Upload
independent
View
0
Download
0
Embed Size (px)
Citation preview
Phycologia (2003) Volume 42 (2), 109-122 Published 29 April 2003
Identification of north-western Atlantic Porphyra (Bangiaceae, Bangiales) based on sequence variation in nuclear SSU and plastid rbcL genes
ANITA S. KLEINl,2* , ARTHUR C. MATHIESON3.4, CHRISTOPHER D. NEEFUS3, DANIELLE F. CAIN2, HEATHER A. TAYLORl,
BRIAN W. TEASDALE3, ANDREW L WEST2, EDWARD J. HEHRE4, JULIET BRODIE5, CHARLES YARlSH6 AND AARON L WALLACEl
lDepartment of Biochemistry and Molecular Biology, University of New Hampshire, Durham, NH 03824, USA
2Graduate Program in Genetics, University of New Hampshire, Durham, NH 03824, USA
3Department of Plant Biology, University of New Hampshire, Durham, NH 03824, USA
4Jackson Estuarine Laboratory, University of New Hampshire, Durham, NH 03824, USA
5Bath Spa University College, Bath, BA2 9BN, England, UK
6Department of Ecology and Evolutionary Biology, University of Connecticut Stamford, CT 06901, USA
A.S. KLEIN, A.C MATHIESON, CD. NEEFUS, D.F CAIN, H.A. TAYLOR, B .W. TEASDALE, A.L WEST, E.J. H EHRE, J. BRODIE,
C Y ARISH AND A.L WALLACE. 2003. Identification of north-western Atlantic Porphyra (Bangiaceae, Bangiales) based on
sequence variation in nuclear SSU and plastid rbcL genes. Phycologia 42: 1 09- 1 22.
Six species of Porphyra have commonly been recognized in the north-western Atlantic from Long Island Sound to the
Canadian Maritimes: P. amplissima, P. leucosticra, P. linearis, P. minima, P. purpurea, and P. umbilicalis. Distinguishing
them with certainty has been problematic. A DNA-based system of molecular identification was developed using partial sequences of the nuclear small subunit ribosomal RNA gene (SSU) or the plastid ribulose-I ,S-bisphosphate carboxylase
oxygenase large subunit gene (rbcL). Multiple samples of each taxon were surveyed for intraspecific variation. Intraspecific
SSU divergences for Porphyra 'Ieucosficta', P. 'miniata', P. 'umbilicalis', and P. 'purpurea' ranged from 0% to 1 %. There
was more variation for P. 'all1plissima' (0-2. 1 %) and P. 'linearis' (0-3.5%); however, each taxon was monophyletic. No
intraspecific differences were observed for these taxa in rbcL (one to eight samples per taxon). These sequences were
compared with P. yezoensis US I, introduced to Maine, and with P. 'dioica', a north-east Atlantic Porphyra easily confused
with P. 'purpurea'. To discriminate between P. 'purpurea', P. 'umbilicalis', and P. 'Ieucosticla' , SSU variation was used
to design primers for the Allele-Specific Polymerase Chain Reaction®>. With molecular tools, we could classify over 80%
of the monostromatic specimens surveyed, but the residue of unidentifiable specimens may indicate the existence of further
monostromatic species in the north-west Atlantic. Porphyra 'purpurea' was found to occur further south than previously
recorded. A morphologically cryptic Porphyra was discovered at Herring Cove, Nova Scotia, Canada.t Phylogenetic anal
yses using SSU or rbcL sequences showed 'soft incongruence' between gene trees, i.e. the topologies of the phylograms
were similar but not identical, with only weak to moderate bootstrap support for the nodes that differed. Both trees strongly
supported a clade including P. 'purpurea', P. 'umbilicalis', P. 'linearis', and P. 'dioica'. Porphyra sp. Herring Cove was
allied with the remaining Porphyra taxa in the SSU tree. The rbcL phylogeny was less well resolved, consisting of a
polytomy of a P. 'purpurea'-P. 'umbilicalis'-P. 'linearis'-P. 'dioica' clade, Porphyra sp. Herring Cove, a clade comprising
P. 'amplissima' and P. 'minima', and a P. 'suborbiculata'-P. 'Ieucosticla'-P. yezoensis clade.
INTRODUCTION
The blade-forming red algal genus Porphyra C. Agardh grows
on rocky, cold- to warm-temperate shorelines throughout the
world (Brodie et ai. 1 996; Yoshida 1997) and is the basis of
a multibillion-dollar aquaculture industry in Asia (Hanisak
1 998). In the early 1990s, Coastal Plantations Inc. established
a small commercial nori aquaCUlture operation in northern
Maine, USA, which was licensed to grow culti vars U5 l and
H25 of the north-west Pacific taxon P. yezoensis Ueda (Levine
1998). Currently, there is considerable interest in fostering
Porphyra aquaCUlture in New England (USA), based on in
digenous Porphyra species (Yarish et al. 1 998, 1 999), which
immediately prompts the question of which species occur in
this region. Prior to this study, s ix species of Porphyra had
been recorded from New England and the Canadian Maritime
Provinces: P. amplissima (Kjellman) Setchell & Hus in Hus,
P. leucosticta Thuret in Le Jolis, P. linearis Grevil le, P. min
iata (c. Agardh) C. Agardh, P. purpurea (Roth) c. Agardh,
and P. umbilical is Kiitzing (Taylor 1 957; Schneider et al.
1 979; Mathieson & Hehre 1986; Bird & McLachlan 1 992;
Hehre & Mathieson 1 993; Silva 1 999). All but P. miniata
were originally described from locations in the north-east At
lantic (http://www.algaebase.com).
* Corresponding author ([email protected]).
t Note added in proof: Porphyra sp. Herring Cove has been designated P. birdiae CD. Neefus & A.C Mathieson. [Neefus CD., Mathieson A.C, Klein A.S. , Teasdale B . , Bray T & Yarish C 2002. Porphyra birdiae sp. nov. (Bangiales, Rhodophyta): a new species from the northwest Atlantic. Algae 1 7: 203-2 1 6. ] .
The present taxonomy of Porphyra is based largely on mor
phological characters, including the colour, size, shape and
thickness of the thallus, cell dimensions, reproductive cell di
vision sequences, and the distribution of fertile thallus tissues.
The cUiTently recognized north-west Atlantic species of Por
phyra can usually be distinguished using these characters, ex
cept for vegetative or juvenile specimens. For Porphyra, blade
morphology is extremely simple and there are few morpho-
1 09
1 10 Phycologia, Vol. 42 (2), 2003
logical characters on which to base species identification
(Lindstrom & Cole 1 993; Brodie et at. 1 996). In some instanc
es, both monoecious and dioecious fronds have been attributed
to the same species (Taylor 1957 ; B ird & McLachlan 1992)
and different karyotypes have been reported for what is cur
rently a single taxon (Kapraun & Freshwater 1987; Kapraun
et at. 1 99 1 ; Lindstrom & Cole 1992; Mitman 1 992; Mitman
& van der Meer 1994; Wilkes el at. 1999). These contradic
tory patterns l ikely result from cryptic variabil ity, sexual dif
ferences, polyploidy, or misidentification. Accordingly, Lind
strom & Cole ( 1993) recommend that at least one nonmor
phological diagnostic character should be used to verify the
identification of individual specimens; DNA-based molecular
markers provide such characters.
Because of the considerable taxonomic confusion and mis
identification of many older and recent herbarium accessions
of Porphyra, and because gene sequences have not been ob
tained from type specimens, we have chosen to qualify our
identifications by putting the species epithet in single quotes.
A similarly cautious approach to authenticating source mate
rial (i .e. requiring DNA to be obtained from type material
before identification is accepted as certain) was previously
advocated by Brodie et at. ( 1998). The same conservative
approach has also been used when refening to Porphyra se
quences obtained from GenBank, when the source material
was not from type specimens (Freshwater et at. 1994; Ragan
et at. 1994).
Bird el al. ( 1992) noted that, compared to higher plants and
green algae, several genera of red algae have unusual ly high
levels of sequence variation (� 1 5 %) for the nuclear-encoded
small subunit ribosomal RNA (SSU). Regions of the gene that appear to be phylogenetically informative i ncl ude the S' end
of SSU (approximately from helix 6 to helix 19) and the mid
dle of the gene (helices 19-27). Both regions have been
shown to vary between species (C.J. Bird, personal commu
nication), and do not include a group I intron present in hel ix
5 1 at the 3' end of the gene (Sti l ler & Waaland 1 993; Oliveira
& Ragan 1 994; Kunimoto et at. 1999b). The intron exhibits
intrapopulation variabil ity (Stil ler & Waaland 1993; Oli veira
& Ragan 1994), but its phylogenetic propelties and uti l ity as
a species-specific marker are as yet unclear (Muller et at.
1998, 200 I ; Kunimoto et at. 1 999b). Sequences of SSU have
been previously determined for several North Atlantic Por
phyra taxa, including specimens identified as P. 'amptissima',
P. 'leucosticta', P. 'miniata', and P. 'purpurea' (Ragan et at.
1994; Oliveira et at. 1 995). The SSU sequences (GenBank
L36049, L26202) for two samples of P. 'umbilicalis' collected
from Nova Scotia (Ragan et at. 1 994) differed by 0.3%, hint
ing that there was a low level of intraspecific sequence vari
ation for this gene.
The plastid-encoded, ribulose-I,5-bisphosphate carboxyl
ase-oxygenase large subunit (rbcL) gene has been shown to
be phylogenetically informative at the family, genus, and spe
cies levels in the Rhodophyta (Freshwater et at. 1994). At the
beginning of our studies in 1 995, only three sequences of
Porphyra rbcL were available in GenBank, including a ful l
length sequence for P . 'purpurea' (Reith & Munholland 1 993)
and partial sequences from P. rosengurtii J. Coli & J. Cox
and a topotype specimen of P. 'carolinensis' J. Coli & J . Cox
(Freshwater et at. 1 994). Porphyra suborbiculata Kjellman
has recently been shown to include P. carolinensis and the
New Zealand taxon P. lilliputiana W. Nelson, G. Knight & M. Hawkes (Broom et at. 2002).
Phylogenetic analyses of the Bangiophyceae have previ
ously been conducted based o n the sequences o f a single or
at most two examples of each species and this limited sam
pl ing is inadequate to assess intraspecific variation or to reveal
cryptic variation in morphologically similar taxa (Braverstock
& Mortiz 1 996). The number of samples or populations per
taxon needed to rel iably resolve relationships among groups
depends on several factors, including the amount of sequence
polymorphism evident for each species, the evolutionary dis
tance between taxa, and the relative rate of evolution of the
gene(s) being examined. Using isozyme analysis, Lindstrom
& Cole ( 1 992, 1 993) noted that several Porphyra species have
such high levels of intraspecific variation that the current tax
onomy is called into question; some of these taxa may rep
resent species complexes.
The primary objective of thi s study was to develop molec
ular screens that can reliably and objectively sort specimens
of north-west Atlantic Porphyra into taxa. The screens are
based on interspecific sequence differences in the SSU and
rbcL genes. An additional goal was to re-examine the phy
logenetic relationships among north-west Atlantic Porphyra.
We assessed intraspecific sequence variation from SSU and
rbcL of north-west Atlantic Porphyra taxa, plus the morpho
logically similar north-east Atlantic species, P. dioica Brodie
& Irvine, and cultured strains of P. yezoensis (U5 1 and H25)
from northern Maine (Levine 1 998; Yarish et at. 1 998, 1999).
Using new sequence data, allele-specific polymerase chain re
actions (AS-PCR: Okayama et at. 1 989; Wu et at. 1 989) were
designed that were capable of providing accurate separations
of three monostromatic species, P. 'umbilicalis', P. 'leucos
tieta' and P. 'purpurea', among hundreds of samples collected
in population surveys. Using AS-PCR and sequence analysis,
we have begun to document the distributional patterns of
north-west Atlantic Porphyra species.
MATERIAL AND METHODS
Sampling strategy
Collections were made throughout the year at ecologically dif
ferent sites throughout New England and the Canadian Mar
itime Provinces (New Brunswick, Nova Scotia and Prince Ed
ward Island), using protocols simil ar to those outlined by Ma
thieson & Hehre (1986) and Mathieson et at. ( 1 998). Samples
of all conspicuous Porphyra taxa were obtained from diverse
intertidal (on foot) and shallow subtidal habitats (by SCUBA).
Specimens were returned to the Jackson Estuarine Laboratory
for processing; in warm weather or when travel time from the
collecting site exceeded one hour, samples were kept on ice.
Tentative identifications to species were made based on mor
phology, using a variety of taxonomic references, viz. Taylor
( 1 957), Coll & Cox ( 1 977), Kornmann ( 1 986, 1 994), Korn
mann & Sahling ( 1 99 1 ), Schneider & Searles ( 1 99 1), B ird & McLachlan ( 1 992), Villalard-Bohnsack ( 1995), Brodie & Ir
vine ( 1 997), and Sears (2002). Assumptions about the season
al occunence and ecology of different taxa were supplemental
factors that helped in the initial sorting of field samples. For
example, all monostromatic Porphyra collected in New
Klein et al . : Molecular identification of north-west Atlantic Porphyra J 1 1
Hampshire during the summer months were assumed to be
either P. 'umbilicalis' or P. 'leucosticta', based on observa
tions from earlier ecological studies (Taylor 1 957; Kingsbury
1 969; Hehre & Mathieson 1 970; Mathieson & Hehre 1 986).
The nomenclature employed primarily fol lows South & Tit
tley ( 1 986) and Bird & McLachlan ( 1 992), except for recent
changes made by B rodie et al. ( 1 996), Brodie & Irvine ( 1 997),
Silva ( 1 999), Broom et al. (2002) and Sears (2002). Herbar
ium voucher specimens documenting our studies are deposited
in the Albion R. Hodgdon Herbarium (NHA) of the University
of New Hampshire, USA (Table 1 ) . Subsets of each collection
were either frozen at -20°C or -80°C, pressed as herbarium
specimens, or dried in silica gel for later extraction of DNA.
DNA extraction and gene amplification
Small amounts of tissue (50-200 mg) were pulverized in liq
uid nitrogen in a chilled mortar. Grinding was fol lowed by
DNA extraction in high-salt cetyldi methylethylammonium
bromide (CTAB) buffer (Doyle & Doyle 1 990), fol lowed by
extraction with phenol-chloroform, as described by Stiller & Waal and ( 1 993). DNA was precipitated with isopropanol and
then redissolved in 1 0 mM Tris-HCI, I mM EDTA buffer (pH
8.0; TrisEDTA). DNA was stored at 4°C or -80°C.
Because Porphyra thall i are frequently contaminated by
both macro- and microscopic epiphytes (Taylor 1 957; Bird et
at. 1 992), PCR primers were designed that were selective ei
ther for the genus Porphyra in general or for particular species
of Porphyra. Highly conserved regions of SSU and rbcL in
Porphyra were distinguished, based on those accessions avail
able in GenBank when this project was initiated ( 1 995 for
SSU and 1 997 for rbcL). The primers developed for Porphyra
in general would probably also anneal to template DNAs from
the sister genus Bangia Lyngbye, because Porphyra has been
demonstrated to be paraphyletic with respect to Bangia (Oliv
eira et al. 1 995; Muller et al. 1 998).
Primers for SSU were designed based on the GenBank ac
cessions of P. 'purpurea' (L2620 1 ), P. 'amplissima'
(L36048), P. 'miniata' ( L26200) and P. 'leucosticta'
(L26 1 99) (Ragan et al. 1 994). The Lasergene application
Primer Select (version 3 .72, DNASTAR, Madison, WI) was
used to select optimal primer pairs. The quality of each primer
pair was confirmed using Amplify 1 . 1 (Engels 1 993). The
approximate positions of these primers relative to SSU and
their sequences are l isted in Table 2, and corresponding DNA
amplification profiles are l isted in Table 3 .
Allele-specific S S U primers for individual taxa were de
signed, based on sequence analyses of 8- 1 0 samples for each
species, these being collected at different seasons or geograph
ical locations. Each primer pair ampli fied SSU fragments from
P. 'leucosticta', P. 'purpurea', or P. 'umbilicalis'. The rela
tive positions of these primers, their sequences, and corre
sponding PCR amplification profiles are shown in Tables 2
and 3. Standard PCR protocol was used for SSU amplification
(Mull i s & Faloona 1 987). Final concentrations of reagents
were 200 f.lM deoxyribonucleoside triphosphates (dNTPs), 0.4
f.lM for each primel� 2.25 mM MgClz, and 1 X Taq buffer B
(PIN M 1 66 1 ; Promega, Madison, WI). One to four microliters
(25-75 ng) of template and two units of Taq DNA polymerase
were added to each 50 f.ll reaction. Amplifications were car
ried out in thin wall, 200 f.ll tubes or in 96-well plates in an
Ml thermocycler (Ml Research, Watertown, MA) equipped
with a Hot Bonner.@>.
For rbcL analyses, one set of primers, RBCL I and RBCL2,
was designed based on three previously determined Porphyra
sequences: P. 'rosengurtii' (U04042), P. 'suborbiculata' ( =
P. 'carolinensis'; U0404 1 ) (Freshwater et at. 1 994), and P.
'purpurea' (NC000925 ; Reith & Munholland 1 995). A second
set of primers, RBCL3 and RBCL4, was designed after pre
liminary sequence analysis of several amplified fragments of
New England Porphyra taxa (Table 2). Amplification reac
tions for rbcL contained 1 .5 mM MgCI2, J f.lM of each primer
pair, 200 f.lM dNTPs, 2 units of Taq polymerase, and 1 -4 f.lJ
(25-75 ng) of the template. To enhance specificity of ampli
fication, a Hot Start procedure (D' Aquila et at. 1 99 1 ) was
used to initiate PCR with primers RBCL I and RBCL2.
DNA sequencing and phylogenetic analysis
All DNA sequences unique to this study were submitted to
GenBank, either as individual sequences or as population data
sets (Table 1 ) . The same specimens, or samples from the same
collection, were used to amplify and sequence both SSU ri
bosomal DNA (rDNA) and the rbcL gene (Table I). To pre
pare template DNAs for sequencing, amplified DNAs were
purified by gel electrophoresis on low meJting point agarose
(Life Technologies, Gaithersburg, MD), with the agar plugs
being digested with agarase (Sigma, St Louis, MO). Cycle
sequencing was carried out according to the manufacturer's
i nstructions, either with a Taq DyeDeoxy Terminator Cycle
Sequencing Kit with AmpliTaq (PIN 40 1 384; Perkin-Elmer,
Foster City, CA) or with an ABI Prism Dye Terminator Cycle
Sequencing Ready Reaction Kit with AmpliTaq DNA Poly
merase FS (PIN 402080). Additional primers for sequencing
are listed in TabJe 2. Fluorescent-labelled DNAs were sepa
rated on a 6% polyacrylamide gel using an Applied Biosys
tems (ABI) Model 373 Automated DNA Sequencer at the
University of New Hampshire Sequencing Facility.
Sequences were generated with ABI DNA Sequencing Soft
ware, version 2 . l . I , Base Caller ABT50, and were edited using
SegEd (Version 1 .0 .3 ; ABI, Foster City, CA). Edited sequenc
es were assembled using the Lasergene Seq man application
(DNASTAR). Initially, a - 1 1 00 bp fragment of the rbcL was
sequenced. However, only those 8 1 5 bp that aligned with
available sequences for the outgroups were used in the phy
logenetic analysis . Multiple sequence alignments for rbcL
were carried out with the MegAlign application of Lasergene.
For SSU, the two partial gene sequences for each taxon were
concatenated (total length - 990 bp) and then rDNA segments
were aligned, based on predicted secondary structures, using
the Dedicated Comparative Sequence Editor (DCSE: De Rijk
& De Wachter 1 993, http://rrna.uia.ac.be/dcse/). Al l stem do
main alignments were verified manually. Corresponding se
quences for two other bangiophycean red algae (Rintoul et at.
1 999), Erythrocladia Rosenvinge sp. (L26 1 88, AF087 1 1 7)
and Erythrotrichia carnea (Dillwyn) 1. Agardh (L26 1 88,
AF087 1 1 8), were used as outgroups in both sets of al ign
ments. Only those regions of the rDNAs that could be readily
aligned were used for phylogenetic analysis (950 bp).
Sequence alignments were imported into PAUP *4.06b
(Swofford 1 998; http://paup.csit.fsu.edu/) for phylogenetic
Table 1. Algal samples with sequence data from this study. ...... tv
Col1ections Accession numbers GenBank accession numbers Albion Hodgdon Sample � ;:,-
Species Locations Dates H erbarium (NHA)' number SSU2 rbcL '< (") Cl Porphyra 'amplissima' Gove Point, Cobs cook Bay, North 8Jul. 1 995 58 1 86 1 AF358288, AF3583 1 2 AY028522 c;-
Lubec, Maine 2 AF358289, AF358313 AF02 1 034 O'Q 5'
3 AF358290, AF3583 1 4 . 4 AF35829 1 , AF3583 1 5 -< 0 5 AF358292, AF358316 :-' 6 AF358293, AF3583 1 7 .,. tv 7 AF358294, AF358318
� 8 AF358275, AF358274
Christmas Cove, Darmariscotta Riv- 1 8 May 1 996 63333, 63485-63487 1 AF358298, AF358322 tv 0 er, South Bristol, Maine 2 AF358299, AF358323 0 VJ Five Island, Sheepscot River, 20 Jun. 1 996 none available I AF358296, AF358320
Georgetown, Maine 2 AF358297, AF358321
P. 'dioica' Cruden Bay, Aberdeenshire, Scot- Jan. 1995 none available I AF3 1 9773, AF3 1 9774 AF095859 land, UK3 2 AY028524
North of Aberystwyth, Wales, UK 4 Apr. 1 998 AF081291
P. 'leucosticta' Gove Point Cobscook Bay, North 8 Jul. 1 995 58185, 699 1 5, 699 1 6, 6 1 945, 6 1 946 1 AF358278, AF358279 AF078744 Lubec, Maine 2 AF358345, AF358352
3 AF358346, AF358353 4 AF358347, AF358354
Pemaquid Point, Bristol, Maine 8 Aug. 1 996 64968 1 AF358348, AF358355 2 AF358349, AF358356
Rachel Carson Salt Pond Preserve, 9 Aug. 1 996 65006 AF358406, AF358407 AY028526 Chamberlain, Maine
Two Lights State Park, Cape Eliza- 9 Aug. 1 996 65284-65286 1 AF358350, AF358357 AY028525 beth, Maine 2 AF358351, AF358358
Fort Stark, New Hampshire 25 Aug. 1998 7 1 773 AF27 10784
P. 'linearis' S outh Bristol (near Turnip 1.), 1 8 Feb. 1996 60868, 6 1 075 1 AF358327, AF358334 Maine 2 AF358328, AF358335
3 AF358329, AF358336 4 AF358330, AF358337
Seapoint, Kittery, Maine 14 Feb. 1996 6 1 160 1 AF038587, AF038588 AF078745 2 AF358324, AF35833 1 3 AF358325, AF358332 4 AF358326, AF358333
P. 'miniata' Fink Cove, Nova Scotia, Canada 23 Jun. 1996 65301 1 AF358359, AF358385 AF02 1 033 2 AF358360, AF358386 AY028529 3 AF3583 6 1 , AF358387 4 AF358362, AF358388 5 AF358363, AF358389 6 AF358364, AF358390 7 AF358365, AF35839 1 8 AF358366, AF358392 9 AF358282, AF358283
Table 1. Continued.
Species
P. 'purpurea'
P. 'suborbiculata'
Porphyra sp. Herring Cove
P. 'umbilicalis'
P. yezoensis U5 1
Collections
Locations Dates
Cape Elizabeth Light, Cape Eliza 28 Apr. 1 997 beth, Maine
Yarmouth Harbor, Nova Scotia, 28 Sep. 1 996 Canada
Avonport, Nova Scotia, Canada 30 Sep. 1 996
Herring Cove, Nova Scotia, Canada 28 Sep. 1 996
Ross Island, Grand Harbor, New I Nov. 1 996 Brunswick, Canada
Lighthouse Cove, Dipper Harbor, I Nov. 1 996 New Brunswick, Canada
Leighton Cove, Whiting, Maine 24 Mar. 1 996
Camp Ellis, Saco, Maine 6 Feb. 1 996
Waterford, Connecticut Dec. 1 995
Masonboro, North Carolina 20 May 1 998
Herring Cove, Nova Scotia, Canada 28 Sep. 1 996
Sand Beach, Bar Harbor, Mount 22 Feb. 1 996 Desert Island, M aine
Red Point, Swans Island, Maine 1 2 Mar. 1 996
Bagaduce Falls, Brooksville, Maine 23 Mar. 1 996
Reids State Park, Georgetown, 8 Aug. 1 996 Maine
Fort Williams, Portland Head, 27 Jan. 1 996 Maine
Two Lights State Park, Cape Elizabeth, Maine
Dover Point, New Hampshire
Fort Stark, Newcastle, New Hampshire
Eastport, Maine
28 Jan. 1 996
25 Aug. 1 998
20 Jun. 1 998
7 Oct. 1995
, Morphologically similar material was col lected at the same time for DNA extraction.
Accession numbers Albion Hodgdon
Herbarium (NHA)'
64304, 67135
65050
65045-65048
65 1 86-65 1 96
652 1 5-65224
62857
73866, 73867
none avai lable
65044
60822
6 1 1 68
638 1 1
638 1 6-638 1 8, 64962
6 1 996
not avai lable
7 1 783
7 1 780
598 1 9
Sample number
1 2
1 2 3
2 3
1 2
I 2
I 2
1 2
1 2
1 2 3
GenBank accession numbers
SSU2 rbcL
AF358284, AF358285
AF358374, AF358383 AF358375, AF358384
AF358373, AF358382 AY028533
AF358370, AF358379 AY028532 AF35837 1 , AF358380 AF358372, AF35838 1
AF358367, AF358376 AF358368, AF35837 AF358369, AF358378
AF358405, AF358367 AY028535 AY0285 3 1
AF358276, AF358277 AF078746 AF362362, AF362363 AY028534
AY028536 AY028537
AFI33792 AF078743
AY028523
AY l O0474, AY l O0473 AF319460
AF358393, AF358399 AY028540
AF358395, AF358401 AY02854I AF358286, AF358287
AF358394, AF358400 AF358280, AF35828 1
AF358396, AF358402 AY028539 AF358397, AF358403 AF358398, AF358404
AF078747
AY028538
AF27 1 0774
AF27 I 076 (2)
AF364074, AF364075 AF02 1 032
2 Each template was amplified and sequenced with two sets of primers: Por3 and Por4, and either Pori and Por2 or Por l 5 and Porl 6, two entries correspond to the respective sequences from the same template; P. 'suborbiculata' was amplified and sequenced with Pori I and Por l 9, and Porl7 and Porl8. 3 From conchocelis cultures. 4 Represents identical sequences for two isolates.
� � 5' � �
� o � () c � 0.: (lJ g. :!l () � o· ::l o ...., ::l o S� (lJ ;!;. > ;-::l g. ;0 � � i3
...... VJ
1 1 4 Phyc% gia, Vol. 42 (2), 2003
Table 2. Primers for DNA amp lification and sequencing.
Gene fragment'
SSU
SSU
SSU sequencing Porphyra '!eucosticra' SSU
P. 'umbilicalis' SSU
SSU
SSU sequencing P. '!eucosricra' SSU
SSU amplification
P. 'suborbiculala' SSU amplification
P. 'suborbicLl!ala' SSU amplification with Pori 1 P. 'purpurea' SSU
Porphyra rbcL
Porphyra rbcL
Sequencing rbcL Sequencing rbcL Sequencing rbcL Sequencing rbcL
Primer
Pori Por2 Por3 Por4 Por5 Por6 Por7 Por8 Por9 PorlO PorI I Porl2 Porl3 Porl4 Por l 5 Porl6 Por l 7 Por l 8 Por l 9 Purl Pur2 RBCLI RBCL2 RBCL3 RBCL4 RBCLseq l PORRBCL5 PORRBCL6 PORRBCL7
, Fragment amp li fied or specificity for sequencing (or both) .
Sequence (5' -1 3')
GGGGGCCCTTTACGGTCCTCT CAATCCCCAGTCGGCATCGTT GCCAGTAGTCATATGCTTGTCTCA GGGCCCCCTATTGTTATTTT TAGCGTATATTAAAGTTGTTG CCTCAACGCCCGACTCACGAA AGACAAACTCCCACTGGCAACAAG CTTTTGTGCTTTGTGATGATTC AGAAGACACCCTCACAGAAACA TGCCTACACGCCCGACTC CCTTGTTACGACTTCTCCTTCCTC CCTGAGAAACGGCTACCA CAGAGCGCTTTGAGATGATTC CCCGACAAGAGGAGACAAACT ACGGGGAGGTAGTGACAAGAA CCCCCAGAACCCAAAGAC CCTTCGGGAACGCTTTGAG CGTCTTCGATCCCCTAACTTTC CCATTCAAATTTCTGCCCTATCA GGGGCGCGGACACAGAAGC TCATACAACAAATCCCCGCCAATC AACTGCTTCTATTATTGGTA CTTCCGAGTAATCTGTAAA ATGCGCTGGAGAGAAAGAT ACGTTGGCTGTTGGAGTCT TCATGTCATTTTTACGAGCCC TTTGACCAGCATGAATACCAC GAGTTAATATTTTCATCATCTT TGTAAATGGATGCGTATGGC
Relative position and orientation2
490-5 1 0 (F) 1 070- 1 050 (R)
1 7-40 (F) 497-478 (R) 598-6 1 8 (F) 1 33- 1 5 3 (F) 664-64 1 (R) 1 85-206 (F) 645-624 (R) 1 75- 1 92 (F)
1 787-1 764 (R) 356-373 (F) 1 93-2 1 3 (F)
676-656 (R) 468-488 (F) I 1 30-1 I 13 (R)
1 84-202 (F) 658-637 (R) 30 1 -324 (F) 654-672 (F)
1 084- 1 06 1 (R) 360-379 (F) 957-939 (R) 646-664 (F)
1 463-1 445 (R) 877-857 (R)
1 1 68-1 1 48 (R) 635-6 1 4 (R) 952-97 1 (F)
2 Relative to the coding sequence of the gene; (F) = forward, (R) = reverse.
analysis. The neighbour-joining (NJ) algorithm was used to
construct phylogenetic hypotheses for rbcL. Several character
weightings of the first, second and third codon positions were
explored. For SSU, character sets corresponding to secondary
structures (stems, bulges, and loops identified in DCSE) were
defined and various weightings of these features were ex
plored. Uncorrected distances with among-site rate variation
were used with an NJ algorithm to construct the SSU phylog
eny under the criterion of minimum evolution (ME). The dis
tance model outlined by Tamura & Nei ( 1 993) was applied
with the NJ algorithm for the rbcL phylogeny. Various char
acter weightings for first, second and third codon positions of
rbcL were explored. One thousand bootstrap replicates were
performed in order to assess the robustness of phylogenetic
reconstructions.
Gene trees were also examined using maximum parsimony
(MP) and maximum likelihood (ML) criteria, as implemented
in PAUP The topologies of the MP, ML and ME phylogenies
were compared using the parsimony and likelihood implemen
tations of the Kishino-Hasegawa test. In order to bypass a bug
in PAUP* 4.0 1 Ob (http://paup.csit.fsu.edu/problems.html, 5 Au
gust 2002), the distribution for likelihood score was set to
RELL.
RESULTS
SSU sequence analysis and reclassification of Porphyra samples
Partial SSU sequences were obtained from Porphyra samples
collected in the north-west Atlantic (Table 1) and correspond-
ing SSU sequences were also obtained for the north-east At
lantic taxon P. 'dioica' (AF3 l 9773 and AF3 1 9774), the north
west Pacific P. 'yezoensis' cultivar US I (Table I ), and P. 'su
borbiculata' (AF I 33792), which is an apparently cosmopoli
tan or perhaps introduced taxon ( Humm 1 979; Broom et al.
2002). The partial SSU sequence for P. 'yezoensis' US 1 was
identical to several other Japanese P. 'yezoensis' cultivars
(Kunimoto et al. 1999a).
There was good correspondence between existing SSU se
quence data for north-west Atlantic Porphyra (Ragan et al.
1 994; Oliveira et al. J 995) and populations sampled in this
study. At least one sequence of each taxon of north-west At
lantic Porphyra sampled (Table 4) was 2: 99% identical to
those previously reported. Intraspecific variation ranged from
0-0.34% in P. 'umbilicalis' (eight samples), to 0-2. 1 % in P.
'amplissima' ( 1 2 samples) and 0-3.5% for P. 'linearis' (eight
samples). Some intraspecific variants represented samples
from different locations and seasons; for example, P. 'am
plissima' AF358293 and AF3583 1 7 from Cobscook Bay, Lu
bec, Maine, differed by 1 .7% from AF358299 and AF358323
from the Darmariscotta River in South Bristol, Maine. In other
samples, sequence differences were observed for two different
samples of one taxon from a single collection. For example,
in P. 'amplissima' from Lubec, Maine, AF358288 and
AF3583 1 2 di ffered by 2. 1 % from AF358293 and AF3583 1 7
in partial SSU sequences; i n P. 'linearis' from Seapoint,
Maine, AF358327 and AF358334 differed by 3.5% from
AF358329 and AF358336.
Several samples collected during the summer of 1 995 from
Gove Point in Lubec, Maine, were initially identified by mor
phological examination as P. 'umbilicalis'; subsequent se-
Klein et al.: Molecular identification of north-west Atlantic Porphyra 1 15
Table 3. Amplification profiles.
Primers Hot start' Anneal Extension Denature2 Cycles
POI'] and Por2 no 56°C, J min noc, 45 s 93°C, 30 s 30 Por3 and Por4 no 4SoC, ] min noc, 45 s 93°C, 30 s 30 Por6 and Por7 no 56°C, 1 mm noc, 45 s 93°C, 30 s 30 PorS and Por9 no 45°C, ] min noc, 45 s 93°C, 30 s 30 Por 1 0 and Por l ] no 50°C, 1 mm noc, 2 min 93°C, 30 s 30 Por 1 3 and Por l 4 no 54°C, 1 min noc, 45 s 93°C, 30 s 30 Por l S and Por l 6 no 47°C, ] min noc, 45 s 93°C, 30 s 30 Pur l and Por2 no 56°C, I min noc, 45 s 93°C, 30 s 30 RBCL I and RBCL2 yes 46°C, 1 min 72°C, I min 94°C, 30 s 30 RBCL3 and RBCL4 no 44°C, I min 72°C, I min 94°C, 30 s 30
, The reaction mixture was heated to 94°C for 3 minutes and then the temperature was reduced to SO°C while Taq polymerase was added. 2 All reactions heated initially to 93°C or 94°C for 3 minutes to denature templates prior to the first round of amplification. After 30 cycles of
amplification, a final cycle was carried out with an extension time of 1 0 minutes.
quence comparisons of SSU fragments showed that these sam
ples were very different from gene sequences previously re
ported for this species (L36049, L26202; Ragan et al. 1 994).
By contrast, the SSU sequences from Gove Point Porphyra
templates were less than � 0.5% divergent from P. 'leucos
ticta' (L26 1 99) and so they were reclassified as P. 'leucostic
ta' (Table 1 ) . Phylogenetic analysis confirmed that these Gove
Point Porphyra formed a monophyletic group with the P. 'leu
costicta' accessions (data not shown). The SSU sequences ob
tained for samples from Leighton Cove, Whiting, Maine
(AF358276 and AF358277), were > 99% identical to P. 'pur
purea' (L2620 J ) , although they had been tentatively identified
by vegetative morphology as P. 'umbilicalis'. Finally, com
parisons of SSU sequences with GenBank accession L26200
led to several Cape Elizabeth, Maine, vegetative samples be
ing reclassified as P. 'amplissima'; they had initial ly been
identified as P. 'miniata' (Table 1 ) .
Evaluation of rbcL, new distributional records, and
cryptic taxa
A � 1 1 00 bp fragment of rbcL was amplified and sequenced
from 3 1 Porphyra specimens, which generaJly represented the
same or similar samples (i.e. from the same collection) as
those for which SSU sequences were obtained (Table 1 ) . The
rbcL fragments sequenced ranged from one (P. 'linearis') to
eight samples (P. 'purpurea'). In contrast to the intraspecific
sequence variation observed for SSU, little or no intraspecific
variation was observed in the rbcL gene. The rbcL sequences
of two P. 'umbilicalis' individuals sampled from an estuary
in New Hampshire were identical to each other and differed
by I bp from the rbcL sequence of two individuals of P.
'umbilicalis' from a nearby coastal site (Table 1) . The rbcL
sequences for the U5 1 and H25 cultivars of P. yezoensis were
identical to each other (data not shown).
The sequence of the rbcL fragment (AF078743, Table 1 )
amplified from a Waterford, Connecticut, collection (late au
tumn 1 995), which was morphologically identified as P. 'leu
costicta', was compared by Blastn Search (Altschul et al.
1990, 1997) with the GenBank database (August 1 997). It was
99% identical to a partial sequence of P. 'suborbiculata' ( =
P. 'carolinensis' U0404 1 ; Freshwater et al. 1994). The dif
ference was a track of N in U0404 1 , this ambiguous sequence
being resolved in AF078743. Freshwater et al. 's (1994) rbcL
sequence (U04041) was obtained from a specimen collected
at Fort Fisher, North Carolina. The type location of P. caro
linens is is not far away, at Fort Macon, Bogue Bank, North
Carolina, and material from Fort Fisher was also examined by
Coli & Cox (1977) in their original description of these spe
cies. Further comparisons of P. 'suborbiculata' were made
with samples collected at Masonboro Island, North Carolina
(supplied by D.W. Freshwater). The partial rbcL sequence for
this accession (AY028523) was identical to the Waterford
sample (Table 1). Based on these data, further morphological
characterization, and recent results from Broom et al. (2002),
Table 4. Comparisons of intraspecific sequence divergence of Porphyra species for SSU.
Reference GenBank Percent identity Number of Percent divergence sequence(s) from with reference samples within taxon sequence
Species prior studies sequence sequenced in this study (%)'
P. 'amplissima' L3604S 99.5 1 3 0-2. 1 P. ' leucosticta' L26 1 99 99.9 9 0-0.46 P. 'linearis' none NA S 0-3.5 P. 'l1'liniata' L26200 99.6 1 2 0-0.97 P. 'purpurea' L2620 1 99.S 1 0 0-0.90 P. 'umbilicalis' L36049 99.4 S 0-0.34
L26202 99.5 AB01 379 99.5
P. yezoensis US I D79976 1 00 2
, Between Sand 1 3 sequences representing an individual taxon were aligned with the Clustal method as implemented in MegaJign, Lasergene. Sequences were trimmed to the same relative beginning and ends. The alignments were converted to Nexus format, and then imported into PAUP* 4.0a and the 5' and middle segments of each SSU were assembled by concatenation. Uncorrected pairwise distances for each sequence were calculated using the algorithm employed by PAUP* NA, none available.
1 1 6 Phycologia, Vol. 42 (2), 2003
A bp 185-213 located on sense strand
Species p. 'leucosticta' P. 'umbilicalis'
Complement of bp 643-677
Species P. 'leucosticta' P. 'umbilicalis'
B
<i>X Haelll
;0 .;:; � � �-3 "'"
t
." <:> .;:; � � """ � �
I
Por8
'''� Porl3 I
CTCTTTCCAGAGCGCTTTGAGATGATTC CT----TTTG--TGCTTTGTGATGATTC
r F"lp1 TGTTGCCAG-TGGGAGTTTGTCTCCTCTTGTCGGG TGTTTCT--GTGAGGG--TGTCTTCTTTTTCTGGG
483bp
C
<i>X Haelll
;0 .;:; � � �-3 "'"
t
." <:> .;:; � � ;;;' � �
460 bp
Fig. 1. A. Positions of allele-specific primers, corresponding to regions of high sequence divergence between Porphyra 'leucosricra' and P. 'umbilicalis'. B. Amplification products with PorS and Por9 (specific for P. 'umbilicalis'), using positi ve and negative control templates. C. Amplification with Por l 3 and Por l 4 (specific for P. 'leucosricta') using positive and negative control templates. Samples were separated on 1 .4% agarose in 0.5 Tris Borate EDTA (TBE) buffer, with 0.005% ethidium bromide at 5 V cm '. Molecular weight markers correspond to bacteriophage q,XJ74 replicative form, cut with restriction enzyme Haell!. DNA fragments were visual ized under UV light.
the Atlantic distributional range for P. 'suborbiculata' can be
extended northwards, from North Carolina to Long Island
Sound.
A cryptic taxon was discovered among samples collected
at Herring Cove, Nova Scotia, Canada, in late September
1996. The sample was morphologically identified as P. 'pur
purea' , but rbcL sequence data demonstrated that it is a pre
viously unknown taxon from the north-west Atlantic. A Blastn
search of GenBank (August 2000) showed that the cryptic
taxon from HetTing Cove is no more than 9 1 % similar to any
other known Porphyra rbcL sequence. Hereafter, it wil l be
referred to as 'Porphyra sp. Herring Cove'. Similar material
was found later (autumn 1998) within Cobscook Bay, Maine.
Given the novel features of the Herring Cove rbcL sequences,
the SSU sequences for this material were also determined
(AY lO0474 and AY I00473).
CANADA QUEBEC
USA
" r-"I' l __ \
\ \ \ \ \ \
,! \
S I
MAINE
GULF OF MAINE 43
N
1 40
67 63
Fig. 2. Geographical distribution of Porphyra taxa confirmed by ASpeR. Between 2 and 20 samples were screened per collection. 0, P. 'Ieucosricta';., P. 'umbilicalis'; x, P. 'purpurea'. Map adapted from Sears (2002).
Development of AS-PCR molecular screens to
discriminate between three Porphyra taxa
AS-PCR molecular screens were developed to differentiate the
three most common monostromatic taxa, P. 'umbilicalis' , P.
'/eucosticta' , and P. 'purpurea' . The allele-specific primers
(Table 2) were designed to anneal to positions in the SSU that
differed maximally among the three rDNA genes but were
invariant within each taxon. For example, the sequences com
plementary to primers Por8 and Por 1 3 differed by two inser
tion-deletions and five base substitutions over 28 bases (Fig.
l A) . Primer pair Por l 3 and Por 1 4 was specific for P. 'leu
costicta' ; in PCR, these primers supported amplification of a
483 bp fragment (Fig. IB). Primers Por8 and Por9 were spe
cific for P. 'umbilicalis' , supporting the ampl ification of a 460
bp fragment (Fig. l C) . Primers Pur l and Pur2 were specific
for P. 'purpurea'; a standard amplification reaction using this
primer pair produced a 430 bp fragment (data not shown).
Positive and negative control templates were chosen for the
AS-PCR screens from which SSU was previously character
ized by sequencing. Each allele-specific primer pair amplified
a fragment of predicted size from the positive control but did
not support DNA amplification from the negative control (Fig.
l B , C). Sequences of fragments amplified with allele-specific
primers confirmed that the primer pairs amplified SSU DNA
(data not shown).
Application of AS-PCR and DNA sequencing to identify
field collections of Porphyra
Table 5 summarizes the number of monostromatic samples
examined by AS-PCR or DNA sequencing. The efficacy of
the AS-PCR screens was limited to the three common species
for which the primers were designed to be targeted. Approx
imately 1 8% of the > 450 samples screened by AS-PCR were
ambiguous: either the SSU fragments did not amplify, or they
amplified weakly with one of the three sets of allele-specific
primers, or they were amplified by two sets of the primers.
For example, DNAs from eight samples of Porphyra sp. Her-
Klein et a1. : Molecular identification of north-west Atlantic Porphyra 1 1 7
Table 5. Monostromatic samples identified by AS-peR.
Identi fication
P. ' leucoslicta' P. 'purpurea' P. 'umbilicalis' Ambiguous Total
Number of samples (%)
1 10 (24 . 1 ) I I I (24.2) J54 (33.7)
82 (1 7.9) 457
ring Cove were not amplified with any of the three sets of
AS-PCR primers. Other ambiguous results would be expected
if collections incl uded additional cryptic species or any other
Porphyra species whose rDNA sequence at the two primer
annealing sites might be similar, but not identical, comple
ments to the corresponding AS-PCR primers.
Figure 2 summarizes the geographical distributions of P.
'umbilicalis' , P. 'leucosricta' , and P. 'purpurea' identified by
molecular methods. The number of Porphyra specimens from
each collection whose identity was confirmed by molecular
assays was 2-20. Geographical records for P. 'purpurea' ex
tended as far south as Long Island Sound. Mixed populations
of P. 'purpurea' and P. 'umbilicalis' were found in collections
from Camp Ellis, Maine (February 1 996). The relative abun
dance of Porphyra species may vary seasonally, e.g. 14 sam
ples of P. 'umbilicalis' were collected in January 1996 at Two
Lights State Park on Camp Elizabeth, Maine, but the four
samples collected at this site in August 1996 were P. 'leu
cosricta' . Over the course of this study, more than 700 sam
ples were analysed by a DNA-based technique (sequencing or
AS-PCR). The combined DNA analyses indicated that ap
proximately 25% of the field collections were misidentified
during the initial morphological inspection (data not shown).
Phylogenetic relationships between north-west Atlantic
Porphyra
Gene trees for the partial SSU and rbcL gene sequences were
constructed for native Porphyra taxa from New England and
the Canadian Maritime Provinces, together with P. 'dioica'
from Europe and the introduced Pacific Asiatic P. yezoensis
U5 1 . Single SSU sequences, representative of each taxon
(Cain 2000), were included in the phylogenetic analysis. Fol
lowing reclassification of some accessions, all SSU sequences
within a designated taxon were shown to obey the principle
of monophyly (analyses not shown). Eryrhrorrichia carnea
and Erythrocladia sp. were used as outgroups. Secondary
structural alignments were determined using DCSE and only
those SSU segments that could be readi ly aligned (950 bp)
were used in phylogenetic analyses. The sequences for Por
phyra rbcL began and ended at different positions relative to
those available for Eryrhrorrichia carnea and Erythrocladia
sp.; hence, only 8 15 bp were used in these phylogenetic anal
yses.
Between species di vergences were 4 - 14% for SSU and 3-
1 1 % for rbcL. To assess whether the individual codon posi
tions for rbcL were saturated for base substitutions (Griffiths
1 997), pairwise distances were computed for each codon po
sition and plotted against the total uncorrected distances. Plots
of first- and third-position changes against total distances were
linear, with high correlation coefficients (R) of - 0.9 (data not
shown). With respect to the outgroups, Erythrotrichia carnea
and Erythrocladia sp., our analysis suggests that Porphyra
rbcL is not saturated for third-position substitutions.
Distance phylograms from SSU and rbcL are shown in Fig.
3. Phylogenies estimated using MP and ML produced similar
topologies, with bootstrap values at the same level of support
as in ME analysis (data not shown). The parsimony version
of the Kishino-Hasegawa test was used, as implemented in
PAUP* 4.0b I 0, to compare the phylogenetic topologies in the
three types of analysis for each gene; no significant differenc
es were detected between ME, MP, and ML. Several weight
ings applied for different codon positions of rbcL did not
change the overall topology of phylogenies, although signifi
cant down-weighting of the third codon position decreased
resolution of the distance phylogram (data not shown).
The overall topologies of the distance phylograms are sim
ilar but not identical for the partial SSU and partial rbcL trees
(Fig. 3). The Porphyra taxa in the SSU gene tree separate into
two strongly supported clades. One consists of Porphyra sp.
Herring Cove, P. 'miniata' , P. 'amp/issima' , P. 'suborbicu
lata' , P. 'leucosticta' and P. yezoensis US I ; the other includes
P. 'dioica', P. 'purpurea' , P. 'linearis' and P. 'umbilicalis'.
A clade consisting of P. 'dioica' , P. 'purpurea', P. 'linearis'
and P. 'umbilicalis' is also strongly supported in the rbcL tree
(Fig. 3b). In the rbcL tree, P. 'amplissima' and P. 'miniata'
become si ster taxa with moderate bootstrap support, whereas
the SSU phylogeny does not support sister taxon relationships
for these two distromatic species. In the rbcL gene tree, P.
'suborbiculara' , P. 'leucosticta' and P. yezoensis form a clade
with weak bootstrap support. The rbcL tree has an unresolved
polytomy for these three clades and Porphyra sp. Hen·i ng
Cove. In both the SSU and rbcL gene trees, P. 'dioica' , which
has frequently been confused with P. 'purpurea' (Brodie & Irvine 1 997), is less closely affi l iated to this species than to
P. 'umbilicalis' .
DISCUSSION
Species identification
In this study, gene sequences of Porphyra species from New
England and the Canadian Maritime Provinces were compared
with each other and with sequences from previous studies of
Porphyra and other Rhodophycean algae (Freshwater et al.
1 994; Ragan et al. 1994; Mizukami et al. 1 998; Kunimoto et
al. 1 999a, b). The data were used to reclassify a significant
proportion of our samples. Identifications based on gene se
quences are only as good as the initial morphological deter
minations, and ideally identifications of samples used in mo
lecular studies should be confirmed by inclusion of corre
sponding molecular genetic data markers for type specimens.
Unfortunately, DNA extractions from 100-year-old type ma
terials are still (and may remain) unreliable (Savolainen et al.
1995); therefore, it is premature to attempt molecular analyses
with precious type herbarium material . Eventually, however,
molecular analyses of type specimens may help to resolve
confusion regarding the taxonomy, phylogeny, ecology, and
biogeography of complex genera such as Porphyra.
Gene sequence analysis improved the discri mination be
tween species in field collections. Comparison of the Gove
1 1 8 Phycologia, Vol. 42 (2), 2003
a SSU
100
74
99
P. 'amplissima ' 73
1,...--P. 'leucosticta '
P. yezoensis
P. 'suborbiculata '
'--------P. 'miniata '
P. sp Herring Cove
P. 'umbilicalis '
P. 'purpurea '
Erythrocladia
--0.0 1 substitutions/site Erythrotrichia carnea
b rbcL
1 00
,.---- P. 'amplissima '
1.... ____ P. 'miniata '
,.-----P. 'suborbiculata ' 55
1 00 P. 'leucosticta '
93 P. 'dioica '
1 00 1 00 P. 'linear is '
P. 'umbilicalis '
P. 'purpurea '
'-------P. sp. Herring Cove
,.--------Erythrocladia sp.
- 0.0 1 substitutions/site Erythrotrichia 'carnea '
Fig. 3. Minimum evolution distance phylograms from partial SSU (a) and rbcL gene sequences (b). The two SSU fragments (- 440 bp + -540 bp) that were sequenced for each taxon were concatenated and then aligned, based on RNA secondary structure predictions. The rbcL alignments correspond to 8 1 5 bp of the full-length gene (positions 380- 1 1 95). Multiple sequence alignments were analysed with the NJ algorithm in PAUP 4.01 0b, with 1 000 bootstrap repl icates. Tamura-Nei corrections were applied in the rbcL analysis. Only bootstrap values > 50 are shown.
Point herbarium samples (which were reclassified from P.
'umbilicalis' to P. 'leucosticta' based on SSU sequences) with
other P. 'leucosticta' is helping to refine our concept of the
range of vegetative morphologies of this taxon (C.D. Neefus
& A.C. Mathieson, in preparation). Porphyra 'amplissima'
was not c learly identified from the north-west Atlantic until
the early J 990s (Bird & McLachlan 1 992; Hehre & Mathieson
1 993); SSU sequence comparisons help to distinguish this tax
on from the other distromatic taxon (P. 'miniata') in this re
gion. Prior to this study, no published gene sequences had
been reported for P. 'linearis' (Table 1 ) . HistoricalJy, P. 'ii
nearis' has been identified as a form or subspecies of P. 'um
bilicalis' (see references in Taylor 1 957; Silva 1 999) and dis
tinguishing P. '/inearis' from P. 'umbiiicalis' i s difficult, be
cause young blades of the l atter can be of the size and stature
expected for P. 'linearis' (Bird & McLachlan 1 992). The SSU
sequence data helped us to evaluate herbarium samples and
subsequently to improve our ability to distinguish these two
taxa morphologicalJy (C.D. Neefus & A.c. Mathieson, in
preparation). Simi lar approaches have been taken to identify
cryptic invasions of Neosiphonia harveyi (1. Bailey) Choi,
Guiry & G.W. Saunders (Mcivor et ai. 200 1 , as Polysiphonia
harveyi; Choi et at. 200 1 ) and to differentiate between Gra
teloupia C. Agardh species (Marston & Villalard-Bohnsack
2002).
The difficulty of making accurate species identification in
Porphyra is reinforced by a recent paper on phylogenetic anal
ysis of Group I introns in Bangiales (Muller et ai. 200 1 ) . Over
50 accessions of Porphyra were examined for two SSU in
trons and their presence or absence was mapped onto an SSU-
based phylogeny. Porphyra 'umbilicalis' sequences appear i n
three different clades and P . 'purpurea' appears in two sister
clades. For P. 'umbilicalis', 1 -2% variation occurred among
samples in the same clade, but substantially more sequence
divergence was found between samples in different clades,
with P. 'umbilicalis' HG (AF I 75549) differing from P. 'um
bilicalis' HF (L25202) by - 4-6%. Muller et al. state that
the identification of Porphyra species in their study is tenta
tive, because of the lack of a definitive global key. Our results,
however, indicate that it i s possible to correct species identi
fications of north-west Atlantic Porphyra, so that each taxon
is monophyletic for SSU. Kunimoto et ai. ( 1 999a) have made
similar observations for accessions of P. 'yezoensis' and P.
'tenera'.
Sequence variation in SSU and rbcL genes
To evaluate intra- and interspecific polymorphism of Porphyra
from New England and the Canadian Maritime Provinces, se
quence divergences have been determined for partial SSU and
rbcL gene fragments. As shown here, as well as in previous
studies (Ragan et at. 1 994; Oliveira et ai. 1 995; Kunimoto et
ai. 1 999a), the interspecific SSU divergence is very high. In
our study, SSU sequence divergence (- 990 bp) was 4-1 4%
and rbcL (8 1 5 bp) divergence was 3-1 1 %. Interspecific se
quence variation for partial SSU genes in north-west Atlantic
Porphyra was thus comparable with that observed by Kuni
moto et ai. ( 1 999b) for Japanese species (0.4- 1 1 %).
Kunimoto et ai. ( 1 999a) were concerned that the low level
of variation in SSU (0.4%) between P. 'tenera' and P. ye-
Klein et al . : Molecular identi fication of north-west Atlantic Porphyra 1 1 9
zoensis was insufficient to distinguish these as individual spe
cies. Wild and cultivated varieties of P. yezoensis were iden
tical over the whole length of SSU rDNA, but differed over
the more variable internal transcribed spacer I sequence
(ITS 1 ) . The P. 'tenera' ITS I was less similar to the P. ye
zoensis ITS sequences than these were to each other. There
fore, Kunimoto et al. ( 1 999a) concluded that the small amount
of sequence variation in the SSU between P. tenera and P.
yezoensis was significant in a phylogenetic context.
The SSU sequence of P. 'suborbiculata' from this study is
99% identical to that of P. lilliputiana, a species initially con
sidered to be endemic to New Zealand (Nelson et af. 1 998),
and also 99% identical to that of P. 'carolinensis' (Broom et
af. 2002). Porphyra 'suborbiculata' is found i n Japan, Korea
and the Indian Ocean (Silva et af. 1 996) . Based on these and
other molecular data, Broom et af. (2002) recommended these
species be synonymized and we have i mplemented their rec
ommendation. Broom et al. (2002) recommend that biogeo
graphical studies of Porphyra, supplemented with careful
morphological and multilocus molecular analyses, are needed
to resolve apparent vicariant patterns.
The > 9% rbcL divergence between the cryptic Porphyra
sp. Herring Cove (Nova Scotia) and other Porphyra taxa ex
amined here is greater than the pairwise differences between
most of the currently recognized taxa of Porphyra in the
north-west Atlantic. In a wider phylogenetic comparison, in
cluding north-east Pacific Porphyra taxa, Porphyra sp. Her
ring Cove was sister to, but distinct from , a potential new
taxon, to be called P. aestivalis Lindstrom (S.c. Li ndstrom,
personal communication). A detailed morphological descrip
tion of Porphyra sp. Herring Cove is in preparation by C.D.
Neefus & A.c. Mathieson (personal communication). The
Herring Cove alga certainly represents a species hitherto un
recorded in the north-west Atlantic, but whether it is a new
species or simply a new distributional record of a previously
recognized taxon cannot be answered until comparable mo
lecular data are available for the other (> 1 33) recognized
Porphyra species (Yoshida et al. 1 997).
There is no generally recognized threshold value of se
quence divergence that, by itself, can be used as a criterion
for subdividing a taxon into an additional species or infraspe
cific taxa. Prior to our studies, SSU and rbcL intraspecific
sequence divergence for north-west Atlantic Porphyra species
had not been evaluated. We found that intraspecific SSU var
iation was 0- 1 % (Table 4), except in P. 'amplissima' and P.
'linearis' . In a recent paper by Muller et af. (200 1 ) , samples
of P. 'miniata' and P. 'umbilicalis' varied by 1 -2% vs other
individuals within the same taxon. By contrast, we observed
very l ittle intraspecific variation in rbcL sequence variation
« 0. 1 %), albeit for a much smaller number of samples ( 1 -
6) per taxon.
The high level of sequence divergence within P. 'linearis'
and P. 'amplissima' samples suggests that further work is
needed to resolve whether these species need to be split and
whether subtle morphological or ecological characters corre
late with specific sequence variants. However, careful mor
phological assessments of P. 'leucosticta' , which has lower
intraspecific sequence variation « 0.5% for SSU, a relatively
conserved gene) than that in P. 'linearis' and P. 'amplissima' ,
suggest that this taxon could be further divided (Neefus el af.
2000). This is likely also to be true for several other wide-
spread north-west Atlantic taxa, such as P. 'purpurea' and P.
'umbilicalis' . Other, more sensitive molecular markers, such
as isozymes, the nuclear ribosomal internal transcribed spacer
(ITS), or microsatellites (Avise 1 994), can provide higher res
olution in investigations of population structure, biogeograph
ical variation, and ecophysiology, which should ultimately
lead to a re-evaluation of some of the north-west Atlantic
species (Neefus et af. 2000).
Molecular screens for species identification
Sequence data, variable PCR products and restriction frag
ment length polymorphisms (RFLPs) have been used to dif
ferentiate taxa in several algal groups (Stiller & Waaland
1 993; Broom et al. 1 999; Kuni moto et af. 1 999b; Teasdale et
al. 2002). The use of AS-PCR, which was designed to differ
entiate the three monostromatic taxa P. 'leucosticta' , P. 'pur
purea' and P. 'umbilicalis,' provides a rapid method to screen
l arge numbers of vegetative monostromatic samples from di
verse ecological sites along the north-west Atlantic coast. The
three primer pairs were selected to anneal to regions of the
SSU that varied maximally between P. 'umbilicalis' , P. 'pur
purea' , and P. 'leucosticta' . A portion of the samples ( � 1 8%
of 457 samples; Table 5) produced ambiguous results, which
could be explained if the DNA template in these cases rep
resented a different, otherwise unrecorded monostromatic spe
cies, i .e. so that none of the three sets of primers was a perfect
match in primer-template annealing. Furthermore, the three
sets of primers would potentially fail to discriminate between
additional taxa whose SSU sequence was similar to that of
one or more of the target species. Once all the species prev
alent in the north-west Atlantic have been identified, appro
priate primer pairs could be designed to discriminate addi
tional taxa, based on SSU sequences.
Bird & McLachlan ( 1 992) and Li ndstrom & Cole ( 1 992)
suggest that the species richness of Porphyra for the north
west Atlantic has previously been underestimated; our results
confirm their speculation. At least eight species of Porphyra
were recognized in our study: P. 'amplissima' , P. 'suborbi
culata' , P. 'linearis' , P. 'leucosticta' , P. 'miniata' , P. 'pur
purea' , P. 'umbilicalis' , and Porphyra sp. Herring Cove. The
SSU and rbcL sequence data from this study provide an im
portant reference and also make it feasible to compare north
western species with the north-east Atlantic Porphyra (e.g. P.
'dioica' ) or Porphyra species from the other oceans (Broom
et af. 1 999, 2002; Kunimoto et af. 1 999b) .
Phylogenetic analyses
A minor refinement of our phylogenetic analyses of partial
SSU sequences vs earlier studies (Ragan et af. 1 994; Oliveira
et al. 1 995) is that our alignments are based on the predicted
secondary structure (De Rijk & De Wachter 1 993). Our tree
topologies for partial SSU and rbcL sequences were generally
similar but not identical to those of previous studies (Fig. 3) .
Both the SSU and rbcL partial gene trees strongly support a
sister-taxon relationship between P. 'linearis' and P. 'umbil
icalis' . Such results contrast with other treatments, based on
i sozymes, which ally P. 'linearis' with P. 'purpurea' (Lind
strom & Cole 1 992, 1 993) . Some of the confusion about P.
'linearis' may result from the existence of two morphologi
cally similar species, with different chromosome numbers
1 20 Phycologia, Vol. 42 (2), 2003
(S.c. Lindstrom, personal corrununication). Our molecular re
sults support earlier taxonomic studies (e.g. Taylor 1 957), in
which P. ' linearis' was thought to be closely related to P.
'umbilicalis' [P. 'umbilicalis' forma 'linearis' (Greville) Ro
senvinge] .
Comparison o f the S S U phylogeny i n this study with the
recent study by MUller et at. (200 1 ) is hampered by apparent
differences in species identification. Several taxa (i .e. P. 'pur
purea' , P. 'umbilicalis' and P. 'miniata' ) were not monophy
letic in MUller et at. 's analysis, whereas in ours each species was clearly homogeneous with respect to any other and mono
phyletic.
Both the SSU and rbcL gene phylogenies in this study con
firm the findings of Yamazaki et at. ( 1 996), which suggest an
affinity between the Pacific Asiatic P. 'yezoensis' and the
North Atlantic P. 'leucosticta' . Although bootstrap support
was weak in the partial SSU tree, the sister-taxon relationship
between these species was strongly supported in the rbcL phy
logeny.
The demonstration of synonymy between P. 'carolinensis'
and P. 'suborbiculata' (Broom e/ at. 2002) contradicts the
proposition that there are no species in common between the
North Atlantic and the North Pacific (Yoshida et al. 1 997).
Alternative hypotheses to explain the presence of species in
both the North Atlantic and the North Pacific are transarctic
migration during interglacial periods (S.C. Lindstrom, person
al communication) or that Pacific species were introduced into
the northern Atlantic via shipping trade in the 1 9th century
(Brodie et al. 1 998; see also Villalard-Bohnsack 1 998). Humm
( 1 979) also speculated that the occurrence of P. 'sub
orbiculata' ( = P. 'carolinensis' ) in North Carolina (Coli & Cox 1 977) may be because of recent introduction.
The major clades in both of our gene trees (Fig. 3) are
consistent with those observed in previous phylogenetic stud
ies using SSU (Oliveira et at. 1 995 ; MUller et at. 1 998), al
though earlier investigators examined different subsets of Por
phyra taxa. The SSU gene tree (Fig. 3a) does not support any
correlation between number of cell layers and phylogenetic
relationship, agreeing with the conclusions drawn by Oliveira
et at. ( 1 995). By contrast, the rbcL gene tree defined the dis
tromatic P. 'miniata' and P. 'amplissima' (which can be mono
stromatic or di stromatic on the same blade: J. Brodie, unpub
l ished observation) as sister taxa. Our rbcL tree (Fig. 3b)
loosely grouped the monostromatic taxa P. 'leucosticta', P.
'yezoensis', and P. 'suborbiculata' into a distinct clade.
The gene trees presented in this study are based on partial
gene sequences. Some of the clades had weak bootstrap sup
port and topologies may shift for these clades if ful l-length
gene sequences are analysed. Such ' soft' incongruities (See
lanan et at. 1 997) between the two gene trees do not require
explanation at this point. However, well-supported incongru
ities between the nuclear and plastid gene trees are present in
our analyses, for example in the position of P. 'miniata' , and
incongruities have also been observed at a higher taxonomic
level in the Bangiophycideae (Oliveira & Bhattacharya 2000).
Several hypotheses may be put forward to account for in
congruities between the rbcL and SSU gene trees. One or both
genes may be saturated for base substitutions, leading to an
erroneous tree (Swofford et at. 1 997). In our analyses, mu
tational saturation of rbcL was not apparent, but it has been
found to be problematic in phylogenetic reconstruction in the
related bangiophycean alga Bangia atropurpurea (Roth) C.
Agardh (K.M. MUller, personal communication). Secondly,
the gene tree for SSU may be erroneous because of concerted
evolution in the high-copy number rDNA (Hil l i s et al. 1 99 I ) .
Thirdly, differences in gene trees may reflect different evo
lutionary histories between chloroplast and nuclear gene lin
eages, perhaps as a consequence of chloroplast capture. One
way to test these various hypotheses would be to compare the
rbcL and SSU gene trees against those for other nuclear and
plastid genes (Olmstead & Palmer 1 994). D. Mathews and S.
Minocha (personal communication) have found that the to
pology of a gene tree for intron 1 of the nuclear-encoded ac
tin} gene is congruent with the rbcL gene tree in this study.
Such evidence suggests that concerted evolution of the rDNA
may obscure the evolutionary history of Porphyra species and
that an accurate phylogeny for the genus wil l require the ex
amination of multiple genes.
Several other research groups are generating gene sequence
data for many of the recognized species of Porphyra world
wide (Kunimoto et at. I 999a, b; Nelson et al. 200 1 ; Broom
et at. 2002; S.c. Lindstrom, K.M. MUller and R. Sheath, per
sonal communication). Thus far, only a l i mited amount of data
has been released. A synthesis of more gene sequence data,
with appropriate phylogenetic and morphological compari
sons, is needed to resolve the evolutionary history and prob
lems of synonymy in the genus Porphyra and its paraphyletic
sister taxon Bangia (see Oliviera et al. 1 995; MUller et at.
1 998).
ACKNOWLEDGEMENTS
The present study was supported by NOAA's New Hamp
shire-Maine Sea Grant College Program as project RlFMD-
1 40. We would also like to acknowledge the help of several
individuals who made available sequence data, prior to pub
lication, or who provided samples for comparison, viz. Dr
Sandra Lindstrom (University of British Columbia, Vancou
ver, British Columbia, Canada); Drs Kirsten MUller (Univer
sity of Waterloo, Ontario, Canada) and Robert Sheath (Cali
fornia State University San Marcos, CA); and Drs Yuzuru
Mizumaka and Masahiko Kunimoto (Japanese National Fish
eries Institute). Drs Sandra Lindstrom and Carolyn Bird (In
stitute for Marine B ioscience, National Research Council of
Canada, Halifax, Nova Scotia, Canada) also provided invalu
able discussions and advice during our studies. In particular,
we want to thank a third anonymous reviewer for insightful
comments and suggestions for further analysis. This article is
published as Contribution Number 356 from the Jackson Es
tuarine Laboratory and the Center for Marine Biology at the
University of New Hampshire, USA.
REFERENCES
ALTSCHUL S.P., GISH W., MILLER W. , MYERS E.W. & LIPMAN D.l. 1 990. Basic local alignment search tool. Journal of Molecular Biology
2 1 5 : 403-4 10. ALTSCHUL S.P., MADDEN T.L., SCHAFFER A.A., ZHANG l. , ZHANG Z.,
MILLER W. & LIPMAN D.l. 1 997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Ac
ids Research 25: 3389-3402.
Klein et al . : Molecular identification of north-west Atlantic Porphyra 1 2 1
AVISE J.c. 1 994. Molecular markers, natural history, and evolution.
Chapman and Hall, New York. 499 pp. BIRD c.J. & McLACHLAN J. 1 992. Seaweed flora of the Maritimes. 1.
Rhodophyta - the red algae. Biopress, Bristol, UK. 1 77 pp. B llm c.J., RICE E.L., MURPHY C.A. & RAGAN M .A. 1 992. Phyloge
netic relationships in the Gracilariales (Rhodophyta) as determined by 18S rDNA. Phycologia 3 1 : 5 1 0-522.
B RAVERSTOCK P.R. & MORITZ C. 1 996. Project design. In: Molecular
systematics (Ed. by D.M. Hill is, C. Moritz & B .K . Mable), pp. 1 7-28. Sinauer Associates, Sunderland, Massachusetts.
BRODIE J. & IRVINE L.M. 1 997. A comparison of Porphyra dioica sp. nov. and P. purpurea (Roth) c. Ag. (Rhodophyta: Bangiophycidae) in Europe. Cryptogamie, A lgologie 1 8 : 283-297.
BRODIE J., HAYES P. K., BARKER G.L. & IRVINE L.M. 1 996. Molecular and morphological characters distinguishing two Porphyra species (Rhodophyta: Bangiophycidae). European Journal of Phycology 3 1 : 303-308.
BRODlE 1., HAYES P.K., BARKER G.L., IRVINE L.M. & BARTSCH I . 1 998. A reappraisal of Porphyra and Bangia (Bangophycidae, Rhodophyta) in the northeast Atlantic based on the rbcL-rbcS intergenic spacer. Journal of Phycology 34: 1 069- 1 074.
BROOM J.E., JONES W.A., HILL D.F., KNIGHT G.A. & NELSON W.A. 1 999. Species recognition in New Zealand Porphyra using 1 8S rDNA sequencing. Journal of A pplied Phycology 1 I : 42 1-428.
B ROOM J.E., NELSON W.A., Y ARISH C., JONES W.A., AGUILAR ROSAS
R. & AGUILAR ROSAS L.E. 2002. A reassessment of the taxonomic status of Porphyra suborbiculata, Porphyra carolinensis and Por
phyra liLLiputiana (Bangiales, Rhodophyta) based on molecular and morphological data. European Journal of Phycology 37: 227-236.
CAIN D.F. 2000. Genetic characterization and phylogenetic analysis of native western North Atlantic Porphyra, using the 1 8S ribosomal gene. MS thesis. University of New Hamphsire, Durham, New Hampshire. 76 pp.
CHOI H.G., KIM M.S., GUIRY M.D. & SAUNDERS G.W. 200 1 . Phylogenetic relationships of Polysiphonia (Rhodomelaceae, Rhodophyta) and its relatives based on anatomical and nuclear small-subunit rDNA sequence data. Canadian Journal of Botany 799: 1 465-1 476.
COLL J. & Cox J. 1 977. The genus Porphyra C. Ag. (Rhodophyta, Bangiales) in the American North Atlantic. 1. New species from North Carolina. Botanica Marina 20: 1 55-1 59.
D' AQUILA R.T., BECHTEL L.J., VITELER J.A., ERON 1.1., GORCZYCA P. & KAPLIN J.C. 1 99 1 . Maximizing sensitivity and specificity of PCR by preamplification heating. Nucleic A cids Research 1 9 : 37-49.
DE RUK P. & DE WACHTER R. 1 993. DCSE, an interactive tool for sequence alignment and secondary structure research. Computer
A pplied Biosciences 9: 735-740. DOYLE I.J. & DOYLE J.L. 1 990. Isolation of plant DNA from fresh
tissue. Focus 1 2: 1 3- 1 5. ENGELS W.R. 1 993. Contributing software to the Internet: the Amplify
program. Trends in Biochemical Sciences 1 8 : 448-450. FRESHWATER D.W., FREDERICQ S. , B UTLER B.S . , HOMMERSAND M.H. &
CHASE M.W. 1 994. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. Proceedings of the National Academy of
Science of the United States of A merica 9 1 : 728 1-7285. GRIFFITHS C.S. 1 997. Correlation of functional domains and rates of
nucleotide substitution in cytochrome b. Molecular Phylogenetics
and Evolution 7: 352-365. HANISAK M.D. 1 998. Seaweed cultivation: global trends. World A qua
culture 29: 1 8-2 1 . HEHRE E.J . & MATHIESON A.C. 1 970. Investigations of New England
marine algae n. Composition, seasonal occurrence and reproductive periodicity of the marine Rhodophyceae in New Hampshire. Rho
dora 72: 1 94-239. HEHRE E.J. & MATHIESON A.C. 1 993. Porphyra amplissima ( Kjellman)
Setchell et Hus: new records of an 'arctic' seaweed in southern Maine, New Hampshire, and northern Massachusetts. Rhodora 95: 1 84- 1 87.
HILLIS D.M., MORITZ c., PORTER C.A. & BAKER R.J. 1 99 I . Evidence for biased gene conversion in concerted evolution of ribosomal DNA. Science 25 1 : 308-3 1 0.
HUMM H.J. 1 979. The marine algae of Virginia. Special Papers i n Marine Science, number 3 . University Press o f Virginia, Charlottesvi l le. 263 pp.
KAPRAUN D.F. & FRESHWATER D.W. 1 987. Karyological studies of five species of Porphyra (Bangiales, Rhodophyta) from the North Atlantic and Mediterranean. Phycologia 26: 82-87.
KAPRAUN D.F., HINSON T.K. & LEMUS A.J. 1 99 1 . Karyology and cytophotometric estimation of interspecific and intraspecific nuclear DNA variation in four species of Porphyra (Rhodophyta). Phycol
ogia 30: 458-466. KINGSBURY J .M. 1 969. The seaweeds of Cape Cod and the islands.
Chatham Press, Chatham, Massachusetts. 2 1 2 pp. KORNMANN P. 1 986. Porphyra yezoensis bei Helgoland - eine entwick
lungsgeschichtliche Studie. Helgoltinder wissenschaftliche Meere
suntersuchungen 40: 327-342. KORNMANN P. 1 994. Life histories of monostromatic Porphyra species
as a basis for taxonomy and classification. European Journal of
Phycology 29: 69-7 1 . KORNMANN P. & SAHLING P.-H. 1 99 1 . The Porphyra species of Hel
goland (Bangiales, Rhodophyta). Helgoltinder Meeresuntersuchun
gen 45: 1-38. KUNIMOTO M., KITO H., KAMIN1SHI Y, MIZUKAMI Y. & MURASE N.
I 999a. Molecular divergence of the SSU rRNA gene and internal transcribed spacer 1 in Porphyra yezoensis (Rhodophyta). Journal
of A pplied Phycology 1 1 : 2 1 1 -2 1 6. KUNIMOTO M., KITO H. , YAMAMOTO Y., CHENEY D.P., KAMLNISHI Y. &
MIZUKAMI Y. 1 999b. Discrimination of Porphyra species based on small subunit ribosomal RNA gene sequence. Journal of Applied
Phycology 1 1 : 203-209. LEVINE I.R. 1 998. Commercial cultivation of Porphyra (nori) in the
United States. World A quaculture 29: 37-38, 45-47. LINDSTROM S.c. & COLE K.M. 1 992. Relationships between some
North Atlantic and North Pacific species of Porphyra. Canadian
Journal of Botany 70: 1 355-1 363. LINDSTROM S.c. & COLE K.M. 1 993. The systematics of Porphyra:
character evolution in closely related species. Hydrobiologia 260/ 26 1 : 1 5 1 - 1 57.
MARSTON M.F. & VILLALARD-BoHNSACK M . 2002. Genetic variabil ity and potential sources of Grateloupia doryphora (Halymeniaceae, Rhodophyta) an invasive species in Rhode Island waters (USA). Journal of Phycology 38: 639-658.
MATHIESON A.C. & HEHRE E.J. 1 986. A synopsis of New Hampshire seaweeds. Rhodora 88: 1- 1 39.
MATHIESON A.C., DAWES c.J. & HEHRE E.J. 1 998. Floristic and zonation studies of seaweeds from Mount Desert Island, Maine: an historical comparison. Rhodora 1 00: 333-379.
McIVOR L., MAGGS C.A., PROVAN J. & STANHOPE M.J. 200 1 . rbcL
sequences reveal mUltiple cryptic introductions of the Japanese red alga Polysiphonia harveyi. Molecular Ecology 1 0: 9 1 1-9 1 9.
MITMAN G.G. 1 992. Meiosis, blade development and sex determina
tion in Porphyra umbilicalis (L.) 1. Agardh from A vonport, Nova
Scotia, Canada. PhD thesis. Dalhousie University, Nova Scotia, Canada. 1 42 pp.
MITMAN G.G. & VAN DER MEER J.P. 1 994. Meiosis, blade development, and sex determination in Porphyra purpurea (Rhodophyta). Journal of Phycology 30: 1 47-1 59.
MLZUKAMI Y, KAMINISHI Y., KUNIMOTO M., KOBAYASHI M., MURASE
N. & KITO H. 1 998. Comparison of partial nucleotide sequences in the exonic region of a small subunit ribosomal RNA gene for discrimination of laver (Porphyra) species and cultivars. Fisheries Sci
ence, Tokyo 64: 886-89 1 . MOLLER K.M., SHEATH R.G., VIS M.L., CREASE T.J. & COLE K.M.
1 998. Biogeography and systematics of Bangia (Bangiales, Rhodophyta) based on the Rubisco spacer, rbcL gene and 1 8S rRNA gene sequences and morphometric analyses. I. North America. Phy
cologia 37: 1 95-207. MOLLER K.M., CANNONE J.J., GUTELL R.R. & SHEATH R.G. 200 1 . A
structural and phylogenetic analysis of the group IC 1 introns in the order Bangiales (Rhodophyta). Molecular Biology and Evolution
1 8 : 1 654-1 667.
1 22 Phycoiogia, Vol. 42 (2), 2003
MULLlS KB. & FA LOON A F.A. 1 987. Specific synthesis of DNA i n vitro via a polymerase-catalyzed chain reaction. I n : Recombinant
DNA Part F (Ed. by R. Wu), pp. 335-350. Academic Press, San Diego.
NEEFUS e.D., MATHIESON A.C., Y ARISH e., KLEIN A.S., WEST A., TEASDALE B . & HEHRE E.1. 2000. Five cryptic species of Porphyra
from the Northwest Atlantic. Journal of Phycology 36, supplement: 73.
NELSON W.A., KNIGHT G.A. & HAWKES M.W. 1 998. Porphyra lilLi
putiana sp. nov. (Bangiales, Rhodophyta): a diminutive New Zealand endemic with novel reproductive biology. Phycological Re
search 46: 57-6 1 . NELSON W.A., BROOM J.E. & FARR TJ. 200 1 . Four new species of
Porphyra (Bangiales, Rhodophyta) from the New Zealand region described using traditional characters and 1 8S rDNA sequence data. Cryptogam ie, A lgologie 22: 263-284.
OKAYAMA H., CURIEL D.T, BRANTLY M .L., HOLMES M.D. & CRYSTAL
RG. 1 989. Rapid, nonradioactive detection of mutations in the human genome by allele-specific amplification. Journal of Laboratory
and Clinical Medicine 1 1 4 : L OS-I 1 3 . OLlVE1RA M.C. & BHATTACHARYA D. 2000. Phylogeny of the Bangio
phycidae ( Rhodophyta) and the secondary endosymbiotic origin of algal plastids. A merican Journal of Botany 87: 482-492.
OLIVEIRA M.C. & RAGAN M.A. 1 994. Variant forms of a group I intron in nuclear small-subunit rRNA genes of the marine red alga. Mo
lecular Biology and Evolution I I : 1 95-207. OLIVEIRA M.e., KURNIAWAN J. , BIRD e.J., RICE E.L., MURPHY e.A.,
SINGH R.K, GUTELL R.R. & RAGAN M.A. 1 995. A prel iminary investigation of the order Bangiales (Bangiophycidae, Rhodophyta) based on the sequences of nuclear small-subunit ribosomal RNA genes. Phycological Research 43: 7 1 -79.
OLMSTEAD R.G. & PALMER J.D. 1 994. Chloroplast DNA systematics: a review of methods and data analysis. A merican Journal of Botany
8 1 : 1 205-1 224. RAGAN M.A., BIRD e.l. , RlCE E.L., GUTELL R.R., MURPHY C.A. &
SINGH R.K. 1 994. A molecular phylogeny of the marine red algae ( Rhodophyta) based on the nuclear small-subunit rRNA gene. Pro
ceedings of the National A cademy of Science of the United States
of A merica 9 1 : 7276-7280. REITH M. & MUNHOLLAND J. 1 993. A high-resolution gene map of the
chloroplast genome of the red alga Porphyra purpurea. Plant Cell
5: 465-475. REITH M. & MUNHOLLAND J. 1 995. Complete nucleotide sequence of
the Porphyra purpurea chloroplast genome. Plant Molecular Biol
ogy Reporter 1 3 : 333-335. RINTOUL TL., SHEATH R.G. & V IS M. 1 999. Systematics and bioge
ography of the Compsopogonales (Rhodophyta) with emphasis on the freshwater famil ies in North America. Phycologia 38: 5 1 7-525.
SAVOLAINEN V.W., CENOUD P., SPICHIGER R., MARTINEZ M.D., CREVECOEUR M. & MANEN J.F. 1 995. The use of herbarium specimens in DNA phylogenetics: evaluation and improvement. Plant Systemat
ics and Evolution 1 97 : 87-98. SCHNEIDER e.W. & SEARLES R.B. 1 99 1 . Seaweeds of the southeastern
United States. Duke University Press, Durham, North Carolina. 553 pp.
SCHNEIDER C.W., SUYEMOTO M.M. & YARlSH e. 1 979. An annotated
checklist of Connecticut seaweeds. State Geological and Natural H istory Survey, Connecticut Department of Environmental Protection, Hartford, Connecticut. 20 pp.
SEARS J .R. [Ed.] 2002. NEAS keys to benthic marine algae of the
northeastern coast of North A merica from Long Island Sound to
the Strait of Belle Isle, ed. 2. Contribution No. 2 . Northeast Algal Society, Dartmouth, Massachusetts. 1 6 1 pp.
SEELANAN T, SCHNABEL A. & WENDEL J.F. 1 997. Congruence and consensus in the cotton tribe (Mal vaceae). Systematic Botany 22: 259-290.
SILVA P.e. 1 999. Porphyra. Index Nominum Algarum. Web page:
http://ucjeps.berkeley.edu/rlmoe/porphyra.html (revised 20 December 1 999). University Herbarium, University of California, Berkeley.
SILVA P.C., BASSON P.w. & MOE R .L. 1 996. Catalogue of the benthic marine algae of the Indian Ocean. University of California Publi
cations in Botany 79: 1 - 1 259. SOUTH G.R. & TITTLEY LA. 1 986. Checklist and distributional index
of the benthic algae of the North A tlantic Ocean. Huntsman Marine Laboratory, St Andrews, New Brunswick, Canada, and British Museum (Natural History), London. 76 pp.
STILLER l .W. & WAALAND I .R. 1 993. Molecular analysis reveals cryptic diversity in Porphyra (Rhodophyta). Journal of Phycology 29: 506-5 1 7.
SWOFFORD D.L. 1 998. PA UP*. Phylogenetic analysiS using parsimony
(* and other methods), version 4. Sinauer Associates, Sunderland, Massachusetts.
SWOFFORD D.L., OLSEN G.J., WADDELL P.J. & HILLIS D.M. 1 997. Phylogenetic inference. In: Molecular systematics (Ed. by D.M. Hil l is, e. Moritz & B . K. Mable), pp. 407-5 1 5. S inauer Associates, Sunderland, Massachusetts.
TAMURA K . & NEI M. 1 993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 1 0: 5 1 2-526.
TAYLOR W.R. 1 957. Marine algae of the northeastern coast of North
A merica. University of Michigan Press, Ann Arbor. 509 pp. TEASDALE B.W., WEST A.L., TAYLOR H. & KLEIN A.S. 2002. A simple
restriction fragment length polymorphism (RFLP) assay to discriminate common Porphyra (Bangiophyceae, Rhodophyta) taxa from the northwest Atlantic. Joumal of Applied Phycology 1 4 : 293-298.
VILLA LARD-BoHNSACK M. 1 995. Illustrated key fO the seaweeds of
New England. Rhode Island Natural History Survey, Kingston, Rhode Island. 1 46 pp.
V ILLALARD-BoHNSACK M. 1 998. Non-indigenous benthic algal species introduced to the northeastern coast of North America. In: NEAS
keys to the benthic marine algae of the northeastern coast of North
A merica from Long Island Sound to the Strait of Belle Isle (Ed. by J. Sears), pp. 1 30-1 3 1 . Contribution No. I . Northeast Algal Society, Dartmouth, Massachusetts.
WILKES R.I. , Y ARISH C. & MITMAN G.G. 1 999. Observations on the chromosome numbers of Porphyra (Bangiales, Rhodophyta) populations from Long Island Sound to the Canadian Maritimes. A lgae
14 : 2 1 9-222. Wu D.Y., UGOZZLI L., PAL B .K & WALLACE R.B. 1 989. Allele-spe
cific enzymatic amplification of beta globin genomic DNA for diagnosis of sickle cell anemja. Proceedings of the National Academy
of Science of the United States of A merica 86: 2757-2760. YAMAZAKl S. , KlTADE Y., MARUYAMA T. & SAGA N. 1 996. Phyloge
netic position of Porphyra yezoensis based on the 1 8S rDNA sequence. Journal of Marine Biotechnology 4: 230-232.
YARISH e., WILKES R., CHOPIN T, FEI X.G., MATHIESON A.e., KLEIN
A.S., NEEFUS e.D., MITMAN G.G. & LEVINE 1. 1 998. Domestication of indigenous Porphyra (nori) species for commercial cultivation in northeast America. World Aquaculture 29: 26-30.
YARlSH C. , CHOPIN T., WILKES R., MATHIESON A.e., FEl X.G. & Lu S. 1 999. Domestication of nori for northeast America: the Asian experience. Bulletin of the Aquaculture A ssociation of Canada 99: 1 1 - 1 7 .
YOSHIDA T . 1 997. The history and future prospects o f systematics of Bangiaceae, Rhodophyta. Natural History Research, Special Issue 3: 1 -4.
YOSHIDA T, NOTOYA M., KIKUCHI N. & M IYATA M. 1 997. Catalogue of species of Porphyra in the world, with special reference to the type locality and bibl iography. Natural History Research, Special Issue 3: 5- 1 8.
Accepted 10 October 2002