Effects of the environmental contaminants DEHP and TCDD on estradiol synthesis and aryl hydrocarbon receptor and peroxisome proliferator-activated receptor signalling in the human

ORIGINAL RESEARCH

Effects of the environmentalcontaminants DEHP and TCDD onestradiol synthesis and aryl hydrocarbonreceptor and peroxisome proliferator-activated receptor signalling in thehuman granulosa cell line KGNJana Ernst1,*,†, Johann-Christoph Jann1,†, Ronald Biemann2,Holger M. Koch3, and Bernd Fischer1

1Department of Anatomy and Cell Biology, Martin Luther University Faculty of Medicine, Grosse Steinstrasse 52, Halle(Saale) D-06097, Germany2Department of Clinical Chemistry and Pathobiochemistry, Otto-von-Guericke-University, Leipziger Strasse 44, Magdeburg D-39120, Germany3Institute for Prevention and Occupational Medicine of the German Social Accident Insurance, Institute of the Ruhr University Bochum (IPA),Burkle-de-la-Camp-Platz 1, Bochum D-44789, Germany

*Correspondence address. E-mail: [email protected]

Submitted on November 27, 2013; resubmitted on May 30, 2014; accepted on June 13, 2014

abstract: Environmental contaminants binding to transcription factors, such as the aryl hydrocarbon receptor (AhR) and the alpha andgamma peroxisome proliferator-activated receptors (PPARs), contribute to adverse effects on the reproductive system. Expressing both theAhR and PPARs, the human granulosa cell line KGN offers the opportunity to investigate the regulatory mechanisms involved in receptor cross-talk, independent of overriding hormonal control. The aim of the present study was to investigate the impact of two environmental contaminants,2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, an AhR ligand) and di-(2-ethylhexyl) phthalate (DEHP, a PPAR ligand), on gonadotrophin sensitivityand estrogen synthesis in KGN cells. Accumulation of the DEHP metabolite mono-(2-ethylhexyl) phthalate (MEHP) in DEHP-exposed cells wasmeasured by high-performance liquid chromatography mass spectrometry, thereby demonstrating DEHP metabolism to MEHP by KGN cells. Byemploying TCDD ( an AhR agonist), rosiglitazone (a PPARgamma agonist) or bezafibrate (a PPARalpha agonist), the presence of a functional AhRand PPAR cascade was confirmed in KGN cells. Cytotoxicity testing revealed no effect on KGN cell proliferation for the concentrations of TCDDand DEHP used in the current study. FSH-stimulated cells were exposed to TCDD, DEHP or a mix of both and estradiol synthesis was measuredby enzyme-linked immunosorbent assay and gene expression by quantitative RT–PCR. Exposure decreased estradiol synthesis (TCDD, DEHP,mix) and reduced the mRNA expression of CYP19 aromatase (DEHP, mix) and FSHR (DEHP). DEHP induced the expression of the alpha andgamma PPARs and AhR, an effect which was inhibited by selective PPAR antagonists. Studies in the human granulosa cell line KGN show thatthe action of endocrine-disrupting chemicals may be due to a direct activation of AhR, for example by TCDD, and by a transactivation viaPPARs, for example by DEHP, inducing subsequent transcriptional changes with a broad range of effects on granulosa cell function.

Key words: aryl hydrocarbon receptor / peroxisome proliferator-activated receptor / phthalate diesters / estradiol / KGN granulosa cells

IntroductionPlasticizers, such as phthalates, are widely used in industry and consumergoods. Since phthalates do not form strong molecular polymer linkagesthey easily diffuse into the environment (Kavlock et al., 2006). Over thelast decade epidemiological studies observed a link between phthalates

and numerous health problems, including obesity, type 2 diabetes, ath-erosclerosis, asthma and allergies (Bornehag et al., 2004; Hatch et al.,2008; Lind and Lind, 2011; Lind et al., 2012; Sun et al., 2014). Phthalatesare reported to have adverse effects on the human reproductive system.Prenatal and early post-natal environmental phthalate exposure wasassociated with decreased hormone levels and genital alterations in

† These authors contributed equally to this work.

& The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved.For Permissions, please email: [email protected]

Molecular Human Reproduction, Vol.20, No.9 pp. 919–928, 2014

Advanced Access publication on June 20, 2014 doi:10.1093/molehr/gau045

by guest on February 5, 2016http://m

olehr.oxfordjournals.org/D

ownloaded from

http://molehr.oxfordjournals.org/

male offspring (Swan et al., 2005; Main et al., 2006). Recently, phthalateswere shown to negatively affect testosterone levels, semen quality,sperm motility and morphology (Pant et al., 2008; Wirth et al., 2008; Jur-ewicz et al., 2013). Comparable evidence on female reproductive tox-icity is scarce. In girls, high urinary phthalate concentrations are linkedto a delayed pubarche but not thelarche (Frederiksen et al., 2012).Studies on the association of phthalates and endometriosis risk revealedcontradictory results (Cobellis et al., 2003; Kim et al., 2011; Upson et al.,2013). Investigating the effects of phthalate exposure by measuringdiester levels in serum is limited due to their rapid metabolism to monoe-sters and the high risk of background contamination. Therefore, urinarymetabolites are analysed to evaluate the body burden of phthalate die-sters, such as di-(2-ethylhexyl) phthalate (DEHP), being the environmen-tally most abundant phthalate for many years. An investigation of theinternal exposure to DEHP in nursery-school children and theirparents and teachers showed a higher level in urine for the children,with 90 mg/l (adults: 59.1 mg/l) (Koch et al., 2004). Also healthy preg-nant women in different countries were studied revealing an exposurerange of 31.8–79.3 mg/l (Enke et al., 2013). Owing to the use of DEHP-plasticized medical devices, patients can be exposed to much higherlevels. An analysis of blood bags, for example, revealed DEHP concentra-tions of up to 83.2 mg/ml (Inoue et al., 2005). DEHP exposure of neo-nates who are treated in intensive care reached levels of 123.1 mg/mlafter exchange transfusion (Plonait et al., 1993) or 34.9 mg/ml afterextracorporeal membrane oxygenation (Karle et al., 1997).

Referring to environmental contaminants such as endocrine-disrupting chemicals (EDCs) is based on their ability to interfere with syn-thesis, release, transport, metabolism, binding, action and elimination ofnaturally occurring hormones (Kavlock et al., 1996). The human alphaand gamma peroxisome proliferator-activated receptors (PPARs) areknown targets for environmental phthalate di- and monoesters asshown by an in silico approach (Sarath Josh et al., 2013). The DEHP me-tabolite mono-(2-ethylhexyl) phthalate (MEHP) wasreported to activatehuman PPARalpha and PPARgamma in MCF-7 cells (a human breastcancer cell line) (Venkata et al., 2006) and to promote adipocyte differ-entiation and adipogenesis in human preadipocytes (Ellero-Simatos et al.,2011). These findings were confirmed for DEHP in murine mesenchymalstem cells (Biemann et al., 2012; Biemann et al., 2014). Furthermore,phthalates affected aryl hydrocarbon receptor (AhR) activation in vitro,acting as weak agonists (Kruger et al., 2008; Mankidy et al., 2013). TheAhR, being a prominent member of the basic helix-loop-helixPer-ARNT-SIM (bHLH-PAS) protein family, is evolutionary well con-served and present in a wide range of vertebrate and invertebratespecies and tissues. It can be activated by a broad range of substanceswith little structural similarity. Halogenated and polycyclic aromatichydrocarbons are well-characterized synthetic ligands, but also naturalexogenous and endogenous compounds have been described (reviewedin Denison and Nagy, 2003). Few data on human exposure to2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), one of the best describedAhR ligands, are available. Population-based studies found an increasingrisk for endometriosis, earlier menopause and prolonged menstrualcycles in the Seveso accident cohort (Eskenazi et al., 2002a, b; Eskenaziet al., 2005). TCDD concentrations in human adipose tissue, measuredin people with occupational and non-occupational exposure, are in thepg per gram of fat range. TCDD levels in human breast milk from differentregions of Germany differ between 3.2 and 4.3 pg/g fat (Beck et al.,1994).

Single activation of the AhR (Horling et al., 2011) and PPAR(Lovekamp-Swan et al., 2003) receptor pathways by EDCs causes adecreased expression of cytochrome P450 aromatase (CYP19), thekey enzyme in estrogen biosynthesis in granulosa cells. Additionally,treatment with MEHP or a selective PPARalpha, but not PPARgamma,agonist increased AhR and CYP1B1 expression in rat granulosa cells(Lovekamp-Swan et al., 2003). In Caco-2 cells PPARalpha activationup-regulated AhR expression via a PPAR response element (PPRE) inthe AhR promoter (Villard et al., 2007).

The immortalized human granulosa cell line KGN was chosen for thecurrent study. It is characterized by retaining typical granulosa cell fea-tures over a long period in culture (Nishi et al., 2001). TCDD, by activat-ing AhR and inducing the expression of the AhR target genes CYP1A1 andCYP1B1, causes an altered expression of gonadotrophin and estrogenreceptors in this culture model (Horling et al., 2011). Expressing PPARstoo, KGN offers the opportunity to study the receptor crosstalk inde-pendently from overriding hormonal control by theca cells and/or thehypothalamic–pituitary axis. A crosstalk between AhR and othernuclear receptors was already demonstrated, mediating subsequent cel-lular responses (Pocar et al., 2005; Seifert et al., 2008). The aim of thepresent study was to investigate the impact of two environmental con-taminants, TCDD and DEHP, on gonadotrophin sensitivity and estrogensynthesis in KGN granulosa cells assessed by gene expression studies andby enzyme-linked immunosorbent assay (ELISA).

Methods

Cell lineThe immortalized human granulosa cell line KGN was purchased fromRIKENBioResource Center (Iberaki, Japan).

ChemicalsThe chemicals used in the present study were purchased from the followingcompanies: 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) from Amchro(Hattersheim, Germany), di-(2-ethylhexyl) phthalate (DEHP) and bezafi-brate from Sigma-Aldrich (Taufkirchen, Germany), alpha-Naphthoflavone(ANF) and dimethyl sulphoxide (DMSO) from Sigma-Aldrich (Germany),MK 886, GW 9662 and rosiglitazone from Cayman (Ann Arbor, MI, USA).All chemicals were dissolved in DMSO with a final concentration of 0.1% inKGN cell cultures. This DMSO concentration was shown to have no effecton estradiol synthesis and expression of CYP19 and FSHR mRNAs in prelim-inary experiments (data not shown).

Cell cultureAs described previously (Horling et al., 2011), KGN cells were cultured inDulbecco’s modified Eagle’s medium (DMEM, Gibco, Berlin, Germany) con-taining 10% heat-inactivated fetal calf serum (Gibco), 1% L-glutamine (Gibco)and 1% penicillin/streptomycin (PAA, Pasching, Austria) in a humidifiedatmosphere of 20% O2 and 5% CO2 at 378C.

Exposure schedulesThe concentration for TCDD exposure (10 nM) was chosen according to aprevious study in the KGN cell model (Horling et al., 2011). A concentrationrange between 0.1 and 100 nM TCDD had been investigated and analysedwith regard to the expression of the AhR target gene CYP1B1. CYP1B1 wassignificantly induced following exposure to 10 nM TCDD. This exposurelevel is in agreement with another study in cultured primary human granulosa

920 Ernst et al.



ownloaded from


lutein cells (Vidal et al., 2005). It has also been shown to be the lowest max-imally effective concentration for the reduction of the estradiol level in suchculture systems (Enan et al., 1996). Based on previous in vitro investigationsusing DEHP in the mM range (Kruger et al., 2008; Ohno et al., 2009; Guptaet al., 2010), we used 0.5, 5 and 50 mM DEHP. Concentrations in mMexceed environmental DEHP exposure reported in various studies (Kochet al., 2004; Goen et al., 2011; Enke et al., 2013; Zota et al., 2014), but arein line with clinically relevant DEHP concentrations found in blood bags(Inoue et al., 2005). Various exposure schedules were applied. TCDDand/or DEHP were given with or without selective antagonists of AhR(ANF, Horling et al., 2011), PPARalpha (MK 886, Kehrer et al., 2001) orPPARgamma (GW 9662, Seargent et al., 2004) (concentration 10 mMeach, according to the references) for 5 or 24 h after a 2 h pre-incubationwith the antagonists. Corresponding controls were cultured in the sameway but without antagonists. For investigating hormone synthesis, KGNcells were cultured in medium containing 10 mM 4-androstene-3,17-dione(Sigma-Aldrich) and stimulated with 20 ng/ml FSH (Sigma-Aldrich) (Horlinget al., 2011). A functional PPAR cascade was investigated by employingclassical agonists, i.e. rosiglitazone (PPARgamma agonist, 500 nM, Kirchneret al., 2010) or bezafibrate (PPARalpha agonist, 25 mM, Guo et al., 2006),in concentrations shown to activate PPAR. In these experiments KGNwere cultured for 24 h.

MEHP accumulationAfter 5 h in culture with or without added DEHP, the DEHP MEHP was ana-lysed in the medium and cell lysates using high-performance liquid chroma-tography tandem mass spectrometry with quantification via isotopedilution (Koch et al., 2003). The assays used to determine MEHP (andother oxidized DEHP metabolites) was performed via tandem mass spec-trometry with isotope dilution quantification. The selectivity and specificityof such an HPLC-MS/MS method (including isotope labelled internal stan-dards) can be considered a gold standard for a robust, sensitive and specificdetermination of such biomarkers. The respective LOQs for MEHP (andother phthalate metabolites) are 0.5 mg/l for MEHP and 0.2 mg/l for the oxi-dized metabolites. The extensive chromatographic separation and the specif-ic mass transitions ensure that ‘cross-reactivity’ (in LC-MS/MS better termedinterference) with or by other phthalates or phthalate metabolites can beexcluded. Sample measurements were carried out by the IPA laboratory inBochum (Germany), which has successfully participated as a reference la-boratory for phthalate metabolite analyses in the quality assurance pro-gramme of the European Union financed Consortium to Perform HumanBiomonitoring on a European Scale (COPHES).

Cell proliferationThe effect of 24 h exposure to 10 nM TCDD, DEHP (0.5, 5 and 50 mM) andTCDD/DEHP mix on cell proliferation and cytotoxicity was investigatedusing the EZ4U assay (Biomedica, Vienna, Austria) according to manufac-turer’s instructions.

RNA isolation and cDNA synthesisTotal RNA from cultured KGN cells was isolated using the AllPrep Kit(Qiagen, Hilden, Germany) according to manufacturer’s manual. cDNAwas generated from 3 mg total RNA using the RevertAid H Minus ReverseTranscriptase (Thermo Scientific, Dreieich, Germany). Reactions were per-formed in a final volume of 20 ml containing 1 × first-strand buffer, 200 unitstranscriptase enzyme, 1 mM dNTPs (Invitrogen, Karlsruhe, Germany) as wellas 1 ml random hexamer primer and 50 U RNase Inhibitor (both from RocheDiagnostics, Mannheim, Germany) at 428C for 1 h followed by incubation at708C for 10 min.

Quantitative realtime RT–PCRQuantitative RT–PCR was performed to measure mRNA expression levelsin a StepOnePlusTM Real-Time PCR System (Applied Biosystems, FosterCity, CA, USA). Gene expression with normalization to 106 copies of 18Sribosomal RNA as housekeeping gene was determined in a 96-well plateformat for the following genes: AhR and its target gene cytochrome P4501B1 (CYP1B1), PPARalpha and PPARgamma and their target gene fatty acid-binding protein 3 (FABP3), the FSH receptor (FSHR) and CYP19. Theprimers and amplicons were as shown in Table I.

PCR reactions were prepared in a final volume of 20 ml reaction mixturecomprising 500 nM specific primers (Sigma-Aldrich), 10 ml SYBRgreen Mas-termix (MESA Blue qPCRTM Mastermix Plus for SYBRw Assay, Eurogentec,Cologne, Germany) and 3 ml of cDNA (diluted 1:4.5). The cycle parameterswere 5 min 958C, and 40 three-step cycles of 10 s 958C, 15 s 608C and 20 s728C. Standard curves were generated for each gene using a plasmid dilutionseries containing the target sequences.

Hormone assayThe supernatant from FSH-stimulated KGN cells with 24 h of exposure toTCDD and/or DEHP was collected for measuring estradiol by ELISA(DRG Instruments, Marburg, Germany), which was performed accordingto manufacturer’s manual. Cells from these experimental series were alsoused for RNA and protein extraction. ELISA data were normalized to theprotein concentration of individual samples.

.............................................................................................................................................................................................

Table I Primers for quantitative RT–PCR.

Gene Forward primer 5′ –3′ Reverse primer 5′ –3′ Amplicon length (bp)

18S CCTGTATTGTTATTTTTCGTCACTACCT AGAAACGGCTACCACATCCAA 105

AhR AGAGTTGGACCGTTTGGCTA AGTTATCCTGGCCTCCGTTT 167

CYP19 ATGTGGACGTGTTGACCCTTCT AGGAGAGCTTGCCATGCATCAA 133

CYP1B1 TTGGACAAGGATGGCCTCATC TTTCGCAGGCTCATTTGGGT 171

FABP3 GGCCAGCATGACCAAGCCTACA AGCTCCCGCACAAGTGTGGTC 228

FSHR TCCTTGTGCTCAATGTCCTG ACCTTGAGGGAGGCAGAAT 196

PPAR alpha TCATCACGGACACGCTTTCAC AAGCCCTTGCAGCCTTCAC 175

PPAR gamma AGATCATCTACACCATGCTGGCCT TGTCCTCGATGGGCTTCACATTCA 255

18S ribosomal RNA (18S), aryl hydrocarbon receptor (AhR), cytochrome P450 aromatase (CYP19), cytochrome P450 1B1 (CYP1B1), fatty acid-binding protein 3 (FABP3), FSH receptor(FSHR), peroxisome proliferator-activated receptors alpha and gamma (PPARalpha and PPARgamma).

DEHP/TCDD effects in KGN granulosa cells 921



ownloaded from


Protein isolationProtein from cultured KGN cells was isolated using the AllPrep Kit (Qiagen)according to manufacturer’s manual. The protein concentration was deter-mined by the Bio-Rad Protein Assay (Bio-Rad, Munich, Germany).

Statistical analysesAll experiments were performed as at least three independent experiments(N ). The number of technical replicates (n) within one experimental run isindicated in the individual figure legend. For statistical analyses Prism 5(GraphPad Software, Inc., La Jolla, CA, USA) and SigmaPlot 11.0 (Systat Soft-ware, Inc., Erkrath, Germany) was used. Data are presented as mean+ SEM.Comparisons of two groups were performed by an unpaired Student’s t-testand comparisons of multiple groups by one-way-analysis of variance followedby Tukey’s post test. With the exception of MEHP accumulation, all experi-mental data are presented in comparison with the solvent (DMSO)-treatedcontrol group. Differences between groups were considered as statisticallysignificant at P value , 0.05.

Results

KGN cells metabolize DEHP to MEHPThe MEHP concentration after exposure with and without 50 mM DEHPwas measured in culture media and KGN cell lysates at time points 0 and5 h (Fig. 1A). At 0 h, MEHP was found in media with and without DEHPsupplementation, with a significantly 3-fold higher level in the DEHPmedia. After 5 h, MEHP concentrations in the media with DEHP applica-tion were significantly elevated (by 3-fold to 0 h with DEHP, by 8-fold to0 h and by 4-fold to 5 h without DEHP). Cell lysates of DEHP-exposedcells also revealed a significant increase of MEHP: After 5 h of DEHP ex-posure MEHP concentrations showed a 21-fold and 12-fold increasecompared with non-exposed cells at 0 and 5 h, respectively. Thesedata indicate that KGN cells have the ability to metabolize DEHP toMEHP.

TCDD and/or DEHP did not influence KGNcell proliferationCytotoxicity of TCDD (10 nM), DEHP (0.5, 5 and 50 mM) and theTCDD/DEHP mix (10 nM/0.5 mM, 10 nM/5 mM and 10 nM/50 mM)was tested. None of the concentrations used affected KGN cell prolifer-ation (Fig. 1B). Selective AhR, PPARalpha and PPARgamma antagonistswere investigated for their effects on cell proliferation. Compared withDMSO control, no significant differences were observed (10 mM; datanot shown).

AhR and PPARs are active in KGN cellsThe experiments employing PPAR agonists, i.e. bezafibrate as agonist forPPARalpha and rosiglitazone as agonist for PPARgamma, confirmed re-ceptor activity and the presence of a functional PPAR signalling cascade inKGN cells. PPARalpha and PPARgamma were activated by agonist treat-ment (Fig. 1C). The PPAR target gene FABP3 mRNA was increasedby 51% under bezafibrate and by 89% under rosiglitazone treatment.Bezafibrate caused an induction of PPARalpha by 15%. The mRNA ex-pression of AhR and its target gene CYP1B1 were not affected by bezafi-brate and rosiglitazone treatment. TCDD did not influence the mRNAexpression of AhR, PPARs and FABP3, whereas CYP1B1 expression wasincreased by 78%.

Figure 1 DEHP metabolism to MEHP, cell proliferation and receptorpathway activation in KGN granulosa cells. (A) Mono-(2-ethylhexyl)phthalate (MEHP) enrichment in KGN cells. Culture media and celllysates wereanalysed for the di-(2-ethylhexyl) phthalate (DEHP) metab-olite MEHP at time points 0 and 5 h culture with and without 50 mMDEHP (N ¼ 3; n ¼ 1 each; P ≤ 0.05 *relative to 0 h without DEHP,+to 0 h with DEHP and #relative to 5 h without DEHP). (B) KGNcell proliferation after single and combined exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (10 nM) and DEHP (0.5, 5, 50 mM) (N¼ 4;n ¼ 6–8 each; P ≤ 0.05 *relative to dimethyl sulfoxide (DMSO)control). (C) Relative mRNA expression of alpha and gamma peroxi-some proliferator-activated receptors (PPARalpha and PPARgamma),their target gene fatty acid-binding protein 3 (FABP3), aryl hydrocarbonreceptor (AhR) and its target gene cytochrome P450 1B1 (CYP1B1) inKGN cells exposed to TCDD, bezafibrate and rosiglitazone (N ¼ 3;n ¼ 2 each; P ≤ 0.05 *relative to DMSO control).

922 Ernst et al.



ownloaded from


Estradiol synthesis and CYP19 mRNA arereduced under TCDD and DEHPThe concentration of estradiol was measured in the supernatantcollected after 24 h culture in medium containing FSH and androstene-dione (Fig. 2). FSH stimulation itself led to an induction of estradiolsynthesis by 46%. Additional exposure to TCDD and/or DEHP reducedFSH-stimulated estradiol synthesis (TCDD: by 20%, DEHP: by 19%,TCDD/DEHP mix: by 31%).

The mRNA expression of FSHR and CYP19 were determined inunstimulated and FSH-stimulated KGN cells. Basal mRNA levels forboth genes were not significantly influenced by all exposure treatments(Fig. 3A). FSH stimulation did not significantly affect FSHR and CYP19gene expression (Fig. 3B). Additional exposure to DEHP alone andtogether with TCDD reduced CYP19 mRNA expression by 43 and41%, respectively. Single TCDD exposure caused no decrease. FSHRmRNA expression was significantly decreased by 43% by DEHP.TCDD and the TCDD/DEHP mix had no effect on FSHR geneexpression (Fig. 3B).

Ahr expression is induced by DEHPSingle exposure with various DEHP concentrations induced the mRNAexpression of AhR (by 36% at 5 mM DEHP and by 40% at 50 mM DEHP),PPARalpha (by 35% at 5 mM DEHP and by 40% at 50 mM DEHP) andPPARgamma (by 43% at 0.5 mM DEHP and by 81% at 50 mM DEHP)(Fig. 4A and B). The TCDD/DEHP mix increased the mRNAs forCYP1B1 (by 256% at TCDD + 0.5 mM DEHP, by 218% at TCDD +5 mM DEHP and by 140% at TCDD + 50 mM DEHP), PPARalpha (by

42% at TCDD + 0.5 mM DEHP and by 29% at TCDD + 50 mMDEHP) and PPARgamma (by 54% at TCDD + 0.5 mM DEHP (Fig. 4Aand B).

To study the interaction of AhR and PPAR signalling, KGN cells wereexposed to TCDD, DEHP or a mix of both in combination with selectivereceptor antagonists (Fig. 5A and B). The DEHP-induced increase in AhRmRNA (Fig. 4A) wasmaintained under simultaneous AhR antagonization(by 60%; ANF) (Fig. 5A). Under PPARalpha antagonization by MK 886,AhR expression was only slightly increased. Antagonizing PPARgammaby GW 9662 diminished the DEHP effect completely (Fig. 5A). TheTCDD- and TCDD/DEHP-mediated increase of CYP1B1 mRNA(Fig. 1C and 4A) was no longer found under AhR antagonization. Inthe presence of both PPAR antagonists CYP1B1 mRNA was significantlyincreased by the TCDD/DEHP mix (by 154% with MK 886, by 307%with GW 9662) (Fig. 5A). Regarding receptor expression itself, theDEHP-mediated PPARalpha increase (Fig. 4B) was not altered by AhRantagonization (Fig. 5B). However, if both PPARs were antagonized,

Figure 2 Estradiol synthesis in TCDD and/or DEHP-exposed KGNgranulosa cells. Estradiol synthesis measured in unstimulated (-FSH) andin FSH-stimulated KGN cells after exposure to TCDD, DEHP or a mix ofboth for 24 h (N ¼ 5; n ¼ 1 each; P ≤ 0.05 *relative to FSH-stimulatedDMSO control).

Figure 3 Basal and FSH-stimulated FSHR and CYP19 mRNA expres-sion in TCDD and/or DEHP-exposed KGN granulosa cells. RelativemRNA expression of FSH receptor (FSHR) and cytochrome P450 aro-matase (CYP19) in unstimulated (A) and in unstimulated (-FSH) andFSH-stimulated KGN cells (B) after exposure to TCDD, DEHP or amix of both (N ¼ 5; n ¼ 1 each; P ≤ 0.05 *relative to unstimulated(A) or to FSH-stimulated DMSO control (B).




ownloaded from


the DEHP-induced PPARalpha and PPARgamma mRNA increase werediminished (Fig. 5B).

DiscussionKGN granulosa cells have active AhR and PPARsignalling pathways.Hier-archically, PPAR signalling governs AhR expression. This has far-reachingimplications since (i) activation of each receptor pathway, PPARs andAhR and (ii) DEHP-induced signalling reduce estradiol production, i.e.the primary function of granulosa cells. Widespread EDCs, such asphthalates, may affect granulosa cell hormone synthesis by direct activa-tion of the PPAR pathway and by indirect activation of AhR via PPARs.

Ovarian expression patterns of PPARs have been investigated in therat previously: PPARalpha was mainly found in theca and stroma cellswith no change during follicular development and menstrual cycle. Ingranulosa cells PPARgamma was the predominantly expressed isoform.After the LH surge PPARgamma transcription in developing folliclesdeclined (Komaret al., 2001). PPARgamma stimulates estrogen receptoralpha ubiquitination for subsequent degradation (Qin et al., 2003). BothPPARs bind to estrogen response elements acting as competitive

inhibitors (Keller et al., 1995) and affect estradiol synthesis itself (Muet al., 2000; Yanase et al., 2001; Fan et al., 2005). As shown in murineknockout models, PPARgamma is critical for normal ovarian function(Cui et al., 2002). Data from AhR-deficient mice indicate the significanceof the AhR for fertility, with disturbed follicle development and reducedovulation rate (Benedict et al., 2000; Benedict et al., 2003) due to analtered estradiol regulation and responsiveness (Barnett et al., 2007a, b).

We show that the most common phthalate, DEHP, is metabolized toMEHP in human KGN granulosa cells. Application of 50 mM (¼18 mg/ml)DEHP significantly elevated the mean MEHP medium concentrationfrom 8.7 to 25.5 ng/ml within 5 h of culture. KGN cell lysates containeda similar level with 22.0 ng MEHP/ml after 5 h DEHP exposure. It is im-portant to note thatculturemedium and cell lysates which had no contactwith DEHP were also contaminated by MEHP (1.0–6.2 ng/ml). Themeasured MEHP concentrations correlate closely with urinary MEHPlevels of healthy pregnant women (Enke et al., 2013). A likely explanationfor the MEHP contamination, besides the leakage from laboratoryplastic products, is the serum supplement. As previously reported,commercially available media for IVF are contaminated with DEHP andMEHP from the protein sources (Takatori et al., 2012).

Figure 4 Dose-dependent effects of DEHP alone or in the mix with TCDD on AhR, CYP1B1 and PPARs. Relative mRNA expression of AhR and its targetgene CYP1B1 (A) and PPARalpha and PPARgamma (B) in unstimulated KGN granulosa cells exposed to DEHP (0.5, 5, 50 mM) alone or to TCDD/DEHP mix(N ¼ 3; n ¼ 1 each; P ≤ 0.05 *relative to DMSO control).

924 Ernst et al.



ownloaded from


So far, only few in vitro studies on reproductive toxicity have investi-gated exposure to DEHP (Ohno et al., 2009; Gupta et al., 2010),whereas several studies were performed with the primary metaboliteMEHP (Lovekamp-Swan et al., 2003; Gunnarsson et al., 2008; Ohnoet al., 2009; Reinsberget al., 2009; Gupta et al., 2010). Regarding cytotox-icity in KGN cells, we did not observe any influence for concentrations inmedium between 0.5 and 50 mM DEHP after 24 h exposure. TCDD(10 nM) alone and in the mix with DEHP (0.5, 5 and 50 mM) also didnot affect cell proliferation. In primary human granulosa lutein cells noeffect on cell viability was observed for MEHP concentrations up to167 mM (Reinsberg et al., 2009). Exposure of cultured mouse ovarian fol-licles to MEHP and DEHP did not affect antral follicle growth within 24 h.However, an exposure for 72 h to DEHP (10 and 100 mg/ml) or MEHP(1, 10, 100 mg/ml) suppressed antral follicle growth, accompaniedby oxidative stress (Wang et al., 2012a, b), expression of proapop-totic factors and inhibition of cell cycle and antiapoptotic regulators(Wang et al., 2012b). In vivo studies using mice (Li et al., 2012) and rat(Xu et al., 2010) models exposed to DEHP demonstrated increasedgranulosa cell apoptosis. DNA fragmentation after 24 h exposure wasobserved for 3.1 mM TCDD but not for 3.1 nM TCDD (Heimler et al.,1998). If these data are critically assessed then it becomes obvious thatan accidental or chronic high exposure of individuals or in vitro materialscan be a realistic threat.

Ovarian steroidogenesis provides a broad range of attack points forendocrine modulation and disruption, starting at the hypothalamic–pitu-itary axis and reaching to the close interactions of follicular granulosa andtheca cells (Hirosawa et al., 2006; Svechnikova et al., 2007; Jablonskaet al., 2011; Liu et al., 2014). In the current study effects on steroidogen-esis were investigated in the immortalized human granulosa cell line KGNindependently from overriding signals. Basal mRNA expression of FSHRand CYP19 aromatase were not significantly affected by TCDD and/orDEHP exposure. FSH stimulation induced estradiol synthesis (Fig. 2)

and CYP19 protein (data not shown). CYP19 mRNA in KGN granulosacells was increased, however, not to a statistically significant level(Fig. 3B). Additional TCDD and/or DEHP exposure decreased estradiolsynthesis, with the strongest effect exerted by the mix. In primary humangranulosa lutein cells a TCDD-mediated estradiol reduction has beenalready described (Heimler et al., 1998). The mechanism underlyingthe DEHP-mediated decrease of estradiol synthesis may be the down-regulation of the FSHR and CYP19 aromatase expression (Pocar et al.,2012). MEHP exposure revealed a time- and concentration-dependentCYP19 aromatase inhibition with a subsequent decrease in estradiol syn-thesis, which was independent of the FSH-cAMP pathway (Davis et al.,1994; Reinsberg et al., 2009). The CYP19 aromatase suppression wasfound to be conducted via PPARalpha and PPARgamma (Lovekamp-Swan et al., 2003) through an inhibition of the transcriptional activationof the CYP19 aromatase promotor II (Ohno et al., 2009).

Under TCDD exposure the expected CYP1B1 up-regulation with nochange in AhR expression (Horling et al., 2011) was confirmed in thecurrent study. The PPAR agonists rosiglitazone and bezafibrate had noeffect on AhR and CYP1B1 mRNA expression but induced the PPARtarget gene FABP3 as a proof for an active PPAR cascade. In contrast,DEHP significantly increased AhR expression. A possible explanationfor this unexpected finding comes from the concept of ‘selective PPAR-gamma modulators’, implying activation of a ligand-specific subset oftarget genes (Gelman et al., 2007). PPARs and PPAR target gene ex-pression was not influenced by exposure to the AhR agonist TCDD.Also, a study using PPRE-driven luciferase activation in Huh7 cells didnot observe any TCDD-mediated effect (Wang et al., 2010). DEHPalone and in the mix with TCDD increased the transcription of bothPPARs. This shows that TCCD did not alter the DEHP-mediated PPARup-regulation. In contrast, DEHP increased AhR mRNA expressiononly if given alone. The TCDD/DEHP mix did not increase AhRmRNA expression compared with TCDD alone. We do not know

Figure 5 Effects of TCDD and/or DEHP on AhR, CYP1B1 and PPARs under selective pathway antagonization. AhR, CYP1B1 (A) and PPARs (B) mRNAexpression was investigated after the addition of selective antagonists of AhR (ANF), PPARalpha (MK 886) and PPARgamma (GW 9662) during simultan-eous exposure to TCDD, 50 mM DEHP or a mix of both in unstimulated KGN granulosa cells (N ¼ 5; n ¼ 1 each; P ≤ 0.05 *relative to DMSO control).




ownloaded from


why the effects of the mixture differed between PPAR and AhR mRNA ex-pression but this underpins one major finding of the current study: effectsof EDC mixtures clearly differ from effects induced by a single EDC.

As the current data show, granulosa cell function is disturbed byTCDD and DEHP action leading to a reduced estradiol synthesis. Fur-thermore, a DEHP-induced AhR mRNA expression was found. AhRand PPAR signalling not only diminish estradiol levels by disrupting syn-thesis but also increase estradiol metabolism. AhR activates CYP1A1and CYP1B1 (Horling et al., 2011), which metabolize estradiol toseveral hydroxylation products (Lee et al., 2003). In this context it is im-portant to note that PPAR signalling can directly, without AhR signalling,activate CYP1A1 (Seree et al., 2004).

AcknowledgementsWe thank Christine Froehlich for excellent technical assistance.

Authors’ rolesJ.E.: acquisition, analysis and interpretation of data, conception anddesign of the study, drafting the article and final approval. J.C.J.: acquisi-tion, analysis and interpretation of data, conception and design of thestudy. R.B.: acquisition, analysis and interpretation of data, revising thearticle and final approval. H.M.K.: acquisition of data, revising thearticle and final approval. B.F.: project leader, conception and design ofthe study, revising the article and final approval. The authors declarethey have no financial, personal and professional competing interests.

FundingThis work was supported by the European Community’s Seventh Frame-work Programme [grant number 212885 (REEF: Reproductive Effects ofEnvironmental Chemicals in Females)].

Conflict of interestNone declared.

ReferencesBarnett KR, Tomic D, Gupta RK, Babus JK, Roby KF, Terranova PF, Flaws JA.

The aryl hydrocarbon receptor is required for normal gonadotropinresponsiveness in the mouseovary.ToxicolAppl Pharmacol2007a;223:66–72.

Barnett KR, Tomic D, Gupta RK, Miller KP, Meachum S, Paulose T, Flaws JA.The aryl hydrocarbon receptor affects mouse ovarian follicle growth viamechanisms involving estradiol regulation and responsiveness. BiolReprod 2007b;76:1062–1070.

Beck H, Dross A, Mathar W. PCDD and PCDF exposure and levels in humansin Germany. Environ Health Perspect 1994;102(Suppl. 1):173–185.

Benedict JC, Lin TM, Loeffler IK, Peterson RE, Flaws JA. Physiological role ofthe aryl hydrocarbon receptor in mouse ovary development. Toxicol Sci2000;56:382–388.

Benedict JC, Miller KP, Lin T-M, Greenfeld C, Babus JK, PetersonRE, Flaws JA.Aryl hydrocarbon receptor regulates growth, but not atresia, of mousepreantral and antral follicles. Biol Reprod 2003;68:1511–1517.

Biemann R, Navarrete Santos A, Navarrete Santos A, Riemann D, Knelangen J,Bluher M, Koch H, Fischer B. Endocrine disrupting chemicals affect the

adipogenic differentiation of mesenchymal stem cells in distinct ontogeneticwindows. Biochem Biophys Res Commun 2012;417:747–752.

Biemann R, Fischer B, Navarrete Santos A. Adipogenic effects of a combinationof the endocrine-disrupting compounds bisphenol A, diethylhexylphthalate,and tributyltin. Obes Facts 2014;7:48–56.

Bornehag C-G, Sundell J, Weschler CJ, Sigsgaard T, Lundgren B,Hasselgren M, Hagerhed-Engman L. The association between asthmaand allergic symptoms in children and phthalates in house dust: a nestedcase–control study. Environ Health Perspect 2004;112:1393–1397.

Cobellis L, Latini G, de Felice C, Razzi S, Paris I, Ruggieri F, Mazzeo P,Petraglia F. High plasma concentrations of di-(2-ethylhexyl)-phthalate inwomen with endometriosis. Hum Reprod 2003;18:1512–1515.

Cui Y, Miyoshi K, Claudio E, Siebenlist UK, Gonzalez FJ, Flaws J, Wagner K-U,Hennighausen L. Loss of the peroxisome proliferation-activated receptorgamma (PPARgamma ) does not affect mammary development andpropensity for tumor formation but leads to reduced fertility. J Biol Chem2002;277:17830–17835.

Davis BJ, Weaver R, Gaines LJ, Heindel JJ. Mono-(2-ethylhexyl) phthalatesuppresses estradiol production independent of FSH-cAMP stimulationin rat granulosa cells. Toxicol Appl Pharmacol 1994;128:224–228.

Denison MS, Nagy SR. Activation of the aryl hydrocarbon receptor bystructurally diverse exogenous and endogenous chemicals. Annu RevPharmacol Toxicol 2003;43:309–334.

Ellero-Simatos S, Claus SP, Benelli C, Forest C, Letourneur F, Cagnard N,Beaune PH, de Waziers I. Combined transcriptomic-(1)H NMRmetabonomic study reveals that monoethylhexyl phthalate stimulatesadipogenesis and glyceroneogenesis in human adipocytes. J Proteome Res2011;10:5493–5502.

Enan E, Moran F, Vandevoort CA, Stewart DR, Overstreet JW, Lasley BL.Mechanism of toxic action of 2,3,7,8-tetrachlorodibenzo-p-dioxin(TCDD) in cultured human luteinized granulosa cells. Reprod Toxicol 1996;10:497–508.

Enke U, Schleussner E, Palmke C, Seyfarth L, Koch HM. Phthalate exposure inpregnant women and newborns—the urinary metabolite excretionpattern differs distinctly. Int J Hyg Environ Health 2013;216:735–742.

Eskenazi B, Mocarelli P, Warner M, Samuels S, Vercellini P, Olive D,Needham LL, Patterson DG, Brambilla P, Gavoni N et al. Serum dioxinconcentrations and endometriosis: a cohort study in Seveso, Italy.Environ Health Perspect 2002a;110:629–634.

Eskenazi B, Warner M, Mocarelli P, Samuels S, Needham LL, Patterson DG,Lippman S, Vercellini P, Gerthoux PM, Brambilla P et al. Serum dioxinconcentrations and menstrual cycle characteristics. Am J Epidemiol2002b;156:383–392.

Eskenazi B, Warner M, Marks AR, Samuels S, Gerthoux PM, Vercellini P,Olive DL, Needham L, Patterson D, Mocarelli P. Serum dioxinconcentrations and age at menopause. Environ Health Perspect 2005;113:858–862.

Fan W, Yanase T, Morinaga H, Mu Y-M, Nomura M, Okabe T, Goto K,Harada N, Nawata H. Activation of peroxisome proliferator-activatedreceptor-gamma and retinoid X receptor inhibits aromatase transcriptionvia nuclear factor-kappaB. Endocrinology 2005;146:85–92.

Frederiksen H, Sørensen K, Mouritsen A, Aksglaede L, Hagen CP, Petersen JH,Skakkebaek NE, Andersson A-M, Juul A. High urinary phthalateconcentration associated with delayed pubarche in girls. Int J Androl 2012;35:216–226.

Gelman L, Feige JN, Desvergne B. Molecular basis of selective PPARgammamodulation for the treatment of Type 2 diabetes. Biochim Biophys Acta2007;1771:1094–1107.

Goen T, Dobler L, Koschorreck J, Muller J, Wiesmuller GA, Drexler H,Kolossa-Gehring M. Trends of the internal phthalate exposure of youngadults in Germany—follow-up of a retrospective human biomonitoringstudy. Int J Hyg Environ Health 2011;215:36–45.

926 Ernst et al.



ownloaded from


Gunnarsson D, Leffler P, Ekwurtzel E, Martinsson G, Liu K, Selstam G.Mono-(2-ethylhexyl) phthalate stimulates basal steroidogenesis by acAMP-independent mechanism in mouse gonadal cells of both sexes.Reproduction 2008;135:693–703.

Guo L, Fang H, Collins J, Fan X-h, Dial S, Wong A, Mehta K, Blann E, Shi L,Tong W et al. Differential gene expression in mouse primary hepatocytesexposed to the peroxisome proliferator-activated receptor alpha agonists.BMC Bioinformatics 2006;7(Suppl. 2):S18.

Gupta RK, Singh JM, Leslie TC, Meachum S, Flaws JA, Yao HH-C.Di-(2-ethylhexyl) phthalate and mono-(2-ethylhexyl) phthalate inhibitgrowth and reduce estradiol levels of antral follicles in vitro. Toxicol ApplPharmacol 2010;242:224–230.

Hatch EE, Nelson JW, Qureshi MM, Weinberg J, Moore LL, Singer M,Webster TF. Association of urinary phthalate metabolite concentrationswith body mass index and waist circumference: a cross-sectional studyof NHANES data, 1999-2002. Environ Health 2008;7:27.

Heimler I, Rawlins RG, Owen H, Hutz RJ. Dioxin perturbs, in a dose- andtime-dependent fashion, steroid secretion, and induces apoptosis ofhuman luteinized granulosa cells. Endocrinology 1998;139:4373–4379.

Hirosawa N, Yano K, Suzuki Y, Sakamoto Y. Endocrine disrupting effect ofdi-(2-ethylhexyl)phthalate on female rats and proteome analyses of theirpituitaries. Proteomics 2006;6:958–971.

Horling K, Santos AN, Fischer B. The AhR is constitutively activated andaffects granulosa cell features in the human cell line KGN. Mol HumReprod 2011;17:104–114.

Inoue K, Kawaguchi M, Yamanaka R, Higuchi T, Ito R, Saito K, Nakazawa H.Evaluation and analysis of exposure levels of di(2-ethylhexyl) phthalatefrom blood bags. Clin Chim Acta 2005;358:159–166.

Jablonska O, Piasecka J, Petroff BK, Nynca A, Siawrys G, Wasowska B,Zmijewska A, Lewczuk B, Ciereszko RE. In vitro effects of2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on ovarian, pituitary, andpineal function in pigs. Theriogenology 2011;76:921–932.

Jurewicz J,RadwanM,SobalaW,LigockaD,RadwanP,BochenekM,HawułaW,Jakubowski L, Hanke W. Human urinary phthalate metabolites level and mainsemen parameters, sperm chromatin structure, sperm aneuploidy andreproductive hormones. Reprod Toxicol 2013;42:232–241.

Karle VA, Short BL, Martin GR, Bulas DI, Getson PR, Luban NL, O’Brien AM,Rubin RJ. Extracorporeal membrane oxygenation exposes infants to theplasticizer, di(2-ethylhexyl)phthalate. Crit Care Med 1997;25:696–703.

Kavlock RJ, Daston GP, DeRosa C, Fenner-Crisp P, Gray LE, Kaattari S,Lucier G, Luster M, Mac MJ, Maczka C et al. Research needs for the riskassessment of health and environmental effects of endocrine disruptors:a report of the U.S. EPA-sponsored workshop. Environ Health Perspect1996;104(Suppl. 4):715–740.

Kavlock R, Barr D, Boekelheide K, Breslin W, Breysse P, Chapin R, Gaido K,Hodgson E, Marcus M, Shea K et al. NTP-CERHR Expert Panel Update onthe Reproductive and Developmental Toxicity of di(2-ethylhexyl)phthalate. Reprod Toxicol 2006;22:291–399.

Kehrer JP, Biswal SS, La E, Thuillier P, Datta K, Fischer SM, Vanden Heuvel JP.Inhibition of peroxisome-proliferator-activated receptor (PPAR)alpha byMK886. Biochem J 2001;356:899–906.

KellerH,Givel F,PerroudM,WahliW.Signalingcross-talkbetweenperoxisomeproliferator-activated receptor/retinoid X receptor and estrogen receptorthrough estrogen response elements. Mol Endocrinol 1995;9:794–804.

Kim SH, Chun S, Jang JY, Chae HD, Kim C-H, Kang BM. Increased plasmalevels of phthalate esters in women with advanced-stage endometriosis:a prospective case–control study. Fertil Steril 2011;95:357–359.

Kirchner S, Kieu T, Chow C, Casey S, Blumberg B. Prenatal exposure to theenvironmental obesogen tributyltin predisposes multipotent stem cells tobecome adipocytes. Mol Endocrinol 2010;24:526–539.

Koch HM, Gonzalez-Reche LM, Angerer J. On-line clean-up bymultidimensional liquid chromatography-electrospray ionization tandem

mass spectrometry for high throughput quantification of primary andsecondary phthalate metabolites in human urine. J Chromatogr B AnalytTechnol Biomed Life Sci 2003;784:169–182.

Koch HM, Drexler H, Angerer J. Internal exposure of nursery-school childrenand their parents and teachers to di(2-ethylhexyl)phthalate (DEHP). Int JHyg Environ Health 2004;207:15–22.

Komar CM, Braissant O, Wahli W, Curry TE. Expression and localization ofPPARs in the rat ovary during follicular development and the periovulatoryperiod. Endocrinology 2001;142:4831–4838.

Kruger T, Long M, Bonefeld-Jørgensen EC. Plastic components affect theactivation of the aryl hydrocarbon and the androgen receptor. Toxicology2008;246:112–123.

Lee AJ, Cai MX, Thomas PE, Conney AH, Zhu BT. Characterization of theoxidative metabolites of 17beta-estradiol and estrone formed by 15selectively expressed human cytochrome p450 isoforms. Endocrinology2003;144:3382–3398.

Li N, Liu T, Zhou L, He J, Ye L. Di-(2-ethylhexyl) phthalate reducesprogesterone levels and induces apoptosis of ovarian granulosa cell inadult female ICR mice. Environ Toxicol Pharmacol 2012;34:869–875.

Lind PM, Lind L. Circulating levels of bisphenol A and phthalates are related tocarotid atherosclerosis in the elderly. Atherosclerosis 2011;218:207–213.

Lind PM, Zethelius B, Lind L. Circulating levels of phthalate metabolites areassociated with prevalent diabetes in the elderly. Diabetes Care 2012;35:1519–1524.

Liu T, Li N, Zhu J, Yu G, Guo K, Zhou L, Zheng D, Qu X, Huang J, Chen X et al.Effects of di-(2-ethylhexyl) phthalate on the hypothalamus-pituitary-ovarianaxis in adult female rats. Reprod Toxicol 2014;46:141–147.

Lovekamp-Swan T, Jetten AM, Davis BJ. Dual activation of PPARalpha andPPARgamma by mono-(2-ethylhexyl) phthalate in rat ovarian granulosacells. Mol Cell Endocrinol 2003;201:133–141.

Main KM, Mortensen GK, Kaleva MM, Boisen KA, Damgaard IN,Chellakooty M, Schmidt IM, Suomi A-M, Virtanen HE, Petersen DVHet al. Human breast milk contamination with phthalates and alterationsof endogenous reproductive hormones in infants three months of age.Environ Health Perspect 2006;114:270–276.

Mankidy R, Wiseman S, Ma H, Giesy JP. Biological impact of phthalates.Toxicol Lett 2013;217:50–58.

Mu YM, Yanase T, Nishi Y, Waseda N, Oda T, Tanaka A, Takayanagi R,Nawata H. Insulin sensitizer, troglitazone, directly inhibits aromataseactivity in human ovarian granulosa cells. Biochem Biophys Res Commun2000;271:710–713.

Nishi Y, Yanase T, Mu Y, Oba K, Ichino I, Saito M, Nomura M, Mukasa C,Okabe T, Goto K et al. Establishment and characterization of a steroidogenichuman granulosa-like tumor cell line, KGN, that expresses functional follicle-stimulating hormone receptor. Endocrinology 2001;142:437–445.

Ohno S, Yukinawa F, Noda M, Nakajin S. Mono-(2-ethylhexyl) phthalateinduces NR4A subfamily and GIOT-1 gene expression, and suppressesCYP19 expression in human granulosa-like tumor cell line KGN. ToxicolLett 2009;191:353–359.

Pant N, Shukla M, Kumar Patel D, Shukla Y, Mathur N, Kumar Gupta Y,Saxena DK. Correlation of phthalate exposures with semen quality.Toxicol Appl Pharmacol 2008;231:112–116.

Plonait SL, Nau H, Maier RF, Wittfoht W, Obladen M. Exposure of newborninfants to di-(2-ethylhexyl)-phthalate and 2-ethylhexanoic acid followingexchange transfusion with polyvinylchloride catheters. Transfusion 1993;33:598–605.

Pocar P, Fischer B, Klonisch T, Hombach-Klonisch S. Molecular interactionsof the aryl hydrocarbon receptor and its biological and toxicologicalrelevance for reproduction. Reproduction 2005;129:379–389.

Pocar P, Fiandanese N, Secchi C, Berrini A, Fischer B, Schmidt JS,Schaedlich K, Borromeo V. Exposure to di(2-ethyl-hexyl) phthalate(DEHP) in utero and during lactation causes long-term pituitary-gonadal




ownloaded from


axis disruption in male and female mouse offspring. Endocrinology 2012;153:937–948.

Qin C, Burghardt R, Smith R, Wormke M, Stewart J, Safe S. Peroxisomeproliferator-activated receptor gamma agonists induce proteasome-dependent degradation of cyclin D1 and estrogen receptor alpha inMCF-7 breast cancer cells. Cancer Res 2003;63:958–964.

Reinsberg J, Wegener-Toper P, van der Ven K, van der Ven H, Klingmueller D.Effect of mono-(2-ethylhexyl) phthalate on steroid production of humangranulosa cells. Toxicol Appl Pharmacol 2009;239:116–123.

Sarath Josh MK, Pradeep S, Vijayalekshmi Amma KS, Balachandran S, AbdulJaleel UC, Doble M, Spener F, Benjamin S. Phthalates efficiently bind tohuman peroxisome proliferator activated receptor and retinoid Xreceptor a, b, g subtypes: an in silico approach. J Appl Toxicol 2014;34:754–765.

Seargent JM, Yates EA, Gill JH. GW9662, a potent antagonist of PPARgamma,inhibits growth of breast tumour cells and promotes the anticancer effects ofthe PPARgamma agonist rosiglitazone, independently of PPARgammaactivation. Br J Pharmacol 2004;143:933–937.

SeifertA,KatschinskiDM,TonackS,FischerB,NavarreteSantosA.Significanceof prolyl hydroxylase 2 in the interference of aryl hydrocarbon receptorand hypoxia-inducible factor-1 alpha signaling. Chem Res Toxicol 2008;21:341–348.

Seree E, Villard P-H, Pascussi J-M, Pineau T, Maurel P, Nguyen QB, Fallone F,Martin P-M, Champion S, Lacarelle B et al. Evidence for a new humanCYP1A1 regulation pathway involving PPAR-alpha and 2 PPRE sites.Gastroenterology 2004;127:1436–1445.

Sun Q, Cornelis MC, Townsend MK, Tobias DK, Eliassen AH, Franke AA,Hauser R, Hu FB. Association of urinary concentrations of bisphenol Aand phthalate metabolites with risk of type 2 diabetes: a prospectiveinvestigation in the Nurses’ Health Study (NHS) and NHSII cohorts.Environ Health Perspect 2014;122:616–623.

Svechnikova I, Svechnikov K, Soder O. The influence of di-(2-ethylhexyl)phthalate on steroidogenesis by the ovarian granulosa cells of immaturefemale rats. J Endocrinol 2007;194:603–609.

Swan SH, Main KM, Liu F, Stewart SL, Kruse RL, Calafat AM, Mao CS,Redmon JB, Ternand CL, Sullivan S et al. Decrease in anogenital distanceamong male infants with prenatal phthalate exposure. Environ HealthPerspect 2005;113:1056–1061.

Takatori S, Akutsu K, Kondo F, Ishii R, Nakazawa H, Makino T.Di(2-ethylhexyl)phthalate and mono(2-ethylhexyl)phthalate in media forin vitro fertilization. Chemosphere 2012;86:454–459.

Upson K, Sathyanarayana S, de Roos AJ, Thompson ML, Scholes D, Dills R,Holt VL. Phthalates and risk of endometriosis. Environ Res 2013;126:91–97.

Venkata NG, Robinson JA, Cabot PJ, Davis B, Monteith GR, Roberts-Thomson SJ. Mono(2-ethylhexyl)phthalate and mono-n-butyl phthalateactivation of peroxisome proliferator activated-receptors alpha andgamma in breast. Toxicol Lett 2006;163:224–234.

Vidal JD, Vandevoort CA, Marcus CB, Lazarewicz NR, Conley AJ.2,3,7,8-tetrachlorodibenzo-p-dioxin induces CYP1B1 expression inhuman luteinized granulosa cells. Arch Biochem Biophys 2005;439:53–60.

Villard PH, Caverni S, Baanannou A, Khalil A, Martin PG, Penel C, Pineau T,Seree E, Barra Y. PPARalpha transcriptionally induces AhR expression inCaco-2, but represses AhR pro-inflammatory effects. Biochem BiophysRes Commun 2007;364:896–901.

Wang Y-F, Chao H-R, Wu C-H, Tseng C-H, Kuo Y-T, Tsou T-C. Arecombinant peroxisome proliferator response element-driven luciferaseassay for evaluation of potential environmental obesogens. Biotechnol Lett2010;32:1789–1796.

Wang W, Craig ZR, Basavarajappa MS, Gupta RK, Flaws JA. Di(2-ethylhexyl) phthalate inhibits growth of mouse ovarian antral folliclesthrough an oxidative stress pathway. Toxicol Appl Pharmacol 2012a;258:288–295.

Wang W, Craig ZR, Basavarajappa MS, Hafner KS, Flaws JA.Mono-(2-ethylhexyl) phthalate induces oxidative stress and inhibitsgrowth of mouse ovarian antral follicles. Biol Reprod 2012b;87:152.

Wirth JJ, Rossano MG, Potter R, Puscheck E, Daly DC, Paneth N,Krawetz SA, Protas BM, Diamond MP. A pilot study associating urinaryconcentrations of phthalate metabolites and semen quality. Syst BiolReprod Med 2008;54:143–154.

Xu C, Chen J-A, Qiu Z, Zhao Q, Luo J, Yang L, Zeng H, Huang Y, Zhang L,Cao J et al. Ovotoxicity and PPAR-mediated aromatase downregulationin female Sprague–Dawley rats following combined oral exposure tobenzo[a]pyrene and di-(2-ethylhexyl) phthalate. Toxicol Lett 2010;199:323–332.

Yanase T, Mu YM, Nishi Y, Goto K, Nomura M, Okabe T, Takayanagi R,Nawata H. Regulation of aromatase by nuclear receptors. J Steroid BiochemMol Biol 2001;79:187–192.

Zota AR, Calafat AM, Woodruff TJ. Temporal trends in phthalate exposures:findings from the national health and nutrition examination survey, 2001–2010. Environ Health Perspect 2014;122:235–241.

928 Ernst et al.



ownloaded from


Documents

Effects of the environmental contaminants DEHP and TCDD on estradiol synthesis and aryl hydrocarbon receptor and peroxisome proliferator-activated receptor signalling in the human