Introduction of Culex Toxicity into Bacillus thuringiensis Cry4Ba by Protein Engineering

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2003, p. 5343–5353 Vol. 69, No. 90099-2240/03/$08.00�0 DOI: 10.1128/AEM.69.9.5343–5353.2003Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Introduction of Culex Toxicity into Bacillus thuringiensis Cry4Baby Protein Engineering

Mohd Amir F. Abdullah,1,2 Oscar Alzate,1,3 Marwan Mohammad,1 Rebecca J. McNall,4Michael J. Adang,4 and Donald H. Dean1*

The Protein Research Group and Department of Biochemistry, The Ohio State University, Columbus, Ohio1; Departmentof Science in Engineering, Faculty of Engineering, International Islamic University Malaysia, Jalan Gombak,

53100 Kuala Lumpur, Malaysia2; Parque Tecnologico de Antioquia, Medellín, Colombia3;and Department of Entomology, University of Georgia, Athens, Georgia4

Received 2 April 2003/Accepted 26 June 2003

Bacillus thuringiensis mosquitocidal toxin Cry4Ba has no significant natural activity against Culex quinque-fasciatus or Culex pipiens (50% lethal concentrations [LC50], >80,000 and >20,000 ng/ml, respectively). Weintroduced amino acid substitutions in three putative loops of domain II of Cry4Ba. The mutant proteins weretested on four different species of mosquitoes, Aedes aegypti, Anopheles quadrimaculatus, C. quinquefasciatus, andC. pipiens. Putative loop 1 and 2 exchanges eliminated activity towards A. aegypti and A. quadrimaculatus.Mutations in a putative loop 3 resulted in a final increase in toxicity of >700-fold and >285-fold against C.quinquefasciatus (LC50 � 114 ng/ml) and C. pipiens (LC50 � 37 ng/ml), respectively. The enhanced protein(mutein) has very little negative effect on the activity against Anopheles or Aedes. These results suggest that theintroduction of short variable sequences of the loop regions from one toxin into another might provide ageneral rational design approach to enhancing B. thuringiensis Cry toxins.

The ultimate goal of protein engineering of the insecticidalcrystal proteins from Bacillus thuringiensis is to be able todesign any Cry toxin to possess toxic activity against any insect.A more immediate goal is to introduce activity into a toxin thatdoes not possess it. We chose to modify Cry4Ba, a toxinexpressed by B. thuringiensis var. israelensis (B. thuringiensissubsp. israelensis), which has toxicity toward mosquitoes of thegenera Anopheles and Aedes but has no activity against Culex(14).

B. thuringiensis has been used successfully in forestry andagriculture, both as spray formulations and as systemic pesti-cides expressed in plants. The high level of target specificitymakes B. thuringiensis a more desirable choice than broad-spectrum chemical insecticides from an environmental per-spective, but it limits its market potential (48). B. thuringiensissubsp. israelensis has also been used successfully in control ofmosquito vectors. It expresses several genes and has broadcontrol over most important mosquitoes but lacks good per-sistence in the field (5).

There are various approaches to broadening the insecticidalspectrum of B. thuringiensis, including introduction of toxingenes that code for separate insecticidal activities into a recip-ient bacterium (4, 7, 26), creating a bacterium that expresses acombination of toxins instead of a single toxin (46), and engi-neering mutant toxins with new or broadened insecticidal spec-tra (6, 8). In these approaches, multiple gene constructs withseparate mechanisms of action are useful to forestall resistancedevelopment. It is also important that the genes used are astoxic as possible against the target pests.

B. thuringiensis subsp. israelensis-based biopesticides are

used worldwide to control mosquito and black fly populations(5). The mosquitocidal toxins of B. thuringiensis subsp. israelen-sis are due to parasporal toxins deposited during sporulation ascrystals. These insecticidal crystal proteins are composed ofCry4Aa, Cry4Ba, Cry11Aa, and Cyt1Aa (51). Toxic proteingenes from this bacterium have been inserted into other suit-able hosts to confer mosquitocidal activity on the new hosts(24, 31, 32, 36). These approaches hoped to increase the effi-cacy of the toxins over that for the original host.

Genetic studies of coleopteran- and lepidopteran-active B.thuringiensis insecticidal crystal proteins indicated that domainII loop regions are involved in receptor binding (12, 29). Do-main II loop mutations may have either a negative or a positiveeffect on binding and toxicity (44). The loop residues are gen-erally considered to be involved with receptor binding, but thefunctional interactions of individual residues may differ signif-icantly between target insects or receptors (40). A mutation inloop 2 of Cry1Ab decreases the toxicity to Manduca sexta byaffecting irreversible binding, but the same mutant affects nei-ther toxicity nor binding affinity to Heliothis virescens (37). Onthe other hand, alanine substitutions of loop 3 residues G439and F440 in Cry1Ab affect the initial receptor binding andtoxicity in both M. sexta and H. virescens (41). These loops areproposed to be exceptional targets for genetic engineering tocreate more potent toxins with diverse insect specificity (38).For a more general review, see reference 42.

The present study explored the domain II loop regions ofCry4Ba in search of sites involved in mosquitocidal activities.Putative loop residues from Cry4Aa were exchanged with pu-tative loop residues from Cry4Ba. The results of the exchangeswere tested on four different species of important human dis-ease vectors, Aedes aegypti (dengue and yellow fever), Anoph-eles quadrimaculatus (malaria), Culex quinquefasciatus (WestNile virus), and Culex pipiens (West Nile virus). Our results

* Corresponding author. Mailing address: Department of Biochem-istry, The Ohio State University, Columbus, OH 43210-1292. Phone:(614) 292-8829. Fax: (614) 292-6773. E-mail: [email protected].

5343

on April 14, 2016 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

showed that the putative loop 3 exchange caused significantincreases in toxicity of greater than 700-fold against C. quin-quefasciatus and greater than 285-fold against C. pipiens whilestill maintaining wild-type levels against the other two mosqui-toes. The significant increase in toxicity, or its lack thereof, wassurprisingly not related to either receptor binding or irrevers-ible binding. Putative loop 1 and 2 switches, however, abol-ished toxicity towards both Aedes and Anopheles but did notestablish toxicity towards Culex.

MATERIALS AND METHODS

Cloning and construction of a trypsin-site deletion mutant of Cry4Ba. Thecry4Ba gene was a kind gift from A. Delecluse (Pasteur Institute, Paris, France).The gene was amplified by PCR with a set of primers (forward primer FW4AB,5� GAT Tgg atc cAA TGT AAT ATG GGA G 3� [lowercase letters indicateBamHI site], and reverse primer RE4AB, 5� TAT TTT Tgg tac cAG AAT TAATAA ATG CAG 3� [lowercase letters indicate KpnI site]) and subcloned intoplasmid pTZ19R (Fermentas), which was double digested with BamHI and KpnI.The cry4Ba gene was put under the control of the lac promoter of the vector inthis construct. This construct was transformed into DH5� Escherichia coli cellsfor DNA isolation and protein expression. The wild-type Cry4Ba protoxin pro-duced a �46-kDa toxin fragment when digested with trypsin (data not shown).This fragment was found to be inactive (25). The trypsin site was removed bymutating R203 to A by site-directed mutagenesis, as previously reported byAngsuthanasombat et al. (3). The mutated toxin was called 4BRA, and it pro-duced a �66-kDa toxin fragment when digested by trypsin (data not shown).

Mutating Cry toxins by site-directed mutagenesis. Location of the putativeloop regions was made by homology modeling the structure of Cry4Aa onCry3Aa with Swiss Model (http://www.expasy.org/swissmod/SWISS-MODEL.html)(data not shown) and aligning the amino acid sequences of Cry4Aa and Cry4Bawith Swiss PDB-Viewer (18, 35) (Fig. 1). The putative loops 1, 2, and 3 of 4BRAwere mutated to mimic the corresponding putative loops of Cry4Aa. In theputative loop 1, 331IYQ333 were mutated to QTT to yield 4BL1QTT. In theputative loop 2, NDY was inserted between V393 and T394 to yield 4BL2NDY.In the putative loop 3, D454 was replaced with P and AT was inserted afterposition 454 to yield 4BL3PAT. In further mutations of the putative loop 3, D454was replaced with G and AV was inserted after position 454 to yield 4BL3GAV.P454 in the 4BL3PAT construct was mutated to A to yield 4BL3AAT. P454 wasmutated to G to yield 4BL3GAT. Mutation of T456 in the 4BL3PAT backgroundto A yielded 4BL3PAA. Both P454 and T456 were mutated to A’s to yield4BL3AAA. Site-directed mutagenesis was performed by the modified QuickChange (Stratagene) method. DNA templates were purified (Qiagen), methyl-ated (dam methylase; New England BioLabs), and replicated by PCR withExpand long-template polymerase (Roche) with the following cycling parame-ters: step 1, 94°C, 2 min; step 2, 94°C, 10 s; step 3, 48°C, 30 s; step 4, 68°C, 4 min(repeat steps 2 to 4 nine times); step 5, 94°C, 15 s; step 6, 48°C, 30 s; step 7, 68°C,4 min plus 20 s every successive cycle (repeat steps 5 to 7 15 times); step 8, 68°C,7 min; step 9, 4°C, unlimited. The sequences of the primers are listed in Table 1.The reaction product was digested with DpnI (Roche) to remove the methylated

template DNA. The digested PCR product was used to transform E. coli DH5�competent cells. Mutations were confirmed by automated DNA sequencing(Plant-Microbe Genomics Facility, The Ohio State University).

Isolating and purifying Cry toxin. E. coli DH5� cells containing the toxinconstruct were grown on Luria-Bertani agar plates (43) supplemented with 100�g of ampicillin/ml at 37°C. Crystal inclusions were expressed in Terrific Broth(24 g of yeast extract/liter, 12 g of tryptone/liter, 2% glycerol, 25.08 g of K2HPO4/liter, 4.62 g of KH2PO4/liter), supplemented with 100 �g of ampicillin/ml, andgrown for 72 h at 37°C in an incubator-shaker at 250 rpm. Cells were harvestedand lysed, and crystal inclusions were washed as previously described (27).

Crystal inclusion protein was solubilized in carbonate buffer (30 mM Na2CO3,20 mM NaHCO3, pH 10.0), and the protein concentration was measured usingthe Coomassie protein assay reagent (Pierce) with bovine serum albumin (BSA)as standard. For binding assays, solubilized toxin was incubated with 1/20 (vol/vol) 10-mg/ml trypsin (Sigma) at 37°C for 3 h. The activated toxin was purified byhigh-pressure liquid chromatography with a Superdex 200 (Pharmacia) column.

Secondary structure analysis by circular dichroism (CD) spectroscopy. Col-umn-purified toxins were concentrated to at least 1 mg/ml with a Centriconinstrument (YM-30; Millipore). Concentrated toxins were diluted in a phosphatebuffer (10 mM KH2PO4-K2HPO4, 40 mM NaCl, pH 7.4) prepared in Milli-Q(Millipore) water. CD data were collected at room temperature with a 1-cm-path-length quartz cell (Hellma) on an AVIV Model 62A DS spectrophotome-ter, scanning from 250 to 200 nm at 1.0-nm steps. Data shown were based on theaverages of 10 scans.

Determining toxicity of Cry toxins by mosquito larva bioassay. Mosquitoeswere reared in an environment-controlled room at 28°C and 85% humidity, witha photoperiod of 14 h of light and 10 h of dark. The A. quadrimaculatus culturewas from Peggy Hodges (University of Notre Dame), A. aegypti and C. quinque-fasciatus cultures were from A. Yousten (Virginia Polytechnic Institute), and C.pipiens (recently isolated from nature in Ohio) was from R. Robish and W.Foster (Ohio State University). Adult mosquitoes were maintained on heparin-treated cow blood, sugarcane cubes (Domino Dots), and dechlorinated tapwater. Aedes and Culex larvae were maintained on fish food pellets (Koi FloatingBlend; Aquaricare), while Anopheles larvae were maintained on a 2:1 ratio ofground fish food flakes (Vitapro Plus Cichlid Power Flakes; Mike Reed Enter-prises) and brewer’s yeast (M. Q. Benedict, Centers for Disease Control andPrevention). Second-instar larvae were used for all bioassays. Bioassays wereperformed on different days after hatching due to the different growth rates ofthe mosquito larvae. A. aegypti, C. quinquefasciatus, and C. pipiens larvae weretested 2 days after hatching, while A. quadrimaculatus larvae were tested 3 daysafter hatching. A total of six larvae per 2.5 ml of water with one replicate in a24-well Costar cell culture plate (Corning) were fed a serial dilution of Cry toxins(as inclusions), and the number of mortalities was counted after a 24-h incuba-tion at 28°C. The bioassay was repeated to obtain a concentration range on Crytoxin inclusions yielding 10 to 90% mortality. The 50% lethal concentration wascalculated by a Probit method using SoftTOX version 1.1 (WindowChem).

Preparing mosquito brush border membrane vesicles (BBMV). Fourth-instarmosquito larvae were filtered with a nylon mesh, washed in distilled water,separated from large residual food particles, and dried briefly on a filter paper(Fisher) under vacuum suction. Harvested larvae were frozen at �70°C untilneeded. About 4 to 6 g of frozen larvae was homogenized in 8 to 12 ml of cold

FIG. 1. Sequence alignments based on the model structures made with Swiss-Pdb Viewer (18) of Cry4Aa with Cry4Ba. Loop positions areindicated above the sequences, while the amino acid residues involved are in boldface.

5344 ABDULLAH ET AL. APPL. ENVIRON. MICROBIOL.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

buffer A (300 mM mannitol, 5 mM EGTA, 17 mM Tris-HCl, pH 7.5). Larvaewere homogenized by 40 strokes of a Potter-Elvehjem polytetrafluoroethylenepestle in a glass tube at speed number 5 (�6,000 rpm). The homogenized samplewas centrifuged at 11,000 rpm � g for 5 min at 4°C in a JA-17 rotor. The pelletwas discarded while the supernatant was kept for the next step. The supernatantwas filtered through a Whatman (no. 1) filter paper under vacuum, and thefiltrate was collected on ice. The filtrate (4 ml) was layered on top of a 0 to 45%sucrose gradient and centrifuged at 40,000 � g for 2 h at 4°C in an SW28 rotor.The top layer was removed by suction and discarded, leaving the lowest visiblelayer or the pellet. This layer was resuspended in cold sterile double-distilledH2O and centrifuged at 35,000 � g for 15 min at 4°C in a JA-17 rotor. Thesupernatant was discarded, and any loose pellet was rinsed off with binding buffer(60 mM K2HPO4, 5 mM KH2PO4, 150 mM NaCl, 10 mM EGTA, pH 7.00). TheBBMV pellet was resuspended in 1 ml of ice-cold binding buffer supplementedwith Complete (Roche) protease inhibitor and homogenized by 10 strokes ofa small Potter-Elvehjem polytetrafluoroethylene pestle and glass tube. Theprotein concentration of the BBMV was measured with the Coomassie pro-tein assay reagent (Pierce), with BSA as the standard. The BBMV wasdistributed into 0.5-ml aliquots and kept at �70°C until needed. Aminopep-tidase activity was determined as described previously (15). Aminopeptidasein A. quadrimaculatus BBMV was 5.5-fold enriched over that in the homog-enate.

Radioactive labeling of Cry toxins. Activated toxins were iodinated as previ-ously described (52). Briefly, 0.3 to 0.5 mCi of 125I-Na (Perkin-Elmer) wasincubated with one Iodo-bead (Pierce) for 5 min at room temperature. Then,toxin (45 �g) in 0.1 ml of 30 mM Na2CO3–20 mM NaHCO3 (pH 10.0) was addedto the bead reaction mixture. After 5 min at room temperature, the mixture waspassed through a 2-ml Excellulose column (Pierce) to remove free iodine fromthe toxin.

Saturation binding assay. Mosquito BBMV (0.5 to 1.0 �g) were incubatedwith an increasing concentration of 125I-labeled toxin in 0.1 ml of binding bufferfor 1 h at room temperature. The reaction mixture was centrifuged at 26,000 �g for 10 min to separate unbound toxin from BBMV, and the BBMV pellet waswashed two times in binding buffer by centrifugation. The final pellet wascounted in a gamma counter (Wallac) to measure bound 125I-toxin. Nonspecificbinding was the amount of toxin bound in the presence of at least a 250-foldexcess of unlabeled toxin. Specific binding was obtained by subtracting thenonspecific binding counts from the total binding counts. Data were plotted withSigmaPlot version 8.0 (SPSS, Inc.).

Competition binding assay. The course of toxin binding to BBMV was sug-gested to occur through a two-step process involving reversible (19, 20) and

irreversible (21, 37, 50) steps. In this assay, 10 �g of mosquito BBMV wasincubated with 1 nM 125I-labeled toxin in 0.1 ml of binding buffer with increasingamounts of unlabeled toxin for 1 h at room temperature. The reaction mixturewas centrifuged at 26,000 � g for 10 min to separate unbound labeled toxin fromthe BBMV. The supernatant was discarded while the pellet was washed twicewith binding buffer. Counting and plotting of the data were done as describedunder “Saturation binding assay.”

Irreversible binding assay. In the irreversible binding assay, 2 �g of mosquitoBBMV was incubated with 2 nM 125I-labeled toxin in 0.1 ml of binding buffer for1 h at room temperature. Then a 1,000 nM final concentration was added to thebinding reaction mixture and was incubated for a different length of time. Un-bound labeled toxin was separated from the BBMV, and the resulting data wereobtained as described above. Nonspecific binding data were obtained by incor-porating the unlabeled toxin into the labeled toxin at the start of the assay andincubating the toxins with the BBMV for the maximum duration of the assayperiod. Specific binding was obtained by subtracting the nonspecific bindingcounts from the total binding counts.

Proteinase K protection assay. In this assay, 5 �g of C. quinquefasciatusBBMV was incubated with a 10 nM concentration of either 125I-labeled 4BRAor 125I-labeled 4BL3PAT in 0.1 ml of binding buffer for 1 h at room temperature.Later, 10 �g of proteinase K (Roche) was added and incubated for a further 20min. The action of the protease was stopped by 100 �g of Pefabloc SC (Roche).The reaction mixture was centrifuged at 26,000 � g for 10 min at room temper-ature to separate the remaining toxin bound or inserted in the BBMV. The pelletwas washed two times with binding buffer without resuspending the pellet.

Preparation of Culex BBMV for membrane permeation assay. C. quinquefas-ciatus larvae were raised to fourth instar as described earlier. Larvae werecollected, washed in distilled water, dried briefly on filter paper, and stored at�70°C. BBMV were prepared from thawed whole larvae. Thawed larvae werehomogenized in 10 mM HEPES (pH 7.5)–250 mM sucrose containing CompleteEDTA-free protease inhibitor (Roche). After separation by sucrose gradientcentrifugation (0 to 45% [wt/vol] sucrose), the BBMV were washed once in 10mM HEPES (pH 7.5), resuspended in 10 mM HEPES (pH 7.5)–CompleteEDTA-free protease inhibitor, and stored at 0°C overnight.

BBMV permeation assay. BBMV were diluted to 0.2 mg/ml in 10 mM HEPES,pH 7.5, at room temperature (22°C), at least 30 min prior to being used in theBBMV permeation assay. BBMV permeation was measured by a Hi-Tech SF-61stopped-flow spectrophotometer (Hi-Tech Scientific, Salisbury, United King-dom). Right-angle, light-scattering intensity was measured at 488 nm. Assayswere initiated by mixing the BBMV with an equal volume of 150 mM KCl in 10mM HEPES (pH 7.5) containing toxin. Experiments were repeated by mixing the

TABLE 1. Sequences of primers used in site-directed mutagenesis

Primera Sequence (5�33�) Mutant

Fw4BR203A GGTCTTTAGCAGCTAGTGCTGGTGACC 4BRARe4BR203A GGTCACCAGCACTAGCTGCTAAAGACC

Fw4BL1QTT ACCAATACTCAAACTACAGATTTAAGATTTTTATC 4BL1QTTRe4BL1QTT TCTTAAATCTGAAGTTTGAGTATTGGTCCAGAAATC

Fw4BL2NDY CTAATCGAGTTAATGATTATACAAAAATGGATTTC 4BL2NDYRe4BL2NDY CATTTTTGTATAATCATTAACTCGATTAGAGGGTATTC

Fw4BL3PAT GATGTTATACCTGCGACTTATAACAGTAACAGGGTTTC 4BL3PATRe4BL3PAT CTGTTATAAGTCGCAGGTATAACATCAGTTTTTATATAG

Fw4BL3AAT GATGTTATAGCTGCGACTTATAACAGTAACAGGGTTTC 4BL3AATRe4BL3AAT CTGTTATAAGTCGCAGCTATAACATCAGTTTTTATATAG

Fw4BL3GAT GATGTTATAGGTGCGACTTATAACAGTAACAGGGTTTC 4BL3GATRe4BL3GAT CTGTTATAAGTCGCACCTATAACATCAGTTTTTATATAG

Fw4BL3GAV GATGTTATAGGTGCGGTTTATAACAGTAACAGGGTTTC 4BL3GAVRe4BL3GAV CTGTTATAAAGCGCACCTATAACATCAGTTTTTATATAG

Fw4BL3PAA GATGTTATACCTGCGGCTTATAACAGTAACAGGGTTTC 4BL3PAARe4BL3PAA CTGTTATAAGTCGCAGGTATAACATCAGTTTTTATATAG

Fw4BL3AAA GATGTTATAGCTGCGGCTTATAACAGTAACAGGGTTTC 4BL3AAARe4BL3AAA CTGTTATAAGCCGCAGCTATAACATCAGTTTTTATATAG

a The sets of complementary primers for creating the mutants are grouped together.

VOL. 69, 2003 INTRODUCING CULEX ACTIVITY INTO Cry4Ba 5345


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

BBMV either with 150 mM KCl in 10 mM HEPES (pH 7.5) or with 10 mMHEPES (pH 7.5) alone.

Biotinylation of Cry toxins. Purified toxin was incubated with N-hydroxysuc-cinimide–biotin (Pierce) at a ratio of 50:1 (biotin to protein) for 1.5 h at roomtemperature. Free biotin was removed by dialysis against 20 mM Na2CO3 (pH9.2)–200 mM NaCl for 2 h at 4°C. Protein concentration was determined by theBio-Rad protein assay with BSA as a standard.

Precipitation of C. quinquefasciatus BBMV proteins. BBMV proteins wereprecipitated using the Plus-One 2-D Clean-Up kit (Amersham) according to themanufacturer’s instructions. Resulting pellets were resuspended in 5 M urea–2 Mthiourea–2% CHAPS {3-[(3-cholamidopropyl)-dimethylammonio]-1-propane-sulfonate}–2% SB3 to 10 (Sigma). The protein concentration was determinedusing the Plus-One 2-D Quant kit (Amersham).

Ligand blots of 4BRA and 4BL3PAT on C. quinquefasciatus BBMV proteins.BBMV and precipitated BBMV proteins separated by sodium dodecyl sulfate–10% polyacrylamide gel electrophoresis were transferred to polyvinylidene di-fluoride membranes by the method of Towbin et al. (47). Blots were blocked with5% BSA in TBST (1� Tris-buffered saline, 0.1% Tween 20) for 2 h followed byincubation with 5 nM biotinylated toxin overnight at 4°C. Blots were washed withthree changes of TBST for 20 min each. Washed blots were incubated with a1:250,000 dilution of a monoclonal antibody to biotin conjugated to horseradishperoxidase for 1 h at room temperature. After another set of washes, blots weredeveloped with ECL� (Amersham).

RESULTS

Structural analysis. Expression of Cry4Ba protoxins in E.coli and subsequent digestion by trypsin are a presumptive testof global folding fidelity (1). All of the Cry4Ba mutant proteinsconstructed in this study were stable to trypsin digestion (datanot shown). The CD spectra of the Cry4Ba activated toxinmutants indicated that there was no global or significant per-turbation in the secondary structure of the toxins due to themutations (Fig. 2). The CD spectrum of wild-type Cry4Ba wasof interest because it was nicked by trypsin at the positionbetween R203 and S204 (determined by N-terminal amino acidsequencing results), and yet it was similar to 4BRA (the trypsinsite was removed) and other mutants based on 4BRA.

Mosquito bioassay of Cry4Ba and its muteins. Mutationsin the predicted loop regions of domain II affected toxici-

ties against the three genera of mosquito. Loop 1 of 4BRAwas mutated to mimic loop 1 of Cry4Aa, 331IYQ333 to QTT(4BL1QTT). This caused the toxin to lose activity againstA. aegypti and A. quadrimaculatus with activity against C.quinquefasciatus remaining nil (Table 2). The mutation inloop 2, where NDY was inserted between V393 and T394(4BL2NDY), also caused the toxin to lose activity against A.aegypti and A. quadrimaculatus, with activity against C. quin-quefasciatus remaining nil (Table 2). In contrast, the mutationin loop 3, where D454 was replaced with P and AT was in-serted after position 454, caused the toxin to gain activity morethan 219-fold against C. quinquefasciatus and C. pipiens, rela-tive to 4BRA, while still maintaining activity against both Aedesand Anopheles (Table 2). In further mutations in loop 3, D454was replaced with G and AV was inserted after position 454(4BL3GAV), modeled after the loop 3 sequence of Cry1Aa.The toxicities of 4BL3GAV and 4BL3GAT against C. quinque-fasciatus showed more than 700-fold increases relative to4BRA and 2-fold increases over 4BL2PAT (Table 2). Thesame effect was not observed against C. pipiens, as 4BL3GAVwas as toxic as 4BL3PAT and 4BL3GAT was twofold less toxicthan 4BL3PAT to this mosquito (Table 2).

Other mutations in loop 3 caused variable toxicities againstthe different species of mosquitoes used in this study (Table 2).When P454 in the 4BL3PAT construct was mutated to A(4BL3AAT), toxicity against A. quadrimaculatus improved 2.8-fold over that of 4BL3PAT. The same mutation did not sig-nificantly alter its toxicity towards A. aegypti, but it also reducedits toxicity against the two Culex species. When P454 was mu-tated to G (4BL3GAT), activities against A. quadrimaculatusand C. pipiens were reduced twofold, while the activity againstA. aegypti was not significantly different. Mutation of T456, inthe 4BL3PAT background, to A (4BL3PAA) reduced toxicityagainst A. quadrimaculatus, A. aegypti, and C. pipiens. How-ever, when both P454 and T456 were mutated to A’s to yield

FIG. 2. CD spectra of purified toxins of Cry4Ba and its mutants.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4BL3AAA, the activity of the mutant against A. quadrimacu-latus was twofold more toxic than that of 4BL3PAT and theactivity against Culex species was lost, while activity against A.aegypti was not significantly different from that of 4BL3PAT.

Mutation of R203 to A in the loop area between two alpha-helices to remove a trypsin site did not significantly improvetoxicities against A. aegypti or A. quadrimaculatus in theCry4Ba background. However, when the trypsin site was notremoved in the 4BwtGAV construct, it caused a significantreduction in the activity against both Aedes and Anophelescompared to that of 4BL3GAV.

Binding assays. Saturation binding of 4BL3PAT and 4BRAwas conducted in the presence of a 250-fold excess of homol-ogous and heterologous toxin to determine specific binding ofthese toxins to C. quinquefasciatus BBMV. The binding curvesindicated a sigmoid response for both toxins, and 4BL3PATshowed slightly better binding than 4BRA did (Fig. 3).

Heterologous competition between labeled 4BRA toxin and4BL3PAT toxin for binding to C. quinquefasciatus BBMV wasconducted, with homologous binding of 4BRA to itself as acomparison (Fig. 4A). The results indicated that there was aslightly better competition of 4BL3PAT for the 4BRA binding

FIG. 3. Specific saturation binding of 4BL3PAT and 4BRA to C. quinquefasciatus BBMV.

TABLE 2. Bioassay results for four species of mosquitoes

ToxinLC50 (ng/ml)a

A. quadrimaculatus A. aegypti C. quinquefasciatus C. pipiens

Cry4Aa ND 600 (1,300–2,000)b 980 (680–1,490)c 400 (300–500)b

Cry4Ba 25 (18–32) 61 (28–175) �80,000d �20,000g

4BwtGAV 745 (607–962) 174 (117–280) �20,000f ND4BRA 21 (15–29) 21 (5–51) �80,000e �20,000d

4BL1QTT �20,000d �20,000c �20,000d ND4BL2NDY �20,000d �20,000d �20,000d ND4BL3PAT 44 (40–50) 53 (19–91) 365 (267–529) 95 (69–130)4BL3AAT 16 (8–23) 68 (19–140) 1,035 (485–8,972) 229 (142–512)4BL3GAT 88 (64–119) 64 (39–94) 122 (75–189) 180 (117–317)4BL3GAV 52 (32–74) 44 (20–68) 114 (83–150) 70 (34–129)4BL3PAA 197 (136–328) 144 (75–277) 4,000 (1,948–14,838) 481 (44–988)4BL3AAA 23 (17–30) 82 (50–126) �20,000e 630 (306–11,328)

a Two-day-old larvae of A. aegypti, C. quinquefasciatus, and C. pipiens and 3-day-old larvae of A. quadrimaculatus were used for bioassays. Mortality was recorded after24 h of exposure to a serial dilution of the toxins. The 95% confidence limits are indicated in parentheses. Bioassays for the Cry4B constructs used purified inclusioncrystal protein produced in E. coli. ND, not determined. LC50, 50% lethal, concentration.

b Data from reference 14.c Data from reference 2.d 8% mortality was observed at this dose.e No mortality was observed.f 17% mortality was observed at this dose.g 8% mortality was observed at this dose.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

site on C. quinquefasciatus BBMV but not sufficient to explainthe more than 219-fold better toxicity. Likewise, there was alsono significant difference in the ability to irreversibly bind theBBMV for both 4BRA and 4BL3PAT (Fig. 4B).

Proteinase K protection assay. 4BRA and 4BL3PAT toxinswere partitioned into C. quinquefasciatus BBMV and subse-

quently digested with proteinase K. The total bound and pro-teinase K-protected toxins are shown in Fig. 5. More 4BRAthan 4BL3PAT was protected.

Pore formation measured by light scattering on mosquitoBBMV. Light-scattering assays were performed according tothe technique of Carroll and Ellar (9). 4BL3PAT and 4BRA

FIG. 4. (A) Homologous and heterologous competition binding assays. 125I-labeled 4BRA was incubated with C. quinquefasciatus BBMV withincreasing amounts of unlabeled toxin. (B) Irreversible binding studies. C. quinquefasciatus BBMV were preincubated with 125I-labeled toxin for1 h. Then binding was competed with excess cold toxin for different durations. Data shown are means of three binding experiments.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

were tested on C. quinquefasciatus BBMV. Our results (Fig. 6)indicate that 4BL3PAT has more pore-forming ability than4BRA does.

Ligand blots on C. quinquefasciatus BBMV proteins. Bothtoxins bound weakly to proteins in the range of 60 to 75 kDaand strongly to proteins at 18, 20, 25, and 30 kDa (Fig. 7, lanes2 and 4). 4BRA bound uniquely to a 50-kDa protein with

moderate intensity (lane 4), and 4BL3PAT bound uniquelyand intensely to two bands at 35 and 36 kDa (lane 2).

DISCUSSION

Cry4Ba toxin is active against Anopheles and Aedes but hasno measurable activity against Culex species (14) (Table 2). Weapplied present knowledge of the general location of receptor

FIG. 5. Proteinase K protection assay of 4BRA and 4BL3PAT. 125I-labeled toxin was incubated with C. quinquefasciatus BBMV for 1 h. Freeand noninserted toxin was digested with proteinase K, and the reaction was stopped with Pefabloc. BBMV-protected toxin was separated bycentrifugation, and the counts were measured.

FIG. 6. C. quinquefasciatus BBMV light-scattering assay. BBMV (0.2 mg/ml) were coinjected with different samples. All samples were in 10 mMHEPES buffer, pH 7.5. The samples were KCl (150 mM) (line 1), 4BRA (66 pmol of toxin/mg in 150 mM KCl) (line 2), 4BL3PAT (66 pmol oftoxin/mg in 150 mM KCl) (line 3), and HEPES buffer alone (line 4). Light scattering was measured using a stopped-flow apparatus at a 488-nmwavelength with the temperature controlled at 20°C. The curves were normalized to begin from the same point. The increasing intensity isindicative of reswelling of the vesicles. The data shown are averages of two experiments.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

binding epitopes on Cry toxins (22, 42) and have demonstratedthat certain mutants in domain II loop 3 of the Cry4Ba toxinspecifically increase mosquitocidal toxicity towards Culex spe-cies (Table 2). We also observed that mutations of loop 1 or 2of domain II reduced activity against Aedes and Anopheles,indicating a role for these loop residues in the mechanism ofaction of Aedes and Anopheles.

As was previously reported, wild-type Cry4Ba is cleaved bygut juice of C. pipiens into 18- and 46-kDa fragments (25).Similar results were obtained by trypsin digestion in this study.We observed that the 18- and 46-kDa fragments were associ-ated with each other by gel filtration chromatography (resultsnot shown), agreeing with the results of Yamagiwa et al. (54),and our secondary structural analysis by CD spectroscopy (Fig.2) showed that differences between the wild-type Cry4Ba andits mutants were insignificant. The blocking of the trypsin sitein domain I of Cry4Ba resulted in an increase in toxicity of4BRA relative to Cry4Ba of 2.9-fold, in agreement with pre-vious results (3), but our 95% confidence limit of the toxinsoverlapped, indicating that the increase in toxicity againstAnopheles or Aedes in this construct was not significant. How-ever, removal of the trypsin site yielded more pronouncedresults in comparing two mutants in the putative domain IIloop 3. 4BwtGAV, which retained the trypsin cleavage, was4.0-fold less toxic to Aedes, 14.3-fold less toxic to Anopheles,

and more than 175-fold less toxic to C. quinquefasciatus than4BL3GAV, which had the trypsin cleavage site removed (Ta-ble 2). Therefore, the removal of the trypsin site in this con-struct significantly improved the overall activity of the toxinstowards all species of mosquitoes tested.

Bioassays against four species of mosquitoes with the wild-type Cry4Ba toxin, 4BRA toxin, and the loop muteins areshown in Table 2. The data indicate that introducing threeresidues (PAT) from the putative loop 3 of Cry4Aa into 4BRAcaused more than a 219-fold increase in activity against Culex.Variation of this sequence caused variable effects on toxicity tothe mosquitoes tested. The 4BL3GAV mutant gave more thana 700-fold increase over 4BRA or wild-type Cry4Ba. While theremoval of the trypsin cleavage site aided toxicity against allgenera of mosquito, no Culex activity was observed unless theputative domain II loop 3 was modified by insertion and sub-stitution.

Mutations in putative loops 1 and 2 to introduce residuesfrom Cry4Aa significantly disrupted toxicity against bothAnopheles and Aedes but did not introduce activity againstCulex. The roles that the different loops played in the activityagainst the different mosquito species were not conclusive. Theactivity of the toxins seemed to rely on the interactions be-tween the different loops. The specific sequence in the putativeloop 3 was not critical for Culex toxicity, as the different com-binations of the PAT sequence, e.g., GAT, AAT, PAA, andAAA, all had a certain level of Culex toxicity. However, all thevariations in the putative loop 3 that were constructed involvedconservative mutations, as no charged residue was used. Theresults indicated that the putative loop 3 was particularly im-portant for Culex activity but also could affect Aedes andAnopheles activities. The putative loops 1 and 2 were criticalfor Aedes and Anopheles activities, but their function for Culexactivity is not clear. There remains a possibility that otherresidues could be substituted to optimize the mosquitocidalactivity of the toxin.

We explored the mechanistic basis of the improvement ofthe putative domain II loop 3 mutant 4BL3PAT by severalmethods. It had previously been shown that loop regions ofdomain II harbor receptor-binding epitopes in several insecti-cidal Cry toxins (23, 39, 41, 45, 53). It has also been shown thatsome mutations in loop regions do not affect initial receptorbinding, as measured by competition binding, but affect irre-versible binding, suggesting that they affect insertion of thetoxin into the membrane (39, 53).

We began our analysis of the 4BL3PAT mechanism of ac-tion by examining saturation binding. Saturation binding stud-ies of 4BRA and 4BL3PAT binding to Culex BBMV, with theuse of homologous and heterologous competing toxins to re-duce nonspecific binding, yielded sigmoid-shaped bindingcurves (Fig. 3), indicating cooperativity in binding. This has notbeen observed in previous studies of B. thuringiensis Lepidop-tera-active toxins binding to Lepidoptera BBMV (16, 28, 49).Nonlinear regression analysis (Table 3) shows tighter bindingof the toxic 4BL3PAT than of the nontoxic 4BRA. However,4BRA showed a higher concentration of maximum bindingsites (Bmax) than did 4BL3PAT, perhaps due to more positivecooperative binding as indicated by the higher Hill coefficientnumber for 4BRA. When nonspecific binding of 4BL3PAT wasblocked with 4BRA, both tight binding and higher Bmax were

FIG. 7. Ligand blot of biotin-labeled 4BRA (Cry4Ba) and4BL3PAT (Mutant) to C. quinquefasciatus BBMV. Ten micrograms ofBBMV proteins was separated by sodium dodecyl sulfate-polyacryl-amide gel electrophoresis, blotted onto a polyvinylidene difluoridemembrane, and probed with 5 nM biotinylated toxins. Arrows point tobands that are uniquely bound by 4BL3PAT. Lanes 1 and 3, BBMV;lanes 2 and 4, precipitated BBMV. Numbers between the panels aremolecular masses in kilodaltons.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

observed. Cooperativity could be explained in several ways.One possibility is that multiple binding sites exist for 4BRAand 4BL3PAT. The high-affinity sites are detected above back-ground first, and then the low-affinity sites are revealed asmore labeled toxin is added to the binding mixture. 4BRA doesnot displace the high-affinity 4BL3PAT binding. Another pos-sibility may be the oligomerization process as toxins associatewith the receptors in the “pre-pore” formation (17) or in themembrane.

Competition binding of 4BRA toxin and 4BL3PAT to C.quinquefasciatus BBMV indicated that there was little sig-nificant difference in the ability to reversibly bind C. quin-quefasciatus BBMV (Fig. 4A). Both saturation binding andcompetition suggest a model where 4BL3PAT binds to bothproductive binding proteins and more numerous nonproduc-tive sites, while 4BRA binds only to the nonproductive sites(Fig. 8).

Further experiments with irreversible binding assays indi-cated that there was also no significant difference in the abil-ities of the muteins and wild-type toxins to irreversibly bindBBMV (Fig. 4B). Indeed, more 4BRA than 4BL3PAT boundirreversibly, and both toxins continued to associate withBBMV with time rather than be chased off.

Irreversible binding is generally assumed to represent mem-brane insertion (21, 30, 37, 39, 50) and has been shown tocorrelate with toxicity. We therefore conducted proteinase Kstudies to determine if the bound toxins were susceptible to

exogenous proteinase. Figure 5 shows that relatively more4BRA than 4BL3PAT is protected. These results counter theexpectation that more of the active toxin would bind and beinserted into the membrane. Whether these toxins, 4BRA inparticular, are protected by insertion into the membrane or byassociation with BBMV proteins remains to be shown.

To examine the pore-forming ability of the active and inac-tive toxins, we conducted light-scattering assays on CulexBBMV according to the method of Carroll and Ellar (10),previously used for lepidopteran toxins. Our results (Fig. 6)indicate that 4BL3PAT has more pore-forming ability thandoes 4BRA, but the latter showed greater pore-forming abilitythan expected from its low toxicity.

In summary, we have demonstrated that relatively few aminoacid residue changes in domain II loop 3 of Cry4Ba can intro-duce a large increase in toxicity toward a genus of mosquitoagainst which it was not active. We have previously reviewedthe attempts to improve Cry toxins by rational design (13), butthe greater-than-750-fold increase in Culex activity for Cry4Bafar exceeds previous accomplishments. Surprisingly, our stud-ies of the mechanism of action of Cry4Ba indicate that more-active toxins do not bind to BBMV with more affinity than lessactive toxins, nor are they inserted to a greater extent. Weobserve that Cry4Ba and the trypsin-stable mutant form,4BRA, bind (Fig. 4A) and are inserted into (Fig. 4B and 5)Culex BBMV (or are somehow protected from proteinase K),as well as or better than 4BL3PAT but do not form very activepores in vitro (Fig. 6). Since the few amino acid residues thatwere introduced in domain II loop 3 resulted in a significantlymore active toxin, we must speculate on the role of theseresidues in the increased toxicity. A radical hypothesis wouldbe that these residues directly affect the pore-forming ability ofthe toxin. Another radical hypothesis for the enhanced toxin,4BL3PAT, would involve programmed cell death (apoptosis).Apoptosis has been observed to occur in B. thuringiensis subsp.israelensis endotoxin-treated A. aegypti cell cultures (11). OtherCry toxins seem to exert the same apoptotic effect on culturedmidgut cells of H. virescens (33, 34). These hypotheses are atvariance with the Lepidoptera paradigm of the mechanism ofaction of Cry toxins, which describes the loops of domain II asreceptor-binding epitopes. The more parsimonious hypothesis(and one more in keeping with the Lepidoptera paradigm) isthat the residue changes in domain II loop 3 allow 4BL3PATto a bind to a “functional” receptor (one that leads to properinsertion and activity), as illustrated in Fig. 8. This model issupported by the ligand blots that show that both 4BRA and4BL3PAT bind to a series of proteins, while 4BL3PAT bindsuniquely to two proteins of 35 and 36 kDa (Fig. 7). The modelis also supported by the specific saturation binding studies,where 4BRA was used to compete for binding of 4BL3PAT(Fig. 3). Further experiments will be conducted to resolve thisparadox.

ACKNOWLEDGMENTS

We thank A. Curtiss, F. Ahmed, and K. Nzinga for technical assis-tance. Special thanks go to A. Valaitis for amino acid sequencing.

This work was supported by an NIH grant to D. H. Dean and M. J.Adang (grant no. R01 AI 29092).

FIG. 8. Model for binding of toxic 4BL3PAT to productive bindingsites (gray) and nonproductive binding sites (white). Nontoxic protein4BRA binds only to the nonproductive binding sites. The nonproduc-tive binding sites are more numerous.

TABLE 3. Nonlinear regression of the binding curvesto a Hill equationa

Toxin Bmax (fmol/�g) K�D (nM) Hill coefficient

4BRA 13.1 0.5 6.9 2.7 4.8 0.84BL3PAT 9.3 0.4 0.9 0.2 2.8 0.54BL3PAT* 18.3 1.6 2.6 0.5 2.3 0.4

a Each binding condition was conducted with 250 M excess homologous toxinadded to reduce nonspecific binding, with the exception that 4BL3PAT* wasconducted with 250 M excess 4BRA.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

REFERENCES

1. Almond, B. D., and D. H. Dean. 1993. Structural stability of Bacillus thurin-giensis -endotoxin homolog-scanning mutants determined by susceptibilityto proteases. Appl. Environ. Microbiol. 59:2442–2448.

2. Angsuthanasombat, C., N. Crickmore, and D. J. Ellar. 1992. Comparison ofBacillus thuringiensis subsp. israelensis CryIVA and CryIVB cloned toxinsreveals synergism in vivo. FEMS Microbiol. Lett. 94:63–68.

3. Angsuthanasombat, C., N. Crickmore, and D. J. Ellar. 1993. Effects ontoxicity of eliminating a cleavage site in a predicted interhelical loop inBacillus thuringiensis CryIVB delta endotoxin. FEMS Microbiol. Lett. 111:255–261.

4. Bar, E., J. Lieman-Hurwitz, E. Rahamim, A. Keynan, and N. Sandler. 1991.Cloning and expression of Bacillus thuringiensis israelensis -endotoxin in B.sphaericus. J. Invertebr. Pathol. 57:149–158.

5. Becker, N., and J. Margalit. 1993. Use of Bacillus thuringiensis israelensisagainst mosquitoes and blackflies, p. 145–170. In P. F. Entwistle, P. F. Cory,M. J. Bailey, and S. Higgs (ed.), Bacillus thuringiensis, an environmentalbiopesticide: theory and practice. John Wiley & Sons, Inc., New York, N.Y.

6. Berry, C., J. Hindley, A. F. Ehrhardt, T. Grounds, I. deSouza, and E. W.Davidson. 1993. Genetic determinants of host ranges of Bacillus sphaericusmosquito larvicidal toxins. J. Bacteriol. 175:510–518.

7. Bourgouin, C., A. Delecluse, F. De la Torre, and J. Szulmajster. 1990.Transfer of the toxin protein genes of Bacillus sphaericus into Bacillus thur-ingiensis subsp. israelensis and their expression. Appl. Environ. Microbiol.56:340–344.

8. Caramori, T., A. M. Albertini, and A. Galizzi. 1991. In vivo generation ofhybrids between two Bacillus thuringiensis insect-toxin-encoding genes. Gene98:37–44.

9. Carroll, J., and D. J. Ellar. 1993. An analysis of Bacillus thuringiensis -en-dotoxin action on insect-midgut-membrane permeability using a light-scat-tering assay. Eur. J. Biochem. 214:771–778.

10. Carroll, J., and D. J. Ellar. 1997. Analysis of the large aqueous poresproduced by a Bacillus thuringiensis protein insecticide in Manduca sextamidgut-brush-border-membrane vesicles. Eur. J. Biochem. 245:797–804.

11. Charles, J.-F. 1983. Action of the delta-endotoxin of Bacillus thuringiensisvar. israelensis on cultured cells from Aedes aegypti L. Ann. Microbiol. (Paris)134A:365–381.

12. Dean, D. H., F. Rajamohan, M. K. Lee, S.-J. Wu, X.-J. Chen, E. Alcantara,and S. R. Hussain. 1996. Probing the mechanism of action of Bacillusthuringiensis insecticidal proteins by site-directed mutagenesis. Gene 179:111–117.

13. Dean, D. H., T. H. You, F. Rajamohan, M. K. Lee, J. L. Jenkins, M. Audtho,S.-J. Wu, and X. Liu. 2002. Rational design of Cry toxins, p. 112–117. In R. J.Akhurst, C. E. Beard, and P. Hughes (ed.), Biotechnology of Bacillus thur-ingiensis and its environmental impact. Proceedings of the 4th Pacific RimConference. Scribbly Gum Publications, Canberra, Australia.

14. Delecluse, A., S. Poncet, A. Klier, and G. Rapoport. 1993. Expression ofcryIVA and cryIVB genes, independently or in combination, in a crystal-negative strain of Bacillus thuringiensis subsp. israelensis. Appl. Environ.Microbiol. 59:3922–3927.

15. Erlanger, B. E., N. Kokowsky, and W. Cohen. 1961. The preparation andproperties of two new chromogenic substrates of trypsin. Biochem. Biophys.95:271–278.

16. Estada, U., and J. Ferre. 1994. Binding of insecticidal crystal proteins ofBacillus thuringiensis to the midgut brush border of the cabbage looper,Trichoplusia ni (Hubner) (Lepidoptera: Noctuidae), and selection for resis-tance to one of the crystal proteins. Appl. Environ. Microbiol. 60:3840–3846.

17. Gomez, I., J. Sanchez, R. Miranda, A. Bravo, and M. Soberon. 2002. Cad-herin-like receptor binding facilitates proteolytic cleavage of helix �-1 indomain I and oligomer pre-pore formation of Bacillus thuringiensis Cry1Abtoxin. FEBS Lett. 513:242–246.

18. Guex, N., and M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis18:2714–2723.

19. Hofmann, C., and P. Luthy. 1986. Binding and activity of Bacillus thuringien-sis delta-endotoxin to invertebrate cells. Arch. Microbiol. 146:7–11.

20. Hofmann, C., P. Luthy, R. Hutter, and V. Pliska. 1988. Binding of thedelta-endotoxin from Bacillus thuringiensis to brush-border membrane vesi-cles of the cabbage butterfly (Pieris brassicae). Eur. J. Biochem. 173:85–91.

21. Ihara, H., E. Kuroda, A. Wadano, and M. Himeno. 1993. Specific toxicity of-endotoxins from Bacillus thuringiensis to Bombyx mori. Biosci. Biotechnol.Biochem. 57:200–204.

22. Jenkins, J. L., and D. H. Dean. 2000. Exploring the mechanism of action ofinsecticidal proteins by genetic engineering methods, p. 33–54. In J. K.Setlow (ed.), Genetic engineering: principles and methods, vol. 22. PlenumPress, New York, N.Y.

23. Jenkins, J. L., M. K. Lee, A. P. Valaitis, A. Curtiss, and D. H. Dean. 2000.Bivalent sequential binding model of a Bacillus thuringiensis toxin to gypsymoth aminopeptidase N receptor. J. Biol. Chem. 275:14423–14431.

24. Khampang, P., W. Chungjatupornchai, P. Luxanamil, and S. Panyim. 1999.Efficient expression of mosquito-larvicidal proteins in a gram-negative bac-

terium capable of recolonization in the guts of Anopheles dirus larva. Appl.Microbiol. Biotechnol. 51:79–84.

25. Komano, T., M. Yamagiwa, T. Nishimoto, H. Yoshisue, K. Tanabe, K. Sen,and H. Sakai. 1998. Activation process of the insecticidal proteins CryIVAand CryIVB produced by Bacillus thuringiensis subsp. israelensis. Isr. J. En-tomol. 32:185–198.

26. Lecadet, M. M., J. Chaufaux, J. Ribier, and D. Lereclus. 1992. Constructionof novel Bacillus thuringiensis strains with different insecticidal activities bytransduction and transformation. Appl. Environ. Microbiol. 58:840–849.

27. Lee, M. K., A. Curtiss, E. Alcantara, and D. H. Dean. 1996. Synergistic effectof the Bacillus thuringiensis toxins CryIAa and CryIAc on the gypsy moth,Lymantria dispar. Appl. Environ. Microbiol. 62:583–586.

28. Lee, M. K., R. E. Milne, A. Z. Ge, and D. H. Dean. 1992. Location of aBombyx mori receptor binding region on a Bacillus thuringiensis -endotoxin.J. Biol. Chem. 267:3115–3121.

29. Li, J., J. Carroll, and D. J. Ellar. 1991. Crystal structure of insecticidal-endotoxin from Bacillus thuringiensis at 2.5 A resolution. Nature 353:815–821.

30. Liang, Y., S. S. Patel, and D. H. Dean. 1995. Irreversible binding kinetics ofBacillus thuringiensis CryIA -endotoxins to gypsy moth brush border mem-brane vesicles is directly correlated to toxicity. J. Biol. Chem. 270:24719–24724.

31. Liu, J. W., W. H. Yap, T. Thanabalu, and A. G. Porter. 1996. Efficientsynthesis of mosquitocidal toxins in Asticcacaulis excentricus demonstratespotential of gram-negative bacteria in mosquito control. Nat. Biotechnol.14:343–347.

32. Lluisma, A. O., N. Karmacharya, A. Zarka, E. Ben-Dov, A. Zaritsky, and S.Boussiba. 2001. Suitability of Anabaena PCC7120 expressing mosquitocidaltoxin genes from Bacillus thuringiensis subsp. israelensis for biotechnologicalapplication. Appl. Microbiol. Biotechnol. 57:161–166.

33. Loeb, M. J., R. S. Hakim, P. Martin, N. Narang, S. Goto, and M. Takeda.2000. Apoptosis in cultured midgut cells from Heliothis virescens larvaeexposed to various conditions. Arch. Insect Biochem. Physiol. 45:12–23.

34. Loeb, M. J., P. A. W. Martin, R. S. Hakim, S. Goto, and M. Takeda. 2001.Regeneration of cultured midgut cells after exposure to sublethal doses oftoxin from two strains of Bacillus thuringiensis. J. Insect Physiol. 47:599–606.

35. Peitsch, M. C. 1996. ProMod and Swiss-Model: internet-based tools forautomated comparative protein modelling. Biochem. Soc. Trans. 24:274–279.

36. Poncet, S., C. Bernard, E. Dervyn, J. Cayley, A. Klier, and G. Rapoport.1997. Improvement of Bacillus sphaericus toxicity against dipteran larvae byintegration, via homologous recombination, of the Cry11A toxin gene fromBacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 63:4413–4420.

37. Rajamohan, F., E. Alcantara, M. K. Lee, X. J. Chen, A. Curtiss, and D. H.Dean. 1995. Single amino acid changes in domain II of Bacillus thuringiensisCryIAb -endotoxin affect irreversible binding to Manduca sexta midgutmembrane vesicles. J. Bacteriol. 177:2276–2282.

38. Rajamohan, F., O. Alzate, J. A. Cotrill, A. Curtiss, and D. H. Dean. 1996.Protein engineering of Bacillus thuringiensis -endotoxin: mutations at do-main II of Cry1Ab enhance receptor affinity and toxicity towards gypsy mothlarvae. Proc. Natl. Acad. Sci. USA 93:14338–14343.

39. Rajamohan, F., J. A. Cotrill, F. Gould, and D. H. Dean. 1996. Role of domainII, loop 2 residues of Bacillus thuringiensis CryIAb -endotoxin in reversibleand irreversible binding to Manduca sexta and Heliothis virescens. J. Biol.Chem. 271:2390–2397.

40. Rajamohan, F., and D. H. Dean. 1996. Molecular biology of bacteria onbiological control of insects, p. 105–122. In M. Gunasekaran and D. J. Weber(ed.), Molecular biology of the biological control of pests and diseases ofplants. CRC Press, Inc., Boca Raton, Fla.

41. Rajamohan, F., S.-R. A. Hussain, J. A. Cotrill, F. Gould, and D. H. Dean.1996. Mutations at domain II, loop 3, of Bacillus thuringiensis CryIAa andCryIAb -endotoxins suggest loop 3 is involved in initial binding to lepidop-teran midguts. J. Biol. Chem. 271:25220–25226.

42. Rajamohan, F., M. K. Lee, and D. H. Dean. 1998. Bacillus thuringiensisinsecticidal proteins: molecular mode of action. Prog. Nucleic Acids Res.Mol. Biol. 60:1–27.

43. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

44. Schnepf, E., N. Crickmore, J. VanRie, D. Lereclus, J. Baum, J. Feitelson,D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidalcrystal proteins. Microbiol. Mol. Biol. Rev. 62:775–806.

45. Smedley, D. P., and D. J. Ellar. 1996. Mutagenesis of three surface-exposedloops of a Bacillus thuringiensis insecticidal toxin reveals residues importantfor toxicity, receptor recognition and possibly membrane insertion. Micro-biology 142:1617–1624.

46. Thanabalu, T., J. Hindley, S. Brenner, C. Oei, and C. Berry. 1992. Expres-sion of the mosquitocidal toxins of Bacillus sphaericus and Bacillus thurin-giensis subsp. israelensis by recombinant Caulobacter crescentus, a vehicle forbiological control of aquatic insect larvae. Appl. Environ. Microbiol. 58:905–910.

47. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

proteins from polyacrylamide gels to nitrocellulose sheets: procedure andsome applications. Proc. Natl. Acad. Sci. USA 76:4350–4354.

48. Van Frankenhuyzen, K. 1993. The challenge of Bacillus thuringiensis, p. 1–35.In P. F. Entwistle, J. S. Cory, M. J. Bailey, and S. Higgs (ed.), Bacillusthuringiensis, an environmental biopesticide: theory and practice. John Wiley& Sons, Inc., New York, N.Y.

49. Van Rie, J., S. Jansens, H. Hofte, D. Degheele, and H. Van Mellaert. 1990.Receptors on the brush border membrane of the insect midgut as determi-nants of the specificity of Bacillus thuringiensis delta-endotoxins. Appl. En-viron. Microbiol. 56:1378–1385.

50. Van Rie, J., S. Jansens, H. Hofte, D. Degheele, and H. Van Mellaert. 1989.Specificity of Bacillus thuringiensis -endotoxin: importance of specific recep-tors on the brush border membrane of the mid-gut of target insects. Eur.J. Biochem. 186:239–247.

51. Ward, M. G. 1984. Formulation of biological insecticides: surfactant anddiluent selection. ACS Symp. Ser. 254:175–184.

52. Wolfersberger, M. G. 1990. The toxicity of two Bacillus thuringiensis -en-dotoxins to gypsy moth larvae is inversely related to the affinity of bindingsites on midgut brush border membranes for the toxins. Experientia 46:475–477.

53. Wu, S.-J., and D. H. Dean. 1996. Functional significance of loops in thereceptor binding domain of Bacillus thuringiensis CryIIIA -endotoxin. J.Mol. Biol. 255:628–640.

54. Yamagiwa, M., M. Esaki, K. Otake, M. Inagaki, T. Komano, T. Amachi, andH. Sakai. 1999. Activation process of dipteran-specific insecticidal proteinproduced by Bacillus thuringiensis subsp. israelensis. Appl. Environ. Micro-biol. 65:3464–3469.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Documents

Introduction of Culex Toxicity into Bacillus thuringiensis Cry4Ba by Protein Engineering