HUMAN MUTATION Mutation in Brief #946 (2007) Online

MUTATION IN BRIEF

© 2007 WILEY-LISS, INC.

Received 12 July 2006; accepted revised manuscript 21 September 2006.

GM1 Gangliosidosis: Molecular Analysis of Nine Patients and Development of an RT-PCR Assay for GLB1 Gene Expression Profiling Anna Caciotti1, Maria Alice Donati1, Elena Procopio1, Mirella Filocamo2, Wim Kleijer3, Wim Wuyts4, Bettina Blaumeiser4, Alessandra d’Azzo5, Lisa Simi6, Claudio Orlando6, Fiona McKenzie7, Agata Fiumara8, Enrico Zammarchi1*, and Amelia Morrone1

1Department of Pediatrics, Meyer Hospital, Florence, Italy; 2Diagnosi Pre-Postnatale Malattie Metaboliche, Laboratory IRCCS Gaslini, Genoa, Italy; 3Erasmus University Medical Centre, Rotterdam, Holland; 4 Department of Medical Genetics, University Hospital of Antwerp, Antwerp, Belgium; 5 Department of Genetics, St Jude Children’s Hospital, Memphis, Tennessee; 6Department of Clinical Physiopathology, University of Florence, Florence, Italy; 7Hunter Genetics, University of Newcastle, Newcastle, Australia; 8Regional Referral Center for Inborn Errors of Metabolism, Department of Pediatrics, University of Catania, Catania, Italy

*Correspondence to: Enrico Zammarchi, A.O.U Meyer, Dept. of Pediatrics, Via L. Giordano 13, 50132, Florence, Italy Communicated by Elizabeth Neufeld

The human GLB1 gene produces two alternatively spliced transcripts that encode the lysosomal enzyme β-galactosidase (GLB1) and the elastin binding protein (EBP). Mutations at the GLB1 locus, which are responsible for the storage disorder GM1 gangliosidosis, may affect either both proteins or GLB1 only. The EBP, when affected, contributes to specific features of GM1 gangliosidosis patients, such as cardiomyopathy and connective-tissue abnormalities. Here we report the development of reliable and quantitative assays based on real-time PCR for assessing the levels of GLB1 and EBP transcripts in patients’ samples. We also report the characterisation of GLB1 gene mutations in nine GM1 gangliosidosis patients in order to correlate the genetic lesions with mRNA levels and phenotypes. Mutation analysis identified four new (c.1835_1836delCC; p.Arg148Cys; c.1068+1G>T; and p.Pro549Leu), five known (p.Arg59His; p.Arg201His; p.Gly123Arg; c.245+1G>A; and c.75+2insT) mutations and one new polymorphism (c.1233+8T>C). Comparative analysis of the patients' phenotypes enabled a more thorough correlation between GLB1 mutations and specific clinical manifestations. GLB1 and EBP mRNA levels were both reduced in three patients carrying the splicing defects. The accurate and fast method for the detection of alternatively spliced transcripts of the GLB1 gene could be applied to other disease-causing lysosomal genes that encode multiple mRNAs. © 2007 Wiley-Liss, Inc.

KEY WORDS: EBP; GLB1; GM1-gangliosidosis; real-time PCR

INTRODUCTION

GM1 gangliosidosis (MIM# 230500) is an autosomal recessive storage disorder characterised by the generalized accumulation of GM1 ganglioside, oligosaccharides, and the mucopolysaccharide keratan sulfate (Suzuki et al. 2001). Deficiency of the lysosomal hydrolase beta-galactosidase (GLB1), causes the main clinical manifestations of the disease.

DOI: 10.1002/humu.9475

2 Caciotti et al.

The lysosomal GLB1 is encoded by the GLB1 gene that alternatively gives rise to the elastin binding protein (EBP), a key recycling chaperone in the tropoelastin assembly process of the extracellular matrix (Hinek and Wilson 2000). The pathomechanism of specific clinical manifestations such as skeletal deformities, connective-tissue abnormalities and cardiomyopathy has been related to impaired elastogenesis and EBP defects in GM1 gangliosidosis patients (Morrone 2000, Hinek et al. 2000a, Caciotti et al. 2005a, Caciotti et al. 2005b).

In this study, we focus on correlating the genotypes and phenotypes of GM1-gangliosidosis patients by associating specific clinical features with particular GLB1/ EBP defects. In order to evaluate the effects of GLB1 gene mutations on the transcriptional regulation of GLB1 and EBP proteins, we developed a fast assay for the quantification of both the GLB1 mRNAs by real time reverse transcription-PCR. We also report the clinical, biochemical and molecular characterisation of 9 recently diagnosed GM1 gangliosidosis patients (seven with the infantile form and two with the juvenile).

MATERIALS AND METHODS

Patients The mRNA analysis was performed in cultured fibroblast samples derived from all the GM1 gangliosidosis

patients here reported and from 13 normal controls. This analysis was also performed in fibroblast specimens from the three patients reported in Caciotti et al. 2005b, from Patient2.1 (reported in Morrone et al. 2000), and from two GM1 gangliosidosis patients with the infantile phenotype, not yet characterised at a molecular level. The main clinical characteristics of the 9 patients here described are summarised in Table 1.

Analysis of Genomic DNA

The GLB1 gene (NT_022517.16, NM_000404.1) of the 9 patients was amplified by PCR. The oligonucleotides and the amplifying and sequencing conditions for DNA and c-DNA analyses have been described previously (Morrone et al. 2000, Caciotti et al. 2003). The nomenclature of GLB1 genetic lesions is as designed previously (den Dunnen and Antonarakis 2000, den Dunnen and Paalman 2003). c-DNA nucleotide numbering starts at the ATG translation initiation codon. The GLB1 mutations were confirmed in DNA samples of patients and their relatives.

Restriction Site Analysis The new c.1233+8T>C sequence variation, detected in Patient9, was investigated by restriction analysis with

the DdeI enzyme (Roche, Mannheim, Germany). Exon 12 of the GLB1 gene was amplified in 100 normal controls by the following genomic oligonucleotides :

10S 5’ GGGGTGCAGTGTGTGAATGCTGCTTTTG 3’ (c.1144 -40/-23nt) 10Amut 5’ CAAGTAGAAAAAAGGCGAGGCATTACCTCTG 3’ (c.1233 +40/+10nt). The underlined base corresponds to a mispairing with the normal sequence introduced because of the absence of

a natural restriction site. The amplification restriction conditions were previously reported (Caciotti et al. 2005a).

Single Strand Conformation Polymorphism (SSCP)

SSCP was used to screen exon 15 containing the new c.1646C>T (p.Pro549Leu) mutation detected in Patient7. DNA from 100 normal alleles was amplified as previously reported (Morrone et al. 2000). Amplified samples were denatured 5min at 94°C, then placed on ice for 5 min and loaded into a 6% polyacrylamide gel. Electrophoresis was performed using the Genephor system and the GeneGel Excel 12.5/24 Kit (Amersham Biosciences, Uppsala, Sweden) at 15°C for 2h and 30min at 600V and the gels were subsequently visualized by silver-staining.

Expression Studies Site-directed mutagenesis and fragment replacement were performed as previously reported (Caciotti et al.

2003) in order to introduce the new missense mutation c.442C>T (p.Arg148Cys) detected in patients 1 and 6, in a transient GLB1 expression vector as described previously. The oligonucleotide primers for site-directed mutagenesis have been previously reported (Caciotti et al. 2003) except for the following:

Arg148Cys forward 5' GTCTATTCTTCTCTGCTCCTCC 3' (429/450nt exon 4) Arg148Cys reverse 5' GGAGGAGCAGAGAAGAATAGAC 3' (450/429nt exon 4) The underlined bases correspond to a mispairing with the normal sequence.

RT PCR in GM1 Gangliosidosis 3

Transfection into COS-1 Cells Normal and mutant vectors were transiently over-expressed into African green monkey kidney cells (COS-1) as

described previously (Caciotti et al. 2003). Cell cultures and biochemical enzymatic assay of GLB1 and NEU1 enzymes were performed as previously

described (Caciotti et al. 2003).

RNA Isolation and cDNA Synthesis

All reagents for total RNA extraction from patients’ fibroblasts were purchased from Eppendorf AG (Hamburg, Germany). RNA integrity was verified by 0.8% agarose gel electrophoresis and by evaluating GAPDH mRNA expression with the Pre-Developed TaqMan Assay Reagent, GAPDH endogenous control kit from Applied Biosystems (Foster City, CA). RNA concentrations were determined with Nanodrop® ND-1000 Spectrophotometer. Control and patients’ total RNA (400ng) was reverse transcribed in 80μl of final volume in a reaction mixture containing 10μl TaqMan RT buffer 1X, 5.5mM MgCl2, 500μM each dNTP, 2.5 μM random hexamers, 0.4U/μl Rnase Inhibitor and 1.25 U/μl MultiScribe Reverse transcriptase provided by Applied Biosystems. The profile of the one-step reverse transcriptase was: 10min at 25°C, 30min at 48°C and 2min at 95°C.

Quantification of GLB1 and EBP mRNA The measurement of GLB1 and EBP mRNA (GenBank M22590, NM_000404) was performed using a

quantitative real-time PCR method, based on TaqManTM technology. For the detection of GLB1 mRNA the following probe and primers were chosen:

probe 582/609nt: 5' CTGTGATTTTGACTACCTGCGCTTCCTGC 3' labeled with VIC, located on exon 6, forward primer 538/564nt: 5’ GTTATAACAGTGCAGGTTGAAAATGAA 3’ which hybridises on exon 5 and exon 6 junction region, reverse primer 618/635nt: 5’ CCCAGATGGTGGCGAAAG 3’ located on exon 6.

For the detection of EBP mRNA the following probe and primers were chosen: probe 240start-471end nt: 5’ CCAGACATTACCTGGCAGCTG 3’ labeled with FAM, which hybridises on

exon 2 and exon 5 junction region, forward primer 223/238nt: 5’ GCTGGGCTGAACGCCA 3’, located on exon 2, reverse primer 499/480nt: 5’ GCAGAAGGACTCCCAACCAC 3’, located on exon 5.

PCR analysis was performed using 25ng of cDNA in a reaction mixture containing 300nM of forward and reverse primers and 200nM of the fluorescent probes (for each gene in different wells), and 12.5μl Universal master Mix. Plates were treated 2min at 50°C, 10min at 95°C and then submitted to 40 cycles of amplification at 95°C for 15sec, 60°C for 1min in the ABI Prism 7700 Sequence Detector PE Applied Biosystems (Foster City, USA). Plasmid vectors carring GLB1 and EBP cDNAs were tenfold serially diluted from a starting quantity of 10-7 ag for each gene expression analysis and used as standard curves. The absolute values of GLB1 and EBP mRNAs were expressed as copy/μg total RNA (mean± SD).

Statistical Analysis Statistical analysis was carried out using the SPSS software package (SPSS INC, Chicago, IL). Statistical

differences between groups were assessed by t-test. Differences with p<0.05 were considered statistically significant.

RESULTS

Clinical presentation

The phenotypes of the GM1 gangliosidosis patients here reported have been summarised in Table 1. A broad range of clinical features was identified in patients with the infantile form of the disease. Mitral and tricuspid insufficiency represents an uncommon feature detected in the juvenile Patient8.

Biochemical and Genetic Analysis The diagnosis of GM1-gangliosidosis was confirmed by the absence or reduction of GLB1 enzyme activity in

patients’ leukocytes and fibroblasts coupled with normal NEU1 activity. The full length GLB1 cDNA of the patients and the exon/intron boundaries of the corresponding GLB1 gene were amplified and directly sequenced on both strands. Five new (c.1835_1836delCC; c.442C>T; c.1068+1G>T; c.1646C>T and c.1233+8T>C) and five

4 Caciotti et al.

known (c.176G>A; c.245+1G>A, c.602G>A; c.367G>A and c.75+2insT) genetic sequence variations were identified in the patients’ samples (Table 2). Retro-transcription PCR performed on samples from Patient2 and 5, who were homozygous for splicing defects, identified frameshift and premature termination codons (PTCs). In particular, the c.75+2insT was previously reported to cause a 20 nucleotide insertion and consequently a frameshift in the open reading frame of at least two aberrant transcripts, one of which terminates in an early stop codon (Morrone et al. 1994). We have also found that the c.245+1G>A, detected in Patient2, gives rise to at least one aberrant transcript skipping exon 2. This transcript terminates with a PTC starting at position c.266 in exon 3.

Screening of the New Point Missense Mutations The possibility that the three new point genetic changes could have been benign polymorphisms was

investigated by restriction site analysis, transient expression studies, and SSCP. Restriction analysis by DdeI showed that the c.1233+8T>C genetic lesion, detected in the GLB1 gene of

Patient9, occurred with a frequency of about 20% in the screened normal alleles, suggesting that this intronic change is benign. This nucleotide change increases the strength of a pre-existing site for the human cDNA termed pre-mRNA splicing factor SC35 (data obtained from http://www.sce.umkc.edu/∼roganp/Information/viewarticles.html).

GLB1 expression vector with mutated GLB1 cDNA containing the p.Arg148Cys point mutation, detected at a homozygous level in Patient1 and at a heterozygous level in Patient6, was created by in vitro site directed mutagenesis and fragment replacement. The pcD-GLB1 p.Arg148Cys mutated vector was transiently expressed in COS-1 cells showing no residual GLB1 enzyme activity.

SSCP analysis performed to clarify the nature of the c.1646C>T (p.Pro549Leu) mutation, detected in the GLB1 gene of Patient7, showed this genetic variation to be absent in the normal population, suggesting it is a disease-causing mutation. This genetic variation was detected at a heterozygous level in the patient’s father. It was absent in the mother’s DNA, who shares with the Patientthe p.Arg482His at a heterozygous level.

Real Time Detection of GLB1 and EBP mRNA Expression Quantitative analyses of GLB1 and EBP mRNAs were achieved by absolute real time PCR. To determine the

quantity of mRNAs in patients’ specimens, pCD-GLB1 and pCD-EBP vectors were used to generate the standard curves. Tenfold dilution series of both plasmids were tested to obtain the dynamic ranges. Results indicated that these assays could distinguish 10-fold differences in concentration from about 20 to 2 X 106 vectors’ molecules per reaction mixture (Fig.1). To investigate minor variations in input amounts of control and patients’ RNA samples, GAPDH mRNA level was quantified in parallel with each sample (data not shown).

We analyzed total RNA extracted from the fibroblasts of 15 GM1 gangliosidosis patients (10 with the infantile, 3 with the juvenile and 1 with the adult form of the disease) and 13 normal controls. With respect to the standard deviation, the mean value of GLB1 control mRNA was not significantly different from that of most of the patients' samples (normal mean value: 8.30 X 106± 4.43 X 106, patients’ mean value 9 X 106± 6.64 X 106 molecules). Neither were there significant differences between the EBP mRNA levels of most of the patients’ and the control samples (normal mean value: 8.03 X 105± 5.67 X 105, patients’ mean value: 7.64 X 105± 3.36 X 105 molecules). In contrast, the three patients carrying splicing defects (Patient2, 5 and 8) had reduced levels of both GLB1 and EBP mRNA expression (Table 3). In particular, one of these three patients, homozygous for the c.245+1G>A mutation, showed a complete absence of the EBP mRNA, likely because of impaired annealing of the EBP Taq-Man probe, mapping between exon 2 and 5.

GAPDH mRNA expression levels in this patient’s specimen were equal to those detected in controls and other patients’ samples. We note that statistical analysis of our cohort shows that even if GLB1 and EBP mRNA expression levels fall within the range of the established confidence limits, they follow parallel trends in their respective amounts (Fig. 2).

DISCUSSION

This study focuses on GLB1 gene expression profiling in fibroblasts from GM1 gangliosidosis patients and on their molecular analysis. The new missense mutations identified were evaluated in order to determine whether there was a genotype-phenotype correlation. The p.Arg148Cys and the p.Pro549Leu mutations were found at homozygous level (Patient1) and in combination with a deletion (Patient6) or with the severe known (Oshima et al.

RT PCR in GM1 Gangliosidosis 5

1991, Georgiou et al. 2005) p.Arg482His point mutation (Patient7). Since they were found in patients with the infantile form of the disease, these mutations can be correlated with this severe phenotype. The only two patients with the juvenile phenotype (patients 8 and 9) were shown to have the p.Arg201His mutation that has been detected in a significant number of unrelated GM1 gangliosidosis patients with this form of the disease (Kaye et al. 1997, Morrone et al. 2000, Caciotti et al. 2005a). Given that Patient8 carries a splicing defect (c.1068+1G>T), the p.ArgR201His mutation is predicted to be responsible for the juvenile phenotype.

The newly defined c.1233+8T>C polymorphism was detected at heterozygous level in the GM1 gangliosidosis Patientwith the juvenile phenotype (Patient9) in trans with the p.Arg201His allele. A second GLB1 mutation was not detected in this patient. The c.1233+8T>C variant has been calculated to strengthen a pre-existing binding site for the SC35, that is required for spliceosome assembly. The SC35 splicing factor is a Ser/Arg-rich (SR) protein and it plays an important role in the constitutive and alternative splicing of pre-mRNA and in mRNA transport, stability, and translation (Lin et al. 2005). However, since the c.1233+8T>C genetic sequence variation has been found in 20% of normal alleles, it is hard to envisage that this genetic change has a pathologic effect.

For diagnostic purposes, we developed a new and rapid method for the absolute determination of GLB1 and EBP mRNA copies in RT-PCR assays. Expression patterns of total mRNA from Patientand control cultured fibroblasts were comparable with respect to the quantification of the respective GLB1 and EBP transcripts. The only exceptions were the specimens from the GM1 gangliosidosis patients where at least one splicing mutation occurred in common regions between GLB1 and EBP. As expected in those cases (Patient2, 5 and 8), GLB1 and EBP mRNA levels were mildly or severely reduced. These results indicate that our method provided low thresholds for detection and wide dynamic ranges.

It has been previously reported, also in lysosomal storage diseases, that genetic variations introducing PTCs, can generate nonsense mediated mRNA decay (Lualdi et al. 2006). Splicing defects and deletions, generating frameshift mutations in the mRNA translation, cause premature stop codons, as detected in Patient 2 and 5. A process of mRNA decay in these patients’ specimens could be proposed.

Statistical analysis showed that levels of GLB1 and EBP mRNA increase/decrease in equal steps in their respective samples. This finding demonstrates that the two alternatively spliced mRNA of the GLB1 gene are transcribed within the same dynamic range.

Genotype-phenotype correlation in GM1 gangliosidosis has been suggested (Morrone et al. 2000, Caciotti et al 2003, Yoshida et al. 1991). Mutations affecting both GLB1 and EBP proteins have been previously linked to the presence of cardiac involvement (Morrone et al. 2000). Our data indicates that most of the infantile patients here reported showed some cardiac involvement (Patient5 died before such investigations). Patient1 and 6, had no cardiac involvement consistent with their mutational analysis that identified at least one mutation not affecting the EBP protein.

In contrast cardiac involvement was observed in Patient3, where neither mutation affected the EBP protein. An explanation for this finding may lie in the effect of glycosphingolipid secondary storage. There are reports concerning various lysosomal diseases which highlight the inhibition of secondarily involved lysosomal enzymes and the defects in glycosphingolipid trafficking either to or from the lysosomes (Sillence and Platt 2003).

The effect of all undegraded products that, like glycosphingolipids, accumulate in lysosomes, such as keratan sulphate (KS) storage in GM1 Gangliosidosis and Morquio syndromes, could also contribute to the pathogenesis. Patients affected by mucopolysaccharidosis IVA (Morquio syndrome), typically demonstrate excessive urinary excretion of KS and can also exhibit cardiac involvement including cardiac valve and ventricle abnormalities (Guertl et al. 2000).

The juvenile Patient 8 showed mitral and tricuspid insufficiency and massive KS urinary excretion, both typical features of Morquio syndrome. Patient8 showed the p.Arg201His mutation, that affects the GLB1 enzyme only. Despite this, the presence of elevated urinary glycosaminoglycan and KS in particular could be related to the clinical findings and might explain this patient’s specific cardiac abnormalities.

Aortic smooth muscle cells actively express EBP, and aortic lesions are common features of disorders involving elastic fiber assembly (see Marfan syndrome). Thus, lack of EBP, be it of primary or secondary origin and its relation to impaired elastogenesis, could explain the aortic insufficiency detected in the other juvenile p Patient (Patient 9).

This biochemical and molecular model could be extended to the explanation of the cardiomyopathy detected in Patient 3. Since this Patientalso showed no primary EBP involvement but elevated urinary excretion of KS, it could be hypothesized that glycosaminoglycan accumulation contributed to his cardiac feature.

6 Caciotti et al.

The lack of EBP of primary and secondary origin has been linked to impaired elastogenesis in GM1-gangliosidosis patients (Hinek et al. 2000b, Caciotti et al. 2005b). In contrast, skeletal abnormalities were present in most of the patients here reported irrespective of mutation type. We could hypothesize that the correlation between connective/bone tissue abnormalities and specific GLB1 and EBP defects needs better evaluation of crucial parameters such as the accurate and renewed clinical investigations throughout the entire life of patients and the natural history of the disease’s progression with the potential progressive accumulation of KS depending on the type of mutations in the GLB1 enzyme active site.

In summary, our data supported the hypothesis that a reduction in EBP could be linked to cardiac involvement in GM1 gangliosidosis patients. The evaluation of EBP expression by real time PCR, as developed here, can prove helpful in the prognostic assessment of these patients. It is increasingly clear that the involvement of EBP in determining each patient's phenotype cannot be ignored, especially when instigating any eventual therapy.

ACKNOWLEDGMENTS

The authors thank the families of the patients for their collaboration. This paper was partially financed by grants: Fondi Ateneo (MURST ex 60%), MIUR-PRIN 2004, Azienda Ospedaliera Meyer, Association AMMEC and MPS Italy. One of the samples were obtained from the “Cell Line and DNA Bank from Patients Affected by Genetic Diseases” collection (http://www.gaslini.org/labdppm.htm) supported by Italian Telethon grants (project no GTF04002).

RT PCR in GM1 Gangliosidosis 7

Table 1. Clinical Features of the New GM1-Gangliosidosis Patients Reported in This Study

Patient/ Phenotype

Ethnic origin

Age at onset

Initial signs

Psychomotor delay (PMD), CNS/muscle

Eye Course facies

Heart Hepato/ spleno

megaly (H/S)

Skeleton/ connective

tissue

Other Death

1/ I Australia 8m Delayed development angiokeratoma mild facial

coarse

PMD, seizures, EEG: epileptiform activity,

hypotonia, progressive hypertonia from 10m

- Yes Normal Mild H Lumbar gibbus

Apnoea, chronic cough,

respiratory infections

2y

2 /I Morocco birth Respiratory impairment

PMD, hypotonia - Yes Atrial septa defect

no Normal Oedema, dyspnea

Alive at 10m

3/ I Italy 2m Hydrocele (right side),

splenomegaly

PMD, hypotonia Cherry red spot, corneal

clouding, nystagmus

Yes Ventricular hypertrophy,

cardiomyopathy (left side)

H/S Dorsolumbar kyphosis,

osteoporosis

Dyspnea, u.KS

excretion

18m

4/I Gypsy

birth Bilateral hydrocele

PMD, hypotonia Cherry red spot

Yes cardiomyopathy - Lumbar vertebral

platyspondily

- -

5/ I Belgium 6m Psychomotor delay

PMD, hypotonia Normal Yes - H/S Radiolucent bones,

avitaminosis

Respiratory infections, elevated u.

GAG

20m

6 /I Italy

11m Hypotonia, Psychomotor

delay

PMD, hypotonia Normal Yes Normal H/S Lumbar gibbous, L2

vertebral deformity

Cortical atrophy

Alive at 16m

7/ I Italy 1m Trunk hypotonia,

limb hypertonia, cherry red

spot

PMD, trunk hypotonia, limb

hypertonia

Cherry red spot,

convergent strabismus, nystagmus

Yes Hyperechogen aortic and

mitral valve, mitral

insufficiency

H left sided scoliosis,

dorsolumbar kyphosis

Dyspnea, pulmonitis,

diffuse hypo-

myelination

18m

8/ J Italy 3y Speech impairment,

behavior problems

Mild PMD, Ataxia Normal Yes Mitral and tricuspid

insufficiency

Normal - Mildly elevated u.GAG,

u.KS excretion

Alive at 11y

9/ J Italy 3y Speech impairment,

corneal clouding

PMD, Ataxia Corneal clouding

Yes Mild aortic insufficiency

Normal Vertebral deformities

Cortical atrophy

Alive at 16y

Additional table abbreviations: m. month; y year; - not investigated or unknown; u.GAG urinary glycosaminoglicans; u.KS urinary keratan sulfate.

8 Caciotti et al.

Table 2. Mutation Analysis of the GM1 Gangliosidosis Patients’ GLB1 Gene

Patient GLB1 nucleotide change Effect on GLB1 coding region Exon References

1/I c.442C>T/ c.442C>T p.Arg148Cys/ p.Arg148Cys 4 This work

2/I c.245+1G>A/c.245+1G>A

c.29T>C

Splicing defect

p.Leu10Pro polymorphism

(homozygous level)

2

1

(Georgiou et al.2004)

(Nishimoto et al.1991)

3/I c.367G>A/c.367G>A p.Gly123Arg/ p.Gly123Arg 3 (Yoshida et al.1991)

4/I c.176G>A/c.176G>A p.Arg59His/ p.Arg59His 2 (Morrone et al.2000)

5/I c.75+2insT/c.75+2insT Splicing defect 1 (Morrone et al.1994)

6/I c.442C>T/

c.1835_1836delCC

p.Arg148Cys/ frame shift 4

16

This work

This work

7/I c.1445G>A/

c.1646C>T

p.Arg482His/

p.Pro549Leu

14

15

(Oshima et al.1991)

This work

8/J c.602G>A /

c.1068+1G>T

p.Arg201His/

Splicing defect

6

10

(Kaye et al.1997)

This work

9/J c.602G>A /

?

c.34C>T

c.1233+8T>C

p.Arg201His/

?

p.Leu12Leu polymorphism

(heterozygous level)

polymorphism

(heterozygous level)

6

?

1

12

(Kaye et al.1997)

(Silva et al.1999)

This work

LB1 gene (NT_022517.16, NM_000404.1). c-DNA nucleotide numbering starts at the ATG translation initiation codon. I=infantile; J=Juvenile.

Table 3. Number of EBP and GLB1 Copies Detected in GM1 Gangliosidosis Patients and Control Samples. Patients With Values Outside the Mean Are Reported in Detail.

Patient N. of copies EBP ±SD N. of copies GLB1 ±SD 2 0.00E+00 1.63E+06±

1.57E+05 5 1.12E+05±

7.94E+03 1.28E+06± 1.68E+05

8 1.25E+04± 2.00E+04

1.12E+06± 7.94E+04

Patients’ mean value (except patients 2, 5,

and 8)

7.64E+05± 3.36E+05

9.06E+06± 6.64E+06

Normal mean value 8.03E+05± 5.67E+05

8.30E+06± 4.43E+06

RT PCR in GM1 Gangliosidosis 9

Figure 1. Real time standard curves. Standard curves of pCD-GLB1 and pCD-EBP plasmid vectors used for absolute quantisation of GLB1 and EBP mRNA expression. Standard curves were generated by six tenfold serial dilution from a starting quantity of 2x106 plasmid copies.

R2 = 0,7859

Figure 2. Correlation between EBP and GLB1 mRNA expression. The comparison of GLB1 and EBP mRNA levels showed concerted trends of the respective amounts.

R2 = 0,7632

1,00E+05

1,00E+06

1,00E+07

1,00E+08

1,00E+04 1,00E+05 1,00E+06 1,00E+07

GLB1 mRNA expression (copy/μg total RNA)

EB

P m

RN

A e

xpre

ssio

n(co

py/ μ

g to

tal R

NA

)

samplescontrolsamplescontrol

10 Caciotti et al.

REFERENCES

Caciotti A, Bardelli T, Cunningham J, d'Azzo A, Zammarchi E, Morrone A. 2003. Modulating action of the new polymorphism L436F detected in the GLB1 gene of a type-II GM1 gangliosidosis patient. Hum Genet 113:44-50.

Caciotti A, Donati MA, Boneh A, d’Azzo A, Federico A, Parini R, Antuzzi D, Bardelli T, Nosi D, Kimonis V, Zammarchi E, Morrone A. 2005a. Role of β-galactosidase and Elastin Binding Protein in Lysosomal and non Lysosomal multienzyme complexes of GM1- gangliosidosis patients. Hum Mutat 25:285-292.

Caciotti A, Donati MA, Bardelli T, d'Azzo A, Massai G, Luciani L, Zammarchi E, Morrone A. 2005b. Primary and Secondary Elastin-Binding Protein Defect Leads to Impaired Elastogenesis in Fibroblasts from GM1-Gangliosidosis Patients. Am J Pathol 167:1689-1698.

den Dunnen JT, Antonarakis SE. 2000. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat; 15:7-12.

den Dunnen JT, Paalman MH. 2003. Standardizing mutation nomenclature: why bother?. Hum Mutat 22:181-182.

Georgiou T, Drousiotou A, Campos Y, Caciotti A, Sztriha L, Gururaj A, Ozand P, Zammarchi E, Morrone A, d'Azzo A. 2004. Four novel mutations in patients from the Middle East with the infantile form of GM1-gangliosidosis. Hum Mutat. 24:352.

Georgiou T, Stylianidou G, Anastasiadou V, Caciotti A, Campos Y, Zammarchi E, Morrone A, D'azzo A, Drousiotou A. 2005. The Arg482His mutation in the beta-galactosidase gene is responsible for a high frequency of GM1 gangliosidosis carriers in a Cypriot village. Genet Test 9:126-132.

Guertl B, Noehammer C, Hoefler G. 2000. Metabolic cardiomyopathies. Int J Exp Pathol. 81:349-372.

Hinek A, Smith AC, Cutiongco EM, Callahan JW, Gripp KW, Weksberg R. 2000b. Decreased elastin deposition and high proliferation of fibroblasts from Costello syndrome are related to functional deficiency in the 67-kD elastin-binding protein Am J Hum Genet 66:859-872.

Hinek A, Wilson SE. 2000. Impaired elastogenesis in Hurler disease: dermatan sulfate accumulation linked to deficiency in elastin-binding protein and elastic fiber assembly Am J Pathol 156:925-938.

Hinek, A, Zhang, S, Smith, AC, Callahan, JW. 2000a. Impaired elastic-fiber assembly by fibroblasts with either Morquio B disease or infantile GM1-gangliosidosis is linked to deficiency in the 67 kD spliced variant of β-galactosidase Am J Hum Genet 67:23-36.

Kaye E, Shalish C. Livermore J, Taylor HA, Stevenson R, Breakefield O. 1997. β-Galactosidase gene mutations in Patientwith slowly progressive GM1-gangliosidosis. J Child Neurol 12:242-247.

Lin S, Xiao R, Sun P, Xu X, Fu XD. 2005. Dephosphorylation-dependent sorting of SR splicing factors during mRNP maturation. Mol Cell 20:413-425.

Lualdi S, Di Rocco M, Corsolini F, Spada M, Bembi B, Cotugno G, Battini R, Stroppiano M, Gabriela Pittis M, Filocamo M. 2006a. Identification of nine new IDS alleles in mucopolysaccharidosis II. Quantitative evaluation by real-time RT-PCR of mRNAs sensitive to nonsense-mediated and nonstop decay mechanisms. Biochim Biophys Acta. 1762:478-484.

Morrone A, Bardelli T, Donati MA, Giorgi M, Di Rocco M, Gatti R, Parini R, Ricci R, Taddeucci G, d'Azzo A, Zammarchi E. 2000. beta-galactosidase gene mutations affecting the lysosomal enzyme and the elastin-binding protein in GM1-gangliosidosis patients with cardiac involvement Hum Mutat 15:354-366.

Morrone A, Morreau H, Zhou XY, Zammarchi E, Kleijer WJ, Galjaard H, d'Azzo A. 1994. Insertion of a T next to the donor splice site of intron 1 causes aberrantly spliced mRNA in a case of infantile GM1-gangliosidosis. Hum Mutat 3:112-120.

Nishimoto JE, Namba E, Okada S, Suzuki K. 1991. Gm1-gangliosidosis (genetic beta-galactosidase deficiency): Identification of four mutations in different clinical phenotypes among Japanese patients. Am J Hum Genet 49:566-574.

Oshima A, Yoshida K, Shimmoto M, Fukuhara Y, Sakuraba H, Suzuki Y. 1991. Human beta-galactosidase gene mutations in morquio B disease. Am J Hum Genet 49:1091-1093.

Sillence DJ, Platt FM. 2003. Storage diseases: new insights into sphingolipid functions. Trends Cell Biol 13:195-203.

RT PCR in GM1 Gangliosidosis 11

Silva CM, Severini MH, Sopelsa A, Coelho JC, Zaha A, d'Azzo A, Giugliani R. 1999. Six novel beta-galactosidase gene mutations in Brazilian patients with GM1-gangliosidosis. Hum Mutat 13:401-409.

Suzuki Y, Oshima A, Nanba E. 2001. ß-galactosidase deficiency (ß-galactosidosis) GM1-gangliosidosis and Morquio B disease. In: Scriver CR, Beaudet AL, Sly WS, Valle D, editors. The Metabolic and Molecular Bases of Inherited Disease. New York: McGraw-Hill Publishing Co. p 3775-3809.

Yoshida K, Oshima A, Shimmoto M, Fukuhara Y, Sakuraba H, Yanagisawa N, Suzuki Y. 1991. Human beta-galactosidase gene mutations in GM1-gangliosidosis: a common mutation among Japanese adult/chronic cases. Am J Hum Genet 49:435-442.