperm quality. Int J Fertil 20:30–32
Bernardino RL, Jesus TT, Martins AD, Sousa M, Barros A, Cavaco JE,Socorro S, Alves MG, Oliveira PF (2013) Molecular basis of bicar-bonate membrane transport in the male reproductive tract. Curr MedChem 20:4037–4049
Bourne RB, Kretzschmar WA, Esser JH (1971) Successful artificial in-semination in a diabetic with retrograde ejaculation. Fertil Steril 22:275–277
Boussouar F, Benahmed M (1999) Epidermal growth factor regulatesglucose metabolism through lactate dehydrogenase A messengerribonucleic acid expression in cultured porcine Sertoli cells. BiolReprod 61:1139–1145
Boussouar F, Benahmed M (2004) Lactate and energy metabolism inmale germ cells. Trends Endocrinol Metab 15:345–350
Brownlee M (2001) Biochemistry and molecular cell biology of diabeticcomplications. Nature 414:813–820
Cameron DF, Murray FT, Drylie DD (1985) Interstitial compartmentpathology and spermatogenic disruption in testes from impotentdiabetic men. Anat Rec 213:53–62
Carosa E, Radico C, Giansante N, Rossi S, D’Adamo F, Di Stasi SM,Lenzi A, Jannini EA (2005) Ontogenetic profile and thyroid hor-mone regulation of type-1 and type-8 glucose transporters in ratSertoli cells. Int J Androl 28:99–106
Courtens JL, Ploen L (1999) Improvement of spermatogenesis in adultcryptorchid rat testis by intratesticular infusion of lactate. BiolReprod 61:154–161
Dias TR, Rato L, Martins AD, Simões VL, Jesus TT, Alves MG, OliveiraPF (2013) Insulin deprivation decreases caspase-dependent apopto-tic signaling in cultured rat Sertoli cells. ISRN Urol 2013:970370
Dias TR, Alves MG, Silva BM, Oliveira PF (2014) Sperm glucose trans-port and metabolism in diabetic individuals. Mol Cell Endocrinol396:37–45
Donoso P, Tournaye H, Devroey P (2007) Which is the best sperm re-trieval technique for non-obstructive azoospermia? A systematicreview. Hum Reprod Update 13:539–549
Erkkila K, Aito H, Aalto K, Pentikainen V, Dunkel L (2002) Lactateinhibits germ cell apoptosis in the human testis. Mol Hum Reprod8:109–117
Fedele D (2005) Therapy insight: sexual and bladder dysfunction associ-ated with diabetes mellitus. Nat Clin Pract Urol 2:282–290
Fink RI, Wallace P, Brechtel G, Olefsky JM (1992) Evidence that glucosetransport is rate-limiting for in vivo glucose uptake. Metabolism 41:897–902
Galardo MN, Riera MF, Pellizzari EH, Chemes HE, Venara MC,Cigorraga SB, Meroni SB (2008) Regulation of expression ofSertoli cell glucose transporters 1 and 3 by FSH, IL1 beta, andbFGF at two different time-points in pubertal development. CellTissue Res 334:295–304
Griswold MD, Merryweather J (1982) Insulin stimulates the incorpora-tion of 32Pi into ribonucleic acid in cultured sertoli cells.Endocrinology 111:661–667
Guma FC,Wagner M,Martini LH, Bernard EA (1997) Effect of FSH andinsulin on lipogenesis in cultures of Sertoli cells from immature rats.Braz J Med Biol Res 30:591–597
Jutte NH, Jansen R, Grootegoed JA, Rommerts FF, Clausen OP, van derMolen HJ (1982) Regulation of survival of rat pachytene spermato-cytes by lactate supply from Sertoli cells. J Reprod Fertil 65:431–438
Kaiser GR, Monteiro SC, Gelain DP, Souza LF, Perry ML, Bernard EA(2005) Metabolism of amino acids by cultured rat Sertoli cells.Metabolism 54:515–521
Kolodny RC, Kahn CB, Goldstein HH, Barnett DM (1974) Sexual dys-function in diabetic men. Diabetes 23:306–309
Lawler JM, Barnes WS, Wu G, Song W, Demaree S (2002) Direct anti-oxidant properties of creatine. Biochem Biophys Res Commun 290:47–52
Lee H, Kim JH, Chae YJ, OgawaH, LeeMH,Gerton GL (1998) Creatinesynthesis and transport systems in the male rat reproductive tract.Biol Reprod 58:1437–1444
Mallidis C, Green BD, Rogers D, Agbaje IM, Hollis J, Migaud M,Amigues E, McClure N, Browne RA (2009) Metabolic profilechanges in the testes of mice with streptozotocin-induced type 1diabetes mellitus. Int J Androl 32:156–165
Martins AD, Alves MG, Simoes VL, Dias TR, Rato L, Moreira PI,Socorro S, Cavaco JE, Oliveira PF (2013) Control of Sertoli cellmetabolism by sex steroid hormones is mediated through modula-tion in glycolysis-related transporters and enzymes. Cell Tissue Res354:861–868
Martins AD, Alves MG, Bernardino RL, Dias TR, Silva BM, Oliveira PF(2014) Effect of white tea (Camellia sinensis (L.)) extract in theglycolytic profile of Sertoli cell. Eur J Nutr 53:1383–1391
Meroni SB, Riera MF, Pellizzari EH, Cigorraga SB (2002) Regulation ofrat Sertoli cell function by FSH: possible role of phos-phatidylinositol 3-kinase/protein kinase B pathway. J Endocrinol174:195–204
Mita M, Borland K, Price JM, Hall PF (1985) The influence of insulinand insulin-like growth factor-I on hexose transport by Sertoli cells.Endocrinology 116:987–992
Nakamura M, Hino A, Yasumasu I, Kato J (1981) Stimulation of proteinsynthesis in round spermatids from rat testes by lactate. J Biochem89:1309–1315
Oliveira PF, Alves MG, Rato L, Laurentino S, Silva J, Sa R, Barros A,Sousa M, Carvalho RA, Cavaco JE, Socorro S (2012) Effect ofinsulin deprivation on metabolism and metabolism-associated genetranscript levels of in vitro cultured human Sertoli cells. BiochimBiophys Acta Protein Struct Mol Enzymol 1820:84–89
Oliveira PF, Martins AD, Moreira AC, Cheng CY, Alves MG (2015) TheWarburg effect revisited-lesson from the sertoli cell. Med Res Rev35:126–151
Oonk RB, Grootegoed JA, van der Molen HJ (1985) Comparison of theeffects of insulin and follitropin on glucose metabolism by Sertolicells from immature rats. Mol Cell Endocrinol 42:39–48
Padron RS, Dambay A, Suarez R, Mas J (1984) Semen analyses in ado-lescent diabetic patients. Acta Diabetol Lat 21:115–121
Cell Tissue Res
Pfaffl MW (2001) A new mathematical model for relative quantificationin real-time RT-PCR. Nucleic Acids Res 29:e45
Rato L, Socorro S, Cavaco JE, Oliveira PF (2010) Tubular fluid secretionin the seminiferous epithelium: ion transporters and aquaporins inSertoli cells. J Membr Biol 236:215–224
Rato L, Alves MG, Socorro S, Carvalho RA, Cavaco JE, Oliveira PF(2012) Metabolic modulation induced by oestradiol and DHT inimmature rat Sertoli cells cultured in vitro. Biosci Rep 32:61–69
Rato L, AlvesMG, Dias TR, Lopes G, Cavaco JE, Socorro S, Oliveira PF(2013) High-energy diets may induce a pre-diabetic state alteringtesticular glycolytic metabolic profile and male reproductive param-eters. Andrology 1:495–504
Rato L, Alves MG, Cavaco JE, Oliveira PF (2014a) High-energy diets: athreat for male fertility? Obes Rev 15:996–1007
Rato L, Duarte AI, Tomas GD, Santos MS, Moreira PI, Socorro S,Cavaco JE, Alves MG, Oliveira PF (2014b) Pre-diabetes alters tes-ticular PGC1-alpha/SIRT3 axis modulating mitochondrial bioener-getics and oxidative stress. Biochim Biophys Acta 1837:335–344
Riera MF, Meroni SB, Gomez GE, Schteingart HF, Pellizzari EH,Cigorraga SB (2001) Regulation of lactate production by FSH,iL1beta, and TNFalpha in rat Sertoli cells. Gen Comp Endocrinol122:88–97
Robinson R, Fritz IB (1981) Metabolism of glucose by Sertoli cells inculture. Biol Reprod 24:1032–1041
Rocha CS, Martins AD, Rato L, Silva BM, Oliveira PF, AlvesMG (2014) Melatonin alters the glycolytic profile of Sertoli
cells: implications for male fertility. Mol Hum Reprod 20:1067–1076
Salvaterra T, Alves MG, Domingues I, Pereira R, Rasteiro MG, CarvalhoRA, Soares AM, Lopes I (2013) Biochemical and metabolic effectsof a short-term exposure to nanoparticles of titanium silicate in tad-poles of Pelophylax perezi (Seoane). Aquat Toxicol 128–129:190–192
Sexton WJ, Jarow JP (1997) Effect of diabetes mellitus upon male repro-ductive function. Urology 49:508–513
Skinner MK, Griswold MD (1982) Secretion of testicular transferrin bycultured Sertoli cells is regulated by hormones and retinoids. BiolReprod 27:211–221
Tabak O, Gelisgen R, Erman H, Erdenen F, Muderrisoglu C, Aral H,Uzun H (2011) Oxidative lipid, protein, and DNA damage as oxi-dative stress markers in vascular complications of diabetes mellitus.Clin Invest Med 34:E163–E171
Ulisse S, Jannini EA, Pepe M, De Matteis S, D’Armiento M (1992)Thyroid hormone stimulates glucose transport and GLUT1 mRNAin rat Sertoli cells. Mol Cell Endocrinol 87:131–137
Vaz CV, Alves MG, Marques R, Moreira PI, Oliveira PF, Maia CJ,Socorro S (2012) Androgen-responsive and nonresponsive prostatecancer cells present a distinct glycolytic metabolism profile. Int JBiochem Cell Biol 44:2077–2084
Zysk JR, Bushway AA, Whistler RL, Carlton WW (1975) Temporarysterility produced in male mice by 5-thio-D-glucose. J Reprod Fertil45:69–72
Cell Tissue Res
