P

Ip

ACa

b

c

d

a

ARRAA

KMEEBDD

1

itb[[ad2dia[m

mrf

0d

ARTICLE IN PRESSG ModelOWER-11745; No. of Pages 8

Journal of Power Sources xxx (2009) xxx–xxx

Contents lists available at ScienceDirect

Journal of Power Sources

journa l homepage: www.e lsev ier .com/ locate / jpowsour

ntegrating engineering design improvements with exoelectrogen enrichmentrocess to increase power output from microbial fuel cells�

bhijeet P. Borolea,∗, Choo Y. Hamiltonb, Tatiana A. Vishnivetskayaa, David Leakc,alin Andrasc, Jennifer Morrell-Falveya, Martin Kellera,d, Brian Davisond

BioSciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6226, United StatesThe University of Tennessee, Knoxville, TN 37996, United StatesImperial College, London, UKBioEnergy Science Center, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6226, United States

r t i c l e i n f o

rticle history:eceived 9 January 2009eceived in revised form 2 February 2009ccepted 3 February 2009vailable online xxx

a b s t r a c t

Microbial fuel cells (MFC) hold promise as a green technology for bioenergy production. The challengeis to improve the engineering design while exploiting the ability of microbes to generate and transferelectrons directly to electrodes. A strategy using a combination of improved anode design and an enrich-ment process was formulated to improve power densities. The design was based on a flow-through anodewith minimal dead volume and a high electrode surface area per unit volume. The strategy focused onpromoting biofilm formation via a combination of forced flow through the anode, carbon limitation, and

eywords:icrobial fuel cell

nrichmentxoelectrogeniciofilm-formingirect electron transfer

step-wise reduction of external resistance. The enrichment process resulted in development of exoelec-trogenic biofilm communities dominated by Anaeromusa spp. This is the first report identifying organismsfrom the Veillonellaceae family in MFCs. The power density of the resulting MFC using a ferricyanide cath-ode reached 300 W m−3 net anode volume (3220 mW m−2), which is about a third of what is estimatedto be necessary for commercial consideration. The operational stability of the MFC using high specific

as de

iversity surface area electrodes w

. Introduction

Energy from wastes and renewables is becoming increasinglymportant as fossil energy increases in cost and environmen-al impact. Microbial fuel cells produce energy directly fromiodegradable matter such as sugars, organic acids and biomass1,2]. The maximum power density reported for air-cathode MFCs3,4] is on the order of 100 W m−3, while those using ferricyanide ascatholyte [5] is on the order of 250 W m−3. The maximum powerensity reported on the basis of projected surface area is about700 mW m−2 [6]. Most of the MFC power density improvements toate are due to improvements in system design parameters. These

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

nclude electrode spacing [1,7,8], type of membrane separating thenode and the cathode [9–11], relative areas of the two electrodes11] and their surface properties [12] related to microbial attach-

ent and electron transfer. The ratio of the electrode surface area to

� The submitted manuscript has been authored by a contractor of the U.S. Govern-ent under Contract No. DE-AC05-00OR22725. Accordingly, the U.S. Government

etains a nonexclusive, royalty-free license to publish or reproduce the publishedorm of this contribution, or allow others to do so, for U.S. Government purposes.∗ Corresponding author. Fax: +1 865 574 6442.

E-mail address: borolea@ornl.gov (A.P. Borole).

378-7753/$ – see front matter. Published by Elsevier B.V.oi:10.1016/j.jpowsour.2009.02.006

monstrated by operating the MFC for a period of over four months.Published by Elsevier B.V.

the volume of anode chamber occupied has also been investigated[13]. Maximization of this ratio can result in higher power densitiesas shown with Shewanella biocatalyst [13]; however reports on useof such a design to carry out and characterize the exoelectrogenicenrichments are rare [5]. Logan et al. used a graphite fiber brushanode [3] and Aelterman et al. used a graphite granule-based anode[5] minimizing dead volume, which resulted in power densities upto 258 W m−3 or 2600 mW m−2.

The dependence of the power output upon the biology or typeof microorganisms is poorly understood [14,15]. The operatingparameters known to affect the enrichment of exoelectrogenicorganisms and the ability to achieve high rates of electricity pro-duction include mode of operation, flow rate, substrate loadingand external resistance [16–18]. The circulation of anode liquid(non-continuous vs. continuous flow) dictates whether communi-ties with direct electron-transport or mediated electron transportmechanism inhabit the anode electrode. A non-continuous systemis typically enriched with mediator-producing organisms such asPseudomonas aeruginosa [16] with accumulation of pyocyanin. The

009), doi:10.1016/j.jpowsour.2009.02.006

use of continuous flow systems have potential to enrich microbialcommunities not relying on mediators. Mediator-based organismsmay remain within the electrode even in continuous flow sys-tems depending their affinity to the electrode. Further study isneeded to understand the effect of the liquid flow rate on the

INP

2 Power

eopuaiwrcobbt

apcbeiflstflapptdio

2

2

d#sc1

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

nrichment of mediator-based vs. direct electron transfer-basedrganisms. The substrate loading is another important operatingarameter, although studies showing its effect on microbial pop-lation are rare. In fed-batch systems, where the carbon source isdded periodically, a substantial excess of the carbon source existsnitially. This promotes growth of non-exoelectrogenic organisms

hich convert the available carbon to other byproducts. The appliedesistance (load) or poised voltage also affects the enrichment pro-ess [17,18]. Improvements in MFCs are possible via incorporationf the existing knowledge about the system design parameters andy exploring less-studied parameters. Investigations which com-ine efficient MFC designs with use of effective operational regimeso enrich exoelectrogens will result in further improvements.

In this work we report systematic changes to the anode designnd the operating parameters that targeted improved MFC anodeerformance and power density. Previously reported MFC designhanges that have been known to improve power density were com-ined to develop a new design. These included use of high anodelectrode surface area [3,11] combined with minimal dead volumen the anode, reducing electrode spacing, essentially to zero, use of aow-through design for the anode electrode [5,8], similar projectedurface areas for anode and cathode and use of a hydrophilic elec-rode surface. Operating parameters including use of continuousow [19], reduction of external resistance [20], control of oxygenvailability in the anode, which have been reported to improveower output, were also implemented to exert the desired selectionressure. In addition, a forced flow-through anode was used to fur-her enhance exoelectrogenic growth. The improvements in powerensity and the composition of exoelectrogenic community result-

ng from this unique integrated design and the use of multi-modeperation are reported.

. Methods

.1. MFC construction

The MFC used in this study consisted of an anode chamber (4 cm

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

iameter × 1.27 cm thickness) containing carbon felt (Alfa Aesar,42107) as the electrode material (0.6 m2 g−1, estimated specificurface area 45,350 m2 m−3 of anode volume) and a platinum-oated carbon cathode (Pt/C air-cathode, Fuel cell store, #GDE HT40W-E) separated by a Nafion-115 membrane (Fig. 1A). The carbon

Fig. 1. (A) Schematic of the MFC recirculation set up wi

PRESSSources xxx (2009) xxx–xxx

felt was made hydrophilic using a plasma treatment for 20 min [21].The electrode material completely filled the anode chamber leavingno dead volume. The MFC anode chamber was made up of a pieceof 4 cm diameter PVC pipe. The anode, membrane and the cathodewere bolted together within two Lexan end plates. The liquid flowthrough the anode was directed upwards through the carbon felt.A gold wire was used as a current collector for the air-cathode anda graphite rod was used for the anode. The Pt/C air-cathode wasused during biocatalyst enrichment (Fig. 1A), while a ferricyanide-cathode was used for determining the maximum power density.Use of air-cathode over long periods resulted in accumulation ofsalts on the cathode side (due to osmotic pressure), which werewashed off with water once a month. The cathode was changed inan anaerobic chamber to minimize exposure to oxygen. The elec-trode for the ferricyanide-cathode was also made using a pipe (4 cmdiameter × 2.54 cm thick) with carbon felt as the electrode material(2.54 cm × 2.54 cm × 0.625 cm). The felt was suspended by a carbonrod in a way that the felt surface was in firm contact with the Nafionmembrane. The cathode chamber for the ferricyanide-cathode wassparged with air to mix the contents. The anode projected sur-face area for the system was 12.56 cm2 and the anode volume was15.96 cm3. A picture of the ferricyanide-cathode MFC is shown inFig. 1B.

2.2. Inoculation and operation

The nutrient medium (Medium AC-1) used for enrichment con-sisted of 975 ml of a sterile salts solution and 12.5 ml each of filtersterilized Wolfe’s mineral solution and vitamin solution [22]. Thesterile salts solution was made up of 0.31 g NH4Cl, 0.13 g KCl, 4.97 gNaH2PO4·H2O, and 2.75 g Na2HPO4·H2O per liter of nanopure water[23], and was adjusted to pH 7.0 with 1N NaOH prior to steriliza-tion. The nutrient medium AC-1 (200 ml) was placed in a glassbottle reservoir (anode liquid reservoir) and recirculated throughthe anode chamber at 4–7 ml min−1 (Fig. 1A). The medium wasdeaerated with nitrogen at a flow rate of 5 ml min−1 or higher.The MFCs were maintained at 30 ± 1 ◦C, during the course of the

009), doi:10.1016/j.jpowsour.2009.02.006

experiment. The MFC components were immersed in water andautoclaved individually and then assembled in a sterile hood.

The anode chamber of the MFC was inoculated with a 1 mlsample of anaerobic digester slurry collected from the Knoxvillemunicipal wastewater treatment plant. The inoculum was added

th an air-cathode and (B) photograph of the MFC.

INP

Power

dtiwemttmccq6cbwvb

wtocsIwtt

2

t(acTFttMtctofimsoe

aaappaco

2

iw

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

irectly into the flow line entering the anode chamber, carried intohe anode chamber by the deaerated recirculating medium. Dur-ng the enrichment process, the recirculating medium was replaced

hen the OD600 increased above 0.05 units. This was approximatelyvery 3 days. Beginning on day 64, 48 ml of fresh deaerated nutrientedium (3× of the anode volume) was also used to flush out plank-

onic bacteria from the anode chamber using forced flow throughhe chamber. A syringe was used to pull freshly added nutrient

edium (after deaeration via nitrogen sparging) through the anodehamber to remove mediators and organisms from the pores of thearbon felt. The flushing procedure was carried out at the same fre-uency as that of the anode medium replacement, beginning day4 for the rest of the enrichment period. The recirculating mediumonsisted planktonic bacteria either growing in the anode cham-er of the MFC or in the reservoir itself. The enrichment processas targeted to obtain exoelectrogenic biofilm-forming organisms

ia removal of free-floating cells and any mediators and mediator-ased organisms growing in the MFCs.

The enrichment was conducted in three different modes. Mode Ias essentially a growth mode, in which the consortia was allowed

o grow at a constant load using a given carbon source, but usingnly the electrode as the electron acceptor. Mode II consisted of aarbon starvation mode, in which the carbon source addition wastopped to enable consumption of carbon source added in mode I.n mode III, the carbon source was restored and the external loadas reduced in a step-wise manner from 500 to 250 � (day 119) and

hen to 100 � (day 130), to allow higher current to flow betweenhe electrodes.

.3. Enrichment of the MFC anode biocatalyst

During the start-up of the MFC, a mixed carbon source con-aining 0.2 g l−1 glucose, 0.2 g l−1 lactate, and 0.05 g l−1 cellulosefinal concentration in recirculation medium) was added to thenode solution in fed-batch manner, either when the medium washanged or upon depletion, directly into the recirculation medium.he cellulose was prepared by treating crystalline cellulose (Avicel,MC, PH105) via a phosphoric acid swelling method [24]. The addi-ion of the carbon source was continued until day 28, at which pointhe MFC output had stabilized between 0.3 and 0.4 V at a 500 � load.

ode II was initiated beginning on day 29. The primary purpose ofhis mode was to deplete carbon source from the anode. No externalarbon source was added thereafter, until day 72, which, in additiono depleting carbon source present in anode, also allowed selectionf organisms capable of either using residual cellulose (remainingrom the addition during the first 28 days) or those capable of stor-ng carbon internally and then using it subsequently for cellular

aintenance needs. Thus, the second phase of enrichment (carbontarvation mode) essentially targeted enrichment of the MFC withrganisms capable of storing carbon internally [25] and using it aslectron donor and the electrode as electron acceptor.

The addition of the carbon source was restarted on day 73, whendecline in the voltage output was observed. The carbon source

dded beginning on day 73, contained a mixture of 0.2 g l−1 glucosend 0.2 g l−1 lactate, but no cellulose. The cellulose was excluded torevent nonhomogeniety within the anode chamber when makingower density and Coulombic efficiency measurements. Glucosend lactate were added into the aqueous anode medium, which wasontinuously recirculated through the anode chamber at a flow ratef 4–7 ml min−1.

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

.4. Power density analysis

The power density analysis for the MFC was conducted by feed-ng the carbon source in a fed-batch manner. The nutrient mediumas completely replaced prior to every analysis, followed by addi-

PRESSSources xxx (2009) xxx–xxx 3

tion of 0.2 g l−1 of the carbon source (glucose and lactate, each) intothe medium. A 200 mM potassium ferricyanide in 200 mM potas-sium phosphate buffer was used as the catholyte to determine thepower density. The analysis was conducted 60 min after addition ofthe carbon source, to allow the voltage output to stabilize. A vari-able resistor ranging from 0 to 5000 � was used and the voltagerecorded by a Fluke multimeter Model 83. The resistance sweepwas conducted at an interval of 5 min. The maximum power den-sity was confirmed by operating the MFC at the particular resistancefor at least one hour, following the power density analysis. Multi-ple measurements of the voltage output at the resistance exhibitingmaximum power density were made on different days to determinereproducibility of the power density curve. The results were alwaysfound to be within a 10% standard deviation.

2.5. Genetic characterization

2.5.1. 16S clone libraryMicrobial samples were collected from the anode of MFC on days

113, 126, 133 and day 136. The cells were dislodged from the elec-trode using a hypodermic needle, followed by withdrawal of thedislodged cells via liquid flow through the anode using a syringe.Genomic DNA was isolated using the standard freeze–thaw pro-cedure, followed by phenol–chloroform extraction [26]. The 16SrRNA genes were amplified using GoTaq Flexi DNA polymerase(Promega, Madison, WI) and Bacteria-specific primers targetingpositions 8–27 and 1510–1492 of Escherichia coli 16S rRNA [27].PCR products purified from UltraPureTM Agarose (Invitrogen, Carls-bad, CA) using QIAquick Gel Extraction kit (Qiagen Inc., Valencia,CA) were ligated in pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA),and transformed into TOP10 chemically competent E. coli (Invit-rogen) according to the manufacturer’s instructions. The plasmidDNA released from the positive transformants by heating to 95 ◦Cwas amplified by rolling circle amplification (RCA) by the TempliPhimethod that utilized bacteriophage �29 DNA polymerase (Amer-sham Biosciences, Piscataway, NJ). The 16S rRNA genes were thensequenced using the BigDye Terminator v3.1 Cycle Sequencing kitand TA Forward and TA Reverse primers with priming site on theplasmid. Sequences were determined by resolving the sequencereactions on an Applied Biosystems 3730 automated sequencer.

Clone libraries were checked for presence chimeric sequencesusing a program Bellerophon (http://foo.maths.uq.edu.au/∼huber/bellerophon.pl) [28] and the CHIMERA CHECK (http://rdp8.cme.msu.edu/cgis/chimera.cgi?su=SSU) [29]. Putative chimeraswere excluded from further analyses. Sequences were initiallyaligned against the most similar sequences in the RibosomalDatabase Project II (RDP II) and assigned to a set of hierar-chical taxa using a Naïve Bayesian rRNA classifier version 1.0(http://rdp.cme.msu.edu/classifier/classifier.jsp). Closest relativeswere retrieved from NCBI GenBank following BLAST search [30].Multiple sequence alignment was done using the program ClustalX [31]. Phylogenetic 16S rRNA analyses were performed by theneighbor-joining [32] and maximum composite likelihood [33]methods. Bootstrap values were based on 1000 replicates gener-ated using the program Mega 4 [34]. To determine the clone librarycoverage for each sample, statistical analyses were performedusing DOTUR [35]. The population distribution is reported as apercent of the total number of bacterial clones sequenced for eachsample. Sequences generated in the present study were depositedin GenBank (accession numbers FJ393061 through FJ393217).

009), doi:10.1016/j.jpowsour.2009.02.006

2.5.2. DGGE analysisDGGE analysis focused on the V3 region of the 16S rRNA gene

which was amplified by nested PCR using separate primers to targetboth Bacterial and Archaeal sequences For Bacteria, the majorityof the 16S rRNA gene was initially amplified from genomic DNA,

IN PRESSP

4 Power Sources xxx (2009) xxx–xxx

upa(CTa5aAtGt

o(da6bht

oacwaietw(maHf(

2

EctebiSwsfli

3

3

bdaar

reported this storage. Assuming 100% Coulombic efficiency, weestimate that the cellulose added during mode I could produceelectricity for 14 days (at 0.2 V output). The MFC was operated inmode II for 44 days, during which time, the current output wasstable at ∼0.4 mA (Fig. 3). On the 45th day, or 73 days since start

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

sing the same set of primers as above, employing Phusion DNAolymerase (Finnzymes) in a 50 �l reaction volume. In the nestedmplification, primers 518R (ATTACCGCGGCTGCTGG) and GC-341FCGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTC-TACGGGAGGCAGCAG), containing the GC clamp [36], were used.o examine the benefits of the nested approach, the V3 region waslso directly amplified from the genomic templates using primers18R and GC-341F, directly. For targeting Archaea, the initialmplification used primers A46F: (C/T)TAAGCCATGC(G/A)AGT and1100r: (T/C)GGGTCTCGCTCGTT(G/A)CC, while nested amplifica-

ion used primers A340F: CGCCCGCCGCGCGCGGCGGGCGGGGCG-GGGCACGGGGGGCCCTACGGGG(C/T)GCA(G/C)CAG, containing

he GC clamp and A519R: TTACCGCGGC(G/T)GCTG [37].The products of the PCR reaction were then mixed with 10 �l

f DNA loading buffer and separated on a 10% polyacrylamide gel37.5:1, acrylamide/bisacrylamide) prepared with a denaturing gra-ient of 35–65% (100% denaturing gradient corresponds to 7 M ureand 40% formamide (Sigma)). Gel electrophoresis was performed at0 ◦C, for 20 h at 120 V. The gel was subsequently stained in 1× TAEuffer containing 1:1000 dilution of Cybrgreen I (Invitrogen) for anour before being photographed and bands excised on a blue lightransilluminator.

The excised gel fragments were left overnight to elute in 30 �lf sterile water. One microliter was used as a PCR reaction templates described above using primers 518R and 341F without the GClamp (ACTCCTACGGGAGGCAGCAG) or ARCH340F and ARCH519Rithout the GC clamp as appropriate. Fragment termini were

denylated by addition of 0.5 �l of Taq Polymerase (Invitrogen) andncubation at 72 ◦C for 20 min. They were subsequently cloned inither pCR3.1TOPO (Invitrogen) or pGEM-T Easy (Promega) vec-ors according to the manufacturers’ protocols. Positive clonesere identified by PCR with universal primers M13F and M13R

Fermentas) and plasmid DNA prepared using a Qiagen plasmidiniprep kit. Sequencing was performed from the M13F primer

t the Genomics Core Laboratory, MRC Clinical Sciences Centre,ammersmith Hospital, London, UK. Sequence analysis was per-

ormed using the programs Bioedit, AlignX (Invitrogen) and Blasthttp://blast.ncbi.nlm.nih.gov/Blast.cgi).

.6. Imaging of MFC biofilms

The MFC was transferred to an anaerobic chamber (Thermolectron Corporation, Model 1025, Marietta, OH) and the electrodehambers was disassembled. Samples of the microbes growing onhe carbon felt electrode were removed by using sterile tweez-rs. The detached carbon fibers from the electrode along with theiofilm/microbes growing on it were transferred on to a glass slide

nside the anaerobic chamber itself. The cells were stained withyto9 at a final concentration of 5 �M (Molecular Probes). Cellsere imaged using a Leica TCS SP2 confocal laser scanning micro-

cope equipped with a 488 nm Ar laser and the emission spectrumrom 500–535 nm was collected. Z-series optical sections were col-ected at 0.5 �m intervals through the biofilm and the resultingmages were projected as a single 2D image.

. Results

.1. Biocatalyst enrichment

The goal of the experiment was to maximize the growth of

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

iofilm-forming, exoelectrogenic organisms in the anode. This wasone via careful selection of the anode design and the MFC oper-ting parameters. The MFC was operated in three different modesnd in a sequential dual flow regime, which included a continuousecirculation at low flow rate and an intermittant forced flow at

Fig. 2. Current vs. time profile for MFC-A showing the change in current during thevarious modes of operation.

higher flow rates enabling removal of mediators and planktonicorganisms. The flow-through design used allowed easy removalof non-biofilm-forming organisms via periodic replacement of theanodic fluid (Fig. 1A).

During the first 28 days (mode I), the carbon source was addedin excess of the amount needed for electricity production, based onthe voltage measurement on the particular day. This was continueduntil the voltage output reached 0.4 V at a 500 � load. On day 29,mode II was initiated, by halting carbon source addition. It wasobserved that electricity production continued even after depletionof the carbon source in the nutrient medium, indicating that somecarbon was stored internally by the cells. Freguia et al. [25] also

009), doi:10.1016/j.jpowsour.2009.02.006

Fig. 3. Image of the microbial consortium inhabiting anode electrode (carbon felt)of the mixed carbon source MFC. The sample was stained with Syto9 (MolecularProbes). The community is dominated by biofilm-forming organisms.

IN PRESSP

Power Sources xxx (2009) xxx–xxx 5

uTtmdwtpbflectgctpfltf

cbmfifiipwestm1ddpetcatd

Fig. 5. Rarefaction curves with 95% confidence intervals for the clone libraries

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

p, current production decreased and the mode II was terminated.he amount of glucose and lactate added during mode I was morehan sufficient to produce the observed current for the duration of

ode I and mode II, assuming that part of carbon source was addeduring mode I was stored as internal carbon. The purpose of mode IIas two-fold, first to deplete the residual carbon source present in

he anode and secondly, to enrich organisms capable of electricityroduction from internally stored carbon. Such a consortium woulde useful in handling process fluctuations (e.g., carbon loading,ow rates). In mode III, reduction in external resistance, which isquivalent to higher availability of an electron acceptor (in thisase, the cathode) leads to a higher current between the anode andhe cathode and to an opportunity for growth of the exoelectro-enic organisms. The current output increased during this periodoinciding with each reduction (Fig. 2). During all these modes,he removal of mediators and free-floating cells was continued viaeriodic replacement of the anode fluid. During mode III, the forcedow was used in addition to anode fluid replacement to removehe mediators and cells from the anode and enhance biofilmormation.

Fig. 3 shows an image of the microbial community coating thearbon felt fibers from the MFC. A consortium dominated by aiofilm was observed. The image provided strong evidence for for-ation of a thick biofilm on the electrode fibers. The image shows 4

bers with up to 100 �m thick microbial growth on each side of theber (when observed in 2D). A 3D image observed by taking depth

mages showed the biofilm surrounding all around the fiber. Theresence of planktonic organisms in the bulk liquid shows that theyere not completely eliminated from the consortium. The diam-

ter of the biofilm thickness surrounding the electrode fibers inome locations was as much as 150 �m. The time taken for resump-ion of electricity production after replacement of the nutrient

edium (thereby removing planktonic organisms) was less than5 min, indicating that the electricity production was primarilyue to biofilm-based organisms. In MFCs using mediators, hours toays are needed to resume high power output [16]. The maximumower density of the MFC-A using glucose and lactate (0.2 g l−1,ach) as the carbon source and using a ferricyanide cathode sys-

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

em was 300 W m−3 net anode volume (NAV) (3220 mW m−2). Theombination of the different modes of operation and the use ofn improved anode resulted in thick biofilm-dominated exoelec-rogenic consortia capable of producing electricity at high powerensities.

Fig. 4. Composition of microbial consortia from MFC anode: (a) MFC sampled

from each condition sampled. Number of operational taxonomic units (OTUs) wasobtained for every clone library using of the furthest-neighbor approach with a 97%sequence similarity cutoff. The curve leveling indicates saturation in recovering ofclones.

3.2. Biocatalyst characterization

3.2.1. 16S rRNA clone libraryA 16S rRNA analysis of the anodic consortium from the MFC

based on frequency of sequences found in bacterial primer-basedclone-library is shown in Fig. 4a. This included 66% Veillonellaceae(25% Anaeroarcus spp., 41% Anaeromusa spp.), 11% Rhodocyclaceae,10% �-Proteobacteria, 8% Bacteroidetes and 4% other Clostridiales.A temporal analysis of the samples collected during mode III indi-cated that the community was changing slowly during this period.A rarefaction analysis substantiates this observation (Fig. 5). Thenumber of operational taxonomic units obtained and predicted foreach time event shows that the community had not reach completestability by day 136 (Table 1). The dominant genus in the first sam-ple (day 113) was Anaeromusa, with Anaeroarcus being the seconddominant, which subsequently became the dominant genus (Fig. 4band c). A phylogenetic tree of the microbial community from day136 is shown in Fig. 6.

009), doi:10.1016/j.jpowsour.2009.02.006

3.2.2. DGGE analysisA DGGE analysis of the samples collected from MFC-A revealed

that, on the basis of numbers, mobility and relative intensity ofthe bands, there was a gradual enrichment of certain species and

on day 113; (b) MFC sampled on day 126; (c) MFC sampled on day 136.

ARTICLE IN PRESSG ModelPOWER-11745; No. of Pages 8

6 A.P. Borole et al. / Journal of Power Sources xxx (2009) xxx–xxx

Table 1Characteristics and diversity estimates for 16S rRNA gene clone libraries with a 97% sequence similarity cutoff.

Treatment period, days Number of clonesa Number of OTUs obtainedb Shannon, H′c Number of OTUs expectedd

113 71 22 2.19 47126 89 23 2.50 35136 41 16 2.49 26

aNumber of clones analyzed for each treatment. bOperational taxonomic units based on partial 16S rRNA gene sequences. cShannon index, the higher number the more evenlyspecies in the population represented. Shannon index does not depend on the total population. dOperational taxonomic units expected if we continue to sample bacterialpopulation. eReciprocal of Simpson’s index, higher number represents more diversity [35].

anod

r(dcAA

Fai

Fig. 6. Phylogenetic tree of the MFC

eduction in population diversity between day 113 and day 136

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

Fig. 7). Generally, the eubacterial sequences agreed with thoseescribed above, with a significant number of sequences indi-ating members of the family Veillonellaceae (eg Anaeroarcus,naeromusa, Phascolarctobacterium spp.). Bands corresponding tonaeroarcus/Anaeromusa reduced in intensity over time, while an

ig. 7. DGGE analysis of sequences amplified from the V3 region of 16SrDNA amplifiednode. Samples in panels (A and B) were amplified with Bacteria selective primers, (A) usin panel (C) were amplified by nested PCR using Archaea selective primers for both ampli

e consortium analyzed on day 136.

Enterobacteriaceae band increased. Azoarcus and Azospira spp. were

009), doi:10.1016/j.jpowsour.2009.02.006

clearly identified. Nested PCR amplifications done with archaealspecific primers revealed the presence of archaea, with the mostfrequent sequences being similar to Methanobacterium sp. althoughthe most intense band corresponded to a Methanosaeta sp. Althoughthe primers used were designed to amplify archaeal 16S rDNA

from sequential samples (L-R days 113, 126, 133 and 136, in all panels) from MFCng nested PCR and (B) amplifying directly with primers 518R and GC-341F. Samplesfications.

INP

Power

grafa

3

cfVoftotrr(tfdttfttio

4

4

rtTwisrbflcurapttptcsb2dnboddt

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

enes, a number of bacterial sequences were also obtained. Theelative intensity of the bacterial DGGE bands compared to therchaeal bands, given the expected poor priming efficiency for theormer suggested that, while clearly presented, archaea were notbundant.

.3. Microbial diversity in consortia

Little is known about the two most dominant genera, Anaeroar-us sp. and Anaeromusa sp., found in the clone-libraries obtainedrom the anode samples. Both of these genera belong to the familyeillonellaceae, and have been described as amino-acid utilizingrganisms [38,39]. This is the first report of the presence of thisamily in an exoelectrogenic MFC anode community. Fig. 6 showshe phylogenetic tree of the organisms detected in the clone-libraryf the day 136 sample from the MFC. The tree shows that several ofhe organisms other than the Veillonellaceae were related to thoseeported in MFCs. One member of the �-Proteobacteria (4F06) waselated to an uncultured bacterium (24d08) from an upflow MFC99% similarity). The other clones showed 97% or lower similarityo organisms enriched in MFC anodes, indicating that these are dif-erent genera. The members from the �-Proteobacteria class wereistinctly related to the uncultured bacterium 23h08 isolated fromhe same upflow MFC anode (96% similarity). Other clones fromhe �-Proteobacteria and the Bacteroidetes class show anywhererom 89% to 95% similarity with organisms reported in MFCs inhe literature [40,41]. The rest of the community had no similarityo prior MFC-derived organisms, but showed similarity to organ-sms capable of denitrification and various other organic degradingrganisms.

. Discussion

.1. Parameters affecting MFC power density

The enrichment of exoelectrogenic biofilm-forming organismsesulted in development of a consortium capable of generating elec-ricity at a high power density (300 W m−3 NAV or 3220 mW m−2).his is higher than what has been reported previously for MFCsith three-dimensional anode designs. One estimate suggests this

s about a third of the power density needed for commercial con-ideration of MFCs [42]. High volumetric power densities have beeneported in some studies for anode designs using planar electrodesy reducing the anode chamber volume [43,44]. The projected sur-ace area power densities for such designs; however, are typicallyess than 2000 mW/m2 and as such are not suitable for practi-al application. Many of the design and operational parameterssed in this study have been studied individually and proven toesult in power density improvements. A study using a high surfacerea anode electrode (graphite fiber brush) reported a maximumower density of 2400 mW m−2 with an air-cathode [3]. This elec-rode had an estimated surface area of 18,200 m2 m−3, as comparedo 45,350 m2 m−3 for the carbon felt used in this study, whichotentially contributed to the higher power density observed inhis study. Electrode spacing has been shown to have a signifi-ant impact on the power density as well. MFCs with negligiblepace between the electrodes separated by a cation exchange mem-rane have reported power densities of 1180 mW m−2 [45] and580 mW m−2 [5]. In membrane-free MFCs, the maximum powerensity as high as 2700 mW m−2 was reported [6]. The effective-ess of flow-through systems in improving power densities has also

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

een relatively well established [7,8,19]. A recent study reported usef high shear to develop thick, dense biofilms resulting in powerensities of up to 160 W m−3 [46]. Operation of the MFCs underual flow-rate regime was one of the strategies used in this studyo improve power density. In terms of the operational stability of

PRESSSources xxx (2009) xxx–xxx 7

MFCs, this study shows that biofilms can be grown in high spe-cific surface area electrodes such as the carbon felt resulting in highpower densities while avoiding problems such as clogging. The MFCwas operated for almost 5 months without clogging problems. Thiswas possible due to removal of excess growth by periodic flush-ing of the anode via implementation of a dual flow regime. Thisstudy used a combination of techniques to enhance exoelectrogenicgrowth. Some of these parameters were described recently in areview paper to improve power output from MFCs [4]. Further workis needed in understanding the implications of combining multiplestrategies on the microbial community and to separate the effect ofbiology from design on power density. While there are other issuesto be addressed prior to consideration of MFCs for energy produc-tion [47], the integrated approach developed in this study resultedin a higher power density and indicated a step in the right direc-tion. This study is unique due to the combined approach of fusingeffective engineering design with specific operational parametersleading to development of a microbial community capable of pro-ducing high power densities. The new organisms identified in theconsortia that lead to formation of thick biofilms on the electrodesthat permitted the high power density are evidence of the success ofsuch a strategy. Further improvements in power density will comevia further lowering of the applied resistance during enrichmentperiod, complete elimination of methanogens and use of electrodeswith better electrical and surface properties.

4.2. Microbial diversity

The microbial consortium enriched in this study was quitediverse and was dominated by Veillonellaceae, which have not beenobserved in MFCs previously. The mixed carbon source is a poten-tial reason for the high level of diversity. The effect of the carbonsource on MFC consortia has been reported in the literature [48,49].The presence of carbohydrates has been related to presence of fer-menting organisms such as Firmicutes in MFCs previously [14,15].However, whether any of these organisms are exoelectrogens is notclear yet. Further work using pure strains isolated from MFCs isnecessary to understand their functional diversity. Methanogenshave also been reported to be present in some MFC communities[50]. The use of archaeal primers revealed the presence of a fewmethanogens in the MFC-A, but at a low abundance. Complete elim-ination of methanogens from MFC communities is an importantneed for further development of MFCs, as they represent electronsinks.

While the influence of MFC design and biology on power densityis not fully understood, this study shows that combining appropri-ate enrichment methodologies with proper design can influencethe power density and potentially the make-up of the microbialcommunity. In addition to the impact of the MFC operating con-ditions on enrichment of microorganisms, these parameters canpotentially play a large role in maintaining high power output fromMFCs during their use as energy production devices, primarily dueto the effect of these parameters on the stability of the consortia.

4.3. Achieving higher power densities and sustainable MFCdesigns

In this work, only the anode chamber and the anode biocatalystwere targeted for improvement. A Pt-based air-cathode was usedduring the enrichment process, while a ferricyanide-cathode wasused for power density analysis. A detailed analysis of the limita-

009), doi:10.1016/j.jpowsour.2009.02.006

tions of the MFC using the biocatalysts developed in this study isbeing reported elsewhere. The air-cathode is a sustainable cath-ode but it has several limitations for its use in determination ofmaximum power density. The ferricyanide-cathode is not a sustain-able cathode system for practical applications due to the inability

INP

8 Power

ttftcpdFatcips

A

(iaTaf

R

[[[[

[[[

[

[

[[

[[

[

[

[

[[

[

[[[

[[[

[

[

[

[

[[[

[

[

[

[

[

[

ARTICLEG ModelOWER-11745; No. of Pages 8

A.P. Borole et al. / Journal of

o regenerate ferricyanide effectively. An air-cathode requires pro-ons in addition to electrons for electricity production, while aerricyanide-cathode only requires electrons. Proton transport fromhe anode to the cathode limits the overall power output in air-athode MFCs [51]. Comparing the ability of anode biocatalysts toroduce electricity, a cathode which is not a limiting factor in powerensity determination (e.g. ferricyanide-cathode) should be used.urther work is needed to improve proton availability at the cathodend to achieve simultaneous proton transport at rates equivalento electron transport without polarization [52]. The use of biologi-al air-cathodes [53,54] in combination with the anode developedn this study and the use of flow patterns in anodes to facilitateroton transport can potentially produce high power densities in austainable manner needed for commercialization.

cknowledgements

The financial support from the Oak Ridge National LaboratoryORNL) Laboratory Director’s Research and Development Programs gratefully acknowledged. ORNL is managed by UT-Battelle, Inc. viacontract #DE-AC05-00OR22725 for the U.S. Department of Energy.he authors would like to thank Mircea Podar, Jonathan Mielenz andnonymous reviewers for helpful suggestions and Lindsey Amasonor editing the manuscript.

eferences

[1] B.E. Logan, B. Hamelers, R. Rozendal, U. Schrorder, J. Keller, et al., Environ. Sci.Technol. 40 (17) (2006) 5181–5192.

[2] D.R. Lovley, Curr. Opin. Biotechnol. 17 (2006) 327–332.[3] B. Logan, S. Cheng, V. Watson, G. Estadt, Environ. Sci. Technol. 41 (9) (2007)

3341–3346.[4] P. Clauwaert, P. Aelterman, T.H. Pham, L. De Schamphelaire, M. Carballa, et al.,

Appl. Microbiol. Biotechnol. 79 (6) (2008) 901–913.[5] P. Aelterman, K. Rabaey, H.T. Pham, N. Boon, W. Verstraete, Environ. Sci. Technol.

40 (10) (2006) 3388–3394.[6] D.F. Xing, Y. Zuo, S.A. Cheng, J.M. Regan, B.E. Logan, Environ. Sci. Technol. 42 (11)

(2008) 4146–4151.[7] H. Liu, S. Cheng, L.P. Huang, B.E. Logan, J. Power Sources 179 (1) (2008) 274–

279.[8] S. Cheng, H. Liu, B.E. Logan, Environ. Sci. Technol. 40 (7) (2006) 2426–

2432.[9] R.A. Rozendal, T. Sleutels, H.V.M. Hamelers, C.J.N. Buisman, Water Sci. Technol.

57 (11) (2008) 1757–1762.10] Y. Zuo, S. Cheng, B.E. Logan, Environ. Sci. Technol. 42 (18) (2008) 6967–6972.11] S.E. Oh, B.E. Logan, Appl. Microbiol. Biotechnol. 70 (2) (2006) 162–169.12] S.A. Cheng, B.E. Logan, Electrochem. Commun. 9 (3) (2007) 492–496.13] B.R. Ringeisen, E. Henderson, P.K. Wu, J. Pietron, R. Ray, et al., Environ. Sci.

Technol. 40 (8) (2006) 2629–2634.

Please cite this article in press as: A.P. Borole, et al., J. Power Sources (2

14] S. Jung, J.M. Regan, Appl. Microbiol. Biotechnol. 77 (2) (2007) 393–402.15] B.E. Logan, J.M. Regan, Trends Microbiol. 14 (12) (2006) 512–518.16] K. Rabaey, N. Boon, S.D. Siciliano, M. Verhaege, W. Verstraete, Appl. Environ.

Microbiol. 70 (9) (2004) 5373–5382.17] J.M. Regan, Community Interactions with Complex Electron Donors, The First

International MFC Symposium, State College, PA, May 27–29, 2008.

[[[

PRESSSources xxx (2009) xxx–xxx

[18] A. Christy, H. Rismani-Yazdi, Y.Z. Carver, O.H. Tuovinen, Cellulose Conversion toElectricity in Microbial Fuel Cells: Challenges and Constraints, The First Inter-national MFC Symposium, State College, PA, May 27–29, 2008.

[19] L.P. Huang, B.E. Logan, Appl. Microbiol. Biotechnol. 80 (4) (2008) 655–664.20] J.C. Biffinger, J.N. Byrd, B.L. Dudley, B.R. Ringeisen, Biosens. Bioelectron. 23 (6)

(2008) 820–826.21] A. Sayka, J.G. Eberhart, Solid State Technol. 32 (5) (1989) 69–70.22] Y.A. Gorby, S. Yanina, J.S. McLean, K.M. Rosso, D. Moyles, et al., PNAS 103 (30)

(2006) 11358–11363.23] H. Liu, B.E. Logan, Environ. Sci. Technol. 38 (14) (2004) 4040–4046.24] Zhang Y.-H.P., X.B. Cui, L.R. Lynd, L. Huang, Biomacromolecules 7 (2) (2006)

644–648.25] S. Freguia, K. Rabaey, Z.G. Yuan, J. Keller, Environ. Sci. Technol. 41 (8) (2007)

2915–2921.26] P.L. Bond, S.P. Smriga, J.F. Banfield, Appl. Environ. Microbiol. 66 (9) (2000)

3842–3849.27] D.J. Lane, B. Pace, G.J. Olsen, D.A. Stahl, M.L. Sogin, et al., Proc. Natl. Acad. Sci.

U.S.A. 82 (1985) 6955–6959.28] T. Huber, G. Faulkner, P. Hugenholtz, Bioinformatics 20 (2004) 2317–2319.29] B.L. Maidak, J.R. Cole, T.G. Lilburn, C.T. Parker, P.R. Saxman, et al., Nucleic Acids

Res. 29 (2001) 173–174.30] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, J. Mol. Biol. 215 (1990)

403–410.31] D.G. Higgins, P.M. Sharp, Gene 73 (1) (1988) 237–244.32] N. Saitou, M. Nei, Mol. Biol. Evol. 4 (4) (1987) 406–425.33] K. Tamura, M. Nei, S. Kumar, Proc. Natl. Acad. Sci. U.S.A. 101 (30) (2004)

11030–11035.34] K. Tamura, J. Dudley, M. Nei, S. Kumar, Mol. Biol. Evol. 24 (8) (2007) 1596–1599.35] P.D. Schloss, J. Handelsman, Appl. Environ. Microbiol. 71 (2005) 1501–1506.36] G. Muyzer, E.C. de Waal, A.G. Uitterlinden, Appl. Environ. Microbiol. 59 (1993)

695–700.37] L. Ovreas, L. Forney, F. Daae, V. Torsvik, Appl. Environ. Microbiol. 63 (1997)

3367–3373.38] C. Strompl, B.J. Tindall, G.N. Jarvis, H. Lunsdorf, E.R.B. Moore, et al., Int. J. Syst.

Bacteriol. 49 (1999) 1861–1872.39] S. Baena, M.L. Fardeau, T.H.S. Woo, B. Ollivier, M. Labat, et al., Int. J. Syst. Bacteriol.

49 (1999) 969–974.40] J.R. Kim, S.H. Jung, J.M. Regan, B.E. Logan, Bioresour. Technol. 98 (13) (2007)

2568–2577.[41] J.Y. Lee, N.T. Phung, I.S. Chang, B.H. Kim, H.C. Sung, FEMS Microbiol. Lett. 223

(2) (2003) 185–191.42] K. Rabaey, W. Verstraete, Trends Biotechnol. 23 (6) (2005) 291.43] Y. Fan, H. Hu, H. Liu, J. Power Sources (2007).44] K.P. Nevin, H. Richter, S.F. Covalla, J.P. Johnson, T.L. Woodard, et al., Environ.

Microbiol. 10 (10) (2008) 2505–2514.45] P. Liang, X. Huang, M.Z. Fan, X.X. Cao, C. W, Appl. Microbiol. Biotechnol. 77 (3)

(2007) 551-558.46] T.H. Pham, N. Boon, P. Aelterman, P. Clauwaert, L. De Schamphelaire, et al.,

Microb. Biotechnol. 1 (6) (2008) 487–496.47] J. Keller, K. Rabaey, Experiences from MFC Pilot Plant Operation, The First Inter-

national MFC Symposium, State Colegge, PA, May 27–29, 2008.48] B.H. Kim, H.S. Park, H.J. Kim, G.T. Kim, I.S. Chang, et al., Appl. Microbiol. Biotech-

nol. 63 (2004) 672–681.49] N.T. Phung, J. Lee, K.H. Kang, I.S. Chang, G.M. Gadd, B.H. Kim, FEMS Microbiol.

Lett. 233 (2004) 77–82.50] M. Barreto, E. Jedlicki, D.S. Holmes, Appl. Environ. Microbiol. 71 (6) (2005)

2902–2909.

009), doi:10.1016/j.jpowsour.2009.02.006

[51] R.A. Rozendal, H.V.M. Hamelers, C.J.N. Buisman, Environ. Sci. Technol. 40 (17)(2006) 5206–5211.

52] Y.Z. Fan, H.Q. Hu, H. Liu, Environ. Sci. Technol. 41 (23) (2007) 8154–8158.53] A.P. Borole, S. LaBarge, B. Spott, J. Power Sources 188 (2) (2009) 421–426.54] P. Clauwaert, D. Van der Ha, N. Boon, K. Verbeken, M. Verhaege, et al., Environ.

Sci. Technol. 41 (21) (2007) 7564–7569.