lable at ScienceDirect

Plant Physiology and Biochemistry 48 (2010) 426e433

Contents lists avai

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

Expression profiling of various genes during the fruit developmentand ripening of mango

Sagar S. Pandit a,1, Ram S. Kulkarni a, Ashok P. Giri a, Tobias G. Köllner b, Jörg Degenhardt b,Jonathan Gershenzon b, Vidya S. Gupta a,*

a Plant Molecular Biology Unit, Division of Biochemical Sciences, National Chemical Laboratory, Pune 411008, IndiabDepartment of Biochemistry, Max Planck Institute for Chemical Ecology, Jena, Germany

a r t i c l e i n f o

Article history:Received 6 January 2010Accepted 20 February 2010Available online 1 March 2010

Keywords:Mangifera indicaStress responseTerpene metabolismTranscriptome analysis

Abbreviations: CysPI, cysteine protease inhibitor;DAP, days after pollination; EF1, Elongation factor 1tags; ERF, ethylene-response factor; FPP, farnesyl pypyrophosphate synthase; GGPP, geranylgeranyl panylgeranyl pyrophosphate synthase; GLVs, greenpyrophosphate; GPPS, geranyl pyrophosphate synthIPP, isopentenyl pyrophosphate; IPPI, isopentenyl pyroisochorismate hydrolase; LOX, lipoxygenase; MDHARbate reductase; MeTr, methyltransferase; MT, metallosynthase; sHSP, small heat shock protein; SqTPS, sesubiquitin-protein ligase.* Corresponding author. Tel.: þ91 20 25902247; fax

E-mail addresses: vs.gupta@ncl.res.in, vidyagene@1 Present address: Department of Molecular Ecolo

Chemical Ecology, Jena, Germany.

0981-9428/$ e see front matter � 2010 Elsevier Masdoi:10.1016/j.plaphy.2010.02.012

a b s t r a c t

Mango (Mangifera indica L. cv. Alphonso) development and ripening are the programmed processes;conventional indices and volatile markers help to determine agronomically important stages of fruit life(fruit-setting, harvesting maturity and ripening climacteric). However, more and precise markers arerequired to understand this programming; apparently, fruit's transcriptome can be a good source of suchmarkers. Therefore, we isolated 18 genes related to the physiology and biochemistry of the fruit andprofiled their expression in developing and ripening fruits, flowers and leaves of mango using relativequantitation PCR . In most of the tissues, genes related to primary metabolism, abiotic stress, ethyleneresponse and protein turnover showed high expression as compared to that of the genes related to flavorproduction. Metallothionin and/or ethylene-response transcription factor showed highest level of tran-script abundance in all the tissues. Expressions of mono- and sesquiterpene synthases and 14e3e3lowered during ripening; whereas, that of lipoxygenase, ethylene-response factor and ubiquitin-proteinligase increased during ripening. Based on these expression profiles, flower showed better positivecorrelation with developing and ripening fruits than leaf. Most of the genes showed their leastexpression on the second day of harvest, suggesting that harvesting signals significantly affect the fruitmetabolism. Important stages in the fruit life were clearly indicated by the significant changes in theexpression levels of various genes. These indications complemented those from the previous analyses offruit development, ripening and volatile emission, revealing the harmony between physiological,biochemical and molecular activities of the fruit.

� 2010 Elsevier Masson SAS. All rights reserved.

1. Introduction

Fruit development and ripening are genetically as well as bio-chemically and physiologically programmed processes. During the

DAH, days after harvesting;a; ESTs, expressed sequencerophosphate; FPPS, farnesylyrophosphate; GGPPS, ger-leaf volatiles; GPP, geranylase; GT, glucosyltransferase;phosphate isomerase; IsoCH,, monodehydrogenase ascor-thionin; MTPS, monoterpenequiterpene synthase; UbqPL,

: þ91 20 25902648.gmail.com (V.S. Gupta).gy, Max Planck Institute for

son SAS. All rights reserved.

development, fruit acts as a sink and grows by accumulating the in-flown material, while ripening is characterized by textural andrheological changes. Cell expansion and softening by cell-wallsolubilization, dismantling of the photosynthetic apparatus,degradation of starch and chlorophyll and respiratory and/orethylene-climacteric are some of the major events of the ripeningprocess [39].

These maturation and ripening events have been probed usinga handful of genes, picked either using differential expressionstudies or by mining the expressed sequence tags (ESTs). Suchwork is known from several fruits like strawberry [2], melons [22],pineapple [21], and banana [18]. From these attempts, we under-stand that most of the physiological processes involved in devel-opment and ripening of the fruit are specific to this propagulecarrying organ. However, fruit's transcriptome reveals the expres-sion of only few organ specific genes. Instead of using completelynew set of genes, fruits express the usual plant transcriptome withtheir own reorganizations in the expression cascades [2]. Theseobservations are valid for both, climacteric and non-climacteric

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433 427

fruits. Roles of several such plant genes have been justified in viewof fruit physiology, whereas for many they still remain to beunderstood.

Among the tropical fruits, mango (Mangifera indica L., Ana-cardiaceae), is the most popular one and Alphonso is its mostfavorite cultivar; it is also the most exported mango cultivar ofIndia. It has gained a worldwide popularity [33] because of itsdelightful flavor, attractive color, ample, sweet, low fiber containingpulp and long shelf life. In spite of possessing so many virtues, it isonerous for farmers due to its erratic and shy bearing, cultivationlocality dependent and environment-governed variation in thefruit quality, susceptibility to fungal pathogens and insect pests,and physiological disorders like spongy tissue [33,36]. To under-stand the basis of such demerits, first of all the knowledge ofbiochemistry and molecular biology of fundamental metabolicprocesses underlying the development and ripening of mango isnecessary andmost importantly, the markers for the determinationof important development and ripening stages such as harvestingmaturity, exact ripeness are required. We initiated a program togenerate this knowledge and in this direction, earlier we reportedthe chemistry of these processes and demonstrated that the vola-tile profiles vary remarkably through the fruit life; in fact, volatileswere proposed to be the useful indicators of development andripening [26]. A step further, in the present work we hypothesizedthat the dynamic biochemistry of these fundamental processes offruit is the function of transcriptomic changes and expression levelsof various genes can also be the indicators of the advancement ofthese processes.

It is known that terpenoids are the dominant compoundsthroughout the life of mango fruit [26,29,25]. More importantly,they also display dynamic qualitative as well as quantitativechanges along with the progress of development and ripening [26].Therefore, we selected to analyze the transcriptional dynamicsof the terpene metabolism related genes in the present work.Glucosyltransferase (GT) and isochorismate hydrolase (IsoCH)genes, which are responsible for the furthermodification of terpeneproducts was considered along with the terpene biosynthesispathway related genes. Secondly, in our pilot experiments fortracking the transcriptomic changes by differential display RT-PCR(DDRT-PCR) [17], we found that the abundance of several tran-scripts sharply varied between the early and late ripening stages(data not shown); earlier based on their volatile emissions, thesestages were reported to be the critical ones for the determination offruit quality [26]. These transcripts corresponded to numerous andfunctionally diverse genes that have never been reported frommango. However, these genes were often reported in the tran-scriptomic analyses of several fruits [2]. This prompted us to test iftheir expression profiles correlate with each other and, whether allof them indicate the important stages of mango development andripening. These genes involved monodehydrogenase ascorbatereductase (MDHAR) that helps to maintain the antioxidanthomeostasis during the rapid cellular activities in the fruit. Amongthe abiotic stress related genes, metallothionin (MT) and 14e3e3were the multifunctional, signal transduction related genes,whereas methyltransferase (MeTr) and low molecular weight/small heat shock protein (sHSP) were the ones involved in themanagement of temperature stress. Lipoxygenase (LOX), chitinaseand cysteine protease inhibitor (CysPI) genes were the contributorsof biotic stress management. A transcription factor involved inethylene response (ERF) and a ubiquitin-protein ligase (UbqPL) thatmanages the protein turnover were also profiled.

Consequently, we studied the temporal (during the develop-ment and ripening of fruit) dynamics of expression of these 18assorted genes in Alphonso. Our earlier work also unveiled a posi-tive correlation between the volatile profiles of developing and

ripening fruits to those of leaf and flower [26]. There is no furtherinformation available on this phenomenon in mango; therefore, tofind whether such correlation also exists between the patterns ofgene expression in these tissues, we opted to analyze the spatial(in leaf, flower and fruit) regulation of the expression of thesegenes. To elucidate the expression profiles of these genes andestablish the comparisons between different tissues, we appliedthe principle of relative quantitation of transcripts [26].

2. Results and discussion

Fruits are fathomed mainly by their flavor and color. Flavor, thecombination of aroma, taste and texture [32], is an importantcriterion in deciding the market value of any fruit, when differentvarieties or cultivars are available for comparison. Often, volatilescomprise the major part of flavor and impart the distinguishablecharacters to it. Mango presents a unique example, where eachcultivar shows high odorant diversity; in addition, the concentra-tions of these compounds have been found quite high [29,25]. Itprompts us to presume that the significant part of the transcrip-tional machinery is involved in the aroma synthesis process.

Having known that these flavor volatiles are the productsof expansive metabolic networks, the involvement of primarymetabolism related genes in controlling the flavor quality isobvious. It reflects that genes related to the physiology of devel-opment and ripening would play a vital role in the determination offruit and flavor quality. This fact has already been enlightened byHofman et al. [11], who showed that the changes in preharvestenvironment brought about remarkable variations in differentqualities of ripe mangos. Under such circumstances, the analysis ofgene expression to understand the transcriptional dynamicsthrough the development and ripening of mango would be an idealapproach. Therefore, present work explores several flavor relatedgenes along with few associated to the physiology of developingand ripening fruits.

2.1. Sequence confirmation and annotation

Sequences of all the cDNA fragments mentioned here (Table 1)could be translated in silico, for uninterrupted amino acidstretches. These sequences were deposited to NCBI, and theiraccession numbers along with the results of BLAST search areshown in Table 1. Amplicons annotated as mitochondrial sHSP andMT turned out to be the complete open reading frames of theirrespective genes. Ribosomal MeTr, geranyl pyrophosphate synthase(GPPS) and sesquiterpene synthase (SqTPS) fragments representedthe 30 ends of their respective transcripts.

2.2. Relative quantitation of transcripts

2.2.1. Internal standardBy 20, 25, 30 as well as 35 cycle PCR, elongation factor 1a gene

expression was found to be uniform through all the tissues itendorsed the equality of initial RNA template as well as that of thefirst strand cDNA for the further analysis.

2.2.2. Terpene metabolismIn Alphonso, terpenoid biosynthesismust be a busy path asmore

than 90% of total aroma compounds in fresh fruit pulp are mono-and sesquiterpene hydrocarbons [25]; color conferring carotenoidsand sterols too are the products of this pathway. Isopentenylpyrophosphate isomerase (IPPI) marks the key point in thispathway. Cytosolic as well as plastidic isoprenoid biosynthesis hasisopentenyl pyrophosphate (IPP) as a common and exchangeableprecursor. Monoterpenes (C10), sesquiterpenes (C15), diterpenes

Table 1Details of primers, annotation, and BLAST analysis for 19 different cDNA fragments that were profiled for expression through 12 mango tissues (leaf, flower, developing and ripening fruits of Alphonso mango).

Accessionno.

Annotation Acronym Primer sequence (50e30)(forward and reverse)

Annealing(�C)

Cycleno.

cDNAfragmentsize (bp)

Blast hit Functionalclass

SignificanceE score(Nucleotide)

Nucleotide %similarity

SignificanceE score(amino acid)

Aminoacid %match

EU513264 Isopentenylpyrophosphate isomerase

IPPI CTCATCGAGGAGGATGCTCTTGGGTTGTAGAGAATCCGACCGAGTGGG

70 30 125 Isopentenyl pyrophosphateisomerase (IPI2)

Terpenebiosynthesis

1e�31 88 2e�15 95100

EU513265 Geranyl pyrophosphatesynthase

GPPS TCTTGTTACGGGTGAAACCATGTTATTTGGTTCTTGTGATGACTC

58 35 554 Geranyl pyrophosphatesynthase

Terpenebiosynthesis

3e�161 83 2e�57 8391

EU513266 Monoterpene synthase MTPS GGTGTGTTGAAAAAGTTCAAGGACACGACTGGAAGATTCATTGCGTGCTTCACTTGC

70 35 224 Monoterpene cyclase Terpenebiosynthesis

1e�08 78 4e�08 5081

EU513267 Geranylgeranylpyrophosphate synthase

GGPPS TCGAGATGATTCACACCATGTCTATGGAATATAATTCAGCCAGAG

58 35 661 Geranylgeranylpyrophosphate synthase

Terpenebiosynthesis

1e�122 75 8e�79 8893

EU513268 Farnesyl pyrophosphatesynthase

FPPS AGTATTCATTGCCACTTCATTGCCAGAACACAGGCTGGATCTGCTTTCCC

68 30 331 Farnesyl pyrophosphatesynthase

Terpenebiosynthesis

1e�94 88 1e�44 8094

EU513269 Sesquiterpene synthase SqTPS GGCAAATCAAGGAAAATTATATCGTCTTGTCAGAGCTGTACGGAGTCTCTGAGCAATG

67 35 580 Sesquiterpene cyclase Terpenebiosynthesis

2e�43 69 1e�25 4059

EU513270 Isochorismate hydrolase IsoCH ATGAGATCCGAAAGAGAAACCCAGATCCTTTCACAGTCAACCAAGTAAGCAAACCC

70 30 540 Isochorismatase hydrolasefamily protein

Benzenoidmetabolism

6e�69 71 2e�71 7184

EU513271 Glucosyl transferase GT AATGGAGTCCGCAAGAGAAAGTTTTGGACCTCATCTACAAACTCTTGAATGTTCC

70 30 373 UDP-glucosyl transferase multifunction 7e�79 78 3e�57 8389

EU513272 Lipoxygenase LOX GACTATCCATATGCTGTGGATGGGGGTATTGGCCAAAGTTAACTGC

56 35 278 Lipoxygenase-1 Aldehydebiosynthesis

1e�79 74 7e�47 8595

EU513274 Monodehydrogenaseascorbate reductase

MDHAR GCTGCTTTCTATGAGGGTTATTATGCAACATCTCCCACAGCATAAACATCAGG

64 30 273 Cytosolicmonodehydroascorbatereductase

Stress response 2e�91 87 1e�37 9296

EU513275 14e3e3 14e3e3 ATGGCTTCCACTCCTTCAGCTCGCGAGGCTGCTGTTCACTGTCAGGCTTGGTGGC

71.5 30 783 14e3e3 protein Stress response 0.0 81 1e�114 9295

EU513276 Metallothionein MT ATGTCTTCTGGTTGTAACTGTGTCACTTGCCACATTTGCAGGGG

57 30 225 Metallothionein 1a Stress response 7e�19 71 3e�08 6476

EU513277 Methyltransferase MeTr TTCCGTGATACTCTCAGATATGTGTCCATCTTGACAAATTAAATAAATCTCTCTGG

62 35 346 FtsJ-like methyltransferasefamily protein

Stress response 3e�26 86 9e�36 7180

EU513278 Small heat shockprotein

sHSP GACCTCAGCCTCTCGCTTCTTCAACACCTCAATTTTTACCTGGAACACGTCACTCC

70.7 30 525 Mitochondrion-localizedsmall heat shock protein23.6

Stress response 1e�64 71 2e�46 6476

EU513279 Chitinase Chitinase ATGTCCCAAAACTGTGACTGTGCTCCCAATTTCTGGCAATAATCAGTGTAATAACC

67 35 722 Chitinase CHI1 Stress response 1e�136 79 1e�84 7985

EU513280 Cysteine proteinaseinhibitor

CysPI GTTGTGAAGGCGAAGCGGCAGGTGGCTAAGCAGAAGCAGCATCAAGAACC

68 30 168 Cysteine proteinaseinhibitor

Stress response 4e�26 77 5e�12 7085

EU513281 Ethylene-responsefactor

ERF AGATGTTGCAACCAAAGAAGCCGCCAGAGTAAGAGGTGATCACGATCAATATTCTGC

68.3 30 445 AP2/EREBP transcriptionfactor ERF-2

Ethylene-response

1e�13 82 8e�22 5063

EU513282 Ubiquitin-proteinligase

UbqPL ATGTAGCAGCCATTGAGGCTCTGGTTCGGTTCACTATGTCAACTTTCGCCTCTTGG

70 30 620 E3 ubiquitin ligase PUB.Armadillo/ U-boxdomain-containing protein

Proteinturnover

4e�97 73 4e�75 7689

EU513283 Elongation factor1-alpha

EF1 AATACGACTCACTATAGGGCAAGCAGATACGACTCACTATAGGGCTCCTTCTC

70 30 and 35 132 Elongation factor 1-alpha Proteinsynthesis

1e�50 94 1e�18 100100

S.S.Panditet

al./Plant

Physiologyand

Biochemistry

48(2010)

426e433

428

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433 429

(C20), triterpenes (C30) and polyterpenes (Cn) are the customaryproducts of this isoprenoid metabolism. These types subsume thevolatile terpenes, pigments like carotene, photosynthetic compo-nent phytol, nutritional elements like vitamin A, D, K, and otherterpene derivatives. To ensure the production of such a diverse arrayof compounds to the required scale, plants must keep their IPPreservoir filled. High expression of IPPI gene (detectable in 30cycles) throughout the development and ripening of mango sup-ported this hypothesis of reservoir; inflowers,wheremajority of IPPpool was supposed to be reserved for the production of fragrancecompounds, IPPI transcript abundance was found at peak (Fig. 1A).

In fruit too, the most relevant fate of IPP would be in theproduction of terpene volatiles, especially monoterpenes, which

Fig. 1. Expression dynamics of 18 genes (A: IPPI, isopentenyl pyrophosphate isomerase; Bgeranylgeranyl pyrophosphate synthase; E: FPPS, farnesyl pyrophosphate synthase; F: SqTferase; I: LOX, lipoxygenase; J: MDHAR, monodehydrogenase ascorbate reductase; K: 14eprotein; O: Chitinase; P: CysPI, cysteine proteinase inhibitor; Q: ERF, ethylene-response faflower, developing and ripening fruits) as revealed by the relative quantitation PCR. Notablethe harvesting maturity (90DAP) and/ or the perfect ripe stage (15DAH) of Alphonso fruit. Tby a trend line. Amplicon concentrations expressed in ng/20 mL reaction, on Y-axis. Bars wi

have already been found to flood the (Alphonso) mango blend[25]. However, we found that MTPS transcript levels dropped inthe ripening phase (Fig. 1C). This fall in expression could beprimarily attributed to the degradation of plastids during fruitripening, as monoterpenes are mainly synthesized in chloroplasts.Considering this, they are entitled to diminish from the blend ofripe fruit; nevertheless, several fruits have evolved their ownmolecular means to retain these compounds as their majorflavorants. In cultivated strawberry, Aharoni et al. [1] explainedthis phenomenon, wherein the cytosolic sesquiterpene synthaseadopted GPP as an additional substrate to produce monoterpenealong with sesquiterpene, in the cytosol. It has also been demon-strated that chromoplasts synthesize and retain monoterpenes in

: GPPS, geranyl pyrophosphate synthase; C: MTPS, monoterpene synthase; D: GGPPS,PS, sesquiterpene synthase; G: IsoCH, isochorismate hydrolase; H: GT, glucosyl trans-3e3; L: MT, metallothionein; M: MeTr, methyltransferase; N: sHSP, small heat shockctor; R: UbqPL, ubiquitin-protein ligase) through 12 tissues of Alphonso mango (leaf,changes in the transcript levels of MTPS, FPPS, GT, LOX, MeTr, sHSP and UbqPL indicatehe peak expression levels of consecutive developing and ripening stages are connectedth the same alphabets are not significantly different from each other at p� 0.05.

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433430

the chloroplast-lacking tissues, especially by using the non-mevalonate pathway [19]. This is very much relevant in theripening fruits, where chromoplasts take over upon the degrada-tion of chloroplasts [28]. Concept of cellular compartmentalizationhas been further obscured, as the contribution of plastidic pathwayto the formation of sesquiterpene, nerolidol was discovered andwas strongly supported by the cross talk that was detectedbetween the cytosolic and plastidic pathways [9]. With the given,high diversity of monoterpenes in Alphonso and other cultivars,mango will be an interesting system to study such mechanisms forthe biosynthesis of these compounds.

Terpene biosynthesis pathway is also involved in the synthesisof ubiquinone (the essential component of electron transportchain) [35], vital pigments like chlorophylls and carotenoids,translation regulating geranyl geranylated proteins (Rho, Rac, Rabetc.) and hormones like gibberellins [4]. Geranylgeranyl pyro-phosphate (GGPP), the precursor in the synthesis of all thesecomponents is generated by GGPPS that catalyses the condensationof three IPP and one dimethylallyl pyrophosphate (DMAPP) units.We found that GGPPS levels were maintained throughout the fruitlife, probably for the regular supply of this vital precursor; however,external stimuli such as harvesting were found to lower thisexpression (Fig. 1D).

When further tracked this GGPP route towards ubiquinonebiosynthesis, we found that IsoCH transcription was down-regulated during ripening (Fig.1G). This enzyme is also known to beinvolved in the metabolism of various cofactors, vitamins andother secondary (volatile) metabolites such as benzenoids [7]. Highexpression of this gene in developing fruits suggests its importantrole at this stage.

Terpenes also contribute to the taste and retronasal flavor byundergoing glucosylations and hydroxylations. Glucosylation ofterpenes is catalyzed by glucosyltransferase (GT) enzymes [31].Glucosylation affects organoleptic properties of the compounds,enhances their solubility, stabilizes the volatiles, assigns substancesfor further esterification and also helps different compounds tomaintain homeostasis [3]. Most of the functions of GTs are relevantand important for the fruit. GT cDNA isolated from mango showedhigh expression (Fig. 1H) in terpene dominant phases of the fruitlife [26]. Moreover based on BLAST analysis, it resembled UDP-glucose:cinnamate glucosyltransferase from Fragaria� ananassaand limonoid UDP glucosyltransferase from Citrus unshiu suggest-ing its role in the formation of terpene derivatives.

2.2.3. Genes related to the dynamic environment of fruit2.2.3.1. MDHAR, the gene related to the nutritional quality offruit. Along with flavor and taste, nutritional qualities of fruit alsoinfluence its market success. Antioxidant levels have always beenan important measure of fruit's nutritional quality [12]. MDHAR isan important antioxidant enzyme possessed by the fruits. It isinvolved in the recycling of antioxidative ascorbate radicals to copeup with the frequent oxidative spurts during the development andripening of fruit [13]. High MDHAR transcript levels point towardsimportant role of this gene in mango fruit. As the appropriateharvesting maturity directly affects the quality of ripe fruit,expression shoot up observed at the fruit maturity was an impor-tant finding (Fig. 1J).

2.2.3.2. Multifunctional genes. By and large, the fruit research hasbeen focused on the improvement of organoleptic values of thefruit and mechanism of ethylene- induced climacteric. Recentstudies that generated comprehensive EST collections, addedsignificant amount of information about the rest of fruit physiology.In these as well as in other exploratory exercises, the members ofplant's stress responsive arsenal were frequently observed to be

employed for the fruit metabolism [2,21]. Though for fruit, ‘stress’ isprobably not the appropriate term, the role of such genes seems tobe pivotal. Most probable rationalization for this fact can be soughtthrough the multifunctionality and familial nature of such genes[31]. Unlikeness in the physiology of fruit and other plant organs, aswell as the small share of plant life that is assigned for fruiting (inmost of the plants) also explain this involvement of multifunc-tional, stress responsive genes; through such genes, it is probablythe economy of transcriptome size and other cellular resources thatthe plants try to adopt and maintain.

14e3e3 domain proteins provide the best example. 14e3e3family proteins are known to be involved in protein-protein inter-actions and signaling pathways where they perform multitude offunctions as activators, repressors, chaperons and adaptors [24].With these myriad functions, these proteins are obviously thehandiest tools for stress management. Indeed, in plants as well as inanimals they are the prime isolates of the stressed tissues [30].These proteins have also been isolated from various fruits liketomato [16], strawberry [2] etc. Though their role in fruit is unclear,their differential expression has been noted during the develop-ment and ripening of the fruit [30]. The form of 14e3e3 isolatedfrom Alphonso fruit appears to be involved more in floral activities,fruit-set and early development, when the cellular activities remainaccelerated (Fig. 1K). It suggests a specialized role of this gene inmango as it was detected within 30 cycles of PCR in all the sampledtissues.

Similar to 14e3e3, MTs form another group of composite-crisismanagers. Elementary function of MTs is metal homeostasis;nonetheless, they operate during almost all biotic as well as abioticstress conditions [20]. Such a pronounced expression enforces theircategorization as stress response genes. However, these genes arealso associated with the ethylene response and fruit ripening [6].Transcript abundance of this gene was the highest among all thegenes profiled in the current set of mango tissues (Fig. 1L). Sucha high expression of MT has always been found associated withfruit life irrespective of the climacteric (banana [6]) or non-climacteric (grape [8], pineapple [21]) nature of the fruit, where itwas considered to be involved in the homeostasis of metalliccofactors, required by the variety of enzymes. In pineapple, itsexpression was correlated with the high oxidative environment[21]. This can also be a putative role for MTs in several other fruitsincluding mango, as these ripening fruits often produce highamount of active oxygen species [12]. Secondly, the expressionprofiles indicated important role of this gene in ripening.

Another stress related candidate isolated from Alphonso fruitwas the ribosomal methyltransferase (MeTr) (Table 1). This enzymeis known to methylate the ribosomal 50s subunit upon heat shockas a signal to halt the protein synthesis; it uses S-adenosyl methi-onine (SAM) as a cofactor. It has been characterized mainly frombacteria; however, it is reported to be conserved from bacteria tohumans [5]. Recently, EST database constructions have reportedsimilar sequences in Arabidopsis, rice and grapevine; nonetheless, itis yet to be characterized in these plants. Upregulation of this genein ripe fruits pointed its role in the thermal elevation at ripening, asan outcome of the climacteric (Fig. 1M). Thus, MeTr appeared to bea part of climacteric. Based on these results, we propose its utility asa marker of ripeness.

A gene for mitochondrial small heat shock protein (sHSP) or lowmolecular weight heat shock protein (LMWHSP) was also analyzedin the present experiment (Table 1). This mango sHSP belonged tothe group of 22/23 kD sHSPs as suggested by the BLAST analysis.Upon heat shock, these type of HSPs (17e30 kD) are reported toprotect respiratory polypeptides from degradation by chaperonicaction [38]. As fruits develop hyperthermia during developmentand (especially) ripening, proteins of such class seem to be the

Table 2Correlations between Alphonso leaf, flower and developing and ripening fruits,based on expression profiles of A) terpenoid metabolism related genes (IPPI, GPPS,MTPS, GGPPS, FPPS, SqTPS, IsoCH and GT), B) genes other than the ones involved interpenoid metabolism (MDHAR, 14e3e3, MT, MeTr, sHSP, CysPI, Chitinase, LOX, ERF,UbqPL) and C] all these 18 genes. Significance tested at the level of p� 0.05. NSh notsignificant at p� 0.05 level; CysPIh cysteine protease inhibitor; ERFh ethylene-response factor; FPPSh farnesyl pyrophosphate synthase; GGPPSh geranylgeranylpyrophosphate synthase; GPPSh geranyl pyrophosphate synthase; GThglucosyl-transferase; IPPIh isopentenyl pyrophosphate isomerase; IsoCHh isochorismatehydrolase; LOXh lipoxygenase; MDHARhmonodehydrogenase ascorbate reduc-tase; MeTrhmethyltransferase; MThmetallothionin; MTPShmonoterpene syn-thase; sHSPh small heat shock protein; SqTPSh sesquiterpene synthase;UbqPLh ubiquitin-protein ligase.

A B C

Leaf Flower Leaf Flower Leaf Flower

Flower 0.49NS e 0.97 e 0.97 e

5DAP 0.22NS 0.28NS 0.95 0.99 0.95 0.9915DAP 0.58NS 0.86 0.68 0.83 0.70 0.8530DAP 0.58NS 0.90 0.72 0.87 0.75 0.8860DAP 0.70NS 0.83 0.82 0.93 0.84 0.9490DAP 0.38NS 0.86 0.64 0.80 0.67 0.822DAH 0.59NS 0.80 0.57NS 0.75 0.60 0.775DAH 0.12NS 0.85 0.63NS 0.80 0.66 0.8110DAH 0.10NS 0.76 0.88 0.97 0.89 0.9715DAH 0.26NS 0.68NS 0.82 0.93 0.84 0.9420DAH 0.25NS 0.82 0.75 0.88 0.77 0.89

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433 431

handiest tools to cope with the situation. Apparently, MeTr class ofHSPs marked ripening phase with the rise in expression (Fig. 1M),whereas sHSP expression peak marked the maturity (90DAP)(Fig. 1N). It reflects that in fruit, roles of these two genes differtemporally.

Chitinases form an interesting class of enzymes in plants, asthese are the common isolates of plant tissues even though plantsdo not produce chitins. Conventionally, these enzymes are knownas pathogenesis- related (PR) proteins that are induced upon bioticas well as abiotic stress. To catalyze the hydrolysis of polymericchitin from the fungal cell wall and help plants defending againstthem is their well-characterized role [10]. Some of their forms arealso known to facilitate the processes like somatic embryogenesis[40]. In addition, their induction upon the administration ofjasmonic as well as salicylic acid and their lysozyme-like activityare reported [40]. However, their proposed hydrolytic action onN-acetylglucosamine-containing glycoproteins of the plant cellwalls and ethylene responsive induction appear to be the mostrelevant roles [14]; in congruence with the ripening relatedexpression rise observed in mango, this function can be postulatedto facilitate the fruit softening during the process of ripening,probably as a consequence of ethylene-climacteric.

Lipoxygenase (LOX) is another enzyme that is thought to reducefruit firmness during ripening [34]. It oxidizes the membrane-released polyunsaturated fatty acids and produces hydroperoxides.This oxidative action often generates free radicals, which aredeleterious for the cell membrane integrity. This activity whencoupled with ripening is thought to contribute to the softening offruit [34]. Fatty acid hydroperoxides are also converted to green leafvolatiles (GLVs), jasmonates and/ or divinyl ether fatty acids. C6 andC9 GLVs (aldehydes, alcohols and esters) are formed after the actionof P450 enzymes like hydroperoxide lyases on LOX products. GLVsimpart green smell to the fruits, so make the important compo-nents of fruit aroma. Ripening induced expression of mango LOXgene was in support of these roles and indicated an importantcontribution of LOX pathway in the ripening of mango (Fig. 1I).

2.2.3.3. Ethylene response. Aharoni and O'Connell [2] isolateda plant specific transcription activation factor associated withethylene and abscisic acid response (ERF) from strawberry andsuggested its involvement in late achene development, theethylene responsive phase. High expression of this gene suggestedthat it is one of the key transcription factors involved in multitudeof activities (Fig. 1Q).

2.2.3.4. Protein turnover. Proteins involved in almost all cellularactivities are a subject of regulation by ubiquitin pathway [37].Ubiquitination system includes three main steps, ubiquitin activa-tion by ubiquitin-activating enzyme (E1), binding of this complexto ubiquitin-conjugating enzyme (E2), and coupling of this complexto the target protein by ubiquitin-protein ligase (E3) (UbqPL). Formost of the proteins, such assembly results in proteolytic degra-dation to end their role in the cellular processes. Thus in a broadersense, expression rise of ubiquitin pathway genes usually indicatesthe termination of physiological processes or senescence. Inter-estingly, mango ripeness was also marked by the expression rise ofUbqPL (Fig. 1R) suggesting its connection with the climacteric.

2.3. Spatial differentiation of gene expression

The genes studied here have been isolated from mango fruit.Moreover, most of them have been isolated from this tree speciesfor the first time. So we also conducted expression profiling ofthese genes in leaf and flower tissues, in order to establish thecomparison between these tissues. In this attempt, expression

profiles of all 18 genes (C) in flowers showed better positivecorrelation to those in fruits, as compared to the correlationshowed by the leaf profiles (Table 2). These results were congruentto those derived based on the volatile profiles of these tissues [26].Because the leaf and flower show different degrees of correlationwith developing and ripening fruits based on volatile profiles [26]and mango blend is dominated by the terpenoid volatiles, we splitthis set of 18 genes in to two sub-sets: the first containing the genesrelated to terpenoid metabolism (A) and the second consisting ofremaining ten genes (B). Indeed, we could note a remarkabledifference with these two datasets wherein, all the correlations ofleaf to fruit, based on the sub-set A were insignificant, but thosebased on sub-set B were positive and significant (except those with2DAH and 5DAH fruits) (Table 2). However, with all three datasets(including one set of all 18 genes) flowers showed higher positivecorrelation with various stages of fruit (Table 2). These results,together with those from the volatile analysis [26] indicate that thetranscriptomic and metabolomic activities in flower are in betterharmony with those in fruit. Thus, flower can be considered as aninitial stage in the orchestration of these activities, while studyingthe setting, development and ripening of fruit. Earlier [26], wehad suggested that the volatile compounds are synthesized inboth, the leaf and fruit, in contrast to the previous notion [15,23]that they are mainly synthesized in leaf; based on this, it wasalso believed that the raw mango aroma of developing fruit isimparted by the sap [23]. Thus, the lower values of correlationbetween leaf and fruit based on dataset A, support our theory ofspatially independent synthesis of terpenoid compounds.

3. Conclusion

Overall, this analysis revealed the temporal and spatial regula-tion of the analyzed genes during the development and ripening ofAlphonso mango. Zeroing down of the expression of many genes at2DAH stage advocated our a priori hypothesis about the ‘zero day’stage that 90DAP fruit upon harvesting may carry the continuationof in planta processes and therefore, can be regarded as ‘virtual’zero day, whereas within two days, almost complete halting of inplanta processes may take place to consider 2DAH as a ‘real’ zero

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433432

day stage. This finding was congruent with that of the volatileanalysis [26] and thus, it was important for the planning of furtherbiochemical and molecular studies in Alphonso fruit. Expressionpeaks of sHSP and MDHAR genes and the characteristic expressiondrop of plastid associated GPPS and MTPS genes and more impor-tantly, the drop in correlation values (in all three datasets) (Table 2)at 90DAP supported the conventional indices, which consider thisstage as a perfect physiological maturity for harvesting. Similarly,15DAH could be marked as a perfect ripe stage by the expressionpeaks of FPPS, LOX, MeTr, Chitinase and UbqPL genes.

4. Materials and methods

4.1. Plant material

Alphonso fruit matures in about 90 days after the fruit-set andripens in further 15 to 20 days when harvested and incubated at28�C [26]. Therefore, fruits of 5, 15, 30, 60 and 90 days after polli-nation (DAP) and of 2, 5, 10, 15 and 20 days after harvesting (DAH)were collected from the orchards of the Regional Fruit ResearchStation (RFRS) of Dr. Balasaheb Savant Kokan Krishi Vidyapeeth[(DBSKKV) (Dr. Balasaheb Savant Kokan Agricultural University)], atDeogad (Maharashtra, India). According to the conventional indicesfor Deogad grown Alphonso fruit, 5 and 15DAPh early develop-ment; 30 and 60DAPh mid development; 90DAP/00DAHhharvesting maturity; 2DAHh harvesting- ripening intermediate;5DAHh early ripening; 10DAHhmid ripening; 15DAHh ripe and20DAHh overripe [26]. Along with these fruit tissues, fullyexpanded leaves and open flowers (entire) were also collected. Allthe tissues were carried to the laboratory in liquid nitrogen andwere preserved at �80 �C till use.

4.2. RNA isolation, cDNA synthesis, cDNA cloning,sequencing and annotation

A protocol previously developed by us [27] was used to isolatethe total cellular RNA from all 12 tissues. For all the tissues, firststrand cDNA was synthesized over 1mg of total RNA using, Clonte-ch's (Japan) Reverse Transcription system. Prior to reverse tran-scription, all the RNA samples were treated with DNase I. All theamplified cDNA fragments were cloned in pGEM-T Easy vectorsystem (Promega, USA), before they were sequenced. Universal T7and SP6 promoter (Promega, USA) primers were used forsequencing these cloned fragments. All the sequences wereobtained using Megabase 1000 DNA sequencer (AmershamBiosciences, UK). All the sequences were annotatedwith the help ofbasic local alignment search tool (BLAST) algorithm from NationalCentre for Biotechnology Information (NCBI).

4.3. The candidate genes

In the present work, we intend to show how the expressionprofiles of various genes that have been isolated frommango for thefirst time, vary during the processes of development and ripening.Therefore, here we included the genes selected from our twodifferent gene isolation approaches. As mentioned before, thegenes related to terpenoid metabolism were selected based on theprevious reports about the dominance of terpenoid compounds inmango [26]; whereas, the remaining genes were selected based ontheir differential expression in the key stages [26] of mangoripening.

4.3.1. Genes related to terpenoid metabolismHeterologous sequences of these genes (IPPI, GPPS, MTPS,

GGPPS, FPPS, SqTPS, IsoCH and GT) were collected from NCBI and

were aligned. Two to three pairs of degenerate primers (that couldspan the longest possible stretches of these genes) were designedand synthesized for each gene, based on these alignments. Thesedegenerate primers were used to amplify the putative transcriptsover the cDNA of 15DAH fruit. These amplification PCRs werecarried out with the help of Advantage� Taq DNA polymerase(Clontech, Japan). Amplified fragments were cloned, sequencedand annotated. Specific (non-degenerate) primers (Table 1) weredesigned for the relative quantification PCR of these annotatedfragments.

4.3.2. Genes related to the dynamic environment of fruitTo find the genes implicated in fruit ripening (other than the

ones related to terpene metabolism), we used the DDRT-PCR [17]using mRNA obtained from the 2DAH and 15DAH fruits. DDRT-PCR experiments were performed using the CLONTECH “DeltaDifferential Display Kit” (Clontech Laboratories, Palo Alto, USA)according to the instructions of the manufacturer.

Differentially displayed fragments were re-amplified, cloned,sequenced and annotated. Specific (non-degenerate) primers(Table 1) were designed for the relative quantification PCR of theseannotated fragments.

By both abovementioned approaches (4.3.1 and 4.3.2) weobtained several cDNA fragments; all these fragments weresubmitted to NCBI database as partial cds. However, we selectedcertain fragments for the relative quantification PCR, on the basis ofsome technical criteria as mentioned below. The data about theprimers used in both these approaches, reactions with the degen-erate primers and the annotations of remaining fragments thatwere not used in the relative quantification PCR are not shownhere.

4.3.3. The technical selection of candidate genesThe specific primer pairs (Table 1) designed with the help of

sequences of these cDNA fragments were used to produce theamplicons for the relative quantification PCR. However, prior torelative quantification PCR, we tested these specific primers togenerate the amplicons using Advantage� Taq DNA polymerase(Clontech, Japan) from the cDNA of all (total 12) the selectedAlphonso tissues (independently). Only the genes, whose specificprimers exclusively produced a single band (as visualized on theethidium bromide stained, 2% agarose gel) in all 12 tissues werecloned. For each tissue, at least five clones were sequenced perprimer pair and their sequences were compared to confirm thehomogeneity and presence of uninterrupted translation frame inthem. Only the fragments, which showed same sequence throughall the tissues, were used in the relative quantification PCR.Annotations of these cDNA (amplified by specific primer pairs) aswell as their respective amino acid sequences obtained by in silicotranslation were confirmed using BLAST with the database of NCBI(Table 1).

4.4. Relative quantification PCR

The template cDNA of each respective tissue was ensured to besynthesized from the uniform amount of RNA. Two and fourmicroliters from each cDNA preparation were separately amplifiedin 20 mL reactions [1� green GoTaq� buffer (Promega, USA),2.0 mM MgCl2, 0.5 mM dNTPs, 0.5 mM of each gene specific primerand GoTaq� DNA polymerase (1 unit) (Promega, USA)]. Thethermal cycling program consisted of 30 or 35 cycles of denatur-ation at 94 �C, annealing followed by extension at 72 �C (each stepof 45 s).

For all the primer pairs, except annealing temperature andnumber of cycles, rest of the PCR program was the same.

S.S. Pandit et al. / Plant Physiology and Biochemistry 48 (2010) 426e433 433

Initially, amplification with each primer pair was attempted in 25and 30 cycle PCRs; few primer pairs that failed to produce detect-able concentration of amplicon (on ethidium bromide stainedagarose gel) in these attempts were subjected to 35 cycle PCRs.Details of annealing and cycle number are given in Table 1. Elon-gation factor 1a (EF1) gene was used as an internal control tomonitor the uniformity of expression across the tissues for 20, 25,30 as well as 35 cycle PCRs.

PCR products were run through 2% agarose gel containing0.5 mg L�1 ethidium bromide along with 1 mg HindIII digestedLambda DNA (l/HindIII) (Genei, India). Concentrations of all thePCR products (ng), including that of internal standard were deter-mined by plotting their band intensities on the standard curvemade by those of l/HindIII (the bands of known concentrations).Imaging, intensity measurement and recording was done usingImageMaster VDS video documentation system (AmershamBiosciences, UK).

4.5. Statistical analysis

All the data used for the present analysis were generated fromtriplicate experiments. Statistical analyses were conducted usingSystat statistical software (version 11, Richmond, CA, USA). Signif-icance of the data was analyzed by ANOVA and Fisher's LSD.Correlations (p� 0.05) between the leaf, flowers and developingand ripening fruits were derived independently based on the geneexpression profiles of A] terpenoid metabolism related genes (IPPI,GPPS, MTPS, GGPPS, FPPS, SqTPS, IsoCH and GT), B] genes otherthan the ones involved in terpenoid metabolism (MDHAR, 14e3e3,MT, MeTr, sHSP, CysPI, Chitinase, LOX, ERF, UbqPL) and C] all these18 genes.

Acknowledgements

This work was funded by DSIR (NWP P23 CMM0002); SagarS. Pandit and Ram S. Kulkarni thank CSIR, for fellowships.

References

[1] A. Aharoni, A.P. Giri, F.W.A. Verstappen, C.M. Bertea, R. Sevenier, Z. Sun,M.A. Jongsma, W. Schwab, H.J. Bouwmeester, Gain and loss of fruit flavorcompounds produced by wild and cultivated strawberry species. PlantCell 16 (2004) 3110e3131.

[2] A. Aharoni, A.P. O'Connell, Gene expression analysis of strawberry achene andreceptacle maturation using DNA microarrays. J. Exp. Bot. 53 (2002)2073e2087.

[3] D. Bowles, J. Isayenkova, E. Lim, B. Poppenberger, Glycosyltransferases:managers of small molecules. Curr. Opin. Plant Biol. 8 (2005) 254e263.

[4] M.S. Brown, J.L. Goldstein, Protein prenylation: mad bet for Rab. Nature 366(1993) 14e15.

[5] H. B}ugl, E.B. Fauman, B.L. Staker, F. Zheng, S.R. Kushner,M.A. Saper, J.C.A. Bardwell,U. Jakob, RNAmethylation under heat shock control. Mol. Cell 6 (2000) 349e360.

[6] S.K. Clendennen, C.D. May, Differential gene expression in ripening bananafruit. Plant Physiol. 115 (1997) 463e469.

[7] J.C. D'Auria, J. Gershenzon, The secondary metabolism of Arabidopsis thaliana:growing like a weed. Curr. Opin. Plant Biol. 8 (2005) 308e316.

[8] C. Davies, S.P. Robinson, Differential screening indicates a dramatic change inmRNA profiles during grape berry ripening. Cloning and characterization ofcDNAs encoding putative cell wall and stress response proteins. Plant Physiol.122 (2000) 803e812.

[9] N. Dudareva, S. Andersson, I. Orlova, N. Gatto, M. Reichelt, D. Rhodes,W. Boland, J. Gershenzon, The nonmevalonate pathway supports bothmonoterpene and sesquiterpene formation in snapdragon flowers. Proc. Natl.Acad. Sci. U.S.A. 102 (2005) 933e938.

[10] J. Flach, P.E. Pilot, P. Jolles, What's new in chitinase research? Experientia 48(1992) 701e716.

[11] P.J. Hofman, L.G. Smith, G.F. Meiburg, J.E. Giles, Production locality affectsmango fruit quality. Aus. J. Exp. Agric. 37 (1997) 801e808.

[12] R. Huang, R. Xia, L. Hu, Y. Lu, M. Wang, Antioxidant activity and oxygen-scavenging system in orange pulp during fruit ripening and maturation. Sci.Hortic. Amersterdam 113 (2007) 166e172.

[13] A. Jimenez, G. Creissen, B. Kular, J. Firmin, S. Robinson, M. Verhoeyen,P. Mullineaux, Changes in oxidative processes and components of the anti-oxidant system during tomato fruit ripening. Planta 214 (2002) 751e758.

[14] A. Kasprzewska, Plant chitinases e regulation and function. Cell. Mol Biol. Lett.8 (2003) 809e824.

[15] H.J.D. Lalel, Z. Singh, S.C. Tan, Distribution of aroma volatile compounds indifferent parts of mango fruit. J. Hortic. Sci. Biotechnol. 78 (2003) 131e138.

[16] M. Lemaire-Chamley, J. Petit, M. Causse, P. Raymond, C. Chevalier, Identifica-tion of differentially expressed genes during early tomato fruit development.Characterization of a novel cDNA coding for a RAD23 protein. Aust. J. Plant.Physiol. 27 (2000) 911e920.

[17] P. Liang, A.B. Pardee, Differential display of eukaryotic messenger RNA bymeans of the polymerase chain reaction. Science 257 (1992) 967e971.

[18] D. Mbeguie-A-Mbeguie, O. Hubert, F.C. Baurens, T. Matsumoto, M. Chillet,B. Fils-Lycaon, S. Sidibé-Bocs, Expression patterns of cell wall-modifying genesfrom banana during fruit ripening and in relationship with finger drop. J. Exp.Bot. 60 (2009) 2021e2034.

[19] U. Mettal, W. Boland, P. Beyer, H. Kleinig, Biosynthesis of monoterpenehydrocarbons by isolated chromoplasts from daffodil flowers. Eur. J. Biochem.170 (1988) 613e616.

[20] G. Mir, J. Doménech, G. Huguet, W.-J. Guo, P. Goldsbrough, S. Atrian,M. Molinas, A plant type 2 metallothionein (MT) from cork tissue responds tooxidative stress. J. Exp. Bot. 55 (2004) 2483e2493.

[21] R. Moyle, D.J. Fairbairn, J. Ripi, M. Crowe, J.R. Botella, Developing pineapplefruit has a small transcriptome dominated by metallothionein. J. Exp. Bot. 56(2005) 101e112.

[22] M. Nagasawa, H. Mori, K. Shiratake, S. Yamaki, Isolation of cDNAs for genesexpressed after/during fertilization and fruit set of melon (Cucumis melo L.).J. Jpn. Soc. Hortic. Sci. 74 (2005) 23e30.

[23] P.S. Negi, J.K. Saby, U.J.S. Prasada Rao, Antimicrobial activity of mango sap. Eur.Food Res. Technol. 214 (2002) 327e330.

[24] C. Oecking, N. Jaspert, Plant 14e3e3 proteins catch up with their mammalianorthologs. Curr. Opin. Plant Biol. 12 (2009) 760e765.

[25] S.S. Pandit, H.G. Chidley, R.S. Kulkarni, K.H. Pujari, A.P. Giri, V.S. Gupta, Cultivarrelationships in mango based on fruit volatile profiles. Food Chem. 114 (2009)363e372.

[26] S.S. Pandit, R.S. Kulkarni, H.G. Chidley, A.P. Giri, T.G. Köllner, J. Degenhardt,J. Gershenzon, V.S. Gupta, Changes in volatile composition during fruitdevelopment and ripening of ‘Alphonso’ mango. J. Sci. Food Agric. 89 (2009)2071e2081.

[27] S.S. Pandit, S.S. Mitra, A.P. Giri, V.S. Gupta, A quick method for isolating RNAfrom raw and ripe fleshy fruits as well as for co-isolating DNA and RNA frompolysaccharide- and polyphenol-rich leaf tissues. J. Plant Biol. 50 (2007)60e64.

[28] H.R. Parikh, G.M. Nair, V.V. Modi, Some structural changes during ripening ofmangoes (Mangifera indica var. Alphonso) by abscisic acid treatment. Ann. Bot.65 (1990) 121e127.

[29] J. Pino, J. Mesa, Y.Muñoz, P.Martí, R.J. Marbot, Volatile components frommango(Mangifera indica L.) cultivars. J. Agric. Food Chem. 53 (2005) 2213e2223.

[30] M.R. Roberts, J. Salinas, D.B. Collinge, 14e3e3 proteins and the response toabiotic and biotic stress. Plant Mol. Biol. 1031 (2002) 1031e1039.

[31] W. Schwab, Metabolome diversity: too few genes, too many metabolites?Phytochemistry 62 (2003) 837e849.

[32] A. Stephan, M. Bücking, H. Steinhart, Novel analytical tools for food flavours.Food Res. Int. 33 (2000) 199e209.

[33] R.N. Tharanathan, H.M. Yashoda, T.N. Prabha, Mango (Mangifera indica L.), “theking of fruits” e an overview. Food Rev. Int. 22 (2006) 95e123.

[34] J.F. Todd, G. Paliyath, J.E. Thompson, Characteristics of a membrane-associatedlipoxygenase in tomato fruit. Plant Physiol. 94 (1990) 1225e1232.

[35] B.L. Trumpower, New concepts on the role of ubiquinone in the mitochondrialrespiratory chain. J. Bioeng. Biomembr. 13 (1981) 1e24.

[36] H.K.N. Vasanthaiah, K.V. Ravishankar, K.S. Shivashankara, A. Lalitha,P. Narayanaswamy, G.K. Mukunda, T.G. Prasad, Cloning and characterizationof differentially expressed genes of internal breakdown in mango fruit(Mangifera indica L.) cv. Alphonso. J. Plant Physiol. 163 (2006) 671e679.

[37] R.D. Vierstra, The ubiquitin-26S proteasome system at the nexus of plantbiology. Nat. Rev. Mol. Cell Biol. 10 (2009) 385e397.

[38] D.L.E. Waters, T.A. Holton, E.M. Ablett, L.S. Lee, R.J. Henry, cDNA microarrayanalysis of developing grape (Vitis vinifera cv. Shiraz) berry skin. Funct. Integr.Genomics 5 (2005) 40e58.

[39] P.J. White, Recent advances in fruit development and ripening: an overview.J. Exp. Bot. 53 (2002) 1995e2000.

[40] M. Wiweger, I. Farbos, M. Ingouff, U. Lagercrantz, S. Von Arnold, Expressionof Chia4-Pa chitinase genes during somatic and zygotic embryo developmentin Norway spruce (Picea abies): similarities and differences betweengymnosperm and angiosperm class IV chitinases. J. Exp. Bot. 54 (2003)2691e2699.