Maladaptation in wild populations of the generalist plant pathogen Pseudomonas syringae

Maladaptation in wild populations of the generalist plantpathogen Pseudomonas syringae

Joel M. Kniskern1,2, Luke G. Barrett1,3, and Joy BergelsonDepartment of Ecology and Evolution, University of Chicago, 1101 E. 57th Street, Chicago, IL60637, USA

AbstractMulti-host pathogens occur widely on both natural and agriculturally managed hosts. Despite theimportance of such generalists, evolutionary studies of host-pathogen interactions have largelyfocused on tightly coupled interactions between species pairs. We characterized resistance in acollection of Arabidopsis thaliana hosts, including 24 accessions collected from the Midwest USAand 24 from around the world, and patterns of virulence in a collection of Pseudomonas syringaestrains, including 24 strains collected from wild Midwest populations of A. thaliana (residents)and 18 from an array of cultivated species (non-residents). All of the non-resident strains and halfof the resident strains elicited a resistance response on one or more A. thaliana accessions. Theresident strains that failed to elicit any resistance response possessed an alternative type IIIsecretion system (T3SS) that is unable to deliver effectors into plant host cells; as a result, theseseemingly non-pathogenic strains are incapable of engaging in gene for gene interactions with A.thaliana. The remaining resident strains triggered greater resistance compared to non-residentstrains, consistent with maladaptation of the resident bacterial population. We weigh theplausibility of two explanations: general maladaptation of pathogen strains and a more novelhypothesis whereby community level epidemiological dynamics result in adaptive dynamicsfavoring ephemeral hosts like A. thaliana.

Keywordslocal adaptation; pathogen; host; coevolution; Pseudomonas syringae; type III secretion;coevolution; R gene; Avr gene; gene-for-gene

INTRODUCTIONThe importance of pathogens as dynamic agents of selection on hosts is reflected in thepersistence of genetic variation for resistance in wild host populations (Salvaudon et al.2008; Lazzaro and Little 2009). With only a few exceptions (Gandon 2004; Thrall et al.2005; Goss and Bergelson 2006; Woodhams et al. 2006) theoretical and empirical studies onthe maintenance of genetic variation for resistance in hosts and virulence in pathogens havefocused on tightly coupled interactions involving relatively specialized pathogens (Barrett etal. 2009). This is despite the fact that a large proportion of pathogens of plants and animalsare generalists that infect multiple host species (Woolhouse et al. 2001; Barrett et al. 2009),and evidence that many emerging diseases are caused by generalist parasites infecting

Author for correspondence: Joy Bergelson, Tel: (773) 702-3855, Fax: (773) 702-9740, [email protected] authors contributed equally to this study.2Current adress: Seminis Vegetable Seeds, Monsanto Vegetable Division, 37437 State Highway 16, Woodland, CA 956953Current adress: CSIRO Plant Industry, GPO Box 1600, Canberra, Australian Capital Territory, 2601, Australia

NIH Public AccessAuthor ManuscriptEvolution. Author manuscript; available in PMC 2012 March 1.

Published in final edited form as:Evolution. 2011 March ; 65(3): 818–830. doi:10.1111/j.1558-5646.2010.01157.x.

NIH

-PA Author Manuscript

NIH


NIH


multiple host species (Cleaveland et al. 2001). There is also growing evidence that variationin host range and virulence can have a significant impact at the ecological level, widelyinfluencing the potential for transmission, disease incidence, and impacts on host fitness(Power and Mitchell 2004; Colla et al. 2006; Barrett et al. 2009; Hellgren et al. 2009).However, the consequences of multi-host-pathogen interactions for the evolution of hostresistance and microbial pathogenesis remain largely unexplored (but see Gandon 2002;Spitzer 2006).

The ecological and evolutionary dynamics maintaining resistance and virulence variation inspecialized, tightly-coupled host-pathogen interactions have been well studied. For suchsystems, microbial pathogens are expected to have an adaptive advantage over their hostsdue to their relatively large population sizes, fast generation times and high migratorycapacity (Hamilton et al. 1990; Kaltz and Shykoff 1998). However, the complexitygenerated by interactions with multiple host species calls into question the applicability ofthese predictions for generalist pathogens. Compared to specialist pathogens, generalistsencounter hosts that vary widely in mechanisms of resistance and in the proportion ofresources allocated to defense (Barrett et al. 2009). Encounter rates between individual hostspecies and generalist pathogens within communities are also likely to be highly dynamic,depending on the diversity, spatial structure and phenology of the host community(Carlsson-Graner and Thrall 2006; Mitchell and Power 2006; Barrett et al. 2008). Suchheterogeneities in selection imposed by alternative host species are likely to limit the abilityof pathogen species to adapt to any one particular host (Gandon 2002; Lajeunesse andForbes 2002). Furthermore, evolutionary outcomes are likely to be highly contextdependent, varying according to the host range of the pathogen concerned, the demographicstructure of the host community, and the biology of the focal host (Wolinska et al. 2006;Poullain et al. 2007). For example, generalist pathogens may be expected to exhibit somedegree of adaptation to one host species within a community, if that species represents a keyresource for the pathogen (Woolhouse et al. 2001). In other cases, generalist pathogens maybe maladapted to particular species, particularly if potential hosts are rarely encountered dueto restricted availability in space or time. In such scenarios, we hypothesize that source-sinktype evolutionary dynamics may favor adaptation of rare and short-lived hosts to generalistpathogens, rather than pathogens to hosts.

For both generalist and specialist pathogens, the potential for reciprocal evolutionary changelargely depends upon a genotype-specific interaction between host and pathogen (e.g. Kaltzand Shykoff 1998; Lively and Dybdahl 2000; Thrall et al. 2002). One well-characterized,highly specific form of qualitative resistance common throughout eukaryotes is termedgene-for-gene (GFG) resistance (Thompson and Burdon 1992). The classic geneticdefinition of this form of resistance is that for every major resistance (R) gene in the host,there is a corresponding avirulence (Avr) gene in the pathogen (Flor 1956). When matchingR and Avr proteins co-occur then a resistance response ensues, but when either protein ismissing then the pathogen escapes R-gene mediated recognition. This simple geneticinteraction has been widely adopted as a general model for describing evolution betweenhosts and their pathogens in natural communities. However, to date, very little is knownabout the evolution of GFG interactions in interactions involving pathogens that can infect abroad range of host species.

In this study we focus on GFG interactions between the herbaceous annual plantArabidopsis thaliana and the generalist bacterial pathogen Pseudomonas syringae. Bacterialplant pathogens represent an excellent resource for the investigation of evolutionarydynamics in wild-host pathogen associations because the underlying mechanisms ofpathogen virulence and host resistance have been well characterized in several modelsystems, allowing characterization and manipulation of genetic dynamics in an ecologically

Kniskern et al. Page 2

Evolution. Author manuscript; available in PMC 2012 March 1.

NIH


NIH


NIH


relevant setting. Bacterial pathogens inject pathogenicity effectors into plant cells using aneedle-like apparatus referred to as the type III secretion system (T3SS) (Mudgett 2005).Avr genes code for effectors that have in some cases been demonstrated to promotepathogen growth (reviewed in Mudgett 2005; Kamoun 2006; Ellis et al. 2007), however,recognition of an effector gene induces a complex and highly effective defense responsecalled the hypersensitive response (HR) that restricts or eliminates pathogen multiplicationwithin the plant (reviewed in Heath 2000). The aim of this study was to investigate howpathogen adaptation to multiple host species may influence the evolution of virulence inpathogens and resistance in hosts. Specifically, we use a combination of molecular andphenotypic approaches to characterize the genetic structure and pathogenic potential ofstrains of P. syringae that are resident and non-resident on A. thaliana. We then examinepatterns of host and pathogen adaptation with respect to the phylogenetic and geographicorigin of host and pathogen genotypes. In particular, we assess to what extent our data areconsistent with the hypothesis that generalist pathogens are maladapted to rare and short-lived hosts, because they specialize on other, more common hosts.

METHODSStudy system

As an empirical model, we chose the interaction between the host plant A. thaliana and thepathogenic bacterium P. syringae. This system is well suited to investigating evolution inmulti-host pathogen interactions because P. syringae infects a wide phylogenetic range ofplant species (including wild A. thaliana plants), and the genetic basis of the interactionbetween P. syringae and A. thaliana is well understood.

Pseudomonas syringae is a species complex encompassing a diverse group of gram-negativebacteria, many strains of which are pathogenic to plants (Sarkar and Guttman 2004). P.syringae sensu lato has the capacity to cause disease on plant species within more than 100families (Hirano and Upper 2000; Barrett et al. 2009), including A. thaliana (Jakob et al.2002). The host ranges of sub-groups and individual strains however are largely unknown,in part because the concept of what constitutes a host is largely undefined. Various strains ofP. syringae have been recovered from the leaf surface and interior of a range ofasymptomatic plants (Orser et al. 1985; Burr et al. 1996; Mohr et al. 2008), and in severalcases, it has proven difficult to show that these strains cause disease on a range of testedplants, although the potential for disease on other unrepresented plants is largely impossibleto rule out (Smith and Saddler 2001; Whipps 2001). Furthermore, Clarke et al. (2010)recently demonstrated that a clade of P. syringae strains that were isolated from various hostspecies and that do not seem to cause disease on plants (Mohr et al. 2008) have an aberrantT3SS, seemingly acquired from an external source via lateral gene transfer. This xenologousT3SS is constitutively expressed, but is lacking in the capacity to deliver effectors into hostcells (Clarke et al. 2010); in other words, these strains fail to elicit GFG resistancecharacterized by the HR phenotype. The characterization of strains that vary widely inpathogenicity adds weight to a growing recognition that P. syringae has a complex lifehistory, including pathogenic, epiphytic, and saprophytic phases (Hirano and Upper 2000;Morris et al. 2008).

A. thaliana is a short-lived winter annual that grows wild in agricultural fields and otherdisturbed areas. In the Midwest USA, seeds germinate in the late fall, and plants flower inApril, completing their life-cycle by early May. Midwest A. thaliana normally has limitedgenetic variation within populations due to its recent introduction to North America(Nordborg et al. 2005) and to its high degree of self-fertilization [99%: (Platt et al. 2010)],although populations are typically polymorphic for R genes like Rps5 and Rpm1 (Bakker et



NIH


NIH


NIH


al. 2006), and adjacent populations are often genetically distinct (Bergelson et al. 1998;Bakker et al. 2006).

In the Midwest USA, P. syringae has been reported as a naturally occurring bacterialpathogen of A. thaliana (Jakob et al. 2002) that imposes significant fitness costs (Gao et al.2009; Roux et al. 2010). The interaction between these two species is an important geneticand molecular model system for studying both microbial pathogenicity and plant responsesto microbial infection. Multiple GFG interactions have been characterized in A. thaliana andP. syringae, including between the plant R protein Rps2 and bacterial effector AvrRpt2(Dong et al. 1991; Whalen et al. 1991; Kunkel et al. 1993), Rps5 and AvrPphB (Jenner et al.1991; Simonich and Innes 1995), and Rpm1, which recognizes both AvrRpm1 (Dangl et al.1992) and AvrB (Bisgrove et al. 1994). However, all of these GFG interactions have beendiscovered in P. syringae strains derived from hosts other than A. thaliana, and it is notknown whether these strains commonly infect A. thaliana, nor whether these specificeffector genes are found in natural populations of P. syringae on wild A. thaliana plants.

Bacterial and plant materialsInbred lines of A. thaliana were obtained from the Arabidopsis Biological Resource Center(ABRC) or were generated from seeds collected from wild A. thaliana in northern Indianaand southwestern Michigan (see Table S1). For wild-collected seeds, an inbred line wasgenerated by sowing a single seed in a 1:1 ratio of Metro-mix and Fafard in the Universityof Chicago greenhouse. Soil was watered to saturation and seeds were placed in a 4° C coldroom for three days. Subsequently, seedlings were moved to a controlled growth chamber ata temperature of 20°C with a 16/8 hr day/night cycle and light provided by 1:1 metal halideto HPS bulbs producing 400 μmoles*m−2*s−1 PAR, and selfed seeds were collected fromthe plants at maturity.

A collection of resident P. syringae strains was assembled from isolates derived from theleaf interior of wild A. thaliana growing in Michigan and Indiana (for collection details, seeJakob et al. 2002; Kniskern et al. 2007; Dunning 2008). A. thaliana leaves were sterilizedwith either 70% ethanol or hydrogen peroxide and ground in 10 mM MgSO4 buffer. Theresulting solution was plated onto solid KB growth media. Colonies were screened for avariety of morphological traits characteristic of Pseudomonas including color, size, shape,and texture (details described in Kniskern et al. 2007), but ultimately the identity of P.syringae strains was verified by sequencing a fragment of the 16S region and observing highsequence homology to published sequences (see Jakob et al. 2002; Kniskern et al. 2007). Forexample, the strains PNA29.1a (GenBank accession number AY574913) and RM29.1a(AY574914) were > 99% similar to P. syringae pv. syringae (AB001443) and P. syringaepv. phaseolicola (AB001448), respectively (Jakob et al. 2002). The identity of these strainswas further verified by developing an intraspecific phylogeny (see below). This collection ofresident strains was compared to a group of non-resident strains of P. syringae collectedfrom a variety of agricultural host species as described above (see Table S1).

Inferring GFG interactions via HR testsWe assembled 48 inbred lines of A. thaliana for the characterization of GFG resistancediversity and structure: 24 accessions were generated from seeds collected from wildpopulations in Midwest USA, and the remaining 24 accessions from the global distributionof A. thaliana were obtained from the ABRC (see above). Seeds of these 48 A. thalianaaccessions were sown as described above but with seven days of stratification at 4° C topromote uniform germination.



NIH


NIH


NIH


For P. syringae, 24 strains were collected from the same Midwest populations as A. thaliana(resident strains), while the remaining 18 strains represent a worldwide collection of strainsisolated from agricultural species (non-resident strains, see Table S1). We examined patternsof GFG resistance by screening all combinations of plant lines and pathogen strains for thehypersensitive response (HR), a simple resistance phenotype that involves leaf tissuecollapse at the site of inoculation. This phenotype is associated with R protein mediatedrecognition of effectors in A. thaliana - P. syringae interactions (Dong et al. 1991;Whalen etal. 1991;Dangl et al. 1992;Kunkel et al. 1993;Bisgrove et al. 1994;Simonich and Innes1995). To screen for the HR resistance phenotype, plants were inoculated with bacterialstrains 21–28 days following germination. To create the solution for inoculation, bacteriawere grown overnight in liquid Kings Broth (KB) medium. The following morning, 5 ml ofthe growth media was diluted in 50 ml of fresh KB media, and then the resulting solutionwas grown for 4–5 hours, centrifuged at 3000 rpm for 10 min., re-suspended in sterile 10mM MgSO4 buffer, and diluted to an OD600 of 0.2 in 10 mM MgSO4 buffer, orapproximately 2.5 × 108 cfu ml−1. Two leaves per plant, from four replicate plants per line,were inoculated with the bacterial solution by using a 1 ml blunt syringe. Plants were scoredfor the HR resistance phenotype approximately 20 hours after inoculation. Prior work hasshown that resistant plants express the HR within 20 hours after inoculation by P. syringae(Aranzana et al. 2005;Van Poecke et al. 2007); susceptible accessions exhibit little if anydisease symptoms that could be confused with the HR during this time frame. We scoredeach leaf as follows: no evidence of HR or mild disease symptoms = 0; severe leaf tissuecollapse due to full HR = 1. Thus, each plant genotype had a total of eight leaves scored inbinary format.

PCR, sequencing, and phylogenetic analysisBecause P. syringae is a diverse species complex, comprised of several discrete anddivergent clades (Sarkar and Guttman 2004), we placed resident strains collected from A.thaliana within this broader framework by constructing a phylogeny of 22 resident and 22non-resident P. syringae strains using the housekeeping gene gyrase B (gyrB). A partialfragment of gyrB was amplified from genomic P. syringae DNA extractions by usingprimers from Sawada et al. (1999). Forward and reverse DNA sequencing of amplicons wasperformed at the University of Chicago Cancer Research Center DNA Sequencing andGenotyping facility. Edited sequences were aligned using the software Bioedit (Hall 1999).Sequences used here have been deposited under Genbank accession numbers GQ199479-GQ199586. A minimum evolution phylogenetic tree was generated in MEGA v4 (Tamura etal. 2007) by using a maximum composite likelihood model of sequence evolution andassuming uniform rates among sites. The tree was rooted with P. aeruginosa strain PA01 asthe outgroup.

T3SS identity and functionalityMany bacteria failed to elicit a HR resistance phenotype on any A. thaliana genotype (seeResults). We thus tested all strains for the potential to induce the HR in tobacco as describedelsewhere (Jakob et al. 2002); this test is important because it reliably distinguishes effectorsecreting, pathogenic Pseudomonads from non-pathogenic or saprophytic Pseudomonads(Klement 1963; Mohr et al. 2008). Failure to initiate an HR in tobacco would suggest amove away from a pathogenic life-history, while induction of the HR would leave open thepossibility that these strains may be secreting novel effectors and acting as pathogens whileescaping GFG recognition. Interestingly, the resident strains that failed to elicit the HR on A.thaliana also failed to elicit the HR on tobacco; these stains are hereafter referred to as HR−.Recently, Clarke et al. (2010) characterized a clade of P. syringae strains that have lost theirancestral T3SS and acquired a xenologous T3SS via lateral gene transfer. This xenologousT3SS is constitutively expressed, but seemingly lacks the capacity to elicit a HR resistance



NIH


NIH


NIH


phenotype in host plants (including tobacco). The large proportion of the resident strains thatwere HR− led us to suspect that a similar phenomenon was occurring in our system.

To determine if our HR− strains lacked the ability to induce the HR resistance phenotypedue to an inability to deliver pathogenicity effectors into the host cell, we first determined ifthey have the genes necessary to make the needle-like apparatus that injects effectors intoplant cells. To do this, we used PCR to test for the presence or absence of conservedcomponents of the ancestral and xenologous T3SS gene clusters in all of the HR− strains(Mohr et al. 2008; Clarke et al. 2010). For the ancestral P. syringae T3SS, we used thedegenerate primer pairs developed by Mohr et al. (2008) to screen the hrp/hrc genes hrpK,hrpL, hrcC (present in all three fully sequenced reference strains of P. syringae: pv. tomatoDC3000, pv. phaseolicola 1448A, and pv. syringae B728a), the CEL effector genes AvrEand hrpW, and the effector gene hop I1 (present in all tested pathogenic strains of P.syringae, including the three fully sequenced reference strains). For the xenologous T3SSdescribed in Clarke et al. (2010), we designed primers specific for variants of the genes hrpL(F: GTCGCGATAACTCTCGATGT; R: ACCCAACAACAACTCCAGAA) and hrcC (F:TCGATATAACGCATCGGATT; R: CCAAGAACCAGATGATCCAG).

We next tested whether the HR− strains had lost the capacity to inject effectors into plantsby engineering a known Avr gene into a subset of HR− strains (RMX815a, LP205a, andME890.2a) and then determining if these engineered strains induce the HR resistancephenotype. To do this, we first created engineered strains of P. syringae with either aplasmid-borne copy of the bacterial Avr effector AvrPphB or an empty vector. To create theengineered strains, we amplified a 989 bp fragment containing the promoter and codingsequence of AvrPphB (provided by R. Innes), using high-fidelity polymerase Pfu(Stratagene) and two primers, one containing an XhoI restriction site (AvrPphB_67F_XhoI:TTTTCTCGAGCCCCTTCACAACCTCATAGC) and one containing an EcoRI site(AvrPphB_1055R_EcoRI: TTTTGAATTCAAATATTGCCGGCGTTACAG). Theamplicon was then digested with XhoI and EcoRI and ligated into the similarly digestedplasmid pME6010 (provided by B. Vinatzer). Escherichia coli DH5α was transformed viaelectroporation with either a plasmid containing the AvrPphB effector (pME6010:AvrPphB)or an empty plasmid (pME6010) and screened for tetracycline resistance (50 ug/ml).Sequencing of the entire insert with primers flanking the cloning site of pME6010(pME6010MCSF2: GGGTGTTATGAGCCATATTCAA and pME6010MCSR2:ACTGAATCCGGTGAGAATGG) was used to confirm the absence of mutations inavrPphB that could have occurred during these manipulations. Plasmid extractions (Qiagenplasmid mini kit) were subsequently transformed via electroporation into P. syringae strains.Colonies were selected for tetracycline resistance and PCR was used to verify the expectedamplicon size for strains harboring either plasmid-borne copy of the effector AvrPphB or anempty vector.

These 3 engineered HR− strains now possessed a functional Avr effector which shouldinduce the HR phenotype in a resistant host if the HR− strains possessed a functional T3SS.We next inoculated these engineered strains into the Col-0 plant ecotype, which possessesRps5, an R gene that recognizes AvrPphB (Simonich and Innes 1995). As positive controls,we engineered with the same plasmids two strains that are known to have a functional T3SSbut that do not normally elicit the HR on the Col-0 accession, because they lack effectorsrecognized by Col-0 (P. syringae pv. tomato DC3000 and P. syringae pv. maculicolaES4326).

In planta bacterial growthTo explore the influence of phylogeny and the T3SS on bacterial growth in planta, wemeasured growth of 40 P. syringae strains (including both resident and non-resident) in the



NIH


NIH


NIH


Col-0 ecotype. PNA29.1a and Knox244a were excluded because they elicit the HR on Col-0and exhibit low growth due to this resistance response. Col-0 was chosen to host the 40 P.syringae strains because it exhibited a low incidence of HR, and also for comparativepurposes; Col-0 is the most widely used accession in P. syringae - A. thaliana studies. Eachstrain was inoculated into Col-0 plants at an initial average in planta density of 811.9 ±149.9 cfu/cm2 leaf tissue (log10 value of 2.9; see Fig. 2). This initial density was estimateddirectly by enumerating bacterial population size for 4–6 replicate plants for two strains(PNA29.1a and P. syringae pv. tomato DC3000) immediately after inoculation in twoseparate experiments.

To prepare the solution for inoculation, bacteria were grown overnight in liquid KB mediaand prepared as described for HR tests, but were diluted to an OD600 of 0.0002 in 10 mMMgSO4 buffer, or approximately 2.5 × 105 cfu ml−1. Two leaves per plant on four replicateplants per accession were inoculated using a 1 ml blunt syringe. After three days, a holepunch was used to remove a disk of tissue from a single leaf per plant. The disk wassterilized in 70% ethanol and ground in 200 ul of 10 mM MgSO4, and then 10 ul of theresulting solution was plated in a dilution series (0, 10−1, 10−2, and 10−3dilutions) on solidKB media. After three more days, colony number was counted to estimate bacterialpopulation size.

Statistical analysesWe adopted a count based approach for the analysis of the HR phenotypic data (Crawley2007), summing for each bacterial × plant combination (n=1432) the number of leavesexhibiting a HR (scored as 1) versus those without (scored as 0). These data were analyzedusing a two-way analysis of deviance with quasibinomial errors, testing for the effects ofhost line and pathogen type (resident vs. non-resident). For the analysis of growth data, wecompared among groups using ANOVA or t-tests in JMP 5.1 or R. All growth data werelog10 transformed to meet assumptions of normality.

RESULTSGenetic structure of P. syringae

Resident strains were all contained within a single lineage (group 2 of Sarkar and Guttman(2004)), and are relatively closely related to P. syringae reference strain B728a (P. syringaepv. syringae B728). Within clade 2, strains were further subdivided into three discrete sub-clades (2a, b and c; Clarke et al. 2010). Non-resident strains were more diverse, representingat least 3 additional major cladistic groups (Fig. 1).

GFG interactions between wild A. thaliana and P. syringaeTwelve of the 24 resident P. syringae strains and all of the non-resident strains elicited theHR on at least one A. thaliana or tobacco line (although not all strains elicit the same patternof HR; see next section). These strains are hereafter referred to as HR+. One of the HR+strains used in this study, P. syringae pv. tomato JL1065, is known to possess the gene forthe effector AvrRpt2 (Dong et al. 1991; Whalen et al. 1991). As expected, this strain induceda strong HR phenotype on A. thaliana lines that are known to possess the complementaryresistance gene Rps2 (see Table S1). Several other HR+ strains, the effector complements ofwhich are largely unknown, elicited similarly strong HR phenotypes across multiple hosts,indicating a high likelihood that these interactions are influenced by GFG resistance. Theremaining twelve resident P. syringae strains failed to elicit the HR response on either A.thaliana or tobacco, suggesting the absence of GFG resistance to these strains. These strainsare hereafter referred to as HR−.



NIH


NIH


NIH


When we investigated the pathogenic potential of HR− strains by engineering a known Avrgene (AvrPphB) into a subset of strains, we found that the positive control strains elicited astrong HR in Col-0 plants at 20 hours after infection. In contrast, the engineered HR− strainscontaining a plasmid-borne copy of AvrPphB failed to elicit the HR on Col-0 plants within20 hours after infection, and also when checked at 48 hours post infection. As expected,none of the engineered strains transformed with the empty control plasmid induced the HR.These data suggest that the HR− resident P. syringae strains in our study lack the ability totranslocate AvrPphB at titers sufficient for induction of the HR in A. thaliana Col-0 plants,suggesting at least partial loss of T3SS function in these strains.

Consistent with the results of Clarke et al. (2010), all HR− strains fall exclusively insubclade 2c (Fig 1). The results of PCR on conserved T3SS genes concur entirely with thephylogenetic, molecular, and phenotypic results. Specifically, primers designed to detect theancestral T3SS in P. syringae successfully amplified conserved components of the T3SSonly from the 30 (18 nonresident and 12 resident strains) HR+ strains. In contrast, primersdesigned to amplify the xenologous T3SS amplified fragments only from the 12 HR− strainsin clade 2c. These PCR results indicate that the HR− strains have lost those genes thatcompose the ancestral T3SS, while gaining genes hypothesized to compose a xenologousversion of the T3SS. Together, the PCR and HR test results suggest that the HR− resident P.syringae strains in our study lack a T3SS capable of delivering effectors at a concentrationsufficient to induce a host resistance response.

Patterns of adaptationFor those HR+ strains possessing a functional T3SS and thus capable of engaging in GFGinteractions with A. thaliana, there was a significantly higher frequency of resistance (HR)induced by resident bacterial strains (37%) relative to non-residents (15%) (Fig. 2, Table 1;p <0.00001). Because resident strains are all Clade 2 genotypes, there is a potential forphylogenetic non-independence to influence this result. We therefore repeated analysiscomparing only strains from clade 2 (Fig 1; n resident = 12, n non-resident = 9). Consistentwith results obtained using the full dataset, resident strains induced a significantly higherfrequency of resistance (37%) relative to non-resident strains (11%) (F= 134.3; p <0.00001).Thus, we conclude that HR+ resident P. syringae strains carry a greater number of effectorsrecognized by A. thaliana relative to non-resident strains; that is, resident strains aremaladapted compared to non-resident strains in terms of avoiding GFG recognition by co-occurring A. thaliana hosts.

In contrast, in testing for patterns of geographic adaptation in the hosts, we found nosignificant differences in the frequency of the HR phenotype among A. thaliana lines fromthe Midwest (23%) versus from the global distribution (24%), nor for the interactionbetween these factors (Fig. 2; Table 1). Consequently, we failed to find evidence thatselective or demographic events have generated divergent R gene complements between A.thaliana lines collected from Midwest and global populations.

Growth of P. syringae strains in plantaThree days after inoculation, many strains of P. syringae had increased in population size(Fig. 3). Several non-resident strains, including P. syringae pv. tomato DC3000 and P.syrinage pv. maculicola ES4328, were highly aggressive pathogens, growing to populationsizes in excess of 106 cfu/cm2; these strains eventually induced disease symptoms oninoculated leaves. However, several other non-resident strains did not grow to largepopulation sizes in A. thaliana. For example the strains P. syringae pv. syringae B728a andP. syringae pv. phaseolicola 1448A both grew to population sizes in the range of 103 – 104

cfu/cm2 and failed to induce disease symptoms. All resident strains of P. syringae



NIH


NIH


NIH


consistently grew to population sizes in the range of 103 – 105 cfu/cm2. Thus, the residentstrains are phenotypically quite distinct from the highly aggressive non-resident strainsisolated from tomato (P. syringae pv. tomato DC3000) and Brassicaceae hosts like radishand broccoli (P. syringae pv. maculicola ES4326; P. syringae pv. alisalensis BS136), butcomparable to, or more aggressive than, non-resident pathogens isolated from other crops(e.g. P. syringae pv. syringae B728a and P. syringae pv. phaseolicola 1448A).

Interestingly, there was no statistically significant effect of the type of T3SS (ancestral vs.xenologous) on in planta growth among 22 of the 24 resident strains (PNA29.1a andKnox244a were excluded from this analysis because they elicit the HR in Col-0 plants; F =1.18, d.f. = 1, 20; P = 0.28). Thus, at least under the experimental conditions used in thisstudy, there appears to be little fitness penalty associated with the loss of a classicalpathogenicity mechanism in P. syringae. This result suggests that strains of P. syringae donot require Avr effectors for successful colonization, growth and survival on A. thaliana.Finally, for strains capable of delivering effectors, there was no statistically significant effectof resident host (A. thaliana vs crop) on in planta growth (F = 0.6151, d.f. = 1, 28; P = 0.44).

DISCUSSIONVariation in both host resistance and pathogen virulence is well characterized in interactionsbetween P. syringae and A. thaliana, yet we are lacking an ecologically relevant perspectiveon how this interaction evolves. This system is unlike pathogen-host systems that aretypically modeled; it is neither obligate nor pairwise, and in fact, a small, ephemeral plantlike A. thaliana is probably not very important to P. syringae population biology. Wediscovered that GFG interactions are common between A. thaliana and resident P. syringaestrains, and that A. thaliana plants are more likely to recognize HR+ resident P. syringaestrains than non-resident strains. In other words, we found evidence that the raw geneticmaterials for a common form of coevolution are available, but that resident pathogens,despite faster generation times and higher migratory potential, appear to be maladaptedcompared to non-resident strains. Somewhat unexpectedly, we also discovered a relativelyhigh prevalence of HR-strains that have lost the ability to interact with plants via the well-characterized mechanisms of the T3SS, which effectively removes them from participationin any characterized GFG facilitated evolutionary interaction. These results suggest thatevolution in multi-host pathogen systems may proceed in ways that do not conform toexpectations developed to explain evolution in more specialized, tightly coupledinteractions.

Pathogen (mal)adaptation?In any host–pathogen interaction, the potential for evolutionary change is contingent upongenetic variation for host and pathogen traits that are important to the outcome of thatinteraction. Whenever resident P. syringae strains were capable of delivering effectors, atleast some A. thaliana accessions exhibited a strong resistance phenotype referred to as thehypersensitive response (HR). The strength of this phenotype was identical to the HRinduced by non-resident strains, and we interpret this response to reflect interactionsbetween major genes for host resistance and pathogen virulence. All accessions of A.thaliana showed a resistance response to some HR+ P. syringae strains. Moreover, no strainof P. syringae elicited a resistance response on all A. thaliana lines.

A. thaliana plants displayed a high level of resistance to resident pathogen strains, comparedto non-resident pathogens, suggesting that HR+ resident P. syringae strains carry a greaternumber of effectors recognized by A. thaliana relative to non-resident strains. Thus, we inferthat resident strains are relatively maladapted in terms of avoiding GFG recognition by co-occurring A. thaliana hosts. As host species differ widely in resistance mechanisms,



NIH


NIH


NIH


phenology, and environmental associations, variation in the level of resistance to residentand non-resident pathogens is not surprising. However, conventional wisdom holds thatpathogens evolve more rapidly than their hosts and are therefore more likely to be ahead inany evolutionary arms race (Hamilton et al. 1990; Kaltz and Shykoff 1998). Given theexpected adaptive advantages for P. syringae of short generation times and high migratorypotential, the finding of pathogen maladaptation in this case (i.e. greater resistance of hoststo resident pathogen strains) warrants further explanation. Here we discuss two broadexplanations for the observation of maladaptation of resident P. syringae strains in theinteraction with A. thaliana: (1) resident strains of P. syringae are maladapted specificallyon A. thaliana, implying this host is ahead of P. syringae in their arms race of adaptiveevolution; and (2) resident strains of P. syringae are generally maladapted to all hosts.

Demographic traits, such as phenology, density and frequency, are typically highly variableamong host species (Barrett et al. 2008). It is our hypothesis that variation in these traits maybe a critical driver of patterns of adaptation in generalist pathogens. Specifically, we predictthat uneven patterns of encounter between a pathogen and its hosts may favor the host in anevolutionary arms race, so that generalist pathogens should be maladapted to hosts that arerarely encountered due to restricted availability in space or time. A complete test of thishypothesis would require reciprocal cross-inoculation experiments investigating resistanceto resident vs non-resident strains of P. syringae in other common, host species with whichA. thaliana co-occurs. Our hypothesis would demand that P. syringae is ahead in the armsrace against hosts that harbor substantial fractions of the pathogen population (i.e. residentstrains induce resistance on fewer host genotypes than non-residents), but behind in hoststhat are ephemeral in time and space (i.e. resident strains induce resistance on more hostgenotypes than non-residents). With this caveat in mind, our data do allow some insight intowhether such dynamics occur.

The finding of relative maladaptation of resident strains on Midwest hosts is consistent witha scenario whereby A. thaliana hosts have an adaptive advantage over resident pathogens. Inour Midwest study populations, A. thaliana is present only ephemerally and represents arelatively small resource base compared to the many other species with which it co-occurs(e.g. cultivated crop species). Indeed, bacterial populations can grow to large size in fieldsplanted with susceptible agricultural plant varieties (Hirano and Upper 1990; Hirano andUpper 2000), and genetically similar P. syringae strains inhabit the leaves of a wide range ofplants with which A. thaliana co-occurs, including the widely planted agricultural speciessoybean (Glycine max) and alfalfa (Medicago sativa) (L.G. Barrett unpublished data).Highly asynchronous epidemic dynamics can occur where agricultural and wild populationsinteract, so that generalist pathogens adapted to abundant agricultural species spill over intosurrounding non-managed communities (Power and Mitchell 2004; Colla et al. 2006; Randet al. 2006; Saleh et al. 2010). Under such a scenario, pathogens should exert selection onthese incidental hosts, causing an evolutionary change in host resistance, but reciprocalselection on generalist pathogens by ephemeral weeds may be weak relative to the selectionimposed by the more abundant hosts. Generalist pathogens may therefore show littleevolutionary response to changes in the resistance structure of these incidental hostpopulations, falling further and further behind in arms races involving GFG resistance.

However, results showing that Midwestern and global A. thaliana plants display a similarlevel of resistance to Midwestern pathogens raise questions regarding the likelihood ofspecific evolutionary responses in A. thaliana to infection by P. syringae. In particular, itmight be expected that if the members of Midwestern plant communities that are importantto P. syringae population biology differ from similarly important hosts elsewhere, thenglobally sampled accessions of A. thaliana will have been exposed to P. syringae adapted toa different suite of hosts. Countering this expectation would be the realization that many



NIH


NIH


NIH


agricultural species that act as hosts have largely cosmopolitan distributions, thus interferingwith any expectation of local adaptation. Nevertheless, if the community drivers of pathogenevolution were indeed different around the globe, and our expectations for pathogenspillover correct, then globally sampled A. thaliana should be less resistant on average toMidwestern P. syringae strains. It is thus important to entertain general maladaptation of theresident P. syringae strains as an alternative hypothesis. Such general maladaptation (interms of triggering the HR across the majority of A. thaliana hosts) may reflect manypossible scenarios. Non-adaptive dynamics in pathogen populations, such as demographicbottlenecking, limited genetic recombination or exchange, and restricted dispersal, arefrequently cited as possible drivers of maladaptation (Parker, 1991; Kaltz et al 1999),although it is not obvious why non-adaptive dynamics should differentially influenceresident and non-resident strains. Alternatively, adaptation to a broad range of environments,including multiple wild plant species, insect hosts (Stavrinides et al. 2009) and non-hostenvironments (Morris et al. 2008), may require the maintenance of a broad suite of effectors(i.e. potential Avr genes) compared to pathogens of crops, which may have a relatively smalland finely tuned subset of effectors enabling growth on a handful of common crops [i.e. acost of generalism; Poullain et al. (2008)]. Rigorous tests of these competing hypotheses willrequire additional data on the frequency of resistance in other common, host species withwhich A. thaliana co-occurs. Regardless, it seems safe to conclude that adaptive constrainsassociated with generalism may limit the capacity of P. syringae to adapt specifically to A.thaliana.

The (de)evolution of virulenceA major life-history shift has seemingly occurred in one element of the P. syringaepopulation resident on A. thaliana. One half (12 of 24) of resident P. syringae strains haveapparently lost the ability to deliver pathogenicity effectors into cells of that host through aneedle-like structure that is part of the bacterial T3SS. Mohr et al. (2008) recently describedseveral wild P. syringae strains isolated from Primula and other plants that have likewiselargely lost the ability to deliver effectors into host cells. Furthermore, these isolates form amonophyletic group and have acquired a seemingly xenologous T3SS via lateral genetransfer (Clarke et al. 2010). We used similar tests to demonstrate that our HR− residentstrains lack conserved components of the classical T3SS, failed to elicit the HR in either A.thaliana or tobacco, and failed to elicit the HR in A. thaliana when transformed with aneffector that the host recognizes. Despite being collected from unrelated hosts, our residentstrains lacking a functional T3SS are closely related to those characterized by Mohr et al.(2008), falling into the same subclade 2c (Fig 1).

The common presence of strains with this key polymorphism, and the finding that they donot, on average, show lower growth within the plant leaf in the A. thaliana ecotype Col-0,relative to those isolates that possess the ability to deliver effectors, raises importantquestions about the evolution of pathogenicity and virulence in a generalist like P. syringae.The use of the T3SS to facilitate delivery of effectors into plant cells has hitherto beenthought to be an important mechanism promoting pathogenicity and ecological fitness in P.syringae. For example, the experimental incapacitation of the T3SS in the A. thaliana HR+resident P. syringae strain PNA29.1a causes an approximate 10 fold reduction in bacterialgrowth on A. thaliana (unpublished data). Even larger reductions in pathogen growth inplanta have been observed in P. syringae pv. tomato DC3000 (Chen et al. 2004) and P.syringae pv. syringae B728a (Mohr et al. 2008) when the T3SS was experimentallydisabled. In contrast, experimentally disabling the xenologous T3SS does not appear toinfluence the growth ability of HR− strains in glasshouse experiments (Clarke et al. 2010).However, the impact of this polymorphism on the fitness of P. syringae under more naturalconditions has yet to be investigated. For example, the T3SS and associated virulence genes



NIH


NIH


NIH


have been demonstrated to significantly increase fitness on the surface of the leaf (Darsonvalet al. 2008; Deng et al. 2009) and enhance transmission potential in the field (Hirano et al.1999; Wichmann and Bergelson 2004; Darsonval et al. 2008).

What processes might have facilitated this major-life history transition within a diverseclade of plant pathogens? Certainly, the T3SS does not universally promote growth on allhost plants. Rather, growth benefits conferred by the T3SS are typically specific to certainhost-pathogen genotypic combinations (Clarke et al. 2010). Within this context, the strongmaladaptation of HR+ strains resident on A. thaliana may provide some insight into the typeof dynamics that potentially promote shifts along the symbiotic continuum. If, in somelineages, the benefits of the ancestral T3SS were reduced, or removed altogether, by hostadaptation or pathogen maladaptation, then the benefits of maintaining the capacity todeliver effectors might be outweighed by the costs of maintaining this apparatus. Similarly,the xenologous T3SS may improve performance in alternative environments, withpotentially little loss of performance in planta. These questions will provide a rich groundfor further research.

ConclusionsThe molecular and genetic basis of resistance to the bacterial plant pathogen P. syringae hasbeen studied intensively in A. thaliana. However, previous studies have focused almostexclusively on interactions involving strains of P. syringae collected from hosts other thanA. thaliana. As a result, very little is known about the virulence, phylogenetic relationships,or form of plant resistance induced by strains of P. syringae encountered by wildpopulations of A. thaliana. Our results suggest that this interaction can provide valuableinsight into the evolutionary dynamics of interactions between hosts and multi-hostpathogens. In particular, we argue that adaptive constrains associated with the capacity toinfect a broad range of host species may limit the capacity of P. syringae to adaptspecifically to A. thaliana, and suggest that pathogen maladaptation may be a commonconsequence of divergent selection pressures from alternative host species on generalistpathogens. More generally, our results suggest that dynamics in multi-host pathogen systemsmay not conform to expectations developed to explain evolution in more specialized, tightlycoupled interactions.

Supplementary MaterialRefer to Web version on PubMed Central for supplementary material.

AcknowledgmentsJ. Greenberg generously provided many strains of P. syringae and B. Vinatzer graciously provided plasmids,protocols, and thoughts on this work. We thank Elizabeth B. Haney for help editing this manuscript. This researchwas funded by NSF grant MCB0603515 and NIH grant GM057994 to JB, and through generous support by theDropkin Foundation.

ReferencesAranzana MJ, Kim S, Zhao KY, Bakker E, Horton M, Jakob K, Lister C, Molitor J, Shindo C, Tang

CL, Toomajian C, Traw B, Zheng HG, Bergelson J, Dean C, Marjoram P, Nordborg M. Genome-wide association mapping in Arabidopsis identifies previously known flowering time and pathogenresistance genes. Plos Genetics 2005;1:531–539.

Bakker EG, Stahl EA, Toomajian C, Nordborg M, Kreitman M, Bergelson J. Distribution of geneticvariation within and among local populations of Arabidopsis thaliana over its species range. MolEcol 2006;15:1405–1418. [PubMed: 16626462]



NIH


NIH


NIH


Barrett LG, Kniskern JM, Bodenhausen N, Zhang W, Bergelson J. Continua of specificity andvirulence in plant host-pathogen interactions: causes and consequences. New Phyt 2009;183:513–529.

Barrett LG, Thrall PH, Burdon JJ, Linde CC. Life history determines genetic structure andevolutionary potential of host-parasite interactions. Trends Ecol Evol 2008;23:678–685. [PubMed:18947899]

Bergelson J, Stahl E, Dudek S, Kreitman M. Genetic variation within and among populations ofArabidopsis thaliana. Genetics 1998;148:1311–1323. [PubMed: 9539444]

Bisgrove SR, Simonich MT, Smith NM, Sattler A, Innes RW. A disease resistance gene in Arabidopsiswith specificity for two different pathogen avirulence genes. Plant Cell 1994;6:927–933. [PubMed:8069104]

Burr TJ, Matteson MC, Smith CA, CorralGarcia MR, Huang TC. Effectiveness of bacteria and yeastsfrom apple orchards as biological control agents of apple scab. Biol Control 1996;6:151–157.

Carlsson-Graner U, Thrall PH. The impact of host longevity on disease transmission: host-pathogendynamics and the evolution of resistance. Evol Ecol Res 2006;8:659–675.

Chen ZY, Kloek AP, Cuzick A, Moeder W, Tang DZ, Innes RW, Klessig DF, McDowell JM, KunkelBN. The Pseudomonas syringae type III effector AvrRpt2 functions downstream or independentlyof SA to promote virulence on Arabidopsis thaliana. Plant Journal 2004;37:494–504. [PubMed:14756766]

Clarke CR, Cai R, Studholme DJ, Guttman DS, Vinatzer BA. Pseudomonas syringae strains naturallylacking the classical P. syringae hrp/hrc locus are common leaf colonizers equipped with anatypical type III secretion system. Mol Plant-Microbe Interact 2010;23:198–210. [PubMed:20064063]

Cleaveland S, Laurenson MK, Taylor LH. Diseases of humans and their domestic mammals: pathogencharacteristics, host range and the risk of emergence. Phil Trans R Soc B 2001;356:991–999.[PubMed: 11516377]

Colla SR, Otterstatter MC, Gegear RJ, Thomson JD. Plight of the bumble bee: Pathogen spillover fromcommercial to wild populations. Biol Conserv 2006;129:461–467.

Crawley, MJ. The R Book. John Wiley and Sons; 2007.Dangl JL, Ritter C, Gibbon MJ, Mur LAJ, Wood JR, Goss S, Mansfield J, Taylor JD, Vivian A.

Functional homologs of the Arabidopsis RPM1 disease resistance gene in bean and pea. Plant Cell1992;4:1359–1369. [PubMed: 1477552]

Darsonval A, Darrasse A, Meyer D, Demarty M, Durand K, Bureau C, Manceau C, Jacques MA. Thetype III secretion system of Xanthomonas fuscans subsp. fuscans is involved in the phyllospherecolonization process and in transmission to seeds of susceptible beans. Appl Environ Microbiol2008;74:2669–2678. [PubMed: 18326683]

Deng X, Xiao Y, Lan L, Zhou JM, Tang X. Pseudomonas syringae pv. phaseolicola mutantscompromised for type III secretion system gene induction. Mol Plant-Microbe Interac2009;22:964–976.

Dong XN, Mindrinos M, Davis KR, Ausubel FM. Induction of Arabidopsis defense genes by virulentand avirulent Pseudomonas syringae strains and by a cloned avirulence gene. Plant Cell1991;3:61–72. [PubMed: 1824335]

Duffy S, Burch CL, Turner PE. Evolution of host specificity drives reproductive isolation among RNAviruses. Evolution 2007;61:2614–2622. [PubMed: 17908251]

Dunning, MTA. Ecology and Evolution. University of Chicago; Chicago, IL, USA: 2008. PhD Thesis:Host genotype and population structure in the interaction between Arabidopsis thaliana and itsnatural bacterial pathogens.

Ellis JG, Dodds PN, Lawrence GJ. The role of secreted proteins in diseases of plants caused by rust,powdery mildew and smut fungi. Curr Opin Microbiol 2007;10:326–331. [PubMed: 17698407]

Flor HH. The complementary genic systems in flax and flax rust. Adv Genet 1956;8:29–54.Gandon S. Local adaptation and the geometry of host-parasite coevolution. Ecol Letters 2002;5:246–

256.Gandon S. Evolution of multihost parasites. Evolution 2004;58:455–469. [PubMed: 15119430]



NIH


NIH


NIH


Gao LP, Roux F, Bergelson J. Quantitative fitness effects of infection in a gene-for-gene system. NewPhyt 2009;184:485–494.

Goss EM, Bergelson J. Variation in resistance and virulence in the interaction between Arabidopsisthaliana and a bacterial pathogen. Evolution 2006;60:1562–1573. [PubMed: 17017057]

Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program forWindows 95/98/NT. Nucleic Acids Symposium Series 1999;41:95–98.

Hamilton WD, Axelrod R, Tanese R. Sexual reproduction as an adaptation to resist parasites (areview). Proc Nat Acad Sci USA 1990;87:3566–3573. [PubMed: 2185476]

Heath MC. Hypersensitive response-related death. Plant Mol Biol 2000;44:321–334. [PubMed:11199391]

Hellgren O, Perez-Tris J, Bensch S. A jack-of-all-trades and still a master of some: prevalence andhost range in avian malaria and related blood parasites. Ecology 2009;90:2840–2849. [PubMed:19886492]

Hirano SS, Charkowski AO, Collmer A, Willis DK, Upper CD. Role of the Hrp type III proteinsecretion system in growth of Pseudomonas syringae pv. syringae B728a on host plants in thefield. Proc Nat Acad Sci USA 1999;96:9851–9856. [PubMed: 10449783]

Hirano SS, Upper CD. Population biology and epidemiology of Pseudomonas syringae. Annu RevPhytopath 1990;28:155–177.

Hirano SS, Upper CD. Bacteria in the leaf ecosystem with emphasis on Pseudomonas syringae---apathogen, ice nucleus, and epiphyte. Microbiol Mol Biol Rev 2000;64:624–653. [PubMed:10974129]

Jakob K, Goss EM, Araki H, Van T, Kreitman M, Bergelson J. Pseudomonas viridiflava and P.syringae - Natural pathogens of Arabidopsis thaliana. Mol Plant-Microbe Interact 2002;15:1195–1203. [PubMed: 12481991]

Jenner C, Hitchin E, Mansfield J, Walters K, Betteridge P, Teverson D, Taylor J. Gene-for-geneinteractions between Pseudomonas syringae pv. phaseolicola and Phaseolus. Mol Plant-MicrobeInteract 1991;4:553–562. [PubMed: 1666524]

Kaltz O, Shykoff JA. Local adaptation in host-parasite systems. Heredity 1998;81:361–370.Kamoun S. A catalogue of the effector secretome of plant pathogenic oomycetes. Annu Rev Phytopath

2006;44:41–60.Klement Z. Rapid detection of the pathogenicity of phytopathogenic pseudomonads. Nature

1963;199:299–300. [PubMed: 14076706]Kniskern JM, Traw MB, Bergelson J. Salicylic acid and jasmonic acid signaling defense pathways

reduce natural bacterial diversity on Arabidopsis thaliana. Mol Plant-Microbe Interact2007;20:1512–1522. [PubMed: 17990959]

Kunkel BN, Bent AF, Dahlbeck D, Innes RW, Staskawicz BJ. RPS2, an Arabidopsis disease resistancelocus specifying recognition of Pseudomonas syringae expressing the avirulence gene avrRpt2.Plant Cell 1993;5:865–875. [PubMed: 8400869]

Lajeunesse MJ, Forbes MR. Host range and local parasite adaptation. Proc R Soc Lond B2002;269:703–710.

Lazzaro BP, Little TJ. Immunity in a variable world. Phil Trans R Soc B 2009;364:15–26. [PubMed:18926975]

Lively CM, Dybdahl MF. Parasite adaptation to locally common host genotypes. Nature2000;405:679–681. [PubMed: 10864323]

Mitchell, CE.; Power, AG. Disease dynamics in plant communities. In: Collinge, SK.; Ray, C., editors.Disease Ecology: Community Structure and Pathogen Dynamics. Oxford University Press;Oxford: 2006. p. 58-72.

Mohr TJ, Liu H, Yan S, Morris CE, Castillo JA, Jelenska J, Vinatzer BA. Naturally occurringnonpathogenic isolates of the plant pathogen Pseudomonas syringae lack a type III secretionsystem and effector gene orthologues. J Bacteriol 2008;190:2858–2870. [PubMed: 18263729]

Morris CE, Sands DC, Vinatzer BA, Glaux C, Guilbaud C, Buffiere A, Yan SC, Dominguez H,Thompson BM. The life history of the plant pathogen Pseudomonas syringae is linked to the watercycle. Isme Journal 2008;2:321–334. [PubMed: 18185595]



NIH


NIH


NIH


Mudgett MB. New insights to the function of phytopathogenic bacterial type III effectors in plants.Annu Rev Plant Biol 2005;56:509–531. [PubMed: 15862106]

Nordborg M, Hu TT, Ishino Y, Jhaveri J, Toomajian C, Zheng HG, Bakker E, Calabrese P, GladstoneJ, Goyal R, Jakobsson M, Kim S, Morozov Y, Padhukasahasram B, Plagnol V, Rosenberg NA,Shah C, Wall JD, Wang J, Zhao KY, Kalbfleisch T, Schulz V, Kreitman M, Bergelson J. Thepattern of polymorphism in Arabidopsis thaliana. PLoS Biol 2005;3:1289–1299.

Orser C, Staskawicz BJ, Panopoulos NJ, Dahlbeck D, Lindow SE. Cloning and expression of bacterialice nucleation genes in Escheria coli. J Bacteriol 1985;164:359–366. [PubMed: 3900043]

Parker MA. Nonadaptive evolution and disease resistance in an annual legume. Evolution1991;45:1209–1217.

Platt A, Horton M, Huang YS, Li Y, Anastasio AE, Mulyati NW, Ãgren J, Bossdorf O, Byers D,Donohue K, Dunning M, Holub EB, Hudson A, Le Corre V, Loudet O, Roux F, Warthmann N,Weigel D, Rivero L, Scholl R, Nordborg M, Bergelson J, Borevitz JO. The scale of populationstructure in Arabidopsis thaliana. PLoS Genetics 2010;6:e1000843. [PubMed: 20169178]

Poullain V, Gandon S, Brockhurst MA, Buckling A, Hochberg ME. The evolution of specificity inevolving and coevolving antagonistic interactions between a bacteria and its phage. Evolution2008;62:1–11. [PubMed: 18005153]

Power AG, Mitchell CE. Pathogen spillover in disease epidemics. Am Nat 2004;164:S79–S89.[PubMed: 15540144]

Rand TA, Tylianakis JM, Tscharntke T. Spillover edge effects: the dispersal of agriculturallysubsidized insect natural enemies into adjacent natural habitats. Ecol Letters 2006;9:603–614.

Roux F, Gao LP, Bergelson J. Impact of initial pathogen density on resistance and tolerance in apolymorphic disease resistance gene system in Arabidopsis thaliana. Genetics. 2010 in press.

Sacristan S, Fraile A, Malpica JM, Garcia-Arenal F. An analysis of host adaptation and its relationshipwith virulence in Cucumber mosaic virus. Phytopathology 2005;95:827–833. [PubMed:18943016]

Saleh AA, Ahmed HU, Todd TC, Travers SE, Zeller KA, Leslie JF, Garrett KA. Relatedness ofMacrophomina phaseolina isolates from tallgrass prairie, maize, soybean and sorghum. Mol Ecol2010;19:79–91. [PubMed: 19943894]

Salvaudon L, Giraud T, Shykoff JA. Genetic diversity in natural populations: a fundamentalcomponent of plant-microbe interactions. Curr Opin Plant Biol 2008;11:135–143. [PubMed:18329329]

Sarkar SF, Guttman DS. Evolution of the core genome of Pseudomonas syringae, a highly clonal,endemic plant pathogen. Appl Environ Microbiol 2004;70:1999–2012. [PubMed: 15066790]

Sawada H, Suzuki F, Matsuda I, Saitou N. Phylogenetic analysis of Pseudomonas syringae pathovarssuggests the horizontal gene transfer of argK and the evolutionary stability of the hrp gene cluster.J Mol Evol 1999;49:627–644. [PubMed: 10552044]

Simonich MT, Innes RW. A disease resistance gene in Arabidopsis with specificity for the avrPph3gene in Pseudomonas syringae pv. phaseolicola. Mol Plant-Microbe Interact 1995;8:637–640.[PubMed: 8589418]

Smith, JJ.; Saddler, GS. The use of avirulent mutants of Ralstonia solanaceanum for control ofbacterial wild disease. In: Jeger, MJ.; Spence, NJ., editors. Biotic Interactions in Plant-PathogenAssociations. CABI Publishing; Wallingford, UK: 2001. p. 159-176.

Spitzer B. Local maladaptation in the soft scale insect Saissetia coffeae (Hemiptera: Coccidae).Evolution 2006;60:1859–1867. [PubMed: 17089970]

Stavrinides J, McCloskey JK, Ochman H. Pea aphid as both host and vector for the phytopathogenicbacterium Pseudomonas syringae. Appl Environ Microbiol 2009;75:2230–2235. [PubMed:19201955]

Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA)Software Version 4.0. Mol Biol Evol 2007;24:1596–1599. [PubMed: 17488738]

Thompson JN, Burdon JJ. Gene-for-gene coevolution between plants and parasites. Nature1992;360:121–125.



NIH


NIH


NIH


Thrall PH, Barrett LG, Burdon JJ, Alexander HM. Variation in pathogen aggressiveness within ametapopulation of the Cakile maritima-Alternaria brassicicola host-pathogen association. PlantPathol 2005;54:265–274.

Thrall PH, Burdon JJ, Bever JD. Local adaptation in the Linum marginale-Melampsora lini host-pathogen interaction. Evolution 2002;56:1340–1351. [PubMed: 12206236]

Van Poecke RMP, Sato M, Lenarz-Wyatt L, Weisberg S, Katagiri F. Natural variation in RPS2-mediated resistance among Arabidopsis accessions: Correlation between gene expression profilesand phenotypic responses. Plant Cell 2007;19:4046–4060. [PubMed: 18083910]

Whalen MC, Innes RW, Bent AF, Staskawicz BJ. Identification of Pseudomonas syringae pathogensof Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean.Plant Cell 1991;3:49–59. [PubMed: 1824334]

Whipps JM. Microbial interactions and biocontrol in the rhizosphere. J Exp Bot 2001;52:487–511.[PubMed: 11326055]

Wichmann G, Bergelson J. Effector genes of Xanthamonas axonopodis pv. vesicatoria promotetransmission and enhance other fitness traits in the field. Genetics 2004;166:693–706. [PubMed:15020460]

Wolinska J, Bittner K, Ebert D, Spaak P. The coexistence of hybrid and parental Daphnia the role ofparasites. Proc R Soc Lond B 2006;273:1977–1983.

Woodhams DC, Voyles J, Lips KR, Carey C, Rollins-Smith LA. Predicted disease susceptibility in aPanamanian amphibian assemblage based on skin peptide defenses. J Wildl Dis 2006;42:207–218.[PubMed: 16870844]

Woolhouse MEJ, Taylor LH, Haydon DT. Population biology of multihost pathogens. Science2001;292:1109–1112. [PubMed: 11352066]

Young JM. Pathogenicity and identification of the lilac pathogen, Pseudomonas syringae pv syringaevan Hall 1902. Annals of Applied Biology 1991;118:283–298.



NIH


NIH


NIH


Figure 1.Minimum Evolution tree based on a 570 bp fragment of the gyrase B gene showingevolutionary relationships among 42 strains of Pseudomonas syringae. Strains that elicit ahost resistance response (HR+) are suffixed with +; those that carry a xenologous T3SS anddo not elicit a host resistance response (HR−) are suffixed with −. Bootstrap values (>75%)from analysis of 10,000 replicates are shown above nodes. The tree was rooted withPseudomonas aeuruginosa strain PA01 as the outgroup. Strains collected from Arabidopsisare marked with an asterisk. All strains collected from A. thaliana are within one of thegroup 2 clades, and HR-strains carrying a xenologous T3SS are found exclusively in clade2c.



NIH


NIH


NIH


Figure 2.Mean resistance of Midwest and globally distributed lines of the host A. thaliana whenchallenged with 12 strains of the pathogen P. syringae collected from Midwestern A.thaliana plants (resident strains) and 18 strains collected worldwide, from a largelyunrelated group of 13 agricultural species (non-resident strains). (a). All P. syringae strains.(b). Only strains belonging to P. syringae clade 2 (see Fig. 1). See table S1 for informationon host and pathogen sampling. Error bars represent standard errors around the mean.



NIH


NIH


NIH


Figure 3.Growth of 24 resident strains of the pathogen Pseudomonas syringae and 18 nonresidentstrains in the A. thaliana ecotype Col-0. Resident strains are further divided into strains thathave a xenologous T3SS and do not trigger the hypersensitive response (HR) in the host (HR−), and strains that have an ancestral T3SS and do trigger HR (HR+). Bars reflect onestandard error of the mean. Each strain is identified by a number found in Table S1.



NIH


NIH


NIH


NIH


NIH


NIH



Tabl

e 1

Effe

ct o

f pat

hoge

n or

igin

(res

iden

t vs n

on-r

esid

ent)

on p

atte

rns o

f gen

e-fo

r-ge

ne re

sist

ance

in th

e in

tera

ctio

n be

twee

n Ps

eudo

mon

assy

ring

ae a

nd A

rabi

dops

is th

alia

na. T

he a

naly

sis o

f dev

ianc

e ta

ble

was

com

pute

d fr

om a

gen

eral

ized

line

ar m

odel

rela

ting

the

freq

uenc

y of

maj

or g

ene

resi

stan

ce to

pat

hoge

n or

igin

(res

iden

t vs.

non-

resi

dent

) and

hos

t orig

in (M

idw

est v

. glo

bally

dis

tribu

ted)

.

Var

iabl

edf

Dev

ianc

eR

esid

ual d

fR

esid

ual D

evia

nce

F

NU

LL14

3182

80.0

Path

ogen

orig

in1

677.

114

3076

02.9

130.

8*

plan

t orig

in1

0.7

1429

7602

.20.

1431

path

ogen

× p

lant

114

.114

2875

88.1

2.72

* p =

2e-1

6


Documents

Maladaptation in wild populations of the generalist plant pathogen Pseudomonas syringae