Immortalized human neural progenitor cells from the ventral telencephalon with the potential to differentiate into GABAergic neurons

Immortalized Human Neural ProgenitorCells from the Ventral Telencephalonwith the Potential to Differentiateinto GABAergic Neurons

Haiyan Zhang,1 Yisong Wang,2 Yongmei Zhao,3 Yanling Yin,4

Qiuyan Xu,3 and Qunyuan Xu2*1Department of Cell Biology, Capital Medical University, Beijing, China2Beijing Institute for Neuroscience, Capital Medical University, Beijing Center of NeuralRegeneration & Repairing, Key Laboratory for Neurodegenerative Diseases ofMinistry of Education, Beijing, China3Key Laboratory for Neurodegenerative Diseases of Ministry of Education, Xuanwu Hospital,Capital Medical University, Beijing, China4Institute for Biomedical Science of Pain, Capital Medical University, Beijing, China

Human neural progenitor cells (hNPCs) are believed tohave important potential in clinical applications andbasic neuroscience research. In the present study, wecreated a new immortalized human neural cell line,hSN12W-TERT, derived from human fetal ventral telen-cephalon, using IRES-based retroviral overexpressionof human telomerase reverse transcriptase. Weshowed that after more than 40 passages, hSN12W-TERT cells possess high telomerase activity, maintaina normal diploid karyotype, and retain the characteris-tics of hNPCs. Under proliferative conditions, thesecells remained undifferentiated, expressing the neuralprogenitor cell markers nestin, vimentin, and Sox2.The cells were able to differentiate into neurons, astro-cytes, and oligodendrocytes after a significantdecrease in the level of telomerase following with-drawal of growth factors. The neurons were postmi-totic and achieved electrophysiologic competence.Furthermore, we showed that most neurons wereGABAergic, especially on differentiation induced bybone morphogenetic protein–2 (BMP2). RT-PCR analy-sis also confirmed that hSN12W-TERT cells expressedmammalian achaete-scute homolog 1 (Mash1) and Dlx2,genes associated with the development of GABAergiccortical interneurons. BMP2 exposure may activate apositive-feedback loop of BMP signaling in hSN12W-TERT cells. Our data indicated that this hSN12W-TERTcell line could be a valuable experimental tool withwhich to study the regulatory roles of intrinsic and ex-trinsic factors in human neural stem cell biology andthat it would be useful in basic research and in researchseeking to discover novel drug targets for clinical can-didates. VVC 2008 Wiley-Liss, Inc.

Key words: neural progenitor cells; immortalized;telomerase; human fetal; ventral telencephalon

Recent progress in stem cell research suggests thatneural progenitor cells from the human brain are crucialfor the successful development of approaches to celltherapy for neurodegenerative diseases such as Hunting-ton’s disease, Parkinson’s disease, and Alzheimer’s disease(Goldman, 2005; Lindvall and Kokaia, 2006). However,these clinically important progenitor cell types havelimited capacity for mitotic expansion, which hasconstrained the therapeutic application of human neuralprogenitor cells (hNPCs). Several approaches have beendeveloped to overcome this problem, including epige-netic expansion by stimulation of cells with mitogens(Svendsen et al., 1998; Carpenter et al., 1999; Vescoviet al., 1999; Zhang et al., 2005) and a combination ofgenetic and epigenetic immortalization strategies: cellsare transduced with an oncogene (like v-myc) by replica-

The first two authors contributed equally to this work.

Contract grant sponsor: National Program of Basic Research; Contract

grant number: 2006CB500700; Contract grant sponsor: National Natural

Science Foundation of China; Contract grant number: 30430280; Con-

tract grant sponsor: Beijing Municipal Science & Technology Commis-

sion Project; Contract grant number: Z0005187040311; Contract grant

sponsor: Beijing Natural Research Foundation; Contract grant number:

7011001; Contract grant sponsor: Scientific Research Common Program

of Beijing Municipal Commission of Education; Contract grant number:

KM200510025011.

*Correspondence to: Qunyuan Xu, Beijing Institute for Neuroscience,

Capital Medical University, Beijing Center for Neural Regeneration &

Repairing, Key Laboratory of Neurodegenerative Diseases of Ministry of

Education, Beijing 100069, China. E-mail: [email protected]

Received 1 May 2007; Revised 4 July 2007 and 24 August 2007;

Accepted 16 September 2007

Published online 11 January 2008 in Wiley InterScience (www.

interscience.wiley.com). DOI: 10.1002/jnr.21581

Journal of Neuroscience Research 86:1217–1226 (2008)

' 2008 Wiley-Liss, Inc.

tion-deficient retroviral vectors, and their proliferation isalso supported with growth factors (Sah et al., 1997;Villa et al., 2000; Cacci et al., 2007). However, telo-meric shortening occurs with decreased telomerase,which acts as a brake on cell division and expansion(Harley et al.,1990; Masutomi et al., 2003); hNPCs typi-cally show down-regulated telomerase activity to unde-tectable levels by a gestational age of 16 weeks (Wrightet al., 1996; Ulaner and Giudice, 1997) or during earlypassage in vitro (Ostenfeld et al., 2000). The develop-mental decline in telomerase activity reflects in part tran-scriptional inactivation of telomerase reverse transcrip-tase, the rate-limiting component of the telomeraseenzyme complex (Wright et al., 1996). Human telomer-ase reverse transcriptase (TERT) has been overexpressedin several neural progenitor cell types as a means ofmaintaining mitotic competence (Bai et al., 2004; Royet al., 2004). Telomerase overexpression permits thegeneration of stable, nontransformed lines of humanneural progenitor cells whose progeny is able to differen-tiate into mature cells of relatively restricted and uniformphenotypes (Roy et al., 2004). The advent of such celllines would provide cellular substrates for the rationalstructural restoration of the damaged brain. However,the potential of hNPCs to differentiate may vary accord-ing to their region of origin (Hitoshi et al., 2002; Osten-feld et al., 2002; Jain et al., 2003). Thus, the positionalsource of donor cells may be crucial to their use as ther-apeutic vectors, both in terms of homeodomain code-dependent responses to positional cues and transmitterrepertoires (Sawamoto et al., 2001). In the ventral telen-cephalon, major subgroups of cerebral cortical interneur-ons originate in the medial ganglionic eminence.GABAergic interneurons, which comprise 20–30% ofcortical neurons and their functional diversity providesthe essential regulatory drive for output control in py-ramidal cells. Studies of how these interneurons are bornand become neurochemically and functionally specifiedand how they might be replenished in many neurologi-cal conditions (for example, epilepsy, Parkinson’s disease,and Huntington’s disease) are in progress (Berghuiset al., 2004).

Based on this consideration, we generated a newhuman neural progenitor cell line by immortalizinghNPCs from human ventral telencephalon of a gesta-tional age of 12 weeks by overexpression of telomerase.This human TERT–immortalized cell line divided inthe presence of EGF and bFGF in adherent cultures,maintained high telomerase activity, with contact anddensity inhibition, and could be maintained for morethan 40 passages in vitro, with an estimated populationdoubling time of about 4.5 days. It showed karyotypicnormalcy without replicative senescence. This cell lineretained its capacity to generate glia and physiologicallymature neurons with persistent expression of mammalianachaete-scute homolog 1 (Mash1), an important regula-tor of neurogenesis in the ventral telencephalon(Casarosa et al., 1999). The production of specializeddifferentiated neurons derived from stem cells has been

proposed as a revolutionary technology for use in regen-erative medicine. However, few examples of specificneuronal cell differentiation have been described to date(Muotri and Gage, 2006). Thus, our cell line may be avaluable experimental tool with which to study the neu-ronal diversification of the regulatory roles of intrinsicand extrinsic factors in human neural stem cell biologyand should be useful for basic research and for the dis-covery of novel drug targets for the treatment of neuro-degenerative diseases.

MATERIALS AND METHODS

Isolation and Immortalization Neural Progenitor Cells

Human neural progenitor cells isolated from the ventraltelencephalons of first trimester embryos were plated on poly-L-lysine (Sigma)–coated culture plates and cultured in a NPCmedium consisting of DMEM/F12, N2 supplement [1% (v/v);Gibco], 0.6% glucose, 20 lg/mL human insulin (Sigma), 2mM L-glutamine, 3 mM sodium bicarbonate, 1% bovine se-rum albumin (Gibco), 20 ng/mL human recombinant EGF(hrEGF; Gibco), and 20 ng/mL human recombinant basicFGF (hrbFGF; Gibco; Zhang et al., 2005).

The primary cultures were immortalized using VSVg-pseudotyped retrovirus encoding hTERT in the MGIN vector(Fig. 1), in which an internal ribosome entry (IRES) was usedto coexpress the hTERT, truncated human nerve growth fac-tor receptor (tNGFR), and enhanced green fluorescent protein(EGFP) genes in a bicistronic transcript emanating from theMSCV LTR (Cheng et al., 1997). The retrovirus-producingcell line PG13/JH1-hTERT was kindly provided by Dr. AlexZhang (Xuanwu Hospital, Capital Medical University, China).For immortalization, hNPCs were plated at density of 2 3105 cells/cm2, grown as a monolayer (5 days in vitro afterplating), and then treated with a mixture of 1 volume of viralsupernatant and 2 volumes of growth medium for 20 hr with8 lg/mL polybrene (Gibco). A repeated-infection procedurewas performed over a period of 72 hr. After retroviral infec-tion for 1 week, neural progenitor cells were expanded andpassaged by trypsinization (using 0.025% trypsin and 0.05 mMEDTA) and replated at 8 3 103 cells/cm2.

Differentiation of Immortalized Cultures

For differentiation, immortalized cells were plated on24-well plates coated with poly-L-lysine/laminin (Sigma), andthe medium was switched to a differentiation medium, NPCmedium, which lacked growth factors hrEGF and hrbFGF.Cells were induced to differentiate by adding RA (1 lM;Sigma) in 0.01% dimethyl sulfoxide (DMSO; Sigma) and

Fig. 1. Schematic representation of the hTERT-encoding retroviralvector. The NGFR and EGFP genes were placed downstream of anIRES, which potentially allows for coexpression of an upstreamgene, hTERT, in bicistronic transcripts that also encodes the trans-membrane domains of NGFR and EGFP reporters.

1218 Zhang et al.

Journal of Neuroscience Research

incubating cells for 1, 3, 5, 7, and 14 days. In some experi-ments, the following factors were included in the differentia-tion medium alone: bone morphogenetic protein–2 (BMP2, 1ng/mL; Peprotech EC), BDNF (10 ng/mL; Peprotech EC),and GDNF (10 ng/mL; Peprotech EC).

Telomerase Assay

Telomerase activity was measured using a TRAPEZE1

ELISA Telomerase Detection Kit S7750 (Chemicon) accord-ing to the standard telomeric repeat amplification protocol(TRAP) based on a previously published method (Kim andWu, 1997). An ELISA assay was used for the nonquantitativedetection of telomerase activity.

Immunofluorescence

Cultures were fixed with 4% buffered paraformaldehydeand stained using previously described procedures (Zhanget al., 2005). Representative fields from at least two independ-ent experiments were imaged using a DFC300 digital cameraand FW4000 imaging software (LEICA, Germany) and thenscored. 40,6-Diamidino-2-phenylindole (DAPI; Sigma) coun-terstaining of nuclei was used to determine the total numberof cells in a field. Primary antibodies included antibodiesagainst GABA (1:500; Sigma) and glial fibrillary acidic protein(GFAP, 1:200; Sigma) and monoclonal antibodies againsthuman nestin (1:200, Chemicon), vimentin (1:600; Chemi-con), Ki 67 (1:200; Chemicon), b-tubulin III (TuJ1, 1:600;Sigma), microtubule-associated protein 2a/b (MAP2a/b,1:200; Chemicon), green fluorescent protein (1:200; Sigma),galactocerebroside (GalC, 1:100; Sigma), and p75NGFR (giftfrom Dr. Alex Zhang). The secondary antibodies used forimmunofluorescent detection were Cy3-conjugated goat anti-mouse IgG (1:200, Sigma), Cy3-conjugated goat antirabbitIgG (1:200; Sigma), Alexa Fluor 594–conjugated goat antirab-bit IgG (1:400; Molecular Probe), or Alexa Fluor 488–conju-gated chicken antirabbit IgG (1:400; Molecular Probe). Thespecificity of all primary and secondary antibodies was con-firmed in appropriate positive and negative control cultures.The 50-bromo-20-deoxyuridine (BrdU) incorporation assaywas carried out using a Cell Proliferation BrdU kit (Roche)according to the manufacturer’s instructions.

RT-PCR

Total RNA from the cultured cells was extracted byacid phenol extraction (Trizol Reagent, Invitrogen) accordingto the manufacturer’s protocol. Reverse transcription (RT)was performed with an oligo-dT primer using the Super-ScriptTM first-strand synthesis system (Invitrogen) and equalamounts of RNA from each group. One microliter of cDNAtemplate was amplified with a PCR PreMix Kit (Sbs, China)using the following conditions: initial denaturation for 5 minat 948C; 28–35 cycles of 948C for 1 min, 558C–658C for 1min and 728C for 1 min; followed by a final elongation stepof 10 min at 728C in a thermal cycler (Applied BiosystemsGene Amp PCR System 2400). PCR products were resolvedby 2% (w/v) agarose gel electrophoresis and visualized by eth-idium bromide staining. The human glyceraldehyde-3-phos-phate dehydrogenase (GAPDH) gene served as an internal

control for the efficiency of mRNA isolation and cDNA syn-thesis. The primers used for transcription factor PCR are listedin Table I.

Flow Cytometry

Cell samples (5 3 105 cells) were stained with propi-dium iodide (PI) for DNA content measurement and analyzedas previously described (Zhang et al., 2005). Control sampleswere taken from human lymphocytes. Data were processedusing ModFitLT V2.0 software. Analysis of each sample wasreplicated an average of three times with a minimum of twocultures on independent days.

Karyotype Analysis

To establish whether the lines were diploid, cells weresubjected to metaphase mitotic arrest using colcemide andthen harvested by trypsin dispersal, hypotonic shock with0.075 M KCl, fixation with methanol/acetic acid (3:1 in vol-ume) fixative, and staining with Giemsa. Cell slide prepara-tions were then analyzed for polyploidy.

Tumorigenicity Assay

To examine the tumorigenicity of the immortalizedcells, 2 3 106 cells were injected subcutaneously into the rightflanks of 4-week-old female athymic Balb/c nude mice. As acontrol, athymic nude mice received transplantation of 2 3106 human neuroblastoma-derived SK-N-SH cells. Animalswere examined weekly for the presence of tumors over a 10-month period.

TABLE I. Sequences of PCR primers used

Target mRNA Primer sequence (50 - 30) Size (bp) Tm (8C)

BMP2 CCACCATGAAGAATCTTTGG 575 55

CCACGTACAAAGGGTGTCTC

BMP2RIA GGACATTGCTTTGCCATCATA 424 55

CAGACCCACTACCAGAACTTT

BMP2RII AATGCAGCCATAAGCGAGG 187 55

TGGTACTCTGGTACGGATTCC

Dlx2 TGGCTGATATGCACTCGA 261 55

GCTGGCTTGGTACTGGTAG

EGFP ATGGTGAGCAAGGGCGAGGA 710 58

TTACTTGTACAGCTCGTCCA

GAD67 CGAGGACTCTGGACAGTAGAGG 182 55

GATCTTGAGCCCCAGTTTTCTG

GAPDH CCACCCAGAAGACTGTGGAT 187 58

AGGTCCACCACTGACACGTT

GAT-1 TGGCTGATGGCTCTGTCTTC 122 55

ACAGTGTCTTCGCTGGGCTG

hTERT GAGGAGGAGGACACAGACCC 289 58

CAGGATCTCCTCACGCAGAC

Mash1 GTCGAGTACATCCGCGCGCTG 220 65

AGAACCAGTTGGTGAAGTCGA

nestin AGGATGTGGAGGTAGTGAGA 266 55

TGGAGATCTCAGTGGCTCTT

Sox2 AGTCTCCAAGCGACGAAAAA 410 55

GGAAAGTTGGGATCGAACAA

vGAT ACGACCTCGACTTTGAGCAC 358 55

ATGAGGATCTTGCCGGTGTA

Immortalized Human Neural Progenitors 1219


Electrophysiology

The whole-cell patch-clamp technique was used to re-cord current. Patch electrodes of thick-walled borosilicate glasswere pulled using a PP-83 micropipette puller (Narishige). Thetypical resistance of the glass electrodes was 3–5 MX whenfilled with intracellular pipette solution. The range of resistanceof the whole-cell series was 10–15 MX. Data were collectedusing an Axopatch 200B amplifier (Axon Instruments) andacquired and analyzed using pCLAMP 9 software (AxonInstruments). The extracellular solution contained 150 mMNaCl, 5 mM KCl, 2.5 mM CaCl2, 1 mM MgCl2, and 10 mMHEPES (pH 7.4). For the recording of evoked sodium cur-rents, cell membrane potential was held at 270 mV andstepped up to 130 mV. The patch-pipette solution contained153 mM CsCl, 1 mM MgCl2, and 10 mM HEPES (pH 7.2).In some experiments, tetrodotoxin (TTX, 10 lM) was addedto block the inward current. To detect current through potas-sium channels, the patch-pipette solution contained 153 mMKCl, 1 mM MgCl2, and 10 mM HEPES (pH 7.2).

Calcium Imaging

To identify neurons physiologically, cells in selectedplates were challenged with a depolarizing stimulus of 60 mMKCl, during which their cytosolic calcium level was observed.Cells were loaded with fluo-3-acetoxymethylester (Fluo-3-AM; Molecular Probes) by incubation with 2 lM Fluo-3-AMfor 30 min at room temperature (208C–228C) in Tyrode’smedium containing 136 mM NaCl, 2.7 mM KCl, 1 mMMgCl2, 1.9 mM CaCl2, 5 mM HEPES, and 5.6 mM glucose.After loading with Fluo-3-AM, the cells were washed withTyrode’s medium and incubated for an additional 20 min toallow complete de-esterification of the dye. Ca21 imaging wasperformed using LEICA-NT confocal microscopes (LEICA,Germany), generating images 512 3 512 pixels in size at anacquisition rate of 0.5 frames/sec. Fluo-3-AM was excitedusing a 488-nm argon ion laser, and emitted light > 505 nmwas detected. The Ca21 imaging data in the present studywere obtained at 208C–228C. We required a threefoldincrease in calcium in response to depolarization to assignneuronal identity.

Cell Counting and Statistical Analysis

All cell counts were performed on blind-coded samples.We counted both total cell number, based on DAPI-positivenuclei, and number of cells immunoreactive for differentmarkers in the same field in three independent experiments.One-way analysis of variance (ANOVA) followed by Fisher’spost hoc test was used to assess differences between groups.Data are expressed as means 6 SEMs, and differences wereconsidered significant at P < 0.05.

RESULTS

Immortalization of Human Neural Progenitorsby Overexpression of hTERT

Ventral telencephalon tissue from human fetalbrains was mechanically and enzymatically dissociated to

a single-cell suspension and then plated and transducedwith hTERT retrovirus. The heterogeneous cell culturewas further expanded with low-density replating, thusallowing for the transduced cells to generate polyclonalcell lines. Single-cell clones were then isolated usingcloning discs (Sigma), deposited in each well of 24-wellplates, and propagated in NPC medium with hrEGF andhrbFGF. Most selectants showed multipolar morphology,with uniform distribution on the surface of the flasks(Fig. 2a), a morphology similar to that of primary neuralprogenitors. One of the colonies, which we designatedhSN12W-TERT (human striatum, neural, 12 weeksg.a., hTERT-immortalized), was established and under-went full characterization.

As an initial step toward studying the utility ofhTERT overexpression as a means of immortalizingneural progenitor cells, we examined the expression ofhTERT and the marker genes EGFP and tNGFR in

Fig. 2. hTERT transduction yielded a human neural progenitor cellline. a: Phase-contrast image taken at passage 20 showing the bipolaror unipolar morphology of immortalized cells (magnification 3200).b: Immunofluorescence image taken at passage 20 showing that thesecells expressed NGFR on their membranes (magnification 3400). c:RT-PCR showed that cells expressed EGFP and hTERT at differentpassages. Lane 1 represents passage 2 of untransfected neural progeni-tors; lanes 2–4 represent immortalized cells at passages 11, 18, and24. d: Telomerase activity measured using a TRAP ELISA kitshowed that these cells had a high proliferation of activity [hSN,untransfected neural progenitors; hSNT, immortalized cells; HSNT/RA, immortalized cells induced by RA (1 lM) for 7 days; SK-N-SH,positive control cells; TSR8, synthetic oligonucleotide with eight telo-meric repeats that served as a template for the PCR reaction].

1220 Zhang et al.


hSN12W-TERT cells. Immunoreactivity for NGFRwas clearly present on the membranes of cells (Fig. 2b).RT-PCR analysis also showed that hSN12W-TERTcells coordinated the expression of EGFP and hTERTgenes at different passages (Fig. 2c). To further confirmthe expression of hTERT, the telomerase activity inthese cells was assessed with untransfected neural progen-itors and SK-N-SH cells serving as controls. A high levelof telomerase activity was found in hSN12W-TERTcells at passage 18, but this was dramatically reduced indifferentiated cells. Relatively weaker activity was alsodetected in untransfected neural progenitors (representedas hSNs) at passage 2 (Fig. 2d). These experiments con-firmed the expression of the transfected hTERT gene inhSN12W-TERT cells.

To assess the proliferation capacity of hSN12W-TERT cells, we carried out flow-cytometry analysis ofthe cell cycle. The proportion of cells in the G0/G1pool was 89% at passage 12 and 77.25% at passage 30;the proportion of cells in the G2/M/S pool was 10.35%

at passages 12 and 21.38% at passage 30 (Fig. 3a,b). Totest the retention of mitotic competence, cultured cellsat passages12 and 30 were exposed to BrdU for differentlengths of time (24, 48, 72, and 96 hr). The percentageof BrdU1 cells was correlated with the length of time toincorporate (r2 5 0.98). Forty-eight hours after platingin the presence of hrEGF and hrbFGF, about 22% and27.3% of the cells were BrdU1 (Fig. 3c,d) and slightlyhigher, 35% and 37% of the cells were Ki67 immunore-active at passages 12 and 30, respectively (Fig. 3e,f). Thegrowth rates of these cells remained similar in long-termculture, as shown in Figure 3g. hSN12W-TERT cellshave been propagated continuously for more than36 months and expanded through 40 passages to date,each of which we calculate to have included 2–3 popu-lation doublings (PDs) with an estimated populationdoubling time of about 4.5 days. Thus, we estimate thatthis line has undergone about 80–120 PDs. Theseexperiments indicated that hSN12W-TERT cellsbecome immortalized after overexpression of hTERT.

Fig. 3. hSN12W-TERT cells retained mitotic and karyotypic stabil-ity in long-term culture. Flow cytometric analysis of PI-labeled cellsrevealed that both (a) early-passage cells (passage 12) and (b) me-dium-passage cells (passage 30) had normal DNA complements withno hyperploidization. Fluorescence images of BrdU (c) and Ki67 (e)immunoreactivity during an early passage (P12) showing that cells

retained their mitotic ability. d, f: Cell nuclei labeled with DAPI atthe same magnification as the images in c and e (magnification3400). g: Growth rate of hSN12W-TERT cells at passages 12 and30. h: Karyotypic analysis of hSN12W-TERT cells (n 5 20)revealed that they had a normal diploid karyotype.



hTERT-Immortalized Neural Progenitors RetainEuploidy and Remain Karyotypically Normal

To verify that hTERT had immortalized the neuralprogenitor cells without causing neoplastic transforma-tion, we first assessed their karyotypes. Metaphases fromhSN12W-TERT cells at passages 12 and 30 were pre-pared and G-banded. Metaphases of both passages werefound to be diploid with 23 pairs of human chromo-somes (20 of 20; Fig. 3h). Neither numerical nor struc-tural chromosomal abnormalities were detected withextended passage in vitro. We next used flow-cytometricanalysis to assess the DNA content of hSN12W-TERTcells and found that the overwhelming majority of cellswere diploid, with no evidence of hyperploidization ateither passage and with no increase in noneuploidy atpassages 12 and 30 (Fig. 3a,b). Finally, we used xenograftanalysis to further evaluate the possibility of tumorige-nicity. Forty weeks after transplantation of passage 12hSN12W-TERT cells, no tumors were found at theinjection sites in Balb/c nude mice (n 5 5) by gross orhistological examination at autopsy. In contrast, SK-N-SH cells gave rise to tumors at the dorsal site in fiveimmunodeficient nude mice 2 weeks after being inocu-lated. These data suggest that hSN12W-TERT cellswere neither aneuploid nor anaplastic.

hSN12W-TERT Cells Possess the PotentialProperties of Neural Progenitor Cells

To determine if hSN12W-TERT cells maintainedthe properties of neural progenitor cells, we first testedtheir expression of the transcription factor Sox2 and thecytoskeletal proteins nestin and vimentin, acceptedmarkers for neuroepithelial progenitors. The hSN12W-TERT cells stably expressed mRNA for nestin and Sox2during long-term proliferation, as shown by RT-PCR(Fig. 4a). They also produced nestin and vimentin asshown by immunocytochemistry (Fig. 4b,c). We thenanalyzed their differentiation potential, an important as-pect of neural progenitor cells. Seven days after thewithdrawal of growth factors, most cells had differenti-ated into GFAP1 astrocytes, with a few differentiatinginto GalC1 oligodendrocytes (data not shown). A signif-icant percentage of cells differentiated into neuronsexpressing b-tubulin III1. When the cells hSN12W-TERT were treated with 1 lM RA, they rapidlyshowed neuronal differentiation. Many phase-bright cellswith rounded cell bodies and long processes with b-tubulin III immunoreactivity were observed 3 days afterthe initiation of differentiation. After 7 days of RA treat-ment, about 35% of the cells were GFAP1 astrocytes(Fig. 4d,e), 60% cells exhibited b-tubulin III–positiveimmunoreactivity (Fig. 4f,g), and a small of percentagewere positive for MAP2a/b (Fig. 4h). Two weeks later,the number of cells showing MAP2a/b immunoreactiv-ity cells had risen dramatically, to 45%. EGFP staining(Fig. 4i) was confined to immortalized cells. We alsoexamined the effects of several factors known to pro-mote neuronal differentiation on the hSN12W-TERT

cells (Fig. 4j). The addition of RA or BMP2 significantlyincreased the number of cells differentiating into neuronscompared with those in the control medium and theneurotrophins BDNF and GDNF. This result indicatesthat hSN12W-TERT cells possess the potential proper-ties of neural progenitor cells.

Generation of Functional Neuronsfrom hSN12W-TERT Cells

To examine whether the differentiated neuronshad electrophysiological function, cells differentiated for1, 3, 5, 7, and 14 days in the presence of RA or for 7days in the presence of BMP2 that had neuronal mor-phology were selected for electrophysiological record-ings. Substantial voltage-dependent potassium currentwas observed in most cells from the first day, whereassodium currents was only observed in cells on the sev-enth day after treatment. The voltage-gated sodium cur-rent (244 6 68 pA; n 5 10 cells; Fig. 5a,b) was rapidand blocked by 10 lM TTX (5 of 5 cells), indicatingthat all the current was TTX sensitive. Two kinds ofpotassium current were detected (2,810 6 840 pA; n 5

Fig. 4. Immortalized cell line possessing the properties of neuralprogenitor cells. a: RT-PCR showed expression of the transcriptionfactor Sox2 and nestin by cells at different passages (hSN, passage 2of primary neural progenitors; 1–4, passages 11, 18, 24, and 40 ofimmortalized cells). Immunofluorescence showed expression of nestin(b, passage 12) and vimentin (c, passage 40) by immortalized cellsunder proliferative conditions. Immortalized cells at passage 12 show-ing expression of GFAP (d), b-tubulin III (f), MAP2a/b (h), andEGFP (i) after treatment with RA (1 lM) for 7 days in vitro. e, g:DAPI counterstaining of nuclei in a field of e and f. j: Percentage ofcells immunoreactive for b-tubulin III and GFAP after differentiationfor 7 days. Data were obtained from triplicate experiments and areexpressed as means 6 SEMs (*P < 0.05, **P < 0.01, one-wayANOVA and Fisher’s post hoc test).

1222 Zhang et al.


10 cells), a delayed rectifier-type K1 current with slightinactivation (7 of 10; Fig. 5c) and A-type potassium cur-rents (3 of 10; Fig. 5d), which delayed rectifier inactiva-tion within 10 msec. Some differentiated cells expressedboth INa and IK, but the relative magnitude of the twocurrents varied widely. Some cells expressed INa or IKalone (n 5 6), whereas other expressed neither.

In addition, neurons generated from hSN12W-TERT cultures exhibited neuronal calcium responses todepolarization. When cultures (n 5 5) were loaded withthe calcium indicator dye Fluo-3-AM and exposed to 60mM KCl, morphologically mature neuronlike hSN12W-TERT cells displayed a rapid and reversible more thanthreefold elevation of cytosolic calcium in response toK1, consistent with the activity of neuronal voltage-gated calcium channels (Fig. 5e).

BMP2 Promotes Differentiation of hSN12W-TERT Cells into a GABAergic Phenotype

To determine the neurochemical phenotype of dif-ferentiated neurons, region-specific developmental tran-scription factors involved in the lineage restriction of thetelencephalic area during embryonic development wereexamined. hSN12W-TERT cells expressed Mash1, aknown neural bHLH gene which is expressed in theproliferative ventral telencephalon (Casarosa et al.,1999). The differentiated hSN12W-TERT cells, how-ever, expressed the specific homeodomain factor Dlx2and glutamic acid decarboxylase 67 (GAD67), a keyenzyme that synthesizes GABA, as well as the transporterproteins GABA transporter-1 (GAT-1) and vesicularGABA transporter (vGAT) (Fig. 6a). After differentia-tion in the presence of BMP2, about 61% of all cells(Fig. 6e) became GABA-positive neurons with strongimmunostaining in the somas and axons (Fig. 6b).These neurons were also stained b-tubulin III immuno-positive (Fig. 6c,d). Other neuronal markers of interest,such as choline acetyltransferase (a marker of choliner-gic neurons) and tyrosine hydroxylase (a marker of cat-echolaminergic neurons), were not observed in differ-entiated cultures.

To investigate the mechanism underlying theactions of BMP2 on hSN12W-TERT cells, the expres-sion of BMP2 and the BMP2 receptor BMP2R wasexamined (Fig. 7). RT-PCR results revealed that BMP2mRNA was only detectable in control cultures, but itwas up-regulated within 3 days of BMP2 exposure. Dur-ing continuous BMP2 exposure, the expression ofBMP2 mRNA increased, whereas the expression ofBMP2 receptor isoforms BMP2RIA and BMP2RIIremained unchanged.

DISCUSSION

In this article we report the generation of a newtelomerase-immortalized human neural progenitor cellline, hSN12W-TERT. This cell line maintains hightelomerase activity and proliferates for more than 40 pas-sages (with at least 80–120 cell population doublings) invitro without replicative senescence or phenotypic orkaryotypic changes in the presence of mitogens. In addi-tion, our progenitor cells are nonanaplastic, with contactinhibition, and do not generate detectable subcutaneousmasses in nude mice. The hSN12W-TERT cell linedescribed in this report may be legitimately considered ahuman neural progenitor cell line that shares some pro-perties with other neural progenitor cell lines (Villaet al., 2000; Bai et al., 2004; Cacci et al., 2007), such asretaining the capacity to divide without a change in itsundifferentiated phenotype in the presence of mitogensand its potential to differentiate into neurons and gliafollowing withdrawal of mitogens. However, this cellline also displays distinct properties: (1) it is derived fromthe embryonic human ventral telencephalon, maintainsMash1 expression and has the gene profile characteristicsof the ventral telencephalic area after multiple passages in

Fig. 5. hSN12W-TERT cells gave rise to mature neurons. a–d:Electrophysiological properties of passage 20 hSN12W-TERT cellstreated with BMP2 (1 ng/mL) for 7 days. e: Calcium imaging ofpassage 12 cells treated with RA (1 lM) for 7 days. a–c: Whole-cellcurrents were elicited by voltage steps ranging from 270 to 1100mV in 10-mV steps. a: Membrane currents were recorded with CsClInner Solution. b: Statistics of the sodium current, depending on thestimulus potential. Two types of potassium current were recorded (c,d). e: Ca21 influx participated in KCl effects; fluo-3-AM fluores-cence intensity showed rapid and reversible increases in cytosolic cal-cium after KCl addition (on exposure to 60 mM KCl).



vitro; (2) it coexpresses the markers EGFP and NGFR,enabling facile monitoring of cells after transplantation;(3) it gives rise to neurons that achieve electrophysiolog-ical competence; (4) it differentiates into neurons that

are predominantly GABAergic; and (5) its cells expressthe BMP2 receptor and maintain competence forBMP2-induced neuronal differentiation. Our findingsindicate that hSN12W-TERT cells have NPC propertiesand could be an interesting source of GABAergic neu-rons for future basic and applied research.

Telomeric shortening occurs with a fall in the levelof telomerase, which acts as a brake on cell division andexpansion. Telomeres are synthesized by telomerase, anenzyme composed of RNA and catalytic protein sub-units called hTERC and hTERT in humans (Fenget al., 1995; Nakamura and Cech, 1998). Telomerase,acting as a reverse transcriptase, produces telomericrepeats using a template provided by hTERC (Greiderand Blackburn, 1989). This enzymatic activity correlateswith hTERT expression, implicating this catalytic subu-nit as the rate-limiting component of the telomerase ho-loenzyme (Nakamura and Cech, 1998). hNPCs typicallydown-regulate telomerase activity to undetectable levelsby a gestational age of 16 weeks (Wright et al., 1996;Ulaner and Giudice, 1997) or during early passages invitro (Ostenfeld et al., 2000). Thus, ectopic expressionof hTERT in normal hNPCs confers telomerase activity,

Fig. 6. hSN12W-TERT cells generated GABAergic neurons. a:RT-PCR showing expression of mash1, Dlx2, GAD67, vGAT, andGAT-1 by hSN12W-TERT cells at passage 20 [lane 1, marker (M);lane 2, expanded cells (C); lanes 3–5, differentiated cells induced byBMP2 (1 ng/mL) for 3, 5 and 7 days in vitro, respectively]. GAPDHwas used as an internal control for each sample. b–d: Immunofluo-rescence images show expression of GABA and b-tubulin-III by dif-

ferentiated hSN12W-TERT cells at passage 20, as induced by BMP2for 7 days (magnification 3400 in b and c). e: BMP2 treatment sig-nificantly increased the number of GABA-positive cells, to 61% of allcells, after 7 days in vitro. Data were obtained from triplicate experi-ments and are expressed as means 6 SEMs (*P < 0.05, by one-wayANOVA and Fisher’s post hoc test).

Fig. 7. BMP2 exposure may activate a positive feedback loop ofBMP signaling in hSN12W-TERT cells. RT-PCR showing expres-sion of BMP2, BMP2RIA, and BMP2RII by hSN12W-TERT cellsat passage 20. Expression of BMP2 mRNA increased after cells wereexposed to BMP2, whereas expression of BMP2RIA and BMP2RIImRNA remained unchanged. GAPDH was used as an internal con-trol for each sample.

1224 Zhang et al.


stabilizes telomere length, and directly immortalizessome of these hTERT-expressing cells (Natesan, 2005).

A major concern regarding genetic immortalizationstrategies, such as the one used in the present study, is thesafety of the generated cell lines. Although the debateabout the role of telomerase in cell transformation contin-ues, our results demonstrate that hSN12W-TERT cellsare stable and do not undergo transformation. First, thehSN12W-TERT cells retained a normal karyotype evenafter more than 40 passages in culture, without numericalor structural chromosomal abnormalities, as shown by ourchromosomal analysis. Second, the telomerase activity ofhSN12W-TERT cells dramatically decreased when thecells were induced to differentiate by the withdrawal ofmitogens, consistent with previous observations inanother cell line (Villa et al., 2004; Cacci et al., 2007).Third, no gross or histological tumor formation wasobserved 40 weeks after transplantation of the hSN12W-TERT cells into five immunodeficient nude mice.

Previous studies have demonstrated that geneticallypropagated lines of human neural progenitor cells allowfor the maintenance of the inherent differentiationpotential of hNPCs (Roy et al., 2004; Cacci et al.,2007). Consistent with these observations, characteriza-tion of the hSN12W-TERT cells in the present studyshowed them to possess the properties of NPCs. Forexample, the hSN12W-TERT cells proliferated rapidlywith the expression of nestin, vimentin, and Sox2, with-out undergoing differentiation, in the presence of themitogens bFGF and EGF. However, they differentiatedinto glia and neurons after removal of mitogens. Moreimportantly, the differentiated neurons were electrophy-siologically functional, showing inward TTX-sensitiveand -resistant Na1 currents and an inwardly rectifyingK1 current and global, spontaneous calcium spikes ofKCl-induced depolarization. Increasing the number ofneurons generated from human neural stem cells is of in-terest to basic scientists, drug companies, and cell therapyprograms. Different neurotrophic factors have beentested for any effect on the differentiation of humanneural stem cells (Sah et al., 1997; Caldwell et al., 2001).The differentiation of hSN12W-TERT cells into neu-rons was accelerated by the treatment with RA orBMP2, which is consistent with the results of previousstudies. RA has been described as a potent inducer ofneuronal differentiation (Pleasure and Lee, 1993; Sahet al., 1997). BMP2 promotes the survival and differen-tiation of embryonic rat striatal GABAergic neurons inculture (Hattori et al., 1999). Furthermore, our resultssuggest that hSN12W-TERT cells retained their regionalidentity, even after multiple in vitro expansions. UsingRT-PCR, we found that the hSN12W-TERT cellsexpressed the genes encoding the basic helix-loop-helixtranscription factor Mash1 and the homeodomain tran-scription factor Dlx2. The proneural protein Mash1 hasalready been shown to be essential for the production ofneuronal precursor cells in the embryonic ventral telen-cephalon (Casarosa et al., 1999; Horton et al., 1999). Inaddition, Mash1 expression in embryonic progenitors

from the telencephalon is necessary for the survival and/or differentiation of GABAergic interneurons and mayregulate the expression of the Dlx homeodomain proteinfamily, members of which are needed to produce GABA(Fode et al., 2000; Parras et al., 2002). Our data showedthat the expression of Mash1 and Dlx2 increased on dif-ferentiation induced by BMP2 and that this increasedexpression was coincident with increasing expression ofGAD67, the key enzyme involved in the synthesisGABA, as well as vGAT and the high-affinity trans-porter protein GAT-1. Furthermore, about 61% of allcells were GABA immunoreactive following exposure toBMP2 for 7 days, similar to the percentage of GABAer-gic neurons generated from the immortalized striatalneural stem cell line ST14A (Bosch et al., 2004). Inorder to explore the mechanism of BMP2-induced dif-ferentiation, the expression of BMP2 and its receptorswas examined in hSN12W-TERT cells. Our results sug-gest that hSN12W-TERT cells express two kinds ofreceptors for BMP2, BMP2RIA and BMP2RII, and thatBMP2 exposure may activate a positive feedback loop ofBMP signaling by elevating the spontaneous expressionof additional BMP2. With regard to the interactionbetween BMP2 and Mash1 during neuronal differentia-tion, the study by Lo et al. (1997) points to a feedbackinteraction between these proteins in a reciprocal man-ner to promote neurogenesis. BMP2 is required for boththe induction and maintenance of Mash1 expression, andcontinued expression of Mash1 in progenitor cells main-tains their capacity to respond to BMP2. This linkagecreates a self-reinforcing positive-feedback loop that mayhelp to drive the cells toward a neuronal fate. The basisfor this irreversible change found in our study is notunderstood but will be revealed by studies of a loss-of-function mutation in the future.

In conclusion, the immortalized human CNS cellline described in this article can be readily expanded inproliferative growth conditions, providing a renewable,homogeneous source of cells. These cells can then bedifferentiated over a relatively short period into glia and/or neurons that express appropriate phenotypic markers.Thus, this human CNS cell line offers significant advan-tages for CNS drug discovery. Moreover, the reportedcell lineage studies provide a basis for investigating themolecular mechanisms that regulate cell fate in thehuman CNS.

ACKNOWLEDGMENTS

We thank Dr. Qi-Lin Cao at the Spinal CordInjury Research Center, University of Louisville, forcritical reading of the manuscript and Professor AlexZhang for providing the retrovirus-producing cellPG13/JH1/hTERT.

REFERENCES

Bai Y, Hu Q, Li X, Wang Y, Lin C, Shen L, Li L. 2004. Telomerase

immortalization of human neural progenitor cells. Neuroreport 15:245–

249.



Berghuis P, Dobszay MB, Ibanez RM, Ernfors P, Harkany T. 2004.

Turning the heterogeneous into homogeneous: studies on selectively

isolated GABAergic interneuron subsets. Int J Dev Neurosci 22:533–

543.

Bosch M, Pineda JR, Sunol C, Petriz J, Cattaneo E, Alberch J, Canals

JM. 2004. Induction of GABAergic phenotype in a neural stem cell

line for transplantation in an excitotoxic model of Huntington’s disease.

Exp Neurol 190:42–58.

Cacci E, Villa A, Parmar M, Cavallaro M, Mandahl N, Lindvall O, Mar-

tinez-Serrano A, Kokaia Z. 2007. Generation of human cortical neu-

rons from a new immortal fetal neural stem cell line. Exp Cell Res

313:588–601.

Caldwell MA, He X, Wilkie N, Pollack S, Marshall G, Wafford KA,

Svendsen CN. 2001. Growth factors regulate the survival and fate of

cells derived from human neurospheres. Nat Biotechnol 19:475–479.

Carpenter MK, Cui X, Hu Z, Jackson J, Sherman S, Seiger A, Wahlberg

LU. 1999. In vitro expansion of a multipotent population of human

neural progenitor cells. Exp Neurol 158:265–278.

Casarosa S, Fode C, Guillemot F. 1999. Mash1 regulates neurogenesis in

the ventral telencephalon. Development 126:525–534.

Cheng L, Du C, Murray D, Tong X, Zhang YA, Chen BP, Hawley

RG. 1997. A GFP reporter system to assess gene transfer and expression

in viable human hematopoietic progenitor cells. Gene Ther 4:1013–

1022.

Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP,

Adams RR, Chang E, Allsopp RC, Yu J. 1995. The RNA component

of human telomerase. Science 269:1236–1241.

Fode C, Ma Q, Casarosa S, Ang SL, Anderson DJ, Guillemot F. 2000. A

role for neural determination genes in specifying the dorsoventral iden-

tity of telencephalic neurons. Genes Dev 14:67–80.

Goldman S. 2005. Stem and progenitor cell-based therapy of the human

central nervous system. Nat Biotechnol 23:862–871.

Greider CW, Blackburn EH. 1989. A telomeric sequence in the RNA of

Tetrahymena telomerase required for telomere repeat synthesis. Nature

337:331–337.

Harley C, Futcher A, Greider C. 1990. Telomeres shorten during aging

of human fibroblasts. Nature 345:458–460.

Hattori A, Katayama M, Iwasaki S, Ishii K, Tsujimoto M, Kohno M.

1999. Bone morphogenetic protein-2 promotes survival and differentia-

tion of striatal GABAergic neurons in the absence of glial cell prolifera-

tion. J Neurochem 72:2264–2271.

Hitoshi S, Tropepe V, Erker M, Van der Kooy D. 2002. Neural stem

cell lineages are regionally specified, but not committed, within distinct

compartments of the developing brain. Development 129:233–244.

Horton S, Meredith A, Richardson JA, Johnson JE. 1999. Correct coor-

dination of neuronal differentiation events in ventral forebrain requires

the bHLH factor MASH1. Mol Cell Neurosci 14:355–369.

Jain M, Armstrong RJE, Tyers P, Barker RA, Rosser AE. 2003.

GABAergic immunoreactivity is predominant in neurons derived from

expanded human neural precursor cells in vitro. Exp Neurol 182:113–

123.

Kim NW, Wu F. 1997. Advances in quantification and characterization

of telomerase activity by the telomeric repeat amplification protocol

(TRAP). Nucleic Acids Res 25:2595–2597.

Lindvall O, Kokaia Z. 2006. Stem cells for the treatment of neurological

disorders, Nature 441:1094–1096.

Lo L, Sommer L, Anderson DJ. 1997. MASH1 maintains competence

for BMP2-induced neuronal differentiation in post-migratory neural

crest cells. Curr Biol 7:440–450.

Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB,

Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA,

Stewart SA, Hahn WC. 2003. Telomerase maintains telomere structure

in normal human cells. Cell 114:241–253.

Muotri AR, Gage FH. 2006. Generation of neuronal variability and

complexity. Nature 441:1087–1093.

Nakamura TM, Cech TR. 1998. Reversing time: origin of telomerase.

Cell 92:587–590.

Natesan S. 2005. Telomerase extends a helping hand to progenitor cells.

Trends Biotechnol 23:1–3.

Ostenfeld T, Caldwell MA, Prowse KR, Linskens MH, Jauniaux E,

Svendsen CN. 2000. Human neural precursor cells express low levels

of telomerase in vitro and show diminishing cell proliferation with

extensive axonal outgrowth following transplantation. Exp Neurol

164:215–226.

Ostenfeld T, Joly E, Tai YT, Peters A, Caldwell M, Jauniaux E, Svend-

sen CN. 2002. Regional specification of rodent and human neuro-

spheres. Brain Res Dev Brain Res 134:43–55.

Parras CM, Schuurmans C, Scardigli R, Kim J, Anderson DJ, Guillemot

F. 2002. Divergent functions of the proneural genes Mash1 and Ngn2

in the specification of neuronal subtype identity. Genes Dev 16:324–

338.

Pleasure SJ, Lee VM. 1993. NTera 2 cells: a human cell line which dis-

plays characteristics expected of a human committed neuronal progeni-

tor cell. J Neurosci Res 35:585–602.

Roy NS, Nakano T, Keyoung HM, Windrem M, Rashbaum WK,

Alonso ML, Kang J, Peng W, Carpenter MK, Lin J, Nedergaard M,

Goldman SA. 2004. Telomerase immortalization of neuronally re-

stricted progenitor cells derived from the human fetal spinal cord. Nat

Biotech 22:297–305.

Sah DW, Ray J, Gage FH. 1997. Bipotent progenitor cell lines from the

human CNS. Nat Biotechnol 15:574–580.

Sawamoto K, Nakao N, Kakishita K, Ogawa Y, Toyama Y, Yamamoto

A, Yamaguchi M, Mori K, Goldman SA, Itakura T, Okano H. 2001.

Generation of dopaminergic neurons in the adult brain from mesence-

phalic precursor cells labeled with a nestin-GFP transgene. J Neurosci

21:3895–3903.

Svendsen CN, ter Borg MG, Armstrong RJ, Rosser AE, Chandran S,

Ostenfeld T, Caldwell MA. 1998. A new method for the rapid and

long term growth of human neural precursor cells. J Neurosci Methods

85:141–152.

Ulaner G, Giudice L. 1997. Developmental regulation of telomerase ac-

tivity in human fetal tissues during gestation. Mol Human Reprod

3:769–773.

Vescovi AL, Parati EA, Gritti A, Poulin P, Ferrario M, Wanke E, Fro-

lichsthal-Schoeller P, Cova L, Arcellana-Panlilio M, Colombo A, Galli

R. 1999. Isolation and cloning of multipotential stem cells from the

embryonic human CNS and establishment of transplantable human

neural stem cell lines by epigenetic stimulation. Exp Neurol 156:71–83.

Villa A, Navarro-Galve B, Bueno C, Franco S, Blasco MA, Martinez-

Serrano A. 2004. Long-term molecular and cellular stability of human

neural stem cell lines. Exp Cell Res 294:559–570.

Villa A, Snyder EY, Vescovi A, Martinez-Serrano A. 2000. Establishment

and properties of a growth factor-dependent, perpetual neural stem cell

line from the human CNS. Exp Neurol 161:67–84.

Wright W, Piatyszek M, Rainey W, Byrd W, Shay J. 1996. Telomerase

activity in human germline and embryonic tissues and cells. Dev Genet-

ics 18:173–179.

Zhang H, Zhao Y, Zhao C, Yu S, Duan D, Xu Q. 2005. Long-term

expansion of human neural progenitor cells by epigenetic stimulation in

vitro. Neurosci Res 51:157–165.

1226 Zhang et al.


Documents

Immortalized human neural progenitor cells from the ventral telencephalon with the potential to differentiate into GABAergic neurons