http://tpx.sagepub.com/Toxicologic Pathology

http://tpx.sagepub.com/content/37/2/209The online version of this article can be found at:

 DOI: 10.1177/0192623308328544

2009 37: 209Toxicol PatholYang Fan, Toshiyuki Yamada, Takeshi Shimizu, Naoki Nanashima, Miki Akita, Kohji Suto and Shigeki Tsuchida

Ferritin Expression in Rat Hepatocytes and Kupffer Cells after Lead Nitrate Treatment  

Published by:

http://www.sagepublications.com

On behalf of: 

  Society of Toxicologic Pathology

can be found at:Toxicologic PathologyAdditional services and information for    

  http://tpx.sagepub.com/cgi/alertsEmail Alerts:

 

http://tpx.sagepub.com/subscriptionsSubscriptions:  

http://www.sagepub.com/journalsReprints.navReprints:  

http://www.sagepub.com/journalsPermissions.navPermissions:  

What is This? 

- Mar 30, 2009Version of Record >>

by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from by guest on October 11, 2013tpx.sagepub.comDownloaded from

Ferritin Expression in Rat Hepatocytes and KupfferCells after Lead Nitrate Treatment

YANG FAN,1,4 TOSHIYUKI YAMADA,1 TAKESHI SHIMIZU,1 NAOKI NANASHIMA,1,2 MIKI AKITA,1 KOHJI SUTO,3 AND

SHIGEKI TSUCHIDA1

1Department of Biochemistry and Genome Biology, Hirosaki University Graduate School of Medicine,

Hirosaki 036-8562, Japan2Department of Medical Technology, Hirosaki University Graduate School of Health Sciences,

Hirosaki 036-8564, Japan3Department of Internal Medicine, Hirosaki City Hospital, Hirosaki 036-8004, Japan

4Research Center of Affiliated Shengjing Hospital, China Medical University, Shenyang, 110004, China

ABSTRACT

Lead nitrate induces hepatocyte proliferation and subsequent apoptosis in rat livers. Iron is a constituent of heme and is also required for cell

proliferation. In this study, the expression of ferritin light-chain (FTL), the major iron storage protein, was investigated in rat livers after a single

intravenous injection of lead nitrate. Western blotting and immunohistochemistry revealed that FTL was increased in hepatocytes around the central

veins and strongly expressed in nonparenchymal cells. Some FTL-positive nonparenchymal cells were identified as Kupffer cells that were positive

for CD68. FTL-positive Kupffer cells occupied about 60% of CD68-positive cells in the periportal and perivenous areas. The relationships between

FTL expression and apoptosis induction or the engulfment of apoptotic cells were examined. TUNEL-positive cells were increased in the treatment

group, and enhanced expression of milk fat globule EGF-like 8 was demonstrated in some Kupffer cells and hepatocytes, indicating enhanced apop-

tosis induction and phagocytosis of apoptotic cells. FTL-positive Kupffer cells were not detected without lead nitrate treatment or in rat livers treated

with clofibrate, which induces hepatocyte proliferation but not apoptosis. These results suggest that FTL expression in Kupffer cells after lead treat-

ment is dependent on phagocytosis of apoptotic cells.

Keywords: Lead nitrate; ferritin; cell proliferation; apoptosis; phagocytosis; Kupffer cell.

INTRODUCTION

Lead is a multitargeted toxicant, causing effects in the

gastrointestinal tract, hematopoietic system, cardiovascular sys-

tem, nervous system, and other systems (Needleman and Land-

rigan 1981). The metal blocks heme synthesis by inhibiting

activities of �-aminolevulinic acid dehydratase and ferrochela-

tase, resulting in development of anemia and impaired functions

of heme-containing enzymes and proteins in many organs, as

described above (Jover et al. 1996; Moore et al. 1987).

Intravenous injection of lead nitrate into rats leads to marked

liver enlargement and hepatocyte proliferation (Columbano

et al. 1983). Acting as a direct mitogen, the metal induces such

effects without precedent liver injury. Some cytokines, including

tumor necrosis factor-a, are suggested to be involved in cell pro-

liferation (Shinozuka et al. 1996), and they are derived from

Kupffer cells (Milosevic and Maier 2000; Pagliara et al.

2003). Withdrawal of lead results in the regression of liver

hyperplasia resulting from the apoptosis of hepatocytes (Colum-

bano et al. 1985); Kupffer cells are also suggested to play an

important role in apoptosis induction (Pagliara et al. 2003).

Apoptotic cells are removed rapidly by phagocytes or macro-

phages. For efficient recognition, apoptotic cells mark them-

selves by presenting ‘‘eat-me’’ signals (Savill et al. 1993).

Phosphatidylserine (PS) and its receptor, milk fat globule EGF

factor 8 (MFG-E8), and mannose receptor are involved in their

recognition by macrophages or Kupffer cells (Callahan et al.

2000; Dini et al. 1996; Hanayama et al. 2004; Ruzittu et al.

1999; Yoshida et al. 2005).

The intracellular iron storage protein ferritin plays important

roles, not only in iron metabolism, but also in inflammation

(Konijn et al. 1981), oxidative damage (Cairo et al. 1995), cell

proliferation (Cozzi et al. 2004; Kikyo et al. 1994), and apoptosis

(Cozzi et al. 2003). Ferritin is composed of twenty-four subunits

of two types, the heavy chain and light chain (Harrison and Arosio

1996), and their protein levels are largely post-transcriptionally

regulated by the iron-regulatory proteins IRP1 and 2 (Ishikawa

et al. 2005; Klausner and Harford 1989).

By inhibiting the heme synthesis pathway and inducing

hepatocyte proliferation and subsequent apoptosis, lead may

cause alterations in iron metabolism and ferritin expression

in the liver. In the present study, expression of ferritin light-

chain (FTL) in rat livers, the dominant subunit in the organ,

Address correspondence to: Shigeki Tsuchida, Department of Biochemistry

and Genome Biology, Hirosaki University Graduate School of Medicine,

5 Zaifu-Cho, Hirosaki 036-8562, Japan; e-mail: tsuchida@cc.hirosaki-u.ac.jp.

Abbreviations: ABC, avidin-biotin-peroxidase complex; a-SMA, a-smooth

muscle actin; DAB, 3, 3-diaminobenzidine tetrahydrochloride; GST, glutathione

S-transferase; FTL, ferritin light-chain; IRP, iron-regulatory protein; MFG-E8,

milk fat globule EGF factor 8; NPC, nonparenchymal cell; PS, phosphatidyl-

serine; RT-PCR, reverse transcriptase-polymerase chain reaction; SDS-PAGE,

sodium dodecyl sulfate-polyacrylamide gel electrophoresis; TUNEL, TdT-

mediated dUTP-biotin nick end labeling.

209

Toxicologic Pathology, 37: 209-217, 2009

Copyright # 2009 by Society of Toxicologic Pathology

ISSN: 0192-6233 print / 1533-1601 online

DOI: 10.1177/0192623308328544

was investigated after lead nitrate administration. We found

that FTL was increased in hepatocytes and nonparenchymal

cells (NPC), and some FTL-positive NPC were identified as

Kupffer cells. We further examined the relationship between

FTL expression in Kupffer cells and apoptosis induction as

well as phagocytic activity.

MATERIALS AND METHODS

Animal Experiments

Male Sprague-Dawley rats maintained in our department,

aged six to seven weeks and weighing 200–250 g, were

used in the present study. The protocol for the animal experi-

ments was approved by the Animal Care and Use Committee,

Hirosaki University, and conducted in accordance with the

Guiding Principles in the Use of Animals in Toxicology. All

animals were housed in plastic cages in an air-conditioned

room with a twelve-hour light/dark cycle in the Institute

for Animal Experiments of Hirosaki University Graduate

School of Medicine, and were allowed free access to water

and laboratory chow diet. Lead nitrate (Wako Chemical

Inc., Osaka, Japan) was dissolved in 0.25 M sucrose just

prior to use, and was given to rats as a single injection of

200 mmol/kg body weight in a volume of 0.5 mL through the

tail vein (Columbano et al. 1983). Control rats received an

equivalent volume of 0.25 M sucrose. Each group contained

at least four rats. Seventy-two hours after the administration

of lead nitrate, animals were weighed and then euthanized

by decapitation under diethyl ether anesthesia. Liver slices

were fixed, and remaining livers were kept frozen at –80�Cuntil biochemical study. Blood hemoglobin levels were mea-

sured with an automatic hematology analyzer (MEK-6450,

Nihon Kohden, Tokyo, Japan).

In some experiments, 0.3% w/w clofibrate (a product of

Tokyo Kasei Kogyo, Tokyo, Japan; purity > 98%) in the basal

diet was given to male SD rats for four weeks.

Western Blotting

Rat livers were homogenized in four volumes of 0.25 M

sucrose, 15 mM Tris-HCl (pH 7.9), 15 mM NaCl, 60 mM KCl,

5 mM EDTA, 0.15 mM spermine, 0.5 mM spermidine, 0.1 mM

phenylmethanesulfonyl fluoride, 1.0 mM dithiothreitol, 1% pro-

tease inhibitor cocktail (Sigma), and centrifuged at 15,000 � g

for ten minutes. The supernatant was used as a cytoplasmic

extract. Nuclear extracts were prepared from rat liver tissues,

as described by Dignam et al. (1983). Proteins of these extracts

were separated by 12.5% or 8% SDS-PAGE gel (Laemmli 1970)

and electroblotted to PVDF membranes (Amersham Bios-

ciences, Tokyo, Japan) according to the method of Towbin

et al. (1979). These were probed with anti-FTL, IRP1,

IRP2, c-Jun or glutathione S-transferase (GST)-P antibodies.

Antibodies against FTL (sc-14420), IRP1 (sc-14216), IRP2

(sc-14221), and c-Jun (sc-1694) were purchased from Santa

Cruz Biotechnology (Santa Cruz, CA, USA). Antibody against

GST-P was raised in a rabbit, as reported previously (Satoh

et al. 1985). Detected bands were quantified with an image

analysis system (ChemiDoc XRS, Bio-Rad, Tokyo, Japan).

RNA Preparation and Reverse Transcriptase-Polymerase

Chain Reaction (RT-PCR)

Total RNA was extracted from frozen liver, as described by

Ookawa et al. (2002), and RT-PCR was performed with the

AccessQuick RT-PCR System (Promega, Tokyo, Japan) by using

0.5 mg RNA. PCR amplification consisted of one minute at 94�C,

two minutes at 55�C to 60�C, and three minutes at 72�C for

twenty-one to thirty cycles. The primers used are shown in

Table 1. RT-PCR products were subjected to electrophoresis in

a 2% agarose gel and visualized with ethidium bromide.

Histological Analysis and Immunohistochemistry

Liver tissues from rats were fixed in 10% formaldehyde and

embedded in paraffin. Tissue sections (4–6 mm thick) were rou-

tinely passed through xylene and a graded alcohol series and

stained with hematoxylin and eosin. Sections for CD68 and

CD34 were incubated with Liberate Antibody Binding

(L.A.B.) solution (Polysciences, Inc, Warrington, PA, USA)

for ten minutes for epitope retrieval. Immunohistochemical

staining for FTL, CD68, CD34, a-smooth muscle actin

(a-SMA), ferritin heavy chain, hemoglobin, or MFG-E8 was

performed by the avidin-biotin-peroxidase complex (ABC)

method (Hsu et al. 1981) with their respective antibodies. Anti-

body against CD68 (MCA341R) was obtained from AbD

Serotec (Oxford, UK), antibodies against CD34 (ab8158) and

TABLE 1.—Primers for RT-PCR

Target Forward (50-30) Reverse (50-30)

FTL TAGTCGTGCTTCAGAGTGAG CGCTCAAAGAGATACTCGCC

IRP2 GGTGACCTACAGAAAGCAGG TCTGTCTCAATGCCTCCAAC

Hepcidin CTAAGCACTCGGATCCAGGC CAGGACAAGGCTCTTGGCTC

Ferroportin GGATGCTGT GGATCTTTAGC TGTCTGCTAATCTGCTCCTG

PS-R ACTGGACGCGACACAATTAC CCTGAACTAAGGCATTCCAG

Mannose R AGCAGAAGAATGCTGAGCTC AGTCCTCCTGCCTGTTGTTC

MFG-E8 TGGGCCTGAAGAATAACACG TATGAAAGGACAGTGGAAGG

Abbreviations: FTL, ferritin light-chain; IRP, iron-regulatory protein; MFG-E8, milk fat globule EGF factor 8; PS-R, phosphatidylserine receptor; RT-PCR, reverse transcriptase-

polymerase chain reaction.

210 FAN ET AL. TOXICOLOGIC PATHOLOGY

a-SMA (ab18147) were from Abcam (Tokyo, Japan), and anti-

bodies against ferritin heavy chain (sc-14416), hemoglobin

(sc-21005), and MFG-E8 (sc-33546) were from Santa Cruz

Biotechnology. The biotinylated anti-rabbit or anti-goat IgG

antibodies and Vectastain ABC kit were obtained from Vector

Laboratories (Burlingame, CA, USA). The specific binding

was visualized with a 3,3-diaminobenzidine tetrahydro-

chloride (DAB) solution. Sections were then lightly counter-

stained with hematoxylin for microscopic examination. The

specimens were examined and photographed using a micro-

scope (COOLSCOPE, Nikon, Tokyo, Japan) interfaced with

a computer.

For immunofluorescence analysis, tissue sections were

incubated with a goat anti-FTL antibody and a mouse anti-

CD68 antibody. Antibodies were stained with fluorescently

labeled secondary antibodies (Alexa Fluor 546 and Alexa

Fluor 488) obtained from Molecular Probes (Eugene, OR,

USA). Species-matched, irrelevant antibodies were used as

negative staining controls. Images were viewed using a fluores-

cent microscope (Olympus BX60) at wavelengths of 546 and

488 nm.

TUNEL Assay

Apoptotic cell death was located in tissue sections by

TUNEL analysis (Waddell et al. 2000). Paraffin tissue sec-

tions (6 mm) were dewaxed at 60�C and passed through a

graded xylene series for five minutes each. Sections were

hydrated through a graded series of ethanol and phosphate-

buffered saline and then incubated with 5 mg/mL proteinase

K in phosphate-buffered saline for ten minutes. TUNEL assay

was performed using a commercial kit, following the manu-

facturer’s instructions (in situ apoptosis detection kit,

TAKARA, Shiga, Japan). The TUNEL labels were visualized

with DAB as a peroxidase substrate. Postweaning mammary

tissue was included as a positive control. Apoptotic cells in

liver sections were quantitated by counting the number of

TUNEL-positive cells in nine random microscope fields

(200X, about 250 hepatocytes/field).

Statistical Analysis

Data were expressed as mean + SEM. Statistical differ-

ences between groups were determined using Student’s t test,

taking p < .05 as the level of significance.

RESULTS

Increase of FTL in Rat Livers by Lead Nitrate

After a single injection of lead nitrate, the livers were signif-

icantly enlarged at seventy-two hours, 6.59 + 0.59 g/100 g body

weight versus 4.31 + 0.17 in the control group (p < .01). Blood

hemoglobin levels were not different between the two groups

(15.4 + 0.7 g/100 mL in the treatment group versus 15.3 +0.5 g/100 mL in control). By western blotting, FTL protein was

3.5 + 1.0-fold increased in the treatment group, as compared

with that in the control group (p < .05, Figure 1A). Since the

ferritin level is regulated post-transcriptionally by IRP1 and IRP2

(Leibold and Munro 1988), these proteins were also examined.

However, IRP1 and 2 levels were hardly changed after the

FIGURE 1.—Increase of ferritin light-chain (FTL) protein in rat livers after

treatment with lead nitrate. Cytoplasmic extracts from control (lane 1)

and lead nitrate-treated (lane 2) rat livers were subjected to SDS-

PAGE and then analyzed for FTL (A), IRP1 (B), IRP2 (C), c-Jun (D),

and glutathione S-transferase (GST)-P (E) proteins by western blotting,

as described in the text. Protein was also stained with Coomassie Brilliant

Blue (F). Each lane contained 50 mg of protein. Lane M, molecular mass

marker proteins. The numbers on the right (A–E) and left (F) indicate

molecular mass in kDa. The data shown are from a representative pre-

paration set and are similar to results obtained in three other sets.

Vol. 37, No. 2, 2009 FERRITIN IN KUPFFER CELLS 211

treatment (Figures 1B and 1C). The up-regulation of c-Jun

protein (Figure 1D) and GST-P (Figure 1E) was confirmed in the

treatment group, which is in line with the findings reported by

Coni et al. (1993) and Roomi et al. (1986), respectively. To con-

firm post-transcriptional regulation of FTL, FTL mRNA and

IRP2 mRNA levels were investigated by RT-PCR. Neither

mRNA was different between the two groups (Figure 2).

Increase of FTL in Hepatocytes and Kupffer Cells by

Lead Nitrate

Immunohistochemical analysis was performed to clarify cell

types exhibiting enhanced FTL expression. As shown in Figure

3B, some hepatocytes around the central veins were more heav-

ily stained by anti-FTL antibody in the treatment group than

those in the control group (Figure 3A). Some NPC were very

heavily stained in the treatment group (arrows in Figure 3B),

whereas such cells were not detected in the control group. To

identify FTL-positive NPC, expression of CD68, CD34, and

a-SMA, markers for Kupffer cells, endothelial, cells and stellate

cells, respectively, was examined in quasi-serial sections. The

expression pattern of CD68 (Figure 3D) was similar to FTL-

positive NPC in the treatment group, whereas those of CD34 and

a-SMA were not (Figures 3F and 3H). Kupffer cells and hepato-

cytes around the central veins were also stained with anti-ferritin

heavy chain antibody (Figure 3J).

To further examine the relationship between FTL-positive

NPC and Kupffer cells, two-color fluorescence analysis with the

respective antibodies was performed (Figure 4). Although the

distinction of FTL-positive hepatocytes and NPC was not clear

in the treatment group (Figure 4D), the merged image of FTL

and CD68 revealed FTL expression in some CD68-positive cells

FIGURE 2.—No alterations in FTL and IRP2 mRNAs in rat livers

treated with lead nitrate. Reverse transcriptase-polymerase chain reac-

tion (RT-PCR) of ferritin light-chain (FTL) (A) and iron-regulatory

protein (IRP)-2 (B) were performed as described in the text using

RNA isolated from control (lane 1) and lead nitrate–treated (lane 2)

rat livers. b-Actin mRNA was assayed to assess mRNA content (C).

RT-PCR products were subjected to electrophoresis in a 2% agarose

gel and visualized with ethidium bromide. Numbers on the right indi-

cate the size of the products in bp. Data are representative of four inde-

pendent experiments.

FIGURE 3.—Immunohistochemical staining for ferritin light-chain (FTL)

(A and B), CD68 (C and D), CD34 (E and F), a-SMA (G and H),

and FTH (I and J) in control (A, C, E, G, and I) and lead nitrate–treated

(B, D, F, H, and J) rat livers. Immunohistochemistry was performed

with the respective antibodies as described in the text. Original magni-

fication, 50X (A–J) and 400X (inserts in B, D, F, H, and J). CV, the cen-

tral vein; PP, the periportal area. Arrows in B indicate the FTL-positive

nonparenchymal cells. Bars in A and B, 200 mm in length; bar in the

insert in B, 25 mm.

212 FAN ET AL. TOXICOLOGIC PATHOLOGY

FIGURE 4.—Immunofluorescence staining of ferritin light-chain (FTL) and CD68 in control (A, C, and E) and lead nitrate–treated (B, D, and F) rat

livers. Immunofluorescence staining was performed as described in the text. The FTL-Alexa546 (red, A and B), CD68-Alexa488 (green, C and D),

and the merge (yellow, E and F) were visualized. Original magnification, 200X. Arrows in F indicate Kupffer cells positive for both FTL and

CD68. Bar in D, 50 mm.

Vol. 37, No. 2, 2009 FERRITIN IN KUPFFER CELLS 213

(Figure 4F) and identified some FTL-positive NPC as Kupffer

cells.

The distributions of CD68-positive cells and FTL-positive

Kupffer cells in areas around the central veins and in the peri-

portal areas were evaluated (Figure 5). In the control group, the

number of CD68-positive cells was higher in the periportal

areas than in areas around the central veins (p < .01), confirm-

ing the finding reported by Sleyster and Knook (1982). After

the lead nitrate treatment, CD68-positive cells were increased

in both areas (vs values in the control, p < .01), and the values

in the two areas were comparable. FTL-positive Kupffer cells

occupied about 60% of CD68-positive cells in both areas

(56.7% in the periportal areas and 60.9% in the perivenous

areas).

Induction of Apoptosis and Phagocytosis of Apoptotic

Cells

Some Kupffer cells engulfing apoptotic cells were positive

for FTL (Figure 5, Insert). Since Kupffer cells have phagocytic

activity (Yoshida et al. 2005), high FTL expression may be the

result of the engulfment of apoptotic cells. To examine this

possibility, first we performed the TUNEL assay to evaluate

apoptotic cells (Figures 6A and 6B). TUNEL-positive cells

were 2.5 + 1.4% of hepatocytes in the treatment group versus

0.31+0.31% in the control group (Figure 6E, p < .01).

Furthermore, expression of MFG-E8 was examined to investi-

gate phagocytic processes. Some Kupffer cells and hepatocytes

were positive for MFG-E8 in the treatment group (Figure 6D),

but were rarely stained in controls (Figure 6C). MFG-E8-

positive Kupffer cells were 18.4 + 7.1% of total Kupffer cells

in the treated livers versus 3.4 + 2.9% in control (Figure 6F,

p < .01). Among receptors for phagocytosis, mRNA levels for

PS receptor (Figure 7A), mannose receptor (Figure 7B), and

MFG-E8 (Figure 7C) were examined by RT-PCR. MFG-E8

mRNA was increased in the treatment group, whereas the oth-

ers were not changed. A protein pumping out iron, ferroportin,

plays a crucial role in macrophages and hepatocytes to decrease

the intracellular iron level (Nemeth et al. 2004), and their pro-

tein amount is regulated by hepcidin (Pigeon et al. 2001). To

examine whether enhanced FTL expression in Kupffer cells

and hepatocytes is a result of iron level alteration by lead

nitrate, ferroportin and hepcidin mRNAs were investigated

by RT-PCR; there were no differences between the two groups

(Figures 7D and 7E), suggesting no change in iron export.

Loss of FTL-Positive Kupffer Cells in Clofibrate-Treated

Rat Livers

To study the relationship between FTL-positive Kupffer

cells and apoptosis, the appearance of such cells was immuno-

histochemically examined in clofibrate-administered rat livers,

because the drug is known to induce hepatocyte proliferation

but not apoptotic changes (Columbano and Shinozuka 1996).

Although FTL expression was increased in hepatocytes around

the central veins, FTL-positive Kupffer cells were not detected

(Figure 8).

DISCUSSION

In the present study, FTL protein was increased in hepato-

cytes around the central veins and NPC after lead nitrate treat-

ment. Some FTL-positive NPC were identified as Kupffer cells

by two-color fluorescence analysis with anti-CD68 and anti-

FTL antibodies; FTL-positive Kupffer cells occupied about

60% of CD68-positive cells. Although CD68-positive cells

were detected, FTL-positive Kupffer cells were not detected

in controls, indicating that FTL is not expressed in Kupffer

cells under basal conditions. In normal rat livers, Kupffer cells

are more frequently distributed in the periportal areas than in

the perivenous areas, and the periportal Kupffer cells are larger

and have higher phagocytic activities than the perivenous

Kupffer cells, demonstrating the presence of two different

types of Kupffer cells (Sleyster and Knook 1982). In the pres-

ent study, CD68-positive cells were more prominently

increased after lead treatment in the perivenous areas than the

periportal areas. This finding supports the proliferation of

Kupffer cells by lead nitrate (Shinozuka et al. 1996) and also

suggests that the perivenous Kupffer cells may be more sensi-

tive to mitotic signals from the metal. Because FTL-positive

hepatocytes were located mainly in the perivenous areas, we

anticipated that FTL-positive Kupffer cells would be preferen-

tially distributed in the same areas. However, positive Kupffer

FIGURE 5.—Alterations in number of CD68- and ferritin light-chain

(FTL)–positive Kupffer cells by lead nitrate treatment. The numbers

of CD68-positive cells in control and lead nitrate-treated rat liver tis-

sues stained with anti-CD68 antibody were counted directly under a

microscope and expressed as cells per mm2 of the periportal areas

(PP) and areas around the central veins (CV) in liver sections (closed

bars). The numbers of FTL-positve Kupffer cells in the respective

areas of liver tissues stained with anti-FTL antibody were also counted

(open bars). Data are mean + SEM from at least four rats for each

group. In the control group, the value of CD68-positive cells in PP was

higher than that in CV (*, p < .01). The values of CD68-positive cells

and FTL-positve Kupffer cells in PP or CV after lead nitrate treatment

were significantly higher than those of control (*, p < .01). An inserted

figure indicates the engulfment of a hepatocyte (arrowhead) by FTL-

positive Kupffer cell (arrow), original magnification 400X.

214 FAN ET AL. TOXICOLOGIC PATHOLOGY

FIGURE 6.—Induction of apoptosis and phagocytosis of apoptotic cells by lead nitrate treatment. (A and B) TUNEL analysis of rat livers treated

with lead nitrate. Liver sections from control (A) and lead nitrate–treated (B) rats were assayed for cell death by nick-end labeling as described in

the text, and photographed under a microscope at 100X magnification. Arrows in the panel B indicate apoptotic TUNEL-positive cells, and an

insert is at a higher magnification (400X). (C and D) Immunohistochemical staining for milk fat globule EGF factor 8 (MFG-E8) in control (C)

and lead nitrate–treated (D) rat livers. Immunohistochemistry was performed as described in the text. Arrows in the panel D indicate MFG-

E8–positive Kupffer cells. An insert in D indicates engulfment of an apoptotic hepatocyte (arrowhead) by an MFG-E8–positive Kupffer cell

(arrow). Original magnification, 100X; insert, 400X. (E) The number of TUNEL-positive cells in control (open bar) and lead nitrate–treated rat

liver tissues (closed bar) expressed as percentages of hepatocytes. Data are mean + SEM from at least four rats for each group. The value in the

treatment group was significantly higher than that of the control (*, p < .01). (F) The number of MFG-E8–positive Kupffer cells in control (open

bar) and lead nitrate–treated rat liver tissues (closed bar) expressed as percentages of Kupffer cells. Data are mean + SEM from at least four rats

for each group. The value in the treatment group was significantly higher than that of control (*, p < .01).

Vol. 37, No. 2, 2009 FERRITIN IN KUPFFER CELLS 215

cells were evenly distributed between the periportal areas and

perivenous areas, which may reflect the even distribution of

TUNEL-positive cells in both areas (data not shown).

Both lead nitrate treatment and clofibrate administration

induced FTL expression in hepatocytes around the central

veins, whereas FTL-positive Kupffer cells were not induced

by clofibrate treatment. The staining intensity of hepatocytes

with anti-FTL antibody was much lower than that of Kupffer

cells, and FTL expression in hepatocytes may be dependent

on cell proliferation rather than apoptotic changes.

Although many hepatocytes become apoptotic after lead

treatment (Columbano et al. 1985), such apoptotic cells are rap-

idly engulfed by Kupffer cells, and their constituents are

promptly degraded (Dini et al. 2002). In fact, the number of

apoptotic cells detected by TUNEL assay was increased by

lead treatment, but the value is rather small and the number

of Kupffer cells actively engulfing apoptotic cells is also low.

MFG-E8 or mannose receptor is a marker for cells actively

engulfing apoptotic cells but not for cells that have engulfed

them. Phagocytosis of apoptotic cells containing iron will

result in high iron content and FTL expression in Kupffer cells,

when iron is not exported. We chose seventy-two hours as a

time for studying FTL expression, and there were no alterations

in ferroportin or hepcidin mRNA levels, suggesting that iron

export is not altered during the experiment period.

Kupffer cells are reported to engulf oxidatively damaged

erythrocytes (Otogawa et al. 2007). Because lead has a destabi-

lizing effect on erythrocyte membranes and induces hemolysis

by reactive oxygen species–generated lipid peroxidation (Law-

ton and Donaldson 1991), we also considered a possibility that

erythrophagocytosis by Kupffer cells may be involved in their

FTL expression. However, this is unlikely because blood hemo-

globin level was not decreased and the engulfment of erythro-

cytes was not demonstrated on immunohistochemistry with

anti-hemoglobin antibody (data not shown).

In conclusion, the results of the present study suggest that

FTL expression in Kupffer cells after lead treatment seemed

to be dependent on phagocytosis of apoptotic cells, and FTL

may be used as a marker for cells that have phagocytosed them.

FIGURE 7.—Enhanced expression of MFG-E8 mRNA in rat livers

treated with lead nitrate. RT-PCR of phosphatidylserine receptor

(A), mannose receptor (B), MFG-E8 (C), ferroportin (D), and hepcidin

(E) were performed using RNA isolated from control (lane 1) and lead

nitrate–treated (lane 2) rat livers as described in the text. b-Actin

mRNA was assayed to assess mRNA content (F). RT-PCR products

were subjected to electrophoresis and visualized as described in

Figure 2. Numbers on the right indicate the size of the products in

bp. Data are representative of four independent experiments.

FIGURE 8.—Immunohistochemical staining for FTL in control (A) and

clofibrate-treated (B) rat livers. Immunohistochemistry was performed

as described. Original magnification, 50X and 200X (insert in B). CV,

the central vein; PP, the periportal area. Bar in A, 200 mm; bar in insert

in B, 50 mm.

216 FAN ET AL. TOXICOLOGIC PATHOLOGY

ACKNOWLEDGMENTS

This study was supported in part by Research Fund from

Hirosaki University Graduate School of Medicine, the M. Endo

Memorial Grant, and Grants-in-Aid from the Food Safety

Commission of Japan.

REFERENCES

Cairo, G., Tacchini, L., Pogliaghi, G., Anzon, E., Tomasi, A., and Bernelli-

Zazzera, A. (1995). Induction of ferritin synthesis by oxidative stress.

Transcriptional and post-transcriptional regulation by expansion of the

‘‘free’’ iron pool. J Biol Chem 270, 700–3.

Callahan, M. K., Williamson, P., and Schlegel, R. A. (2000). Surface expres-

sion of phosphatidylserine on macrophages is required for phagocytosis

of apoptotic thymocytes. Cell Death Differ 7, 645–53.

Columbano, A., and Shinozuka, H. (1996). Liver regeneration versus direct

hyperplasia. FASEB J 10, 1118–28.

Columbano, A., Ledda, G. M., Sirigu, P., Perra, T., and Pani, P. (1983). Liver

cell proliferation induced by a single dose of lead nitrate. Am J Pathol

110, 83–88.

Columbano, A., Ledda-Columbano, G. M., Coni, P. P., Faa, G., Liguori, C.,

Santa Cruz, G., and Pani, P. (1985). Occurrence of cell death (apoptosis)

during the involution of liver hyperplasia. Lab Invest 52, 670–75.

Coni, P., Simbula, G., de Prati, A. C., Menegazzi, M., Suzuki, H., Sarma, D. S.,

Ledda-Columbano, G. M., and Columbano, A. (1993). Differences in the

steady-state level of c-fos, c-jun and c-myc messenger RNA during

mitogen-induced liver growth and compensatory regeneration. Hepatol-

ogy 17, 1109–16.

Cozzi, A., Levi, S., Corsi, B., Santambrogio, P., Campanella, A., Gerardi, G.,

and Arosio, P. (2003). Role of iron and ferritin in TNFalpha-induced

apoptosis in HeLa cells. FEBS Lett 537, 187–92.

Cozzi, A., Corsi, B., Levi, S., Santambrogio, P., Biasiotto, G., and Arosio, P.

(2004). Analysis of the biologic functions of H- and L-ferritins in HeLa

cells by transfection with siRNAs and cDNAs: evidence for a prolifera-

tive role of L-ferritin. Blood 103, 2377–83.

Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983). Accurate transcrip-

tion initiation by RNA polymerase II in a soluble extract from isolated

mammalian nuclei. Nucleic Acids Res 11, 1475–89.

Dini, L., Ruzittu, M. T., and Falasca, L. (1996). Recognition and phagocytosis

of apoptotic cells. Scanning Microsc 10, 239–51.

Dini, L., Pagliara, P., and Carla, E. C. (2002). Phagocytosis of apoptotic cells

by liver: a morphological study. Microscopic Res Techniq 57, 530–40.

Hanayama, R., Tanaka, M., Miyasaka, K., Aozasa, K., Uchiyama, Y., and

Nagata, S. (2004). Autoimmune disease and impaired uptake of apoptotic

cells in MFG-E8-deficient mice. Science 304, 1147–50.

Harrison, P. M., and Arosio, P. (1996). The ferritin: molecular properties, iron stor-

age function and cellular regulation. Biochim Biophys Acta 1275, 161–203.

Hsu, S., Raine, L., and Fanger, H. (1981). Use of avidin-biotin-peroxidase

complex (ABC) in immunoperoxidase techniques. J. Histochem Cyto-

chem 29, 577–80.

Ishikawa, H., Kato, M., Hori, H., Ishimori, K., Kirisato, T., Tokunaga, F., and

Iwai, K. (2005). Involvement of heme regulatory motif in heme-mediated

ubiquitination and degradation of IRP2. Mol Cell 19, 171–81.

Jover, R., Lindberg, R. L., and Meyer, U. A. (1996). Role of heme in cyto-

chrome P450 transcription and function in mice treated with lead acetate.

J Phamacol Exp Ther 50, 474–81.

Kikyo, N., Suda, M., Kikyo, N., Hagiwara, K., Yasukawa, K., Yazaki, Y., and

Okabe, T. (1994). Purification and characterization of a cell growth factor

from a human leukemia cell line: immunological identity with ferritin.

Cancer Res 54, 268–71.

Klausner, R. D., and Harford, J. B. (1989). Cis-trans models for post-

transcriptional gene regulation. Science 246, 870–72.

Konijn, A. M., Carmel, N., Levy, R., and Hershko, C. (1981). Ferritin synthesis in

inflammation. II. Mechanism of increased ferritin synthesis. Br J Haematol

49, 361–70.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of

the head of bacteriophage T4. Natrue 227, 680–85.

Lawton, L. J., and Donaldson, W. E. (1991). Lead-induced tissue fatty acid

alterations and lipid peroxidation. Biol Trace Elem Res 28, 83–97.

Leibold, E. A., and Munro, H. N. (1988). Cytoplasmic protein binds in vitro to a

highly conserved sequence in the 5’ untranslated region of ferritin heavy

and light-subunit mRNAs. Proc Natl Acad Sci USA 85, 2171–75.

Milosevic, N., and Maier, P. (2000). Lead stimulates intercellular signalling

between hepatocytes and Kupffer cells. Eur J Pharmacol 401, 317–28.

Moore, M. R., Goldberg, A., and Yeung-Laiwah, A. A. (1987). Lead effects on

the heme biosynthetic pathway. Relationship to toxicity. Ann N Y Acad Sci

514, 191–203.

Needleman, H. L., and Landrigan, P. J. (1981). The health effects of low level

exposure to lead. Annu Rev Public Health 2, 277–98.

Nemeth, E., Tuttle, M. S., Powelson, J., Vaughn, M. B., Donovan, A., Ward, D. M.,

Ganz, T., and Kaplan, J. (2004). Hepcidin regulates cellular iron efflux by

binding to ferroportin and inducing its internalization. Science 306, 2090–93.

Ookawa, K., Kudo, T., Aizawa, S., Saito, H., and Tsuchida, S. (2002).

Transcriptional activation of the MUC2 gene by p53. J Biol Chem 277,

48270–75.

Otogawa, K., Kinoshita, K., Fujii, H., Sakabe, M., Shiga, R., Nakatani, K.,

Ikeda, K., Nakajima, Y., Ikura, Y., Ueda, M., Arakawa, T., Hato, F., and

Kawada, N. (2007). Erythrophagocytosis by liver macrophages (Kupffer

cells) promotes oxidative stress, inflammation, and fibrosis in a rabbit

model of steatohepatitis: implications for the pathogenesis of human non-

alcoholic steatohepatitis. Am J Pathol 170, 967–80.

Pagliara, P., Carla, E. C, Caforio, S., Chionna, A., Massa, S., Abbro, L., and

Dini, L. (2003). Kupffer cells promote lead nitrate-induced hepatocyte

apoptosis via oxidative stress. Comp Hepatol 2, 8.

Pigeon, C., Ilyin, G., Courselaud, B., Leroyer, P., Turlin, B., Brissot, P., and

Loreal, O. (2001). A new mouse liver-specific gene, encoding a protein

homologous to human antimicrobial peptide hepcidin, is overexpressed

during iron overload. J Biol Chem 276, 7811–19.

Roomi, M. W., Columbano, A., Ledda-Columbano, G. M., and Sarma, D. S. R.

(1986). Lead nitrate induces certain biochemical properties characteristic

of hepatocyte nodules. Carcinogenesis 7, 1643–46.

Ruzittu, M., Carla, E. C., Montinari, M. R., Maietta, G., and Dini, L. (1999).

Modulation of cell surface expression of liver carbohydrate receptors dur-

ing in vivo induction of apoptosis with lead nitrate. Cell Tissue Res 298,

105–12.

Satoh, K., Kitahara, A., and Sato, K. (1985). Identification of heterogeneous

and microheterogeneous subunits of glutathione S-transferase in rat liver

cytosol. Arch Biochem Biophys 242, 104–11.

Savill, J., Fadok, V., Henson, P., and Haslett, C. (1993). Phagocyte recognition

of cells undergoing apoptosis. Immunol Today 14, 131–36.

Shinozuka, H., Ohmura, T., Katyal, S. L., Zedda, A. I., Ledda-Columbano, G.

M., and Columbano, A. (1996). Possible roles of nonparenchymal cells in

hepatocyte proliferation induced by lead nitrate and by tumor necrosis

factor alpha. Hepatology 23, 1572–77.

Sleyster, E., and Knook, D. L. (1982). Relation between localization and func-

tion of rat liver Kupffer cells. Lab Invest 47, 484–90.

Towbin, H., Staehelin, T., and Gordon, J. (1979). Electrophoretic transfer of

proteins from polyacrylamide gels to nitrocellulose sheets: procedure and

some applications. Proc Natl Acad Sci USA 76, 4350–54.

Waddell, B. J., Hesheh, S., Dharmarajan, A. M., and Burton, P. J. (2000).

Apoptosis in rat placenta is zone-dependent and stimulated by glucocor-

ticoids. Biol Reprod 63, 1913–17.

Yoshida, H., Kawane, K., Koike, M., Mori, Y., Uchiyama, Y., and Nagata, S.

(2005). Phosphatidylserine-dependent engulfment by macrophages of

nuclei from erythroid precursor cells. Nature 437, 754–58.

Vol. 37, No. 2, 2009 FERRITIN IN KUPFFER CELLS 217