Helicobacter pylori single-stranded DNA binding protein - functional characterization and modulation of H. pylori DnaB helicase activity

Helicobacter pylori single-stranded DNA bindingprotein – functional characterization and modulationof H. pylori DnaB helicase activityAtul Sharma1,*, Ram G. Nitharwal1,*, Bhupender Singh2, Ashraf Dar1, Santanu Dasgupta2

and Suman K. Dhar1

1 Special Centre for Molecular Medicine, Jawaharlal Nehru University, New Delhi, India

2 Department of Cell and Molecular Biology, Uppsala University, Biomedical Center, Sweden

Helicobacter pylori causes gastric ulcer and gastric

adenocarcinoma related diseases in humans [1,2].

Although there are effective therapies against these

bacteria, an increasing incidence of antibiotic

resistance and recurrent infection following treatment

complicates the situation [3,4]. Considerable research

has been conducted on the clinical aspects of H. pylori

infection but the fundamental aspects of cell cycle and

DNA replication are poorly understood.

H. pylori can transform from the active helical bacil-

lary form into the dormant coccoid form, which is the

manifestation of a bacterial response towards anti-

biotics, stress, aging and unfavorable conditions [5–8].

Almost nothing is known regarding the molecular

mechanisms involved in vegetative to coccoid transi-

tion and the biology of the dormant coccoid form.

DNA replication requires the timely interplay of

various proteins that co-ordinate initiation, elongation

and termination. Although H. pylori fall into the king-

dom of Gram negative bacteria, the sequence analysis

of Helicobacter genome reveals interesting features that

include the location of the dnaA gene, approximately

600 kb away from the dnaN-gyrB gene cluster and the

absence of important genes such as recF and the

Keywords

DNA replication; helicase; Helicobacter

pylori; replication foci; single-stranded

DNA binding protein

Correspondence

S. K. Dhar, Special Centre for Molecular

Medicine, JNU, New Delhi 110067, India

Fax: +91 11 26741781

Tel: +91 11 26742572

E-mail: [email protected]

*These authors contributed equally to this

work

(Received 7 October 2008, revised 10

November 2008, accepted 13 November

2008)

doi:10.1111/j.1742-4658.2008.06799.x

Helicobacter pylori, an important bacterial pathogen, causes gastric ulcer

and gastric adenocarcinoma in humans. The fundamentals of basic biology

such as DNA replication are poorly understood in this pathogen. In the

present study, we report the cloning and functional characterization of the

single-stranded DNA (ssDNA) binding protein from H. pylori. The N-ter-

minal DNA binding domain shows significant homology with E. coli

single-stranded DNA binding protein (SSB), whereas the C-terminal

domain shows less homology. The overall DNA-binding activity and tetra-

merization properties, however, remain unaffected. In in vitro experiments

with purified proteins, H. pylori (Hp) SSB bound specifically to ssDNA

and modulated the enzymatic ATPase and helicase activity of HpDnaB

helicase. HpSSB and HpDnaB proteins were co-localized in sharp, distinct

foci in exponentially growing H. pylori cells, whereas both were spread

over large areas in its dormant coccoid form, suggesting the absence of

active replication forks in the latter. These results confirm the multiple

roles of SSB during DNA replication and provide evidence for altered

replicative metabolism in the spiral and coccoid forms that may be central

to the bacterial physiology and pathogenesis.

Abbreviations

dsDNA, double-stranded DNA; Ec, E. coli; FITC, fluoroscein isothicyanate; GST, glutathione S-transferase; Hp, Helicobacter pylori; IPTG,

isopropyl thio-b-D-galactoside; Pi, inorganic phosphate; SSB, single-stranded DNA binding protein; ssDNA, single-stranded DNA.

FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS 519

helicase loader dnaC [9,10]. We have shown recently

that the H. pylori (Hp) DnaB helicase can bypass

E. coli (Ec) DnaC function in vivo that may explain

the absence of the dnaC gene in H. pylori [11,12]. The

C-terminal region of HpDnaB is unique, with a 34

amino acid residue insertion region that is essential for

its function [13]. Recently, a protein HobA, the struc-

tural homolog of E. coli protein DiaA has been shown

to interact with the initiator protein DnaA and this

interaction is essential for DNA replication in Helicob-

acter [14,15].

One protein that is central to the DNA replication,

repair and recombination is single-stranded DNA

binding protein (SSB) [16,17]. The N-terminal domain

of SSB is highly conserved and forms an oligonucleo-

tide binding fold, and this region is also responsible

for oligomerization, typically homotetramerization in

eubacteria. The C-terminal region is less conserved and

is responsible for protein–protein interaction [18,19].

The proteins that may interact with SSB include DNA

polymerase, RNA polymerase and DNA helicases [20–

22]. Although, no direct interaction has been shown

between SSB and DnaB replicative helicase, the physi-

cal interaction between SSB and PriA helicase, the

major DNA replication restart protein, has been dem-

onstrated recently [23]. The extreme C-terminal ten

residues are essential for the interaction of EcSSB with

PriA helicase and the deletion of these residues affects

the stimulation of helicase activity of PriA mediated

through SSB [23]. Interestingly, deletion of 10 amino

acid residues from the extreme C-terminus affects

in vivo function of EcSSB [24]. Taken together, these

results suggest that the extreme C-terminal residues of

SSB are important for protein–protein interaction.

To understand the basic DNA replication machinery

of H. pylori in detail, we have cloned, over-expressed

and characterized the functional properties of HpSSB

both in vitro and in vivo. We found that HpSSB is a

true homolog of SSB in vivo because it can comple-

ment the Ecssb mutant strain and is localized in the

replisome assembly of E. coli. Furthermore, we show

that HpSSB can modulate the enzymatic activities of

HpDnaB significantly. Finally, we report that both

HpSSB and HpDnaB are co-localized in distinct foci

in replicating H. pylori but not in the dormant coccoid

form, indicating an important difference between the

two forms regarding bacterial physiology and growth.

These results further enhance our knowledge on SSB

proteins from a slow growing pathogenic bacteria and

offer great potential to study DNA–protein and pro-

tein–protein interaction that is central to the DNA

replication machinery in prokaryotes. To the best of

our knowledge, this is the first probe into the coccoid

stage demonstrating its distinction from the vegetative,

spiral stage in DNA replication activity.

Results and Discussion

Cloning, expression, purification and biochemical

activity of HpSSB

The coding region of the ORF, HP1245 (annotated as

the putative HpSSB homlog) was amplified using spe-

cific primers (as shown in the Experimental proce-

dures) and genomic DNA from H. pylori strain 26695.

The amplified PCR product was subsequently cloned

in the expression vector pET28a and was sequenced

completely. The deduced amino acid sequence was

aligned with E. coli and Bacillus subtilis SSB sequences

using the multiple sequence alignment program

clustalw (Fig. 1A). Overall, HpSSB shows 30% iden-

tity and 45% homology with EcSSB. The analysis

shows more homology at the N-terminal DNA-binding

domain (� 67%) compared to the C-terminal domain

(� 34%), which is assumed to be the region responsi-

ble for protein–protein interaction. Sequence compari-

son reveals many interesting features that include the

absence of some important residues in HpSSB com-

pared to that of EcSSB. The tryptophan residues

(Trp40 and Trp54 in EcSSB) have been replaced by

phenyl alanine residues [25]. In vitro, mutations in

these residues in EcSSB show a moderate effect on

DNA binding. His55, a residue important for oligo-

merization, is replaced by Ile in HpSSB. However,

mutation of His55 to Ile does not affect in vitro

oligomerization of EcSSB [26].

To purify recombinant HpSSB for biochemical char-

acterization, the E. coli BL21 codon plus strain was

transformed with pET28a-HpSSB construct, as

described in the Experimental procedures, and the

His-tagged fusion protein was purified using Ni-NTA

agarose beads (Fig. 1B). The purified His6-HpSSB

protein shows an apparent molecular mass of approxi-

mately 25 kDa, which is very close to the deduced

molecular mass of untagged HpSSB (� 20 kDa).

Polyclonal antibodies were raised in mice using the

purified His-HpSSB as antigens. These antibodies

effectively recognized the purified HpSSB antigen

(Fig. 1C). To prove that HpSSB is truly expressed in

H. pylori, a western blot experiment was performed

using the same antibodies against H. pylori bacterial

lysate. A single band was detected in the lane contain-

ing bacterial lysate confirming the expression of

HpSSB in H. pylori (Fig. 1C). There is a difference in

the migration of the recombinant protein and the

endogenous protein because the recombinant protein is

H. pylori SSB protein A. Sharma et al.

520 FEBS Journal 276 (2009) 519–531 ª 2008 The Authors Journal compilation ª 2008 FEBS

Fig. 1. Primary sequence analysis of HpSSB and biochemical properties. (A) The amino acid sequences of E. coli, B. subtilis and H. pylori

were aligned using the CLUSTALW multiple sequence alignment programme. *Identical residues; ‘:’ and ‘.’ indicate strongly and weakly similar

residues, respectively. (B) Coomassie gel showing the expression and purification of His-tagged HpSSB. The molecular mass is shown on

the right. (C) In vivo expression of HpSSB in H. pylori. The western blot shows the expression of HpSSB in H. pylori lysate using polyclonal

antibodies raised against HpSSB. These antibodies also recognize the recombinant protein efficiently, whereas the pre-immune sera fail to

recognize any such band. (D) Size exclusion chromatography of HpSSB. HpSSB protein, along with the marker proteins, was passed through

the Amersham Superdex 200 gel filtration column followed by elution of the proteins. The molecular masses of the standard proteins were

plotted on a logarithmic scale against the fraction numbers respective to their elution pattern. The molecular mass of HpSSB was deduced

from the plot. (E) HpSSB shows a strong affinity towards ssDNA over dsDNA. M13mp18 ssDNA or pUC18 dsDNA alone or a mixture of

both was incubated either in the absence or presence of a different amount of HpSSB followed by separation of the DNA–protein complex

using agarose gel electrophoresis. The retardation pattern of the ssDNA reveals the binding of HpSSB with ssDNA but not with dsDNA.

(F) Electrophoretic mobility shift assay to show the binding of HpSSB to the short radiolabeled oligonucleotide. The intensity of the shifted

band increased with an increasing protein concentration before reaching a saturation point.

A. Sharma et al. H. pylori SSB protein


His-tagged. The pre-immune sera under the same

experimental conditions fail to recognize any band,

suggesting the specificity of these antibodies (Fig. 1C).

EcSSB forms homotetramers in solution. The critical

residue for EcSSB homotetramer formation (His55) is

not conserved in HpSSB [26]. To investigate whether

HpSSB forms homotetramers in solution, gel filtration

analysis was performed using different marker proteins

as standards followed by HpSSB. A standard curve

was plotted using the log molecular mass values of

various standard proteins against the fraction numbers

of the proteins at which they are eluted (Fig. 1D).

From this standard curve, the molecular mass of

HpSSB was calculated to be approximately 80 kDa.

These results suggest that HpSSB forms a tetramer in

solution because the molecular mass of monomeric

HpSSB is approximately 20 kDa.

Finally, we investigated the DNA-binding property

of HpSSB. For this purpose, single-stranded M13mp18

DNA or double-stranded pUC18 DNA, or a mixture

of both, was incubated in the absence or presence of

different quantities of HpSSB followed by resolving

the DNA–protein complexes using agarose gel electro-

phoresis (Fig. 1E). The band corresponding to the

M13mp18 ssDNA is retarded significantly with an

increasing amount of HpSSB protein, whereas pUC18

double-stranded DNA (dsDNA) band is not retarded

at all under the same experimental conditions, indicat-

ing that HpSSB shows a strong affinity towards

ssDNA compared to dsDNA. Furthermore, the affin-

ity of HpSSB towards ssDNA was documented by per-

forming gel retardation assay using a small

oligonucleotide single-stranded radiolabeled probe. No

shift was observed in the absence of HpSSB, whereas

an increasing amount of HpSSB resulted in a more

intense shifted band, finally reaching a saturation point

due to the exhaustion of the free probe (Fig. 1F). The

above results indicate that, although HpSSB shows

some differences with EcSSB at the amino acid level,

overall, HpSSB shows oligomeric properties and

ssDNA binding activities similar to that of EcSSB.

Complementation of E. coli Dssb strain with

HpSSB and in vivo localization of HpSSB

in E. coli

Although HpSSB showed oligomerisation and ssDNA

binding activity in vitro typical of SSB related proteins,

we further analyzed its function as a true SSB homo-

log in vivo. For this purpose, we performed plasmid

bumping experiments where we tried to replace an

Ecssb containing plasmid (pRPZ150, ColE1 ori, TcR)

in E. coli RDP317 (Dssb::kan) (a kind gift from

U. Varshney, IISC, Bangalore, India) with plasmids

(AmpR) containing either Ecssb or HpssbWt or

HpssbDC20 (deletion of 20 amino acid residues from

the C-terminus) or pTRC vector (ColE1 ori, AmpR)

alone where the above genes have been cloned [27].

The details of the bacterial strains and plasmid con-

structs are shown in Table 1. It is important to note

that SSB is an essential protein. Therefore, if the

incoming AmpR plasmids containing test SSB coding

Table 1. Bacterial strains and plasmids.

Strain ⁄ plasmid Genotype ⁄ relevant characteristics Reference

DH10b F-mcrAD(mrr-hsdRMS-mcrBC)u80lacZDM15 DlacX74

recA1 endA1 araD139 D(ara, leu)7697

galU galK k- rpsL nupG

Invitrogen

pET28a T7, his, kanR Novagen

pET28a

HpSSBWt and HpSSB DC 20

pET28 a derivative containing 540 bp and 480 bp of

H. pylori SSB full length and C-terminal

deletion mutant

This study

pET28a HpDnaB pET28a derivative containing 1.5 kb of H. pylori dnaB Soni et al. [11]

pGEX-2T HpDnaB pGEX derivative containing 1.5 kb of H. pylori dnaB Soni et al. [12]

BL21 (DE3) F ± ompT hsdSB (rB ± mB) gal dcm (DE3) Novagen

E. coli RDP317 strain Carries a deletion in its chromosomal ssb gene (ssb::Kan)

and a wild-type copy of the ssb gene on a support plasmid,

pRPZ150 (ColE1 ori, TcR)

Gift from U. Varshney

(IISC, Bangalore, India)

pTRC E. coli SSB Wt Plasmid expressing E. coli SSB ColE1 ori, AmpR Gift from U. Varshney

pTRC HpSSBWt and

HpSSB DC 20.

Plasmid expressing HpSSBWt and DC20. ColE1 ori, AmpR This study

pET28a HpSSB-mCherry pET28a derivative expressing fusion protein of Wt HpSSB and mCherry This study

H. pylori 26695 Gift from A. Mukhopadhyay

(NICED, Kolkata, India)



genes are capable of complementing the Dssb E. coli

strain, TcR plasmids will show the TcS, AmpR pheno-

type. Using this strategy and Ecssb as a positive con-

trol, we found that continuous subculture of the

bacteria in the media containing Amp and Kan but

lacking Tc helps to replace the TcR plasmid with the

incoming AmpR plasmid with greater than 90% effi-

ciency. Similarly HpssbWt shows very high efficiency

(� 87%) compared to that of HpssbDC20 or vector

alone control. The results are summarized in Table 2

and clearly indicate that Hpssb can complement E. coli

Dssb strain in vivo. Moreover, the data suggest that the

last twenty amino acid residues are important for

in vivo function of HpSSB because HpssbDC20 cannot

complement the E. coli mutant strain. It is important

to note that the amino acid residues at the extreme

C-terminal residues of EcSSB have been reported to be

essential because they may be involved in protein–pro-

tein interaction [24]. EcSSB, HpSSBWt and

HpSSBDC20 were expressed efficiently in the E. coli

mutant strain as shown by SDS ⁄PAGE and Coomassie

staining of the bacterial lysate from the transformed

cells (Fig. 2A).

Complementation of E. coli Dssb strain using

HpSSB ensures that it can take over EcSSB function

in vivo. It has been shown recently using green fluores-

cent protein-SSB that replisome machinery containing

replication proteins assemble at the replication origin

[28]. To investigate whether HpSSB can take part in

replisome machinery, we made a His-HpSSB-mCherry

fusion construct where His-tagged HpSSB is fused at

the N-terminus of fluorescent mCherry protein. The

protein was expressed and purified from E. coli BL21

strain and the purified protein was used for DNA

binding activity. mCherry-HpSSB shows DNA-binding

activity that is similar to the Wt HpSSB, suggesting

that the fusion of mCherry does not affect the DNA

binding property of HpSSB (Fig. 2B,C). Subsequently,

we performed in vivo localization experiments using

either lag phase or log phase or stationary phase

E. coli BL21 cells transformed with mCherry-HpSSB

where the expression of mCherry-HpSSB could be

induced using isopropyl thio-b-d-galactoside (IPTG) if

required. The in vivo localization experiments to local-

ize fluorescent mCherry proteins indicate that the

expression of mCherry-HpSSB is poor in the majority

of the lag phase cells, with somewhat diffused staining

pattern (data not shown). Interestingly, the majority of

the cells from the logarithmic phase show moderate

expression of mCherry-HpSSB with distinct foci

(Fig. 2D, upper panel). At the stationary phase of

growth, these cells show expression of mCherry all

over the cell without foci formation (Fig. 2D, upper

panel). Green fluorescent protein-SSB fusion has

recently been used to label replication forks in E. coli

in time-lapse microscopy to demonstrate the dynamics

of replication fork movement during a round of repli-

cation of the bacterial chromosome [28]. We strongly

believe that these distinct foci are the replisome foci

because the foci are not present in the bacteria from

the control stationary phase. These results clearly indi-

cate that HpSSB can take part in the replisome foci in

E. coli, which is consistent with the complementation

of EcSSB mutant strain with HpSSB.

Effect of HpSSB on HpDnaB enzymatic activity

We have shown that HpSSB is a true homolog of SSB

both in vitro and in vivo. SSB interacts with many pro-

teins at the replication fork and modulates their activi-

ties. One of these proteins is DnaB helicase whose

activity can be modulated by SSB [22]. We have

recently cloned, characterized, purified and performed

structure–function analysis of the major replicative

helicase DnaB from H. pylori [13]. We were interested

to see whether HpSSB would modulate the enzymatic

activities of HpDnaB.

One of the hallmarks of the replicative helicases is

its DNA-dependent ATPase activity, which is central

to the helicase activity because it provides energy for

the DNA unwinding and forward translocation on the

replication fork. We have recently shown that the

ATPase activity of HpDnaB can be stimulated many

times in the presence of ssDNA [13]. It has been

reported that DNA-dependent ATPase activity of

DnaB helicase can be inhibited in the presence of SSB

protein [22]. We also found that the ssDNA-dependent

ATPase activity of HpDnaB can be inhibited signifi-

Table 2. Complementation analysis of HpSSB. E. coli RDP 317

Dssb strain was transformed with various AmpR plasmids (as indi-

cated) and, subsequently, they were grown in continuous subcul-

tures in liquid media in the presence of Amp and Kan. Samples

after four subcultures were streaked on agar plates and the resul-

tant single colonies were further patched on agar plates containing

Amp or Amp and Tc. The ability of the patches to grow on the

different plates was monitored and the efficiency of plasmid

replacement was counted. Amp, ampicillin; Tc, tetracyclin.

Test

SSB

genes

No. of

colonies (Amp

resistant)

No. of colonies

(Amp, Tc

resistant)

Efficiency of plasmid

replacement Tc(R)

to Tc(S) (%)

EcSSB 60 5 91

HpSSB 60 8 86.6

HpSSBDC20 52 50 3.8

pTRC vector 50 50 0



cantly in the presence of HpSSB (Fig. 3A,B). The inhi-

bition of ssDNA-dependent ATPase activity of HpDnaB

by HpSSB is likely to be due to the inability of DnaB

to bind the SSB-bound DNA. EcSSB also shows an

inhibitory effect on DNA dependent ATPase activity

of EcDnaB when ssDNA is taken as substrate [22].

Furthermore, we investigated the effect of HpSSB

on the helicase activity of HpDnaB. For this purpose,

the release of a radiolabeled 29 mer ssDNA oligo from

an annealed substrate containing M13mp18 ssDNA

was monitored using HpDnaB and different amount

of HpSSB. We found that, initially, HpSSB stimulates

the helicase activity of HpDnaB at a lower concentra-

tion. However, at a higher concentration of HpSSB,

the helicase activity was inhibited completely

(Fig. 3C,D). It is possible that, at a lower concentra-

tion of HpSSB, the released ssDNA from the annealed

substrate may become stabilized following binding

with HpSSB, thereby preventing rehybridization of the

unwound oligo with the M13mp18 ssDNA. However,

at a higher concentration of HpSSB, the excess multi-

meric HpSSB in the vicinity of fork structure may

Fig. 2. In vivo function of HpSSB. (A) Expression of EcSSB and HpSSB (wild-type and mutant forms) proteins in the E. coli SSB mutant

strain was checked by SDS ⁄ PAGE analysis of bacterial lysate obtained from un-induced and IPTG induced bacterial culture in each case fol-

lowed by Coomassie staining. *Position of the respective proteins. (B) Purification of His-HpSSB-mCherry protein. mCherry was fused with

Wt HpSSB at the C-terminus in pET28a with a His6-tag as described in the Experimental procedures. The fusion protein was purified using

Ni-NTA agarose and the quality of the protein was checked by SDS ⁄ PAGE and Coomassie staining. His-HpSSB is also shown. (C) DNA bind-

ing property of mCherry-HpSSB protein is shown as described earlier for the HpSSB protein. The arrowhead indicates the position of the

ssDNA in the absence of SSB protein and the subsequent retardation of the band with an increasing amount of SSB is also shown.

*Position of the double-stranded control DNA. (D) Localization of mCherry-HpSSB in growing E. coli cells. E. coli strain BL21 was trans-

formed with pET28a vector containing mCherry-HpSSB and the bacteria culture was grown in liquid media in the presence of 0.1 mM IPTG.

D600 was monitored at different time points and glass slides were made to check the fluorescence under the microscope from different

growth phases. Bright red fluorescent spots were observed from cells obtained from the log phase of the growth (as indicated by arrow-

heads) but not from the stationary phase bacteria.



affect the loading of HpDnaB by preventing the access

of HpDnaB to the fork structure.

Finally, we were interested in determining whether

HpSSB has any affinity towards HpDnaB. We per-

formed co-precipitation experiments in the presence of

ammonium sulfate as described previously [29]. We

found that HpSSB is precipitated completely in the

presence of ammonium sulfate because most of it can

be seen in the pellet fraction following precipitation

and SDS ⁄PAGE analysis. Interestingly, most of the

HpDnaB can be found in the supernatant fraction

following precipitation in the presence of ammonium

sulfate under the same experimental conditions

(Fig. 3E). However, when we performed co-precipita-

tion experiments using both HpDnaB and HpSSB

under the same experimental conditions, most of the

HpDnaB was found in the pellet fraction along with

HpSSB (Fig. 3E). These results suggest that HpSSB

has an affinity towards HpDnaB that allows their

coprecipitation.

Association of HpDnaB and HpSSB at high salt

concentration indicates that these two proteins may

have an affinity towards each other. To substantiate

this issue further under more physiological conditions,

we performed a pull-down assay using beads of gluta-

thione S-transferase (GST)-HpDanB beads or GST

A

C D

B

E F

Fig. 3. (A) Effect of HpSSB on ATPase activity of HpDnaB in the presence of ssDNA. The release of radiolabeled Pi from (c-32P)ATP was

monitored in the absence and presence of different concentrations of HpSSB in a mixture containing HpDnaB and ssDNA by thin-layer chro-

matography. The positions of ATP and released Pi are shown. (B) The amount of released Pi in each case was quantified using densitometric

scanning and the values were plotted accordingly. (C) The effect of HpSSB on helicase activity of HpDnaB. The release of unwound oligo

from radiolabeled substrate by HpDnaB was monitored in the absence and presence of different concentrations of HpSSB. (D) The amount

of released oligo in each case was quantified using densitometric scanning and the values were plotted accordingly. (E) Co-precipitation of

HpSSB and HpDnaB. The retention of HpSSB or HpDnaB alone or a mixture containing both the proteins in the pellet (P) and supernatant

(S) fraction was monitored following ammonium sulfate precipitation and subsequent SDS ⁄ PAGE analysis. The positions of both the proteins

are indicated. (F) GST pull-down experiments either using GST-HpDnaB or GST proteins in the presence of purified HpSSB proteins at a low

salt concentration (50 mM NaCl) followed by washing the beads and SDS ⁄ PAGE and western blot analysis of the released proteins using

anti-SSB sera. HpSSB binds specifically to HpDnaB but not to GST alone under the same experimental conditions.



alone in the presence of HpSSB protein. The pull-

down experiments were carried out at a low salt

concentration (50 mm NaCl) followed by washing the

beads first using the binding buffer and, finally, at high

stringency (300–500 mm salt concentration). The pull-

down experiments indicate that HpSSB interact specifi-

cally with GST-HpDnaB but not with control GST

protein under the same experimental conditions

(Fig. 3F). Thus, association of HpDnaB and HpSSB

both at the low and high salt concentrations suggests

that these proteins may physically interact with each

other. A similar interaction has been reported between

replication restart helicase PriA and SSB protein in

E. coli [23].

The interaction of SSB with DnaB helicase appears

to be biologically relevant because the loading of the

HpDnaB helicase may be facilitated by SSB bound to

single-stranded moiety at the fork structure. In chro-

mosomal DNA replication, initiation of Okazaki frag-

ments requires SSB coating of the lagging strand;

similar coating plays a critical function in the restart

of paused replication forks where SSB–DnaB interac-

tions might play critical, although yet undefined roles

[22]. Unlike EcDnaB, HpDnaB does not require a heli-

case loader (EcDnaC) [12]. Hence, HpSSB might have

a closer and more specific interaction with the HpSSB

C-terminal that shows poor homology compared to

that of the EcSSB C-terminal region.

Comparison of localization of replication proteins

between the active helical bacillary form and the

dormant coccoid form of H. pylori

As discussed earlier, H. pylori undergoes morphologi-

cal transition from the spiral shape to the coccoid

form under physiologically unfavorable conditions. It

is reported that the coccoid form is the degenerate

form of the bacteria leading to cell death [30]. There

are also reports indicating the presence of bacterial

enzymatic activities in the dormant form, suggesting

the continuation of metabolic activity at this stage [31–

33]. We compared the DNA replication machinery in

H. pylori in the helical bacillary form and in the coc-

coid stage by attempting to detect and localize active

replication forks. For this purpose, we used two inde-

pendent markers of active growing replication forks

(HpSSB and HpDnaB, respectively) and followed their

localization pattern in the above two forms by immu-

nofluorescence microscopy using specific antibodies

against these markers. We obtained striking results,

where the majority of the active bacillary forms show

clear distinct foci of HpDnaB and HpSSB (wherever

A

C

B

Fig. 4. Immunolocalization of HpDnaB and SSB proteins in H. pylori bacillary and coccoid forms. (A) Glass slides containing either the bacil-

lary form (upper panel) or coccoid form (lower panel) were treated for immunofluorescence (as described in the Experimental procedures)

using HpSSB antibodies (mice, 1 : 500 dilution) followed by FITC conjugated anti-mice sera as secondary antibodies. Green fluorescence

was detected using a fluorescence microscope. (B) Localization of HpDnaB in the above two stages of H. pylori. HpDnaB antibodies (rabbit,

1 : 500) were used as primary antibodies and Alexafluor594 conjugated anti-rabbit sera were used as secondary antibodies. (C) Co-localiza-

tion of HpDnaB and HpSSB proteins in the bacillary form. Both the HpDnaB and HpSSB antibodies were used in combination as primary

antibodies. Alexafluor594 conjugated anti-rabbit and FITC conjugated anti-mice secondary sera were used in combination.



staining was obtained) that are the manifestation of

active replication forks in these bacteria (Fig. 4A,B,

upper panels). HpDnaB and HpSSB foci also co-local-

ized completely with each other, confirming the pres-

ence of active replication forks in the bacillary form

(Fig. 4C). These results also suggest that these proteins

are the components of the replisome complex in vivo

and validate our in vitro co-precipitation and pull-

down results (Fig. 3E,F). Interestingly, the coccoid

forms showed diffused staining pattern for both the

proteins (Fig. 4A,B, lower panels). The absence of dis-

tinct replication foci in the coccoid forms clearly sug-

gests that these forms are physiologically different

from the bacillary form. It has been reported previ-

ously that the DNA content of the coccoid forms is

very low compared to the bacillary forms [30]. Taken

together, these results suggest that either very low or

no DNA replication takes place in the coccoid forms.

In summary, we have reported the functional char-

acterization of the SSB protein from an important

pathogen H. pylori. Although it shows divergence from

the EcSSB at the key residues involved in DNA bind-

ing and oligomerization for EcSSB, surprisingly, it can

complement an Ecssb mutant strain and is localized at

the replisome containing growing replication fork in

E. coli and also in H. pylori. Moreover, both DNA-

dependent ATPase and helicase activity of HpDnaB

can be modulated by HpSSB. Whether the modulation

effect is due to the titration of ssDNA in the presence

of HpSSB, or due to the possible interaction between

the two proteins, remains to be elucidated. However,

co-precipitation of HpSSB and HpDnaB, in vitro pull-

down experiments and in vivo co-localization of these

proteins in the bacillary form raise the possibility that

these two proteins may have an affinity with each

other. Finally, the absence of distinct replication foci

in the coccoid form clearly indicates a physiological

difference from the active bacillary form.

Experimental procedures

Bacterial strains

The bacterial strains and plasmids used in the present study

are listed in Table 1. E. coli strains were grown in LB

media (supplemented with 100 mgÆmL)1 ampicillin or

50 mgÆmL)1 kanamycin wherever needed) either at 37 or

22 �C, as required.

H. pylori culture

H. pylori strain 26695 was grown on brain heart infusion

agar (Difco, Sparks, MD, USA) supplemented with 7%

horse blood serum, 0.4% IsoVitaleX and the antibiotics

amphotericin B (8 mgÆmL)1), trimethoprim (5 mgÆmL)1)

and vancomycin (6 mgÆmL)1). The plates were incubated at

37 �C under microaerobic conditions (5% O2, 10% CO2)

for 36 h.

The coccoid form of H. pylori cells was obtained from

the culture plates kept for prolonged periods of 10–14 days,

as described previously [34,35], at 37 �C under the same

conditions. The morphology of bacteria was observed

under the microscope and cells from both the bacillary and

coccoid form cultures were harvested and used for the

immunofluorescence assay.

DNA preparation methods

E. coli plasmids DNA were prepared by the alkaline lysis

method [36]. Bacteriophage M13mp18 single-stranded

circular DNA was prepared as per the protocol described

previously [37]. H. pylori genomic DNA was isolated from

confluent culture grown on BHI agar using the cetyl

trimethyl ammonium bromide-phenol method [38].

DNA manipulation

In the H. pylori genomic database, an ORF (HP1245) was

annotated as the putative HpSSB homolog. The 540 bp

long DNA fragment representing the ORF was amplified

by PCR using H. pylori strain 26695 genomic DNA as tem-

plate with forward and reverse primers having BamHI

restriction sites using Pfu DNA polymerase. Similarly, a

fragment with a deletion of 60 bp representing the last 20

amino acids at the C-terminus of the Hpssb gene was

amplified by PCR.

The PCR-amplified HpssbWt (540 bp) and HpssbDC20(480 bp) DNA fragments were cloned in the expression

vector pET28a (Novagen, Madison, WI, USA) at the

BamHI site and subsequently sequenced. For the

complementation assay, wild-type and HpssbDC20 genes

were subcloned from the respective pET28a recombinant

clones into pTRC vector at the NcoI–HindIII restriction

sites. For pET28a-HpSSB-mCherry constructs, the Hpssb

gene was amplified using the same forward primer, but a

reverse primer without a stop codon and with a SacI site,

and cloned into pET28a at the BamHI–SacI site followed

by cloning of PCR amplified mCherry gene from PRSET-B-

mCherry [39] at the SacI–XhoI site [HpSSB full length for-

ward BamHI, 5¢-CG GGATCCATGTTTAATAAAGTGA

TTATGG-3¢; HpSSB full length reverse BamHI,5¢CG GG

ATCCCTTCATCAATATTGATTTCAGG-3¢; HpSSBDC20reverse BamHI, 5¢-CGGGATCCTCACTGTGCTTGTAA

ATTCTC-3¢; SSB reverse SacI (without stop codon), 5¢-CGAGCTC AAA GGG GAT TTC TTC TTC-3¢; mCherry

forward SacI, 5¢-CGAGCTC ATG GTG AGC AAG GGC

GAG-3¢; mCherry reverse XhoI, 5¢-CCGCTCGAG TTA

CTT GTA CAG CTC GTC C-3¢].



Purification of His-tagged Wt and DC20 HpSSB

protein

E. coli strain BL21 (DE3) (Novagen) harboring pET28a

HpSSB (Wt), DC20 SSB and SSB-mCherry constructs was

grown at 37 �C in LB media containing 50 mgÆmL)1 kana-

mycin. The bacterial cultures were induced for the expres-

sion of the recombinant proteins using 0.25 mm IPTG at

22 �C for 4 h. His-tagged proteins were purified using

Ni-NTA agarose beads (Qiagen, Hilden, Germany) in

accordance with the manufacturer’s instructions. The eluted

proteins were dialyzed against dialysis buffer containing

50 mm Tris–Cl (pH 7.5), 1 mm EDTA, 100 mm NaCl,

100 mm phenylmethanesulfonyl fluoride and 10% glycerol.

For helicase and ATPase assays, HpSSB (Wt) and

DC20SSB were dialysed against MonoQ and MonoS buf-

fers and subjected to ion exchange chromatography using

MonoQ and MonoS ion-exchange columns (GE Health-

care, Uppsala, Sweden) in accordance with the manu-

facturer’s instructions. The fractions of ion exchange

chromatography were then checked on 10% SDS ⁄PAGE

and pooled and dialysed against dialysis buffer.

Protein concentrations were determined by the Brad-

ford method (Bio-Rad, Hercules, CA, USA) in accor-

dance with the manufacturer’s instructions with BSA as

standard. Western blot analysis was carried out following

standard procedures to check the proteins.

Agarose gel retardation assay

ssDNA binding activity of Wt HpSSB, DC20 and HpSSB-

mCherry was checked by incubating the Wt and DC20SSB protein in varying concentrations (0, 0.45, 0.9, 1.8,

2.7 and 3.6 lg, respectively) with 300 ng of M13mp18

single-stranded circular DNA and ⁄ or 300 ng of pUC18

double-stranded circular DNA in binding buffer (20 mm

Tris–HCl, pH 8.0, 1 mm MgCl2, 100 mm KCl, 8 mm

dithiothreitol, 4% sucrose and 80 lgÆmL)1 BSA) in a

20 lL reaction mixture. After 30 min of incubation on ice,

reaction mixtures were resolved in 0.7% agarose gel along

with M13mp18 ssDNA alone, as a control. The increas-

ing retardation of the nucleoprotein complex with increas-

ing concentrations of SSB indicates the ssDNA binding

activity of test proteins. BSA was taken as a negative

control.

Electrophoretic mobility shift assay

Thirty-two nucleotide ssDNA oligo (CGGGA CCATGCG

CCAAAAAATGCCTAAAGAC) from Microsynth (Balgach,

Switzerland) was radiolabeled using (32P)ATP(cP) with the

help of polynucleotide kinase enzyme and the purified

labeled oligos were incubated in the absence or presence of

HpSSB (20, 60, 100, 140 and 180 ng) in binding buffer

(20 mm Tris–HCl, pH 8.0, 1 mm MgCl2, 100 mm KCl,

8 mm dithiothreitol, 4% sucrose, 80 lgÆmL)1 BSA) for

30 min at room temperature (25 �C) and separated on a

6% native PAGE. The native gel was run at 150 V for 2 h

in 1 · TBE buffer (Tris 89 mm, pH 8, boric acid 89 mm,

EDTA 2 mm). The complex and the free DNA were visual-

ized by autoradiography.

Oligomerization status

Wt HpSSB (500 lg) was subjected to size-exclusion

chromatography on a Pharmacia Superdex 200 gel filtration

column (Amersham Biosciences, Uppsala, Sweden) in a

buffer containing 50 mm Tris–HCl (pH 7.4), 1 mm EDTA,

100 mm phenylmethanesulfonyl fluoride, 10% glycerol,

10 mm b-mercaptoethanol and 100 mm NaCl. The column

was previously calibrated using Pharmacia low- and high-

molecular weight standards as indicated. Fractions

(0.3 mL) were collected and checked for the presence of

proteins by SDS ⁄PAGE.

ATP hydrolysis assay

The ATPase activity of HpDnaB with and without SSB

was measured in a reaction mixture (20 lL) containing

20 mm Tris–HCl (pH 8.0), 1 mm MgCl2, 100 mm KCl,

8 mm dithiothreitol, 4% sucrose, 80 lgÆmL)1 BSA, 1 mm

ATP, 3.4 fmol of (c-32P)ATP and the required amount of

DnaB (50 ng), along with 1 pmol of M13mp18 ssDNA and

various concentrations of SSB. The reaction mixtures were

incubated at 37 �C for 30 min and the reactions were

stopped by putting the tubes on ice. Released inorganic

phosphate (Pi) was separated by thin-layer chromatography

on a poly ethylenemine cellulose strip (Sigma-Aldrich,

St Louis, MO, USA) in 0.5 m LiCl and 1 m formic acid at

room temperature for 1 h. The thin-layer chromatography

plate was dried, autoradiographed and analyzed by a phos-

phorimager (Fuji�lm-BAS-1800; Fuji, Tokyo, Japan) for

quantitation.

Helicase assay

The substrate for helicase assay was prepared by annealing

a 29 mer oligo (5¢-CCAAAACCCAGTCACGACGTTGT

AAAACG-3¢) to M13mp18 single-stranded circular DNA.

This annealed substrate has a six bases long 5¢ tail. Helicase

assay was carried out in a 20 lL reaction mixture contain-

ing 20 mm Tris–Cl (pH 8.0), 8 mm dithiothreitol, 2.5 mm

MgCl2, 2 mm ATP, 80 lgÆmL)1 BSA, 10 mm KCl, 4%

sucrose and 10 fmol of helicase substrate and the indicated

amount of HpDnaB and HpSSB. HpDnaB protein (3.0 ng)

was incubated in above buffer for 15 min (on ice) and then

the indicated amount of HpSSB was added to the reaction.

This mixture was incubated at 37 �C in a water bath for



30 min. The reaction was stopped by the addition of 5 lLof 5 · stop buffer (1.25% SDS, 75 mm EDTA, 25% glyc-

erol) and the products were separated in 10% native gel

(run in 0.5 · TBE). The gel was dried and exposed to

X-ray film and the quantification was performed using a

phosphorimager.

Complementation assay – plasmid bumping

assay

E. coli RDP317 strain, in which the chromosomal ssb gene

is replaced by a kanamycin resistance (ssb::Kan) marker

and harboring a support plasmid pRPZ150 (ColEl ori,

TcR) coding wild-type SSB protein was transformed with

the pTRC HpSSB Wt or pTRC HpSSBDC20 or pTRC

vector alone. Transformants were grown in the presence

of ampicillin (100 lgÆmL)1) and kanamycin (25 lgÆmL)1)

in four consecutive subcultures in 5 mL of LB media, and

then streaked on plain LB agar plates. The isolated single

colony from the streaked plate was patched on LB agar

plates containing ampicillin alone (100 lgÆmL)1) and on

plates containing both tetracycline (25 lgÆmL)1) and ampi-

cillin (100 lgÆmL)1). The number of patches growing in

both the plates was recorded and the plasmid replacement

efficiency was calculated as a percentage. Because SSB is

an essential protein, the original TcR plasmid can be

replaced by the incoming AmpR plasmid only when it

complements the function of Ecssb in vivo. The conversion

of TcR strain into TcS AmpR phenotype shows that the

HpSSB complements the Dssb strain of E. coli. The com-

plementation ability is analysed in terms of the plasmid

replacement efficacy of the E. coli mutant strain trans-

formed with plasmid containing test genes [27]. The

pTRCEcssb was used as a positive control whereas pTRC

vector alone was used as a negative control to assess the

efficacy of the experiment.

Replication foci study

E. coli BL21 (DE3) strain was transformed with pET28a

HpSSB-mCherry construct and the transformants were

grown in 100 mL of LB media containing Kanamycin

(50 lgÆmL)1) in the absence and presence of various con-

centration of IPTG (0.1–2 mm). At various time intervals,

the cell growth was estimated by taking the value at D600

using a spectrophotometer. A 1 mL sample for each growth

stages was collected and the cell pellets were resuspended in

100 lL of growth media. Some 10 lL of this cell suspen-

sion were placed on agarose gel slab (1% agarose gel slab

in 0.9% NaCl or growth media) and covered by a coverslip.

The cells were then observed under a Nikon fluorescent

microscope (Nikon, Tokyo, Japan). The excitation and

emission spectra for mCherry are 587 and 610 nm, respec-

tively. Images were analysed for red fluorescence signals for

a number of bacterial cells.

Co-precipitation experiments

HpSSB and HpDnaB (alone or a mixture containing both

proteins) were precipitated in the presence of ammonium

sulfate using a previously described protocol [29]. In brief,

HpSSB or HpDnaB or both the proteins (10 lm each) were

mixed in 20 lL of co-precipitation buffer (50 mm Tris–

HCl, pH 7.5, 100 mm NaCl and 10% glycerol) and incu-

bated on ice for 15 min. A solution of 20 lL of ammonium

sulfate (250 gÆL)1, final concentration 125 gÆL)1) was added

to the protein mixture and incubated on ice for another

15 min followed by centrifugation at 10 000 g for 1 min.

Supernatant was collected separately and the pellet was

washed three times with 50 lL of wash buffer (co-precipita-

tion buffer plus 125 gÆL)1 ammonium sulfate). Pellet and

soup fractions were suspended in 2 · SDS ⁄PAGE loading

buffer and 20 lL of each was loaded on 10% polyacryl-

amide gel and stained with Coomassie brilliant blue.

GST pull-down assay

GST pull-down assays were performed by incubating

purified His6-HpSSB (6 lg) in the presence of either GST-

HpDnaB or GST proteins bound on glutathione beads in

the binding buffer (20 mm Tris–HCl, pH 7.5, 1 mm

dithiothreitol, 0.1% NP40, 5 mm MgCl2, 50 mm NaCl,

100 lm phenylmethanesulfonyl fluoride) at room tempera-

ture (25 �C) with gentle rotation. The beads were then

washed three times with binding buffer containing 300 mm

NaCl and the bound proteins were analysed by

SDS ⁄PAGE and western blotting.

Generation of HpSSB antibody

Polyclonal antibodies against His-HpSSB protein were gen-

erated in mice essentially following the protocol described

previously [40]. The antibodies were tested for specificity by

western blot analysis using standard protocols.

Immunofluorescence assays

H. pylori cells were harvested on poly-lysine coated glass

slides and fixed with 4% paraformaldehyde in NaCl ⁄Pi for

15 min at room temperature. Cells were then washed with

NaCl ⁄Pi and treated with 50 mm glucose, 20 mm Tris–HCl,

pH 8.0, 10 mm EDTA, 2 mgÆmL)1 lysozyme and 0.1% Tri-

ton X-100 for 1 h at 37 �C. Cells were further washed with

1 · NaCl ⁄Pi and blocked with 2% BSA in 1 · NaCl ⁄Pi.

Cells were then incubated with primary antibodies (1 : 500

for anti-HpDnaB in rabbit and 1 : 500 for anti-HpSSB in

mice) with 2% BSA in NaCl ⁄Pi at 4 �C overnight. After

washing with NaCl ⁄Pi, cells were incubated with secondary

antibodies [1 : 20 dilution for Alexafluor594 conjugated

IgG antibodies raised in goat against rabbit IgG molecules



and 1 : 20 dilution for fluoroscein isothicyanate (FITC)

conjugated IgG antibodies raised in goat against mouse

IgG molecules; Molecular Probes (Carlsbad, CA, USA)

and Invitrogen (Carlsbad, CA, USA), respectively]. Cells

were further washed with NaCl ⁄Pi and 20% glycerol was

used as the mounting medium. An Axioplan2 fluorescence

microscope (Nikon) was used to capture images. For detec-

tion, a FITC filter was used (exciter 480 ⁄ 40 nm and emitter

535 ⁄ 50 nm). For detection of Alexafluor594, a suitable filter

with an exciter range of 540–590 nm and an emission range

of 600–650 nm was used. axiovision, release 4.6 (Nikon)

software was used for analysis of the images.

Acknowledgements

This work was partially supported by an Indo-Swiss

link grant (SIDA-VR No. 348-2006-6709) provided

to S. D. and S. K. D. We acknowledge Dr Umesh

Varshney (Indian Institute of Science, Bangalore, India)

for providing the E. coli SSB mutant strain RDP317

and Dr Ashish Mukhopadhyay (National Institute of

Cholera and Enteric Diseases, Kolkata, India) for his

help in establishing H. pylori culture. A. S. acknowl-

edges the University Grant Commission (UGC) as well

as the Council of Scientific and Industrial Research

(CSIR). R. G. and A. D. acknowledge UGC for fellow-

ships. Dr Rahma Wehelie (Uppsala University,

Sweden) is greatly acknowledged for providing the

H. pylori culture for the immunofluorescence assay.

References

1 Atherton JC (2006) The pathogenesis of Helicobacter

pylori-induced gastro-duodenal diseases. Annu Rev

Pathol 1, 63–96.

2 Dhar SK, Soni RK, Das BK & Mukhopadhyay G

(2003) Molecular mechanism of action of major Heli-

cobacter pylori virulence factors. Mol Cell Biochem 253,

207–215.

3 Dore MP, Piana A, Carta M, Atzei A, Are BM, Mura I,

Massarelli G, Maida A, Sepulveda AR, Graham DY

et al. (1998) Amoxycillin resistance is one reason for fail-

ure of amoxycillin–omeprazole treatment of Helicobacter

pylori infection. Aliment Pharmacol Ther 12, 635–639.

4 Niv Y (2008) H. pylori recurrence after successful eradi-

cation. World J Gastroenterol 14, 1477–1478.

5 Catrenich CE & Makin KM (1991) Characterization of

the morphologic conversion of Helicobacter pylori from

bacillary to coccoid forms. Scand J Gastroenterol

26(Suppl. 181), 58–64.

6 Cellini L, Allocati N, Angelucci D, Lezzi T, Di Campli

E, Marzio L & Dainelli B (1994) Coccoid Helicobacter

pylori not culturable in vitro reverts in mice. Microbiol

Immunol 38, 843–850.

7 Cellini L (1996) Coccoid forms of Helicobacter pylori.

J Infect Dis 173, 1288.

8 Chan WY, Hui PK, Leung K, Chow J, Kwok F & Ng

CS (1994) Coccoid forms of Helicobacter pylori in the

human stomach. Am J Clin Pathol 102, 503–507.

9 Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton

GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill

S, Dougherty BA et al. (1997) The complete genome

sequence of the gastric pathogen Helicobacter pylori.

Nature 388, 539–547.

10 Alm RA, Ling LS, Moir DT, King BL, Brown ED,

Doig PC, Smith DR, Noonan B, Guild BC, deJonge

BL et al. (1999) Genomic-sequence comparison of

two unrelated isolates of the human gastric pathogen

Helicobacter pylori. Nature 397, 176–180.

11 Soni RK, Mehra P, Choudhury NR, Mukhopadhyay G

& Dhar SK (2003) Functional characterization of Heli-

cobacter pylori DnaB helicase. Nucleic Acids Res 31,

6828–6840.

12 Soni RK, Mehra P, Mukhopadhyay G & Dhar SK

(2005) Helicobacter pylori DnaB helicase can bypass

Escherichia coli DnaC function in vivo. Biochem J 389,

541–548.

13 Nitharwal RG, Paul S, Dar A, Choudhury NR, Soni

RK, Prusty D, Sinha S, Kashav T, Mukhopadhyay G,

Chaudhuri TK et al. (2007) The domain structure of

Helicobacter pylori DnaB helicase: the N-terminal

domain can be dispensable for helicase activity whereas

the extreme C-terminal region is essential for its func-

tion. Nucleic Acids Res 35, 2861–2874.

14 Zawilak-Pawlik A, Kois A, Stingl K, Boneca IG, Skro-

buk P, Piotr J, Lurz R, Zakrzewska-Czerwinska J &

Labigne A (2007) HobA – a novel protein involved in

initiation of chromosomal replication in Helicobacter

pylori. Mol Microbiol 65, 979–994.

15 Natrajan G, Hall DR, Thompson AC, Gutsche I &

Terradot L (2007) Structural similarity between the

DnaA-binding proteins HobA (HP1230) from Helicob-

acter pylori and DiaA from Escherichia coli. Mol Micro-

biol 65, 995–1005.

16 Shamoo Y, Friedman AM, Parsons MR, Konigsberg

WH & Steitz TA (1995) Crystal structure of a replica-

tion fork single-stranded DNA binding protein (T4

gp32) complexed to DNA. Nature 376, 362–366.

17 Webster G, Genschel J, Curth U, Urbanke C, Kang

C & Hilgenfeld R (1997) A common core for binding

single-stranded DNA: structural comparison of the

single-stranded DNA-binding proteins (SSB) from

E. coli and human mitochondria. FEBS Lett 411,

313–316.

18 Murzin AG (1993) OB(oligonucleotide ⁄oligosaccharidebinding)-fold: common structural and functional

solution for non-homologous sequences. EMBO J 12,

861–867.



19 Kinebuchi T, Shindo H, Nagai H, Shimamoto N &

Shimizu M (1997) Functional domains of Escherichia coli

single-stranded DNA binding protein as assessed by

analyses of the deletion mutants. Biochemistry 36, 6732–

6738.

20 Kelman Z, Yuzhakov A, Andjelkovic J & O’Donnell M

(1998) Devoted to the lagging strand-the subunit of

DNA polymerase III holoenzyme contacts SSB to pro-

mote processive elongation and sliding clamp assembly.

EMBO J 17, 2436–2449.

21 Richard DJ, Bell SD & White MF (2004) Physical and

functional interaction of the archaeal single-stranded

DNA-binding protein SSB with RNA polymerase.

Nucleic Acids Res 32, 1065–1074.

22 Biswas EE, Chen PH & Biswas SB (2002) Modulation

of enzymatic activities of Escherichia coli DnaB helicase

by single-stranded DNA-binding proteins. Nucleic Acids

Res 30, 2809–2816.

23 Cadman CJ & McGlynn P (2004) PriA helicase and

SSB interact physically and functionally. Nucleic Acids

Res 32, 6378–6387.

24 Curth U, Genschel J, Urbanke C & Greipel J (1996)

In vitro and in vivo function of the C-terminus of

Escherichia coli single-stranded DNA binding protein.


25 Khamis MI, Casas-Finet JR, Maki AH, Murphy JB &

Chase JW (1987) Investigation of the role of individual

tryptophan residues in the binding of Escherichia coli

single-stranded DNA binding protein to single-stranded

polynucleotides. A study by optical detection of mag-

netic resonance and site-selected mutagenesis. J Biol

Chem 262, 10938–10945.

26 Curth U, Bayer I, Greipel J, Mayer F, Urbanke C &

Maass G (1991) Amino acid 55 plays a central role in

tetramerization and function of Escherichia coli single-

stranded DNA binding protein. Eur J Biochem 196,

87–93.

27 Handa P, Acharya N, Thanedar S, Purnapatre K &

Varshney U (2000) Distinct properties of Mycobacte-

rium tuberculosis single-stranded DNA binding protein

and its functional characterization in Escherichia coli.


28 Reyes-Lamothe R, Possoz C, Danilova O & Sherratt

DJ (2008) Independent positioning and action of

Escherichia coli replisomes in live cells. Cell 133,

90–102.

29 Genschel J, Curth U & Urbanke C (2000) Interaction

of E. coli single-stranded DNA binding protein (SSB)

with exonuclease I. The carboxy-terminus of SSB is the

recognition site for the nuclease. Biol Chem 381, 183–

192.

30 Kusters JG, Gerrits MM, Van Strip JAG & Van-

debroucke-grauls MJE (1997) Coccoid forms of Heli-

cobacter pylori are the morphologic manifestation of

cell death. Infect Immun 65, 3672–3679.

31 Bode G, Mauch F & Malfertheiner P (1993) The

coccoid forms of Helicobacter pylori. Criteria for their

viability. Epidemiol Infect 111, 483–490.

32 Cole SP, Cirillo D, Kagnoff MF, Guiney DG &

Eckmann L (1997) Coccoid and spiral Helicobacter

pylori differ in their abilities to adhere to gastric

epithelial cells and induce interleukin-8 secretion. Infect

Immun 65, 843–846.

33 Sorenberg M, Nilsson M, Hanberger H & Nilsson LE

(1996) Morphologic conversion of Helicobacter pylori

from bacillary to coccoid form. Eur J Clin Microbiol

Infect Dis 15, 216–219.

34 Mizoguchi H, Fujioka T, Kishi K, Nishizono A,

Kodama R & Nasu M (1998) Diversity in protein

synthesis and viability of Helicobacter pylori coccoid

forms in response to various stimuli. Infect Immun 66,

5555–5560.

35 Enroth H, Wreiber K, Rigo R, Risberg D, Uribe A &

Engstrand L (1999) In vitro aging of Helicobacter pylori:

changes in morphology, intracellular composition and

surface properties. Helicobacter 4, 7–16.

36 Ausubel FM, Brent R, Kingston RE, Moore DD,

Seidman JG, Smith JA & Struhl K (eds) (1999) Short

Protocols in Molecular Biology, 4th edn, pp. 1–22.

John Wiley & Sons, New York, NY.

37 Sambrook J, Fritsch EF & Maniatis T (ed.) (1989)

Molecular Cloning: A Laboratory Manual, 2nd edn, pp.

4.21–4.32. Cold Spring Harbor Press, Cold Spring

Harbor, NY.

38 Ausubel FM, Brent R, Kingston RE, Moore DD,

Seidman JG, Smith JA & Struhl K (eds) (1998) Current

Protocols in Molecular Biology. Vol. 1, pp. 1.1.1.

John Wiley & Sons, New York, NY.

39 Shaner NC, Campbell RE, Steinbach PA, Giepmans

BN, Palmer AE & Tsien RY (2004) Improved mono-

meric red, orange and yellow fluorescent proteins

derived from Discosoma sp. red fluorescent protein.

Nat Biotechnol 22, 1567–1572.

40 Harlow E & Lane D (1988) Antibodies. Cold Spring

Harbor Laboratory Press, Cold Spring Harbor, NY.



Documents

Helicobacter pylori single-stranded DNA binding protein - functional characterization and modulation of H. pylori DnaB helicase activity