Haploinsufficiency of the insulin-like growth factor-1 receptor enhances endothelial repair and favorably modifies angiogenic progenitor cell phenotype

Skromna, D. Julian A. Scott, Mark T. Kearney and Stephen B. WheatcroftAziz, Matthew Gage, Kamatamu Amanda Mbonye, Jessica Smith, Stacey Galloway, AnnaMughal, Hema Viswambharan, Helen Imrie, Piruthivi Sukumar, Richard M. Cubbon, Amir Nadira Y. Yuldasheva, Sheikh Tawqeer Rashid, Natalie J. Haywood, Paul Cordell, Romana

Repair and Favorably Modifies Angiogenic Progenitor Cell PhenotypeHaploinsufficiency of the Insulin-Like Growth Factor-1 Receptor Enhances Endothelial

Print ISSN: 1079-5642. Online ISSN: 1524-4636 Copyright © 2014 American Heart Association, Inc. All rights reserved.

Greenville Avenue, Dallas, TX 75231is published by the American Heart Association, 7272Arteriosclerosis, Thrombosis, and Vascular Biology published online July 10, 2014;Arterioscler Thromb Vasc Biol.

http://atvb.ahajournals.org/content/early/2014/07/10/ATVBAHA.114.304121World Wide Web at:

The online version of this article, along with updated information and services, is located on the

http://atvb.ahajournals.org/content/suppl/2014/07/10/ATVBAHA.114.304121.DC1.htmlData Supplement (unedited) at:

http://atvb.ahajournals.org//subscriptions/

at: is onlineArteriosclerosis, Thrombosis, and Vascular Biology Information about subscribing to Subscriptions:

http://www.lww.com/reprints

Information about reprints can be found online at: Reprints:

document. Question and AnswerPermissions and Rightspage under Services. Further information about this process is available in the

which permission is being requested is located, click Request Permissions in the middle column of the WebCopyright Clearance Center, not the Editorial Office. Once the online version of the published article for

can be obtained via RightsLink, a service of theArteriosclerosis, Thrombosis, and Vascular Biologyin Requests for permissions to reproduce figures, tables, or portions of articles originally publishedPermissions:

by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from

http://atvb.ahajournals.org/content/early/2014/07/10/ATVBAHA.114.304121

http://atvb.ahajournals.org/content/suppl/2014/07/10/ATVBAHA.114.304121.DC1.html

http://www.ahajournals.org/site/rights/

http://www.ahajournals.org/site/rights/

http://www.lww.com/reprints

http://atvb.ahajournals.org//subscriptions/

http://atvb.ahajournals.org/











1

Type 2 diabetes mellitus is a disorder of cell growth and metabolism leading to a portfolio of chronic disorders

of human health dominated by atherosclerosis-related dis-eases, such as myocardial infarction, stroke, and peripheral arterial disease. As a result, individuals with type 2 diabe-tes mellitus experience cardiovascular event rates clinically manifest 15 years earlier than in patients without diabetes mellitus.1 Effective endothelial repair following structural or functional damage to the endothelium is critical to pre-vent adverse arterial remodeling, thrombosis, and athero-sclerosis.2 Recent studies support a prominent role for impairment of nitric oxide (NO)-dependent endothelial cell repair/replacement in diabetes mellitus–related vascu-lar disease.3,4 Indeed, insulin resistance, the primary meta-bolic disturbance underpinning type 2 diabetes mellitus, is

associated with delayed endothelial repair in the absence of overt glycemia.4 We recently demonstrated that the type 1 insulin-like growth factor receptor (IGF1R), which acts as the principal tyrosine kinase receptor delivering cues for cellular and whole organism growth, is a negative regulator of NO bioavailability and insulin sensitivity in the endo-thelium.5 In mice with haploinsufficiency of the IGF1R, we observed a phenotype of enhanced whole-body insulin sensitivity, enhanced insulin-stimulated phosphorylation of endothelial nitric oxide synthase (eNOS), and increased basal NO generation.5 In the present report, we examine the effect of partial deletion of the IGF1R on vascular regenera-tion in this model and investigate whether manipulation of IGF1R abundance could be a strategy to refine cell-based therapy to augment endothelial repair.

© 2014 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.114.304121

Objectives—Defective endothelial regeneration predisposes to adverse arterial remodeling and is thought to contribute to cardiovascular disease in type 2 diabetes mellitus. We recently demonstrated that the type 1 insulin-like growth factor receptor (IGF1R) is a negative regulator of insulin sensitivity and nitric oxide bioavailability. In this report, we examined partial deletion of the IGF1R as a potential strategy to enhance endothelial repair.

Approach and Results—We assessed endothelial regeneration after wire injury in mice and abundance and function of angiogenic progenitor cells in mice with haploinsufficiency of the IGF1R (IGF1R+/−). Endothelial regeneration after arterial injury was accelerated in IGF1R+/− mice. Although the yield of angiogenic progenitor cells was lower in IGF1R+/− mice, these angiogenic progenitor cells displayed enhanced adhesion, increased secretion of insulin-like growth factor-1, and enhanced angiogenic capacity. To examine the relevance of IGF1R manipulation to cell-based therapy, we transfused IGF1R+/− bone marrow–derived CD117+ cells into wild-type mice. IGF1R+/− cells accelerated endothelial regeneration after arterial injury compared with wild-type cells and did not alter atherosclerotic lesion formation.

Conclusions—Haploinsufficiency of the IGF1R is associated with accelerated endothelial regeneration in vivo and enhanced tube forming and adhesive potential of angiogenic progenitor cells in vitro. Partial deletion of IGF1R in transfused bone marrow–derived CD117+ cells enhanced their capacity to promote endothelial regeneration without altering atherosclerosis. Our data suggest that manipulation of the IGF1R could be exploited as novel therapeutic approach to enhance repair of the arterial wall after injury. (Arterioscler Thromb Vasc Biol. 2014;34:00-00.)

Key Word: endothelium

Received on: October 19, 2012; final version accepted on: June 20, 2014.From the Division of Cardiovascular and Diabetes Research, Leeds Multidisciplinary Cardiovascular Research Centre, University of Leeds, Leeds,

United Kingdom.*These authors contributed equally to this article.The online-only Data Supplement is available with this article at http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.114.304121/-/DC1.Correspondence to Stephen Wheatcroft, PhD, The LIGHT Laboratories, University of Leeds, Clarendon Way, Leeds, LS29JT, United Kingdom. E-mail

[email protected]

Haploinsufficiency of the Insulin-Like Growth Factor-1 Receptor Enhances Endothelial Repair and Favorably

Modifies Angiogenic Progenitor Cell PhenotypeNadira Y. Yuldasheva,* Sheikh Tawqeer Rashid,* Natalie J. Haywood, Paul Cordell,

Romana Mughal, Hema Viswambharan, Helen Imrie, Piruthivi Sukumar, Richard M. Cubbon, Amir Aziz, Matthew Gage, Kamatamu Amanda Mbonye, Jessica Smith, Stacey Galloway,

Anna Skromna, D. Julian A. Scott, Mark T. Kearney, Stephen B. Wheatcroft

Original Article

by guest on September 9, 2014http://atvb.ahajournals.org/Downloaded from

http://atvb.ahajournals.org/lookup/suppl/doi:10.1161/ATVBAHA.114.304121/-/DC1

mailto:[email protected]


2 Arterioscler Thromb Vasc Biol September 2014

Materials and MethodsMaterials and Methods are available in the online-only Supplement.

ResultsEffect of Partial IGF1R Deletion on Endothelial Regeneration After Arterial InjuryTo investigate the effects of partial deletion of IGF1Rs on endothelial regeneration, we subjected IGF1R+/− and wild-type (WT) mice to femoral artery endothelium-denuding wire injury. Femoral arteries were harvested ay days 0, 4, and 7 and the area of endothelial regeneration quantified by Evans blue staining. Wire injury induced immediate and complete denu-dation of endothelium (Figure 1A and 1B). Four days after injury, IGF1R+/− mice displayed significantly enhanced re-endothelialization compared with WT littermates (Figure 1A and 1B). Regenerated area was similar in IGF1R+/− and WT mice by day 7 (Figure 1A and 1B). Serum concentration of insulin-like growth factor (IGF)-1 was similar in IGF1R+/− and WT mice (Figure 1C).

Quantification of Angiogenic Progenitor CellsTo investigate whether the accelerated endothelial repair in IGF1R+/− mice was contingent on increased abundance of endothelial progenitors, we quantified circulating Sca-1+/Flk-1+ progenitor cells and the yield of angiogenic progeni-tor cells (APCs) from mononuclear cells in IGF1R+/− and WT mice. Sca-1+/Flk-1+ cells were similar in abundance in IGF1R+/− mice compared with WT littermates (Figure 2A). Mobilization of progenitor cells from the bone marrow niche in response to proangiogenic cytokines is a prerequisite for effective endothelial repair.6 Systemic administration of vas-cular endothelial growth factor increased circulating numbers of Sca-1+/Flk-1+ cells in both groups of mice (Figure 2B). We found no significant difference in APC mobilization following vascular endothelial growth factor administration in IGF1R+/− mice compared with WT littermates (Figure 2C). We expanded mononuclear cells derived from peripheral blood, spleen, and bone marrow and counted cells displaying typical properties (eg, uptake of acetylated low-density lipoproteins and binding of Ulex lectin) after 7 days of culture as APCs (Figure 2D). The yield of APCs from blood and bone marrow was signifi-cantly lower in IGF1R+/− mice compared with WT; no differ-ence between mice was found in the yield of spleen-derived APCs (Figure 2E). The size and density of APCs, assessed by flow cytometry, was similar in WT and IGF1R+/− mice (Figure IA and IB in the online-only Data Supplement). Expression of the leukocyte marker CD11b and the integrin chain CD49e (which is abundantly expressed on monocytes) were similar

in APCs from WT and IGF1R+/− mice (Figure IC and ID in the online-only Data Supplement). APCs from both genotypes expressed the markers CD68 and Factor XIII-A (Figure IE in the online-only Data Supplement) in keeping with the mono-cytic origin of these cells.7

Adhesion AssayAs adhesion of circulating cells to the damaged vessel wall is a critical step in progenitor cell–mediated vascular repair, we examined the capacity of APCs to adhere to the extracellular matrix glycoprotein protein fibronectin in vitro. APCs from IGF1R+/− mice showed significantly enhanced adhesion to fibronectin compared with WT APC (Figure 3A). Incubation of APCs with the NO synthase inhibitor NG-monomethyl-L-arginine did not modify adhesion of WT APCs but signifi-cantly inhibited adhesion of IGF1R+/− APCs to control levels (Figure 3A).

Nonstandard Abbreviations and Acronyms

APC angiogenic progenitor cell

eNOS endothelial nitric oxide synthase

IGF insulin-like growth factor

IGF1R type 1 insulin-like growth factor receptor

NO nitric oxide

WT wild type

Figure 1. Endothelial regeneration following arterial injury. A, Percent endothelial regeneration in vessels harvested at indi-cated times after arterial injury (*P<0.05; n=6–8 per group). B, Representative images of injured femoral arteries. Evans blue–stained areas represent non–re-endothelialized areas of exposed subendothelial matrix (magnification ×20). C, Concentration of insulin-like growth factor (IGF)-1 in serum of wild-type (WT) and IGF1R+/− mice (n=6–8 per group).



Yuldasheva et al IGF1R Haploinsufficiency Enhances Vascular Repair 3

Tube-Forming AssayTo evaluate the effect of partial IGF1R deletion on the angio-genic potential of APCs, we performed an in vitro angiogenesis assay using conditioned media from APCs from IGF1R+/− and WT mice. As shown in Figure 3B and 3C, we demonstrated a significant increase in endothelial tube formation when human umbilical vein endothelial cells were cultured with conditioned medium from IGF1R+/− APCs compared with medium from WT APCs. We then measured secretion of angiogenic cyto-kines by APCs of both genotypes. We observed a significant increase in concentration of IGF-1 in conditioned medium of IGF1R+/− APCs compared with WT APCs (Figure 3D). The concentrations of vascular endothelial growth factor and hepa-tocyte growth factor were similar in conditioned media from IGF1R+/− and WT APCs (Figure 3E–3F). Concentrations of stromal cell–derived factor-1 and granulocyte colony–stimu-lating factor were below the limits of detection (not shown).

Expression of IGF1R, Insulin Receptor, and eNOS in APCReal-time reverse-transcription polymerase chain reaction demonstrated robust expression of the truncated Igfr1 allele with deletion of exon 3 (encoding a nonfunctional receptor protein) in APCs from IGF1R+/− mice as expected (Figure 4A). Expression of insulin receptor mRNA was significantly increased in APCs from IGF1R+/− mice (Figure 4B). We found no difference in expression of eNOS mRNA in APC from IGF1R+/− mice compared with WT mice (Figure 4C). eNOS

protein expression was similarly unchanged in mononuclear cells derived from bone marrow of IGF1R+/− mice compared with that from WT mice (Figure 4D). However, eNOS 1177Ser-phosphorylation was significantly higher in cells derived from IGF1R+/− mice compared with WT mice (Figure 4D).

Aortic Ring Angiogenesis AssayEndothelial repair is thought to be mediated by an orchestrated response of both circulating APCs and proliferation of native vascular endothelial cells. To investigate whether partial dele-tion of IGF1R impacts on endothelial cell vascular sprouting in the absence of circulating progenitor cells, we performed an in vitro angiogenesis assay in aortic rings. Angiogenic sprout-ing did not differ significantly in aortic rings harvested from IGF1R+/− mice and WT littermates (Figure II in the online-only Data Supplement).

Effect of Pharmacology IGF1R Inhibition on Endothelial Regeneration After Arterial InjuryTo determine whether the enhanced endothelial repair medi-ated by genetic partial deletion of IGF1R could be replicated by pharmacological inhibition of IGF1R, we performed further arterial injury experiments in WT mice treated with PQ401, which blocks signal transduction by inhibiting IGF1R autophosphorylation.8 Administration of PQ401 did not sig-nificantly alter endothelial regeneration after arterial injury (Figure III in the online-only Data Supplement).

BA

ED

Spleen Blood Marrow0

5

10

15

20

25

WTIGF1-R+/-

*

*

ns

Num

ber

of A

PC

per

HP

F

WT IGF1-R+/-0

200

400

600

800

1000ns

Sca-

1+ /Flk

-1+ c

ells

/100

000

lym

phoc

ytes

Baseline VEGF0

100

200

300

400WT

IGF1R+/-

Sca-

1+/F

lk-1

+ ce

lls/1

00 0

00 ly

mph

ocyt

es

**

*

WT IGF1-R+/-0

20

40

60

80

100ns

VE

GF

indu

ced

AP

C m

obili

satio

nch

ange

from

bas

elin

e (%

)

C

Figure 2. Angiogenic progenitor cell (APC) quantification. A, Sca-1+/Flk-1+ cells enumerated in the circulation of wild-type (WT) and IGF1R+/− mice by flow cytometry. B, Sca-1+/Flk-1+ cells enumerated in the circulation at baseline and after administration of vascular endothelial growth factor (VEGF; *P<0.05; **P<0.01). C, Mobilization of Sca-1+/Flk-1+ cells in response to VEGF. D, Representative images revealing the spindle-shaped APCs in culture (phase contrast image, lectin-bound [green], DiI-ac-LDL uptake [red], and dual-stained APCs [yellow]; magnification ×100). E, Spleen-, peripheral blood-, and bone marrow–derived APCs expressed as the number of cells per high-power field (*P<0.05). All n=6 to 8 per group.




Effect of Partial Deletion of IGF1R in Transfused CD117+ Cells on Endothelial RegenerationTo evaluate whether enhanced endothelial repair associated with IGFR downregulation is contingent on changes in the vessel wall or in progenitor cells per se, we performed fur-ther injury experiments followed by infusion of bone mar-row–derived CD117+ (c-kit+) cells, which we have previously shown to be effective in enhancing arterial endothelial regen-eration.4 Splenectomized WT mice were infused with WT or IGF1R+/− bone marrow–derived CD117+ (c-kit+) cells or saline after femoral artery injury. Re-endothelialization was signifi-cantly enhanced by infusion of IGF1R+/− CD117+ bone mar-row–derived cells when compared with infusion of WT cells or cell-free saline (Figure 5A and 5B). To investigate whether transfused CD117+ cells incorporate into the neoendothelium, we repeated the injury experiments in WT mice transfused with CellTracker-Red-labeled CD117+ cells. Labeling with CellTracker-Red did not alter the regenerative capacity of the cells: endothelial regeneration remained enhanced after trans-fusion of cells with partial deletion of IGF1R (Figure 5C and 5D). At day 4 following arterial injury, CellTracker+ cells were detected only rarely in the neoendothelium (in 1 of 4 mice receiving WT cells and 1 of 4 mice receiving IGF1R+/− cells; Figure 5E).

Effect of Partial Deletion of IGF1R in Transfused CD117+ Cells on AtherosclerosisBecause there are conflicting data on the effects of transfusion of bone marrow–derived mononuclear cells on atherosclerosis, with both increased9,10 and reduced11,12 atherosclerotic plaques reported, we performed further experiments to exclude the pos-sibility that partial IGF1R deletion in transfused CD117+ cells could be proatherosclerotic. We quantified atherosclerotic lesion formation in ApoE−/− mice subjected to adventitial carotid artery cuff placement after transfusion of IGF1R+/− or WT CD117+ bone marrow cells. We confirmed that partial IGF1R deletion in transfused cells did not alter atherosclerotic lesion forma-tion (Figure 6A and 6B). To determine whether transfused cells incorporated into plaques, we repeated the experiment using CD117+ cells labeled with CellTracker. At 4 days after trans-fusion, very few CellTracker+ cells were observed in cuffed carotid arteries (scant CellTracker+ staining was seen in 2 of 3 mice receiving WT cells and 1 of 4 mice receiving IGF1R+/− cells; Figure 6D and 6E). When present, CellTracker+ cells were seen in both the endothelium and adventitia (Figure 6D and 6E).

DiscussionThis study builds on our recent reports highlighting IGF1R abundance as a modulator of endothelial NO bioavailability5,13

adhe

rent

cel

ls/h

igh

pow

er fi

eld

WT IGF1R+/- WT IGF1R+/- 0

5

10

15

20*

L-NMMA _ _ + +

A

B

WT IGF1R+/-0

5

10

15

20*

endo

thel

ial t

ubes

/ hi

gh p

ower

fiel

d

C[V

EGF]

pg/

mL

[HG

F] p

g/m

L

D

E

F

WT

WT

IGF1R+/-

IGF1R+/-

[IGF-

I] pg

/mL

80

60

40

20

0

2.0

1.5

1.0

0.5

0.0

30

20

10

0

WT IGF1R+/-

WT IGF1R+/-

WT IGF1R+/-

Figure 3. Angiogenic progenitor cell (APC) functional assays. A, Adhesion of APCs from IGF1R+/− and wild-type (WT) mice to fibronectin-coated plates (repeated after incubation with NG-monomethyl-l-arginine [l-NMMA]; *P<0.05; n=6 mice per group). B, Endothelial tube formation in response to conditioned medium from WT and IGF1R+/− APCs (*P<0.05; n=4–6 mice per group). C, Representative images of tube formation (×200). D–F, Concentrations of angiogenic cytokines in conditioned medium after culturing APCs for 7 days (*P<0.05; n=4–6 mice per group). HGF indicates XXX.




by demonstrating a critical role of the IGF1R in vascular repair. First, we observed that endothelial regeneration is significantly accelerated in IGF1R-deficient mice following denuding wire injury. Second, APCs derived from IGF1R-deficient mice displayed enhanced angiogenic properties in vitro. IGF1R+/− APCs exhibited increased adhesion to extracellular matrix,

an effect blocked by inhibition of NO synthase. APCs from IGF1R+/− mice also demonstrated increased secretion of IGF-1 into the medium and greater capacity to promote endothelial tube formation. Third, infusion of CD117+ bone marrow–derived cells deficient in IGF1R into WT mice after denud-ing injury accelerated healing in comparison with infusion of

D

BA

C

Marrow Spleen Blood0.00

0.02

0.04

0.06

0.08 WTIGF1-R+/-

mIR

gen

e ex

pres

sion **

**

**


0.001

0.002

0.003

0.004 WTIGF1-R+/-

mIG

F1R

gen

e ex

pres

sion

(del

eted

regi

on)

**

*


0.005

0.010

0.015 WTIGF1-R+/-

eNO

S ge

ne e

xpre

ssio

n

Figure 4. mRNA expression and endothelial nitric oxide synthase (eNOS) phosphorylation in cells from IGF1R+/− and wild-type (WT) mice. A, Real-time polymerase chain reaction (PCR) mRNA expression of the truncated Igf1r allele (*P<0.02; n=6 mice per group) in angiogenic progenitor cells (APCs). B, Real-time PCR mRNA expression of the murine insulin receptor in APCs (**P<0.05). C, Real-time PCR mRNA expression of eNOS in APCs (P=not significant). D, Representative blots of total eNOS and ser1177 phospho-eNOS expression in bone marrow–derived mononuclear cells. β-actin expression is shown as loading control. Mean data of ser1177 phospho-eNOS expression are presented (P<0.05; n=9–11 mice per group).

A

BSaline

WT cells

IGF1R+/- cells

WT cells IGF1R+/- cells

C

D

E

Endo

thel

ialis

ed A

rea

(%)

Endo

thel

ialis

ed A

rea

(%)

60* *

ns40

20

0

60

40

20

0Saline WT WT

CD117+ cells CD117+ cells

IGF1R+/-IGF1R+/-

Figure 5. Endothelial regeneration in wild-type (WT)-injured mice following infusion of bone mar-row–derived CD117+ (c-kit+) cells. A, Percent endo-thelial regeneration of injured vessels from WT mice in response to cell transfusion at day 4 (*P<0.001; n=6 per group). B, Representative images of femo-ral vessels harvested 4 days following injury and transfusion of bone marrow–derived CD117+ cells from WT and IGF1R+/− mice (magnification ×20). Saline-infused mice acted as control. C, Percent endothelial regeneration at day 4 of injured ves-sels from WT mice in response to transfusion of CellTracker-labeled cells (P<0.001; n=4 per group). D, Representative images of injured vessels stained with Evan blue. E, Only rare CellTracker-Red labeled cells were seen in the neoendothelium (arrows). Nuclei are labeled with DAPI. Endothelial cells labeled with anti-CD31 (yellow). Magnification ×630.




WT APCs, but did not alter atherosclerotic lesion formation. Collectively, these findings support a novel role for the IGF1R in vascular regeneration.

Recent large-scale clinical trials have challenged conven-tional thinking about therapeutic strategies aiming to reduce the complications of atherosclerosis in patients with type 2 diabetes mellitus.14 These studies demonstrated that intensive lowering of blood glucose15–17 fails to improve cardiovascu-lar mortality in individuals suffering from type 2 diabetes mellitus. We have shown that despite contemporary second-ary prevention therapies, mortality after an acute myocardial infarction in patients with type 2 diabetes mellitus has not improved over the last 10 years, in contrast to the enhanced outcomes enjoyed by patients without type 2 diabetes mel-litus.18 Collectively, these data highlight the fundamental importance of identifying novel approaches to prevent/retard cardiovascular complications in patients with type 2 diabetes mellitus.

Recently, new mechanistic insights into the regulation of endothelial function in the context of metabolic disorders have begun to emerge. Critically, we have shown that the IGF1R can reduce NO bioavailability by interacting with insulin receptors to form insulin-resistant hybrid receptors.5,19 An increase in hybrid receptors is a hallmark of type 2 diabetes mellitus and obesity.20 Many aspects of the diabetic phenotype have been shown to contribute to the formation of hybrids, suggesting that their formation is not just a random process. We demonstrated that downregulation of IGF1R at the whole-body level, or selectively in the endothelium, confers both enhanced insulin sensitivity and endothelial NO generation.5 These data raise the possibility that modulation of IGF1R abundance could be of pathological and potential therapeutic importance in vascular remodeling and disease.

Effective endothelial repair in response to mechanical or biochemical injury has been implicated in preventing adverse vascular remodeling and is thought to mitigate against a range of pathologies, including atherosclerosis,21 restenosis,22 stent thrombosis23, and bypass graft failure.24 Recruitment of circu-lating progenitor cells to sites of injury is central to the repair

process.2 IGF-1 is recognized to increase the circulating abun-dance and enhance the function of endothelial progenitor cells via a mechanism involving phosphoinositide-3-kinase/Akt-mediated phosphorylation of eNOS.25 Insulin-invoked clonal expansion of endothelial progenitor cell colony-forming units in vitro is also thought to be transduced by the IGF1R rather than the insulin receptor.26 However, the effects of genetic modulation of IGF1R abundance in progenitor cells and con-sequences for endothelial repair have not previously been sub-jected to scrutiny.

In the present study, we have clearly demonstrated that reducing IGF1R at a whole-body level accelerates regen-eration of the endothelium after mechanical injury. This observation contrasts with our recent findings in mice with haploinsufficiency of the insulin receptor in which endothe-lial regeneration was compromised4 and implies divergent functional consequences of downregulation of the 2 tyrosine kinase receptors on vascular repair. We did not uncover any differences in angiogenic sprouting between vessels from IGF1R+/− and WT mice in vitro, suggesting that alterations in circulating progenitor cells rather than native endothelial cells likely contributed to the enhanced endothelial regenera-tion observed in vivo. We observed significant reductions in bone marrow–derived and circulating APCs in IGF1R+/− mice. Although at first this seems discordant with the accelerated repair observed in IGF1R+/− mice, it is possible that reduced bone marrow stores and circulating abundance of APCs in IGF1R+/− mice arise as a compensatory response to their enhanced functionality. It is also possible that there is reduced basal endothelial damage in IGF1R+/− mice in keeping with their greater longevity.27

The contribution of APCs to endothelial regeneration is dependent not only on their efficient mobilization in to the circulation but also by their attachment to the damaged vas-cular wall and favorable functional characteristics. Direct evidence that APCs may contribute to endothelial regenera-tion has emerged from our own studies4 and those of other laboratories.28,29 In keeping with others reports, we demon-strated that APCs display markers of monocytic origin which

WT IGF1R+/-0.0

0.5

1.0

1.5

intim

a/m

edia

ratio

genotype of transfused cells

A B C

D E

Figure 6. Carotid artery atheroslcerotic lesion development in ApoE−/− mice following infusion of bone marrow–derived CD117+ (c-kit+) cells. A, Intima/media ratio of carotid artery atherosclerotic lesions after periadventitial cuff placement in ApoE−/− mice transfused with wild-type (WT) or IGF1R+/− CD117+ cells (n=5–6 per group). B and C, Representative images of carotid artery sections taken proximal to the cuff, stained with Miller Elastin stain. Magnification ×400. Scale marker, 500 μm. D and E, Representative images of carotid artery lesions developing 4 days after cuff placement in mice transfused with CellTracker-labeled CD117+ cells (magnification ×630; nuclei stained with DAPI, endothelial cells labeled with anti-CD31 [yellow]). Only rare CellTracker-Red labeled cells were seen (arrows) in the injured vessels of recipients of WT (D) and IGF1R+/− cells (E; D is imaged at the adventitia, hence no CD31 staining).




is in accordance with the accepted paradigm that these cells facilitate vascular repair by secreting proangiogenic cyto-kines, rather than expanding to regenerate damaged endothe-lium per se.30 In vitro studies described here are consistent with this paradigm, as we demonstrated that IGF1R-deficient APCs were more adherent to the matrix protein fibronec-tin and enhanced formation of tubular networks of human umbilical vein endothelial cells more than comparative WT cells. Intriguingly, we found secretion of IGF-1 in to medium was increased in IGF1R+/− cells in comparison with WT cells. IGF-1 exerts potent proangiogenic effects on endothe-lial cells,31 which may explain the increased tube formation we observed in vitro. It is less clear whether increased IGF-1 secretion by APCs could explain the enhanced endothelial regeneration occurring in vivo when IGF1R abundance is also reduced. However, we previously observed that vascu-lar responses to IGF-1 were diminished, but not abrogated in IGF1R+/− mice,5 suggesting that endothelial cells remain responsive to IGF-1. Nevertheless, enhanced functionality of IGF1R+/− APCs may be permissive of their lower abundance in normal vascular homeostasis and may facilitate more expeditious repair in the context of vascular injury.

At the mechanistic level, although APC function is regulated by a range of factors, bioavailability of NO plays a key role.32 As our in vitro experiments were performed in the absence of exogenous IGF-1, we postulate that the enhanced functions of IGF1R+/− APCs we observed are secondary to increased NO bioavailability facilitated by reduced IGF1R abundance rather than altered responses to IGF-1 per se. This is in keeping with our previous demonstration that reduced IGF1R abundance enhances NO generation and insulin sensitivity by altering IGF1R–insulin receptor stoichiometry and hybrid receptor formation.5 Our demonstration here that enhanced adhesion of IGF1R+/− APCs is abrogated by NO synthase inhibition and our finding of increased serine phosphorylation of eNOS in APCs from IGF1R+/− mice, despite similar circulating IGF-1 concentrations, are consistent with this contention. It is also noteworthy that inhibition of IGF1R with monoclonal anti-bodies, which would not be expected to alter IGFR–insulin receptor stoichiometry, has been shown to reduce the migra-tory and angiogenic capacity of APCs in vitro,25 which con-trasts with our finding of enhanced APC function in response to genetic partial deletion of IGFRs.

The enhanced repair observed following partial IGF1R deletion in vivo was not replicated by pharmacological IGF1R inhibition with PQ401. The chronicity of IGF1R suppression achieved by genetic IGF1R deletion limits direct comparison with acute pharmacological IGF1R inhibition. It is possible, however, that the pharmacological strategy proved ineffec-tive because inhibition of IGFR autophosphorylation by PQ401 would not be expected to modulate IGF1R–insulin receptor stoichiometry and hybrid receptor formation, with the consequent enhancement of insulin signaling and NO bioavailability.

Cell-based therapies aimed at enhancing vascular repair represent a novel nonpharmacological approach to treat and prevent diabetes mellitus–related cardiovascular disease.33 Although some commentators have drawn into question the

contribution of progenitor cells to normal vascular homeosta-sis,34,35 our demonstration here that infusion of cells enhances regeneration adds to the evidence that such cells offer thera-peutic potential. Bone marrow cells enriched for the stem cell marker CD117 (c-kit) represent a promising population to augment vascular repair, and we have previously shown these cells to accelerate endothelial regeneration in the con-text of insulin resistance.4 Here, by demonstrating that down-regulating the IGF1R in infused CD117+ cells enhances their reparative capacity, we raise the intriguing possibility that modulating IGF1R abundance could be a strategy to circum-vent the progenitor cells dysfunction which currently limits the utility of cell-based regenerative therapy in diabetes mellitus.

Although infused unselected mononuclear cells and APCs are known to incorporate into the vessel wall,36 the homing and incorporation of CD117+ cells remains underexplored. Here, we observed robust positive effects of infused CD117+ cells on endothelial regeneration, despite apparently detecting only rare incorporation of infused cells into the injured vessel wall at 4 days after injury. As little is known about the kinetics and survival of infused CD117+ cells, we cannot exclude the possibility that the cells incorporated early after infusion but failed to persist >4 days. It is clear that infused CD117+ cells do not directly contribute to endothelial coverage per se, and it is likely that they augment the formation of the neoendothe-lium by paracrine or systemic effects of secreted angiogenic factors on native endothelial cells.

Enthusiasm for cell-based therapy may be tempered by reports that mononuclear cell infusion can accelerate and diminish atherosclerosis.9–12 Here, we were reassured that partial deletion of IGF1R in CD117+ cells infused in to ApoE−/− mice did not modify atherosclerotic lesion forma-tion, suggesting that this strategy could safely be exploited for therapeutic use to accelerate re-endothelialization.

Sources of FundingDr Rashid was supported by an Academy of Medical Sciences/Wellcome Trust Clinical Lecturer Starter Grant. N.J. Haywood holds a British Heart Foundation PhD studentship. A. Aziz holds a British Heart Foundation Clinical Training Fellowship. Dr Cubbon holds a British Heart Foundation Intermediate Clinical Fellowship. Dr Kearney holds a British Heart Foundation Chair in Cardiology. Dr Wheatcroft is supported by a European Research Council Starting Grant.

DisclosuresNone.

References 1. Booth GL, Kapral MK, Fung K, Tu JV. Relation between age and cardio-

vascular disease in men and women with diabetes compared with non-diabetic people: a population-based retrospective cohort study. Lancet. 2006;368:29–36.

2. Dimmeler S, Zeiher AM. Vascular repair by circulating endothelial pro-genitor cells: the missing link in atherosclerosis? J Mol Med (Berl). 2004;82:671–677.

3. Ii M, Takenaka H, Asai J, Ibusuki K, Mizukami Y, Maruyama K, Yoon YS, Wecker A, Luedemann C, Eaton E, Silver M, Thorne T, Losordo DW. Endothelial progenitor thrombospondin-1 mediates diabetes-induced delay in reendothelialization following arterial injury. Circ Res. 2006;98:697–704.




4. Kahn MB, Yuldasheva NY, Cubbon RM, Smith J, Rashid ST, Viswambharan H, Imrie H, Abbas A, Rajwani A, Aziz A, Baliga V, Sukumar P, Gage M, Kearney MT, Wheatcroft SB. Insulin resistance impairs circulating angiogenic progenitor cell function and delays endothelial regeneration. Diabetes. 2011;60:1295–1303.

5. Abbas A, Imrie H, Viswambharan H, et al. The insulin-like growth factor-1 receptor is a negative regulator of nitric oxide bioavailability and insulin sensitivity in the endothelium. Diabetes. 2011;60:2169–2178.

6. Pitchford SC, Furze RC, Jones CP, Wengner AM, Rankin SM. Differential mobilization of subsets of progenitor cells from the bone marrow. Cell Stem Cell. 2009;4:62–72.

7. Hirschi KK, Ingram DA, Yoder MC. Assessing identity, phenotype, and fate of endothelial progenitor cells. Arterioscler Thromb Vasc Biol. 2008;28:1584–1595.

8. Gable KL, Maddux BA, Penaranda C, Zavodovskaya M, Campbell MJ, Lobo M, Robinson L, Schow S, Kerner JA, Goldfine ID, Youngren JF. Diarylureas are small-molecule inhibitors of insulin-like growth factor I receptor signal-ing and breast cancer cell growth. Mol Cancer Ther. 2006;5:1079–1086.

9. Silvestre JS, Gojova A, Brun V, Potteaux S, Esposito B, Duriez M, Clergue M, Le Ricousse-Roussanne S, Barateau V, Merval R, Groux H, Tobelem G, Levy B, Tedgui A, Mallat Z. Transplantation of bone marrow-derived mononuclear cells in ischemic apolipoprotein E-knockout mice acceler-ates atherosclerosis without altering plaque composition. Circulation. 2003;108:2839–2842.

10. George J, Afek A, Abashidze A, Shmilovich H, Deutsch V, Kopolovich J, Miller H, Keren G. Transfer of endothelial progenitor and bone marrow cells influences atherosclerotic plaque size and composition in apolipopro-tein E knockout mice. Arterioscler Thromb Vasc Biol. 2005;25:2636–2641.

11. Rauscher FM, Goldschmidt-Clermont PJ, Davis BH, Wang T, Gregg D, Ramaswami P, Pippen AM, Annex BH, Dong C, Taylor DA. Aging, progen-itor cell exhaustion, and atherosclerosis. Circulation. 2003;108:457–463.

12. Nelson WD, Zenovich AG, Ott HC, Stolen C, Caron GJ, Panoskaltsis-Mortari A, Barnes SA 3rd, Xin X, Taylor DA. Sex-dependent attenuation of plaque growth after treatment with bone marrow mononuclear cells. Circ Res. 2007;101:1319–1327.

13. Imrie H, Abbas A, Viswambharan H, Rajwani A, Cubbon RM, Gage M, Kahn M, Ezzat VA, Duncan ER, Grant PJ, Ajjan R, Wheatcroft SB, Kearney MT. Vascular insulin-like growth factor-I resistance and diet-induced obesity. Endocrinology. 2009;150:4575–4582.

14. Razani B, Semenkovich CF. Getting away from glucose: stop sugarcoating diabetes. Nat Med. 2009;15:372–373.

15. Duckworth W, Abraira C, Moritz T, et al; VADT Investigators. Glucose control and vascular complications in veterans with type 2 diabetes. N Engl J Med. 2009;360:129–139.

16. Gerstein HC, Miller ME, Byington RP, Goff DC Jr, Bigger JT, Buse JB, Cushman WC, Genuth S, Ismail-Beigi F, Grimm RH Jr, Probstfield JL, Simons-Morton DG, Friedewald WT. Effects of intensive glucose lower-ing in type 2 diabetes. N Engl J Med. 2008;358:2545–2559.

17. Patel A, MacMahon S, Chalmers, J et al. Intensive blood glucose control and vascular outcomes in patients with type 2 diabetes. N Engl J Med. 2008;358:2560–2572.

18. Cubbon RM, Wheatcroft SB, Grant PJ, Gale CP, Barth JH, Sapsford RJ, Ajjan R, Kearney MT, Hall AS; Evaluation of Methods and Management of Acute Coronary Events Investigators. Temporal trends in mortality of patients with diabetes mellitus suffering acute myocardial infarction: a comparison of over 3000 patients between 1995 and 2003. Eur Heart J. 2007;28:540–545.

19. Imrie H, Viswambharan H, Sukumar P, et al. Novel role of the IGF-1 receptor in endothelial function and repair: studies in endothelium-tar-geted IGF-1 receptor transgenic mice. Diabetes. 2012;61:2359–2368.

20. Federici M, Porzio O, Lauro D, Borboni P, Giovannone B, Zucaro L, Hribal ML, Sesti G. Increased abundance of insulin/insulin-like growth factor-I hybrid receptors in skeletal muscle of obese subjects is correlated with in vivo insulin sensitivity. J Clin Endocrinol Metab. 1998;83:2911–2915.

21. Davignon J, Ganz P. Role of endothelial dysfunction in atherosclerosis. Circulation. 2004;109:27–32.

22. Kipshidze N, Dangas G, Tsapenko M, Moses J, Leon MB, Kutryk M, Serruys P. Role of the endothelium in modulating neointimal formation: vasculoprotective approaches to attenuate restenosis after percutaneous coronary interventions. J Am Coll Cardiol. 2004;44:733–739.

23. Finn AV, Joner M, Nakazawa G, Kolodgie F, Newell J, John MC, Gold HK, Virmani R. Pathological correlates of late drug-eluting stent thrombosis: strut coverage as a marker of endothelialization. Circulation. 2007;115:2435–2441.

24. Manchio JV, Gu J, Romar L, Brown J, Gammie J, Pierson RN 3rd, Griffith B, Poston RS. Disruption of graft endothelium correlates with early fail-ure after off-pump coronary artery bypass surgery. Ann Thorac Surg. 2005;79:1991–1998.

25. Thum T, Hoeber S, Froese S, Klink I, Stichtenoth DO, Galuppo P, Jakob M, Tsikas D, Anker SD, Poole-Wilson PA, Borlak J, Ertl G, Bauersachs J. Age-dependent impairment of endothelial progenitor cells is corrected by growth-hormone-mediated increase of insulin-like growth-factor-1. Circ Res. 2007;100:434–443.

26. Humpert PM, Djuric Z, Zeuge U, Oikonomou D, Seregin Y, Laine K, Eckstein V, Nawroth PP, Bierhaus A. Insulin stimulates the clonogenic potential of angiogenic endothelial progenitor cells by IGF-1 receptor-dependent signaling. Mol Med. 2008;14:301–308.

27. Holzenberger M, Dupont J, Ducos B, Leneuve P, Géloën A, Even PC, Cervera P, Le Bouc Y. IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature. 2003;421:182–187.

28. Kong D, Melo LG, Gnecchi M, Zhang L, Mostoslavsky G, Liew CC, Pratt RE, Dzau VJ. Cytokine-induced mobilization of circulating endo-thelial progenitor cells enhances repair of injured arteries. Circulation. 2004;110:2039–2046.

29. Wassmann S, Werner N, Czech T, Nickenig G. Improvement of endothe-lial function by systemic transfusion of vascular progenitor cells. Circ Res. 2006;99:e74–e83.

30. Hirschi KK, Ingram DA, Yoder MC. Assessing identity, phenotype, and fate of endothelial progenitor cells. Arterioscler Thromb Vasc Biol. 2008;28:1584–1595.

31. Castellon R, Hamdi HK, Sacerio I, Aoki AM, Kenney MC, Ljubimov AV. Effects of angiogenic growth factor combinations on retinal endothelial cells. Exp Eye Res. 2002;74:523–535.

32. Sasaki K, Heeschen C, Aicher A, Ziebart T, Honold J, Urbich C, Rossig L, Koehl U, Koyanagi M, Mohamed A, Brandes RP, Martin H, Zeiher AM, Dimmeler S. Ex vivo pretreatment of bone marrow mononuclear cells with endothelial NO synthase enhancer AVE9488 enhances their functional activity for cell therapy. Proc Natl Acad Sci U S A. 2006;103:14537–14541.

33. Jarajapu YP, Grant MB. The promise of cell-based therapies for diabetic complications: challenges and solutions. Circ Res. 2010;106:854–869.

34. Hagensen MK, Shim J, Thim T, Falk E, Bentzon JF. Circulating endothe-lial progenitor cells do not contribute to plaque endothelium in murine atherosclerosis. Circulation. 2010;121:898–905.

35. Hagensen MK, Raarup MK, Mortensen MB, Thim T, Nyengaard JR, Falk E, Bentzon JF. Circulating endothelial progenitor cells do not contribute to regeneration of endothelium after murine arterial injury. Cardiovasc Res. 2012;93:223–231.

36. Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, Nickenig G. Intravenous transfusion of endothelial progenitor cells reduces neointima formation after vascular injury. Circ Res. 2003;93:e17–e24.

Defective endothelial regeneration in response to loss of endothelial structural/functional integrity plays a critical role in adverse vascular remodeling in type 2 diabetes mellitus and insulin resistance. We have previously demonstrated that partial deletion of the type 1 insulin-like growth factor receptor (IGF1R) enhanced insulin sensitivity and endothelial nitric oxide bioavailability. Here, we demonstrate that heterozy-gous deletion of IGF1R (IGF1R+/−) in mice enhanced endothelial regeneration following arterial injury. In angiogenic progenitor cells, partial IGF1R deletion enhanced adhesion, increased insulin-like growth factor-1 secretion, and promoted endothelial tube formation in vitro. Partial deletion of IGF1R in bone marrow–derived CD117(c-kit)+ cells significantly enhanced endothelial regeneration when transfused in to wild-type mice but did not accelerate atherosclerosis in ApoE−/− mice. These findings have important implications for modulation of the IGF1R in optimizing cell-based therapy as a strategy to enhance vascular repair.

Significance



1

SUPPLEMENT MATERIAL

Supplementary Figure I

Characterisation of APCs from WT and IGF1R+/- mice.

Flow cytometry was used to estimate the size and density of APCs. Forward scatter (A) and side

scatter (B) were evaluated in 100 000 counted events (n=6 per group). Expression of the

leukocyte marker CD11b (C) and the integrin α-5 chain CD49e (D) were also evaluated by flow

cytometry (n=6 per group). Immunoflourescence microscopy was used to identify CD68

(green), FXIII-A (red) and nuclei DAPI (blue) in bone-marrow-, blood- and spleen-derived APCs

after 4 and 7 days of culture (E – magnification x 200).

2

Supplementary Figure II

Aortic ring angiogenesis assay. A: representative images of angiogenic sprouting

from aortic rings derived from IGF1R+/- and WT mice. B: average sprout length,

normalised to aortic ring circumference, in IGF1R+/- and WT mice (n=6-8 per group).

3

Supplementary Figure III

Effect of pharmacological inhibition of IGF1Rs on endothelial regeneration

following arterial injury. Wild type C57BL6 mice were treated with PQ401 (10mg/kg

intra-peritoneal) or equivalent DMSO after femoral artery wire injury (n=4-5 per group).

A: mean data for endothelial regeneration at day 4 following injury. B: representative

images of injured vessels from control and PQ401-treated animals.

1

Materials and Methods

Gene modified mice. Mice with whole body haploinsufficiency of the Igf1r1, were obtained

from the European mutant mouse archive (Munich, Germany; EMMA Ref:00115), and

maintained in the heterozygous state on a C57BL/6 background by mating IGF1R+/- males with

9-12 week old female C57BL/6 wild type mice (Harlan Laboratories). Mice were housed in a

conventional animal facility with a 12-h light/dark cycle with ad libitum access to standard

rodent chow. Genotyping was performed by RT-PCR of tail DNA as previously described5. ApoE-/-

mice were purchased from Charles River Laboratories (Margate, UK). All experiments were

performed in 4-6 month old male mice unless otherwise stated and were conducted in

accordance with accepted standards of humane animal care under United Kingdom Animals

(Scientific Procedures) Act 1986.

Femoral artery endothelial denuding injury. Unilateral femoral artery wire injury was

carried out as previously described2. Mice were anesthetized with isoflurane (1.5–2%), before

a small incision was made in the mid thigh and extended. Having carefully isolated the femoral

artery, an arteriotomy was made in the saphenous artery using iris scissors (World-Precision

Instruments, Sarasota, FL), and a 0.014-inch-diameter angioplasty guidewire with tapered tip

(Hi-Torque Cross-It 200XT, Abbott-Vascular, IL), was introduced. The guidewire was advanced

1.5 cm in to the femoral artery, and three passages performed per mouse, resulting in

complete endothelial denudation. The guidewire was removed completely and a suture

tightened rapidly immediately distal to the bifurcation of the femoral artery. The skin was

closed with a continuous suture. The contralateral artery underwent an identical sham

operation, without passage of the wire. Animals received peri-operative analgesia with

buprenorphine (0.25 mg/kg s.c.)

Assessment of endothelial regeneration by en face microscopy. Mice were anesthetized

at 0, 4 and 7 days after wire injury, and 50 µL of 0.5% Evans blue dye injected into the inferior

vena cava. The mice were perfused/fixed with 4% paraformaldehyde in PBS before the femoral

arteries (injured and uninjured) were harvested. The vessels were opened longitudinally. The

areas stained and unstained in blue were measured in a 5mm injured segment beginning 5mm

distal to the aortic bifurcation, and the percentage areas were calculated using ImagePro Plus

7.0 software (Media Cybernetics, Bethesda, MD).

Flow cytometric enumeration of circulating progenitor cells. Saphenous vein blood

samples (150µL), were incubated with PharmLyse (BD Biosciences, San Jose, CA), at room

temperature. After centrifugation, mononuclear cells were resuspended in fluorescence-

activated cell sorter (FACS) buffer and incubated with FcR blocker (BD Biosciences) at 4°C.

2

Appropriate volumes of the following antibodies, or their respective isotype controls, were then

added for 10 minutes at 4°C: fluorescein isothiocyanate (FITC) anti-mouse Sca-1 and

phycoerythrin (PE) anti-mouse Flk-1 (BD Biosciences). Circulating progenitor cells were

enumerated using flow cytometry (BD FACS Calibur), to quantify dual-stained Sca-1+/Flk-1+

cells. Isotype control specimens were used to define the threshold for antigen presence and to

subtract nonspecific fluorescence. The cytometer was set to acquire 100,000 events within the

lymphocyte gate, defined by typical light scatter properties. To assess circulating progenitor cell

mobilization, mice received an intra-peritoneal injection of 5µg of vascular endothelial growth

factor (VEGF), on four consecutive days, as previously described2. Sca-1+/Flk-1+ cells were

quantified using FACS analysis at baseline and at day 4 after treatment.

Circulating angiogenic progenitor cell isolation and culture. Mononuclear cells from 1mL

of blood, obtained from the vena cava under terminal anesthesia, were isolated by Histopaque-

1083 (Sigma) density gradient centrifugation. Mononuclear cells were seeded on fibronectin

coated 24-well plates (BD Biosciences) at a density of 5x106 cells/well. Cells were cultured in

endothelial cell growth (EGM-2), medium supplemented with EGM-2 Bullet kit (Lonza, Basel,

Switzerland), in addition to 20% FCS. Spleens obtained from mice under terminal anaesthesia

were mechanically minced. Mononuclear cells were isolated by density gradient centrifugation.

After washing steps, cells were seeded on fibronectin coated 24-well plates at a seeding density

of 8x106 cells/well and cultured as described above. Femurs and tibias were flushed three times

in DMEM with a 26-gauge needle to collect bone marrow. Mononuclear cells were isolated by

density gradient centrifugation as described above. After washing steps, cells were seeded on

fibronectin coated 24-well plates at a seeding density of 1x106 cells/well and cultured as

described above. After 4 days of incubation at 37°C in 5% CO2, non-adherent cells were

discarded by gentle washing with PBS and adherent cells resuspended in medium after

trypsinisation.

Phenotypic analysis of angiogenic progenitor cells in culture. DiI-ac-LDL+/lectin+

angiogenic progenitor cells (APC) were quantified in cultured peripheral blood, spleen, and bone

marrow derived mononuclear cells (see above), resulting in the growth of early-outgrowth cells.

These cells exhibited typical spindle-shaped morphology on day 4 of culture. At day 7, attached

cells from peripheral blood, spleen and bone marrow were stained for the uptake of 1,1’-

dioctadecy-3,3,39,39-tetramethyllindocarbocyanine-labeled acetylated low-density lipoprotein

(DiI-Ac-LDL) (Molecular Probes, Invitrogen, Carlsbad, CA) and lectin from Ulex europaeus FITC

conjugate (Sigma). Cells were first incubated with DiI-Ac-LDL at 37°C for 3 h and later fixed

with 4% paraformaldehyde for 10 minutes at room temperature. Cells were washed and reacted

with lectin for 1 h at room temperature. After staining, cells were quantified by examining five

random high-power fields per well and double-positive cells were identified as APCs. APC size

3

and density were estimated by analysis of forward and size scatter on flow cytometry (BD FACS

Calibur). Flow cytometry was also used to quantify expression of CD11b and CD49e using

AF647-labelled anti-CD11b/isotype-control antibodies (Abcam, Cambridge, UK) and PE-labelled

anti-49e/isotype-control antibodies (BD Biosciences, San Jose, CA, USA). Expression of

monocye/macrophage markers by APCs was evaluated by fluorescence microscopy using rat

monoclonal anti mouse CD68 antibodies (AbD Serotec, Kidlington, UK) and affinity purified

polyclonal sheep anti human factor XIII (A-subunit) antibodies (Enzyme research laboratories,

Swansea, UK). Images were acquired using multiple labelling grade DyLight conjugated

secondary antibodies (Jackson ImmunoResearch, West Grove, PA, USA) in maximum intensity

projections of 1.5µm slices through the sample thickness for each channel on a LSM700

confocal microscope (Zeiss, Germany).

Angiogenic progenitor cell function: adhesion and angiogenesis. To evaluate adhesion,

50,000 APCs were resuspended in EGM-2 medium, plated onto fibronectin coated 24-well

plates, and incubated for 1 h at 37°C. After washing three times with PBS, attached cells were

counted. Adhesion was evaluated as the mean number of attached cells per high power field.

The contribution of nitric oxide to adhesion was evaluated by repeated the experiments after

incubating APCs with the nitric oxide synthase inhibitor L-LMMA (100nmol/L; 30 minutes). The

potential for APCs to stimulate angiogenesis by secreting paracrine factors was assessed as

previously described7. Briefly, conditioned media were obtained by replacing the medium of day

4 APC cultures with serum-free EGM-2 supplemented with 1% FCS and culturing the cells for an

additional 24 h. APCs were enumerated, and conditioned media diluted to correct for cell

numbers. After 24 h, tube formation by human umbilical vein endothelial cell (HUVEC)

(Promocell, Heidelberg, Germany), on matrigel coated 24-well plates (BD Bioscience), in the

presence of conditioned media was measured by staining the viable cells with hematoxylin-

eosin (Sigma). HUVEC cultures were used at passage 3–5. The number of endothelial tubes was

quantified by a blinded observer by averaging the count in multiple high power fields per well.

Secretion of angiogenic cytokines by APCs was evaluated by assessing the concentration of

insulin-like growth factor 1 (IGF1), vascular endothelial growth factor (VEGF), hepatocyte

growth factor (HGF), stromal cell derived factor (SDF)-1 and granulocyte-colony stimulating

factor (G-CSF) in day 4 conditioned medium using Quantikine ELISA kits (R&D Systems,

Minneapolis, MN, USA) according to the manufacturer’s instructions. Conditioned medium was

10x concentrated before analysis (0.5mL concentrator with 3K molecular weight cut-off, Pierce

Biotechnology. Rockford, IL, USA).

mRNA expression in APCs. RNA was isolated using Tri Reagent (Sigma-Aldrich). After DNAse

treatment, 1 μg RNA was reverse transcribed using High Capacity RNA to cDNA kit. Real-time

4

PCR was performed (Applied Biosystems) using SYBR Green PCR Master Mix and the gene

specific primer. Results were normalized to expression of β-actin. Primer sequences were as

follows: mIR F:TGGAGAGGTGTGCCCTGGT R:TGAACATCAGGAGGATCTGCAG; mIGF1R with

deleted exon F:CGCTGCCAGAAAACATGTACTG R:GGTGCATCCTTGGAGCATTT; eNOS F:

CTGGAGCACCCCACGCT R: AGCGGTGAGGGTCACACAG; beta-actin F:

CGTGAAAAGATGACCCAGATCA R: TGGTACGACCAGAGGCATACAG.

Quantification of serine1177 phosphorylated eNOS in bone marrow

Bone marrow was collected by flushing the femur and tibia from one mouse with DMEM and

kept on ice. Marrow was then homogenized and collected through a cell strainer. Homogenate

was added to Ficoll and centrifuged at 400g for 30 minutes to collect mononuclear cells. The

Buffy coat layer was collected and washed once with PBS and then with PBS/DMEM. The

resulting cell pellet was frozen at -80˚C. Marrow-derived mononuclear cells were re-suspended

in 50µL of cell lysis or RIPA buffer, sonicated and kept on ice for 45 minutes, before protein

concentrations were determined using BCA Assay. 50µL of DynaBeads Protein G (Invitrogen)

were first coated with anti-eNOS/NOS Type III anti-body (BD Biosciences) according to

manufacturer’s instructions. After washing the prepared beads, 20µg of marrow-derived APC

lysates were incubated with anti-eNOS-DynaBeads for 30 minutes at room temperature.

Following extensive washing, 30µL of 1X NuPAGE LDS sample buffer and 1X reducing buffer

were added into each of the resulting sample preparations. Samples were then incubated at

95˚C, for 5 minutes before an SDS-PAGE were run and membrane blotted. Levels of total and

phosphorylated eNOS were evaluated by incubating the membranes overnight with anti-eNOS

and anti-phospho eNOS (pS1177) antibodies (Cell Signaling) and chemiluminescence assay

carried out the following day. Quantification of β-actin expression (Santa Cruz Biotechnology)

was used as a loading control.

Aortic ring angiogenesis assay.

Descending thoracic aortas were excised and flushed with ice-cold PBS until free of blood.

Surrounding fibroadipose tissue was dissected free, and the aorta sectioned into 1mm rings.

Culture plates (24-well) were coated with 200 μL/well of growth factor–reduced Matrigel (BD

Bioscience), rings were embedded and the Matrigel was then allowed to polymerize for 30

minutes at 37°C. Rings were incubated with Endothelial Cell Growth Medium MV2 (PromoCell,

Heidelberg, Germany), which was replaced daily. Quantitative analysis of endothelial sprouting

was performed using images from day 6. The greatest distance from the aortic ring body to the

end of the vascular sprouts was measured at three distinct points per ring and in three different

rings per treatment group. Sprout lengths were normalised to the circumference of the aortic

ring.

5

Effect of pharmacological IGF1R inhibition on endothelial regeneration after arterial

injury. Arterial injury experiments were carried out as above in wild type mice in which

IGF1R signalling was inhibited by the pharmacological inhibitor PQ4013. 16-18 week-old male

C57BL6 mice were administered PQ401 (10mg/kg4 reconstituted in 6% DMSO) (SigmaAldrich,

St. Louis, MO) or equivalent DMSO by intra-peritoneal injection immediately after injury.

Femoral arteries were harvested at day 4 and endothelial regeneration was quantified as

above.

Effect of CD117+ cell transfusion on endothelial repair. Bone marrow derived cells were

subjected to magnetic bead separation to collect CD117+ (C-kit receptor+) cells. In brief, bone

marrow derived cells were washed, resuspended, and magnetically labelled with CD117

microbeads (MACS Microbeads, Miltenyi Biotech GmbH, Bergisch Gladbach, Germany). After

incubation and additional washing, magnetic cell separation was performed using a separation

column placed in a magnetic field of a magnetic bead separator (MACS Separation Columns,

Miltenyi). CD117+ cells were collected in buffer and resuspended in 200µL of MACS buffer for

intravenous injection. In order to prevent sequestration of injected cells by the spleen, mice

were anaesthetised with isoflurane, and the spleen excised through a left lateral abdominal

incision. Splenic vessels were carefully ligated using 6.0 silk. After removal of the spleen the

peritoneal wall was closed with 8.0 vicryl sutures before skin closure with 6.0 vicryl.

Immediately after splenectomy and arterial injury, wild type mice received an intravenous

injection of 5x105 CD117+ bone marrow cells from IGF1R+/- or wild type mice. Control animals

underwent splenectomy and vascular injury and received a corresponding volume of normal

saline without cells. Femoral arteries were harvested and examined at 4 days for Evans blue

staining as above. In additional experiments, CD117+ cells derived from IGF1R+/- or wild type

mice were labelled with CellTracker Red (Life Technologies, Paisley, UK) before transfusion.

Injured arteries were imaged en face at day 4 using on a LSM 510 META confocal microscope

(Zeiss, Germany). Endothelial cells were identified using rabbit polycolonal anti-CD31-antibodies

and Chromeo642-conjugated goat polyclonal anti-rabbit secondary antibodies (Abcam,

Cambridge, UK)

Effect of CD117+ cell transfusion on atherosclerosis.

Atherosclerotic lesion formation was evaluated in carotid arteries of ApoE-/- mice after

placement of a peri-adventitial vascular collar as previously described5. Briefly, unilateral 2mm

silastic collars (0.3mm internal diameter) (Dow Corning, Midland, MI, USA) were placed around

6

the carotid artery in 16-week old male ApoE-/- mice under general anaesthesia. Mice were fed

Western diet from 8 weeks of age (21% fat from lard supplemented with 0.15% wt/wt

cholesterol (#829100, SDS, Witham, Essex, UK). 5x105 CD117+ bone marrow cells from

IGF1R+/- or wild type mice were injected via the femoral vein after cuff placement. Carotid

arteries were harvested under terminal anaesthesia after perfusion fixation (4%

paraformaldehyde in PBS) 4 weeks after collar placement. Sections obtained proximal to the

cuffs (where lesion formation was maximal) were stained with Miller Elastin Stain. Lesion

intima/media ratio was calculated using ImagePro Plus 7.0 software (Media Cybernetics,

Bethesda, MD). Incorporation of CD117+ cells into atherosclerotic plaques vas evaluated by

repeating the experiment using CD117+ cells labelled with CellTracker Red (Life Technologies,

Paisley, UK). Cellular incorporation was assessed after 4 days in carotid artery cross sections by

confocal microscopy as described above. Endothelial cells were identified using rabbit

polycolonal anti-CD31-antibodies and Chromeo642-conjugated goat polyclonal anti-rabbit

secondary antibodies (Abcam, Cambridge, UK)

Statistics. Results are expressed as mean±SEM. Comparisons within groups were made using

paired Students t-tests and between groups using unpaired Students t tests or repeated

measures ANOVA, as appropriate; where repeated t-tests were performed a Bonferroni

correction was applied. P<0.05 considered statistically significant.

References

1. Holzenberger M, Dupont J, Ducos B, Leneuve P, Géloën A, Even PC, Cervera P, Le Bouc Y.

IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature.

2003;421:182-187.

2. Kahn MB, Yuldasheva NY, Cubbon RM et al. Insulin resistance impairs circulating angiogenic

progenitor cell function and delays endothelial regeneration. Diabetes. 2011;60:1295-1303.

3. Gable KL, Maddux BA, Penaranda C, Zavodovskaya M, Campbell MJ, Lobo M, Robinson L,

Schow S, Kerner JA, Goldfine ID, Youngren JF. Diarylureas are small-molecule inhibitors of

insulin-like growth factor I receptor signaling and breast cancer cell growth. Mol Cancer

Ther. 2006;5:1079-1086.

4. Lapid K, Itkin T, D'Uva G, Ovadya Y, Ludin A, Caglio G, Kalinkovich A, Golan K, Porat Z,

Zollo M, Lapidot T. GSK3β regulates physiological migration of stem/progenitor cells via

cytoskeletal rearrangement. J Clin Invest. 2013;123:1705-1717.

5. von der Thüsen JH1, van Berkel TJ, Biessen EA. Induction of Rapid Atherogenesis by

Perivascular Carotid Collar Placement in Apolipoprotein E -Deficient and Low-Density

Lipoprotein Receptor-Deficient Mice. Circulation. 2001;103:1164-1170

Documents

Haploinsufficiency of the insulin-like growth factor-1 receptor enhances endothelial repair and favorably modifies angiogenic progenitor cell phenotype