Dear Author,

Here are the proofs of your article.

• You can submit your corrections online, via e-mail or by fax.

• For online submission please insert your corrections in the online correction form. Alwaysindicate the line number to which the correction refers.

• You can also insert your corrections in the proof PDF and email the annotated PDF.

• For fax submission, please ensure that your corrections are clearly legible. Use a fine blackpen and write the correction in the margin, not too close to the edge of the page.

• Remember to note the journal title, article number, and your name when sending yourresponse via e-mail or fax.

• Check the metadata sheet to make sure that the header information, especially author namesand the corresponding affiliations are correctly shown.

• Check the questions that may have arisen during copy editing and insert your answers/corrections.

• Check that the text is complete and that all figures, tables and their legends are included. Alsocheck the accuracy of special characters, equations, and electronic supplementary material ifapplicable. If necessary refer to the Edited manuscript.

• The publication of inaccurate data such as dosages and units can have serious consequences.Please take particular care that all such details are correct.

• Please do not make changes that involve only matters of style. We have generally introducedforms that follow the journal’s style.Substantial changes in content, e.g., new results, corrected values, title and authorship are notallowed without the approval of the responsible editor. In such a case, please contact theEditorial Office and return his/her consent together with the proof.

• If we do not receive your corrections within 48 hours, we will send you a reminder.

• Your article will be published Online First approximately one week after receipt of yourcorrected proofs. This is the official first publication citable with the DOI. Further changesare, therefore, not possible.

• The printed version will follow in a forthcoming issue.

Please note

After online publication, subscribers (personal/institutional) to this journal will have access to thecomplete article via the DOI using the URL: http://dx.doi.org/[DOI].If you would like to know when your article has been published online, take advantage of our freealert service. For registration and further information go to: http://www.springerlink.com.

Due to the electronic nature of the procedure, the manuscript and the original figures will only bereturned to you on special request. When you return your corrections, please inform us if you wouldlike to have these documents returned.

Metadata of the article that will be visualized in OnlineFirst

ArticleTitle Isolation and characterization of 12 polymorphic microsatellite loci in Illicium verum (Schisandraceae)

Article Sub-Title

Article CopyRight Springer Science+Business Media Dordrecht(This will be the copyright line in the final PDF)

Journal Name Conservation Genetics Resources

Corresponding Author Family Name ZhangParticle

Given Name DianxiangSuffix

Division Key Laboratory of Plant Resources Conservation and Sustainable Utilization,South China Botanical Garden

Organization Chinese Academy of Sciences

Address Guangzhou, 510650, China

Email dx-zhang@scbg.ac.cn

Author Family Name MaParticle

Given Name ZhonghuiSuffix

Division Key Laboratory of Plant Resources Conservation and Sustainable Utilization,South China Botanical Garden

Organization Chinese Academy of Sciences

Address Guangzhou, 510650, China

Division

Organization University of Chinese Academy of Sciences

Address Beijing, 10049, China

Email

Author Family Name LuoParticle

Given Name ShixiaoSuffix

Division Key Laboratory of Plant Resources Conservation and Sustainable Utilization,South China Botanical Garden

Organization Chinese Academy of Sciences

Address Guangzhou, 510650, China

Email

Schedule

Received 30 December 2012

Revised

Accepted 31 December 2012

Abstract Twelve polymorphic microsatellite loci were isolated and characterized for Illicium verum, a member of thebasal angiosperms. The observed number of alleles per locus ranged from two to nine. The observed andexpected heterozygosity varied from 0.10 to 1.00 and 0.097 to 0.85, respectively. Twelve loci were screenedin cross-amplification tests for three other Illicium species, in which all loci were successfully amplified.These newly developed microsatellite markers could provide a useful tool for the ongoing efforts in studying

the population genetic variation of I. verum, which will facilitate formulation of appropriate strategies forconservation and sustainable utilization of star anise and its congeneric species.

Keywords (separated by '-') Illicium verum - Microsatellites - Population genetics - Interspecific transferability

Footnote Information

UNCORRECTEDPROOF

TECHNICAL NOTE1

2 Isolation and characterization of 12 polymorphic microsatellite

3 loci in Illicium verum (Schisandraceae)

4 Zhonghui Ma • Shixiao Luo • Dianxiang Zhang

5 Received: 30 December 2012 / Accepted: 31 December 20126 � Springer Science+Business Media Dordrecht 2013

7 Abstract Twelve polymorphic microsatellite loci were

8 isolated and characterized for Illicium verum, a member of

9 the basal angiosperms. The observed number of alleles per

10 locus ranged from two to nine. The observed and expected

11 heterozygosity varied from 0.10 to 1.00 and 0.097 to

12 0.85, respectively. Twelve loci were screened in cross-

13 amplification tests for three other Illicium species, in which

14 all loci were successfully amplified. These newly devel-

15 oped microsatellite markers could provide a useful tool for

16 the ongoing efforts in studying the population genetic

17 variation of I. verum, which will facilitate formulation of

18 appropriate strategies for conservation and sustainable

19 utilization of star anise and its congeneric species.

20

21 Keywords Illicium verum � Microsatellites � Population

22 genetics � Interspecific transferability

23 Illicium verum Hook. f. (now in Schisandraceae, APG III

24 2009) commonly known as star anise or Chinese star anise,

25 is an important economic and traditional medicinal plant.

26 The species has a narrow geographical distribution in

27 southern China and northern Vietnam (Smith 1947). Star

28 anise is widely used in Chinese and Vietnamese cuisine as

29 well as in western cooking (Bown 1995). It has been

30 used in treating digestive disturbances, cough mixtures,

31abdominal colic, vomiting, abdomen and lower back pain

32(Grieve 1984; Cano and Volpato 2004; Wang et al. 2011).

33The essential oil distilled from the fruit of I. verum is also

34frequently used in perfume, toothpaste, flavour liqueurs,

35soft drinks and bakery products (Bown 1995). However,

36the resources and the habitat of I. verum are dramatically

37diminishing in the last decades, due to the extensive

38replacement of star anise by Eucalyptus plantations.

39Understanding the population genetic basis of germ-

40plasm resources is crucial for their evaluation and conser-

41vation, but little is known about the genetic variation and

42population genetic structure of Illicium species. Therefore,

43it is urgent to develop molecular markers for Illicium

44species. In this study, we reported 12 microsatellite loci in

45I. verum and tested their interspecific transferability in

46the congeneric Illicium dunnianum, Illicium tsangii and

47Illicium jiadifengpi. These new microsatellite markers

48could be used to assess the levels of genetic diversity and to

49understand the relationships among those closely related

50species in the ongoing studies.

51A total of 96 I. verum samples were collected from four

52populations in Guangxi, China, for analyzing the genetic

53diversity by the novel microsatellite loci developed in this

54study. In addition, 40 individuals from two populations of

55I. dunnianum, 14 individuals of I. tsangii, and 20 individuals

56of I. jiadifengpi, were used to test the polymorphism and the

57transferability of the microsatellite primers (Table 2).

58Genomic DNAwas extracted from silica gel dried leaf tissue

59of each individual using modified CTAB method (Doyle

601991). Microsatellite loci from an enriched (TG)n library

61were isolated using the Fast Isolation by AFLP of Sequences

62Containing Repeats protocol (FIASCO) with some modifi-

63cations (Zane et al. 2002). Appropriate microsatellite motifs

64tested by the program SSRHunter 1.3.0 (Li and Wan 2005)

65were used to design primers with the program PRIMER

A1 Z. Ma � S. Luo � D. Zhang (&)

A2 Key Laboratory of Plant Resources Conservation

A3 and Sustainable Utilization, South China Botanical Garden,

A4 Chinese Academy of Sciences, Guangzhou 510650, China

A5 e-mail: dx-zhang@scbg.ac.cn

A6 Z. Ma

A7 University of Chinese Academy of Sciences, Beijing 10049,

China

123Journal : Large 12686 Dispatch : 2-1-2013 Pages : 3

Article No. : 9857h LE h TYPESET

MS Code : COGR-D-12-01390 h CP h DISK4 4

Conservation Genet Resour

DOI 10.1007/s12686-012-9857-5

Au

tho

r P

ro

of

UNCORRECTEDPROOF

66 PREMIER 5.0 (Ren et al. 2004).The PCR reactions were

67 performed in a 20 lL mixture containing 40 ng of genomic

68 DNA, 0.3 lL dNTPs, 0.3 lM of each primer, 2 lL of

69 109 PCR buffer, and 0.6 U Taq DNA polymerase (Takara).

70 The amplification conditions were as follows: initial dena-

71 turation at 94 �C for 5 min; subsequent 35 cycles of dena-

72 turing at 94 �C for 40 s, annealing at a primer-specific

73 optimal temperature for 40 s (Table 1), extension at 72 �C

74 40 s, and a final extension at 72 �C for 10 min. The PCR

75 products were determined on the ABI PRISM 3100 Genetic

76 Analyser (Invitrogen). The number of the alleles (Na),

77 observed heterozygosities (Ho), and expected heterozygos-

78 ities (He) were analyzed for each locus in the whole samples

79 using POPGENE 32 software (Yeh et al. 1999). Deviations

80 from Hardy–Weinberg equilibrium (HWE) for each locus

81 were carried out using the GENEPOP version 3.4 (Raymond

82 and Rousset 1995) (Table 2).

83 Finally twelve primer pairs were successfully amplified

84 with the expected size range (Table 1). The number of

85 alleles per locus ranged from 2 to 9 with a mean number of

86 4.1 suggesting that all of the 12 markers are appropriate to

87 analyze the genetic diversity of I. verum populations. The

88observed and expected heterozygosity ranged from 0.10 to

891.00 and 0.097 to 0.85, respectively (Table 2). The trans-

90ferability of the 12 polymorphic I. verum microsatellite

91markers was examined using seventy-four individuals of

92three other Illicium species under the same amplification

93conditions as used for I. verum. Four loci (Iv232, Iv164,

94Iv857 and Iv832, Table 2) were detected to deviate sig-

95nificantly from HWE (P\ 0.01) in all of the four popu-

96lations (SLGX_IV, GFGX_IV, GLGX_IV, YLGX_IV).

97Locus Iv1015 showed deviation from HWE (P\ 0.05) in

98population SLGX_IV but significant (P\ 0.01) in popu-

99lation GFGX_IV and YLGX_IV. Similarly, locus Iv485

100showed deviation from HWE (P\ 0.05) in population

101GLGX_IV and significantly (P\ 0.01) in population

102SLGX_IV and GFGX_IV. Additionally, the locus Iv310

103deviated from the HWE (P\ 0.05) in SLGX_IV and

104GFGX_IV. The long history of artificial graft propagations

105of I. verum might result in extremely low rate of random

106mating, which could be given as a reason for the significant

107deviation from HWE. All of the 12 markers displayed

108polymorphism for species I. verum, I. dunnianum, I. tsangii

109and I. jiadifengpi indicating that it could be important to

Table 1 Characteristics of 12 microsatellite loci identified in I. verum

Locus Sequence (50–30) Repeat Size (bp) Ta (�C) GenBank accession no.

Iv1015 F: GATTATGAAACTTGTGATa (GT)11 248 50 KC176688

R: AGGGTATCACTACACTCA

Iv232 F: GTTCTATCTACAGTAAGGGTa (CA)6 243 60 KC176689

R: CAAACTTGTGATGTTATGAT

Iv164 F: TTCACCACACTCACTCATa (CA)5 199 60 KC176690

R: GAAAACACCCCTTACCTA (CA)8

Iv485 F: CTGCGGGTGGTGCTTCGTa (GT)17 179 60 KC176691

R: TTTGGGGAGTCCTCGGGC

Iv310 F: AAGCCCCTGATTTGTGAAGAa (GT)9 160 56 KC176692

R: ACCAGACACACGCACACATC

Iv984 F: TGGTCCTCTGCCATCTACAAa (CA)7 154 54 KC176693

R: TATCCCAGCCAGTGAAGACA

Iv579 F: TGTGGTCTACAATGAATCb (AC)12 143 52 KC176694

R: TCTAAAGGCTACAAAAAG

Iv857 F: CTCAGGCAACCAAGAAATACb (CT)6 132 52 KC176695

R: TGTCTCTGGTGTGATTTTGA

Iv832 F: CCCTCAAAACCAACGGACCTb (GT)7 131 65 KC176696

R: CCAAGACCAGACACACGCAC

Iv154 F: ATTCTCACAACAACCAAACAb (AC)18 118 54 KC176697

R: CAGAAAGGGTTAGAGTGACA

Iv583 F: CAACATCAAATCATACATb (TC)19 109 52 KC176698

R: AGTTTAGCAACATTCCTT

Iv182 F: GCATTGGTTGTTGTTATTb (TG)7 109 57 KC176699

R: ACACACCTGGTATCCCTA

Presented for each locus are the forward (F) and reverse (R) primer sequences, repeat motif, size of the original fragment (bp), annealing

temperature (Ta), GenBank accession number, a FAM labeled, b JOE labeled

Conservation Genet Resour

123Journal : Large 12686 Dispatch : 2-1-2013 Pages : 3

Article No. : 9857h LE h TYPESET

MS Code : COGR-D-12-01390 h CP h DISK4 4

Au

tho

r P

ro

of

UNCORRECTEDPROOF

110 mitigate marker development costs and enhance genetic

111 analysis in I. verum as well as in the genus Illicium in

112 general (Table 2).

113 Acknowledgments We are grateful to Dr. Wei Gong and114 Ms. Tingting Duan for technical assistances and for helpful comments115 on the manuscript. This work was supported by National Natural116 Science Foundation of China (Grant No. 31170217) and the Knowl-117 edge Innovation Program of the Chinese Academy of Sciences (Grant118 No. KSCX2-EW-Z-6).

119 References

120 APG [Angiosperm Phylogeny Group] III (2009) An update of the121 Angiosperm Phylogeny Group classification for the orders and122 families of flowering plants: APG III. Bot J Linn Soc123 161:105–121124 Bown D (1995) Encyclopaedia of herbs and their uses. Dorling125 Kindersley, London126 Cano JH, Volpato G (2004) Herbal mixtures in the traditional127 medicine of Eastern Cuba. J Ethnopharmacol 90:293–316

128Doyle JJ (1991) DNA protocols for plants. In: Hewitt GM, Johnston129A (eds) Molecular techniques in taxonomy. Springer, Berlin,130pp 283–293131Grieve (1984) A modern herbal. Penguin, ISBN 0-14-046-40-9132Li Q, Wan JM (2005) SSRHunter: development of a local searching133software for SSR sites (in Chinese). Hereditas 27:808–810134Raymond M, Rousset F (1995) Genepop (version 1.2): population135genetics software for exact tests and ecumenicism. J Hered13686:248–249137Ren L, Zhu BQ, Zhang YB, Wang HY, Li CY, Su YH, Ba CF (2004)138The research of applying primer premier 5.0 to design PCR139primer. J Jinzhou Med Coll 25:43–46140Smith AC (1947) The families Illiciaceae and Schisandraceae.141Sargentia 7:1–224142Wang GW, Hu WT, Huang BK, Qin LP (2011) Illicium verum: a143review on its botany, traditional use, chemistry and pharmacol-144ogy. J Ethnopharmacol 136:10–20145Yeh FC, Yang RC, Boyle T (1999) POPGENE Version 1.32,146microsoft windows-based freeware for population genetic anal-147ysis. University of Alberta and Centre for International Forestry148Research, Edmonton149Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite150isolation: a review. Mol Ecol 11:1–16

151

Table 2 Characteristics of 12 microsatellite loci in populations of Illicium species

Population/Code DI Iv1015 Iv232 Iv164 Iv485 Iv310 Iv984 Iv579 Iv857 Iv832 Iv154 Iv583 Iv182

I. verum SLGX_IV Na 5 3 6 4 8 2 8 3 3 3 4 3

Ho 0.88 1.00 0.24 0.96 0.92 0.28 0.88 1.00 0.80 0.60 0.86 0.65

He 0.64 0.62 0.74 0.71 0.81 0.25 0.75 0.62 0.53 0.46 0.70 0.40

P 0.041* 0.005** 0.002** 0.001** 0.047* 0.322 0.970 0.001** 0.003** 0.075 0.256 0.077

I. verum GFGX_IV Na 4 3 6 4 8 2 8 3 3 3 4 3

Ho 1.00 0.95 0.14 0.67 0.81 0.14 0.90 1.00 1.00 0.65 0.65 0.76

He 0.66 0.57 0.67 0.73 0.83 0.14 0.80 0.61 0.61 0.54 0.47 0.69

P 0.001** 0.003** 0.001** 0.001** 0.046* 0.695 0.751 0.001** 0.002** 0.069 0.237 0.060

I. verum GLGX_IV Na 3 3 6 4 9 2 9 3 4 4 3 3

Ho 0.96 0.96 0.31 0.46 0.88 0.31 0.69 1.00 0.88 0.75 0.90 0.82

He 0.63 0.61 0.68 0.51 0.83 0.27 0.74 0.61 0.58 0.52 0.65 0.53

P 0.001** 0.001** 0.003** 0.048* 0.147 0.258 0.900 0.002** 0.003** 0.132 0.187 0.098

I. verum YLGX_IV Na 4 3 5 3 8 2 8 3 4 3 4 3

Ho 0.63 0.92 0.38 0.33 0.88 0.13 0.83 1.00 0.96 0.73 0.82 0.67

He 0.49 0.65 0.70 0.30 0.84 0.12 0.76 0.60 0.59 0.49 0.61 0.51

P 0.358 0.006** 0.003** 0.703 0.051 0.715 0.747 0.004** 0.001** 0.083 0.180 0.105

I. dunnianum NKGD_ID Na 2 3 5 3 6 3 8 2 4 3 4 2

Ho 0.53 0.75 0.47 0.92 0.85 1.00 0.86 0.46 1.00 0.63 0.92 0.31

He 0.31 0.56 0.53 0.76 0.79 0.63 0.66 0.32 0.70 0.51 0.85 0.25

I. dunnianum BFGD_ID Na 2 3 5 4 8 3 8 3 3 3 4 2

Ho 0.63 0.79 0.70 0.85 0.90 0.88 0.84 0.63 1.00 0.77 0.67 0.54

He 0.46 0.63 0.44 0.80 0.83 0.63 0.70 0.57 0.70 0.68 0.53 0.41

I. tsangii NKGD_IT Na 2 4 6 3 8 4 7 2 4 3 4 2

Ho 0.75 0.90 0.40 0.55 0.80 0.83 0.91 0.23 1.00 0.68 0.83 0.63

He 0.49 0.84 0.72 0.58 0.75 0.62 0.78 0.15 0.65 0.57 0.61 0.45

I. jiadifengpi TJGD_IJ Na 2 3 5 4 8 4 8 2 5 3 3 3

Ho 0.35 0.89 0.63 0.87 0.79 0.70 0.76 0.10 1.00 0.42 0.90 0.79

He 0.30 0.62 0.57 0.64 0.81 0.58 0.70 0.097 0.70 0.30 0.76 0.60

Na number of alleles per locus, Ho observed heterozygosity, He expected heterozygosity, P probability of HWE

* P\ 0.05 and ** P\ 0.01 indicate significant deviations from HWE

Conservation Genet Resour

123Journal : Large 12686 Dispatch : 2-1-2013 Pages : 3

Article No. : 9857h LE h TYPESET

MS Code : COGR-D-12-01390 h CP h DISK4 4

Au

tho

r P

ro

of