Dynein-Dependent Transport of the Hantaan Virus Nucleocapsid Protein to the Endoplasmic Reticulum-Golgi Intermediate Compartment

JOURNAL OF VIROLOGY, Aug. 2007, p. 8634–8647 Vol. 81, No. 160022-538X/07/$08.00�0 doi:10.1128/JVI.00418-07Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Dynein-Dependent Transport of the Hantaan Virus NucleocapsidProtein to the Endoplasmic Reticulum-Golgi

Intermediate Compartment�

Harish N. Ramanathan,1 Dong-Hoon Chung,2 Steven J. Plane,1 Elizabeth Sztul,3 Yong-kyu Chu,2Mary C. Guttieri,4 Michael McDowell,2 Georgia Ali,2 and Colleen B. Jonsson2*

Graduate Program in Biochemistry and Molecular Genetics, University of Alabama at Birmingham, Birmingham, Alabama 352941;Department of Biochemistry and Molecular Biology, Southern Research Institute, Birmingham, Alabama 352052;

Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama 352943; andVirology Division, U.S. Army Medical Research Institute of Infectious Diseases,

Fort Detrick, Maryland 217024

Received 27 February 2007/Accepted 17 May 2007

In contrast to most negative-stranded RNA viruses, hantaviruses and other viruses in the family Bunyaviri-dae mature intracellularly, deriving the virion envelope from the endoplasmic reticulum (ER) or Golgicompartment. While it is generally accepted that Old World hantaviruses assemble and bud into the Golgicompartment, some studies with New World hantaviruses have raised the possibility of maturation at theplasma membrane as well. Overall, the steps leading to virion assembly remain largely undetermined forhantaviruses. Because hantaviruses do not have matrix proteins, the nucleocapsid protein (N) has beenproposed to play a key role in assembly. Herein, we examine the intracellular trafficking and morphogenesisof the prototype Old World hantavirus, Hantaan virus (HTNV). Using confocal microscopy, we show that Ncolocalized with the ER-Golgi intermediate compartment (ERGIC) in HTNV-infected Vero E6 cells, not withthe ER, Golgi compartment, or early endosomes. Brefeldin A, which effectively disperses the ER, the ERGIC,and Golgi membranes, redistributed N with the ERGIC, implicating membrane association; however, subcel-lular fractionation experiments showed the majority of N in particulate fractions. Confocal microscopyrevealed that N was juxtaposed to and distributed along microtubules and, over time, became surrounded byvimentin cages. To probe cytoskeletal association further, we probed trafficking of N in cells treated withnocodazole and cytochalasin D, which depolymerize microtubules and actin, respectively. We show thatnocodazole, but not cytochalasin D, affected the distribution of N and reduced levels of intracellular viral RNA.These results suggested the involvement of microtubules in trafficking of N, whose movement could occur viamolecular motors such as dynein. Overexpression of dynamitin, which is associated with dynein-mediatedtransport, creates a dominant-negative phenotype blocking transport on microtubules. Overexpression ofdynamitin reduced N accumulation in the perinuclear region, which further supports microtubule componentsin N trafficking. The combined results of these experiments support targeting of N to the ERGIC prior to itsmovement to the Golgi compartment and the requirement of an intact ERGIC for viral replication and, thus,the possibility of virus factories in this region.

Hantaviruses are present throughout the world, yet hanta-viral illnesses in humans occur predominantly in geographi-cally localized, mostly sporadic and unpredictable outbreaks(65). Presumably, this reflects the ecology of rodents in whichhantaviruses maintain a persistent infection without illness. InEurope and Asia, the Old World hantaviruses cause hemor-rhagic fever with renal syndrome, with 1 to 15% mortality.Hantaan virus (HTNV), a prototype Old World hantavirus, isthe major etiological agent for hemorrhagic fever with renalsyndrome, with as many as 50,000 to 100,000 cases per year (26,41). In the Americas, New World hantaviruses cause hantavi-rus pulmonary syndrome, with up to 40% mortality (52). Un-fortunately, there are no FDA-approved therapeutics available

for treatment of either disease, hence, care is supportive. Basicmechanistic questions regarding components of the life cycleof hantaviruses such as trafficking, replication, and assemblyremain largely unanswered.

Hantaviral particles contain a tripartite, single-strandedRNA genome (viral RNA [vRNA]) of negative polarity (64,66). The S, M, and L segments encode the nucleocapsid pro-tein (N), glycoproteins (Gn and Gc), and L protein (an RNA-dependent RNA polymerase), respectively. Studies of the in-fection of tracheal endothelial cells with Andes virus suggestthat hantaviruses can enter and replicate in the respiratoryepithelium following inhalation (59). Entry of most hantavi-ruses into host epithelial cells begins with the interaction of Gnwith �-1 and �-3 integrins (19, 20), which is followed by re-ceptor-mediated endocytosis through clathrin-coated pits (25).Jin et al. suggested that HTNV particles remain in the endo-somal compartments until moving to late endosomes or lyso-somes (25). Numerous studies have shown that the glycopro-tein is cotranslationally processed into Gn and Gc, which traffictogether from the endoplasmic reticulum (ER) to the Golgi

* Corresponding author. Mailing address: Emerging Infectious Dis-ease Research Program, Department of Biochemistry and MolecularBiology, 2000 9th Avenue South, Southern Research Institute, Bir-mingham, AL 35205. Phone: (205) 581-2681. Fax: (205) 581-2093.E-mail: [email protected].

� Published ahead of print on 30 May 2007.

8634

on August 15, 2015 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

compartment; virions form by budding into the Golgi compart-ment (64, 66, 75). One unanswered question is whether the Nand L proteins, after translation in the cytoplasm, target to theGolgi compartment directly to mediate replication, transcrip-tion, and assembly. Alternatively, replication and transcriptioncould occur at a different site within the cell. Difficulty inworking with the large 240-kDa L protein has hampered ex-perimental progress. However, we and others have made someprogress in characterizing N. The hantaviral N is the mostabundant protein in the virion and in virus-infected cells (66).This multifunctional protein presumably interacts with otherhantaviral proteins, and possibly with host cell components, tomediate virus replication and assembly. There have been, how-ever, relatively few studies that demonstrate its functions orshow at what site(s) within the cell it performs its functions. Atpresent, we know that N interacts with viral RNA (68, 82),itself (1, 2, 30, 31, 33, 47, 48), and perhaps the L protein, Gn (8,17, 75), and cellular factors (32, 34, 43). One study has shownit to be required for replication and/or transcription (17). Al-though the mechanistic details concerning the switch fromprimary transcription to replication are currently lacking, theconcentration of N may drive this switch (28). Clearly, theseinteractions and functions require trafficking of N within thecell, and as with other viruses, it is possible that the replicationand assembly occur at discrete sites within the cell.

The studies reported herein were designed to address how Ntraffics in the cell prior to viral assembly. Studies of N havebeen limited to localization in both Old World (25, 29, 31, 34,54) and New World viruses (54, 59, 76), which have primarilyshown trafficking of N to the perinuclear region. In cells tran-siently expressing N from Black Creek Canal virus (BCCV), Ncolocalizes with the cis-medial Golgi marker �-mannosidase II(Mann II) (54). In contrast, studies performed with Seoul virusshow no colocalization between N and the Golgi marker, al-though N accumulated in the perinuclear area (29). A signal inthe C-terminal region of the Tula virus and BCCV N promotesperinuclear targeting (31, 54). Herein, we demonstrate thatHTNV N colocalized with the ER-Golgi intermediate com-partment (ERGIC) and microtubules but not with the ER,Golgi compartment, early endosomal, or actin markers. Weshow that the movement of N depended on the microtubulenetwork and, further, that disruption of this network reducedlevels of vRNA. Our analyses suggest that N traffics to theERGIC prior to its movement to the Golgi compartment, thatan intact ERGIC is essential for viral replication, and thatthere might be virus factories in the ERGIC region.

MATERIALS AND METHODS

Cell culture, antibodies, and inhibitors. Vero E6 cells (ATCC CRL 1586)were maintained in complete DMEM (Dulbecco’s modified Eagle’s mediumsupplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, and 1%L-glutamine). Primary antibodies included mouse monoclonal antibodies(MAbs) against �-tubulin (Upstate), �-tubulin, vimentin, and filamentous actin(F-actin; Sigma); ERGIC-53 (Alexis); protein disulfide isomerase (PDI; Abcam);early endosomal antigen 1 (EEA1; BD Biosciences); a rabbit polyclonal antibodyagainst Mann II (Abcam); phalloidin conjugated to tetramethylrhodamine(TRITC; Sigma); and wheat germ agglutinin (WGA) conjugated to Alexa 594(Molecular Probes). Secondary antibodies used were goat anti-mouse antibodyconjugated to Alexa 488 or 594 and goat anti-rabbit antibody conjugated to Alexa488 or 594 (Molecular Probes) and goat anti-mouse antibody and goat anti-rabbit antibody conjugated to horseradish peroxidase from KPL. We purchased

brefeldin A (BFA), nocodazole (NOC), and cytochalasin D (CytD) from Sigma,and we purchased ribavirin (RBV) from ICN Pharmaceuticals.

Production of HTNV N-specific antibodies in rabbits and mice. N was ex-pressed with the T7 polymerase expression system and purified as hexahistidine-tagged fusion proteins from the soluble fraction, as previously described (27).Rabbit polyclonal antibody (no. 143) was raised to the HTNV N antigen in NewZealand White rabbits by Southern Biotechnology Associates (Birmingham,AL). A murine MAb (E-314) was raised to the same HTNV N antigen by CellEssentials, Inc. (Boston, MA). Five mice were immunized per antigen, andenzyme-linked immunosorbent assay (ELISA)-positive animals with the bestantibody response to the antigen were euthanized. Spleens were removed forcollection of cells and subsequent fusion by standard methods. Cell culturesupernatants of fusion clones were screened by ELISA for the presence ofvirus-specific antibodies. For those clones that showed a positive signal byELISA, we expanded the supernatant to produce 50 ml of antibody-rich super-natant, from which we purified this MAb. Cells were frozen in liquid nitrogen tosafeguard the stability of the cell line. Hybridoma cells were cultured in HyClonemedium (HYQSFM4Mab) supplemented with 10% fetal clone III serum and0.01% penicillin-streptomycin. Hybridoma clones were grown to 1 � 106/ml foreach T-150 sterile flask and incubated at 37°C, 5% CO2 until �90% confluence.At �90% confluence, cells were stressed in the same medium until 30 to 40%were dead (3 to 5 days). Cells were checked for the percentage dead with trypanblue. Supernatant from stressed hybridoma clones was removed to a sterileconical tube and centrifuged at 150 � g for 5 min at room temperature. Thesupernatant containing the MAb was recovered from the cell pellet and purifiedwith a MabTrap kit (Amersham Biosciences) by following the manufacturer’sprotocol.

Virus strain, RNA isolation, and construction of recombinant plasmids.HTNV (strain 76-118) was used for all experiments. The open reading frameencoding N was amplified by reverse transcription-PCR (RT-PCR) from totalRNA extracted from HTNV-infected cells with TRIzol (Invitrogen). RT-PCRsused SuperScript III reverse transcriptase (Invitrogen), Pfu DNA polymerase(Stratagene), a gene-specific forward primer (5� TAGTAGTAGACTCCCTAAAGAGCT 3�), and a reverse primer (5� GGCCCTCTAGAGTTTCAAAGGCTCTTGGTTGGAG 3�). PCR products were digested with XbaI and were phos-phorylated and blunt-end cloned into pcDNA3.1 (Invitrogen) to producepcHTNVN. The nucleotide sequence of pcHTNVN was confirmed by bidirec-tional sequencing with universal cytomegalovirus forward and bovine growthhormone reverse primers using an ABI 3130xl genetic analyzer (Applied Bio-systems). The plasmid p50-green fluorescent protein (p50-GFP), a gift fromWilliam Britt, was described previously (9).

Confocal and immunofluorescence microscopies. For all microscopy studies,Vero E6 cells were seeded in Lab-Tek II 2-well chamber slides (Nalge NuncInternational). For infection studies, Vero E6 cells at 60% confluence wereinfected with HTNV at a multiplicity of infection (MOI) of 0.1 or as noted for 1 hat 37°C with 5% CO2 as previously described (69), or they were transfected with1 �g of plasmid DNA using Lipofectamine 2000 in OptiMEM (Invitrogen)according to manufacturer’s instructions. After 1 h of incubation, completeDMEM was added to the wells, and the mixtures were incubated at 37°C in a 5%CO2 chamber. At different time points, Vero E6 cells were fixed either in acetonefor 15 min or with 3.5% paraformaldehyde for 30 min at room temperature,followed by permeabilization with 0.1% Triton X-100 for 5 min. Slides werewashed three times with phosphate-buffered saline (PBS).

The HTNV N was detected by incubating the cells with either HTNV N MAbE-314 at a 1:200 dilution or rabbit polyclonal antibody no. 143 at a dilution of1:10,000 for 1 h at room temperature. Golgi compartments were stained withTRITC-conjugated Alexa 594 or with polyclonal anti-Mann II antibody at adilution of 1:75. PDI, EEA1, ERGIC-53, actin, �-tubulin, and vimentin weredetected with the respective MAbs listed above at a dilution of 1:100 for 1 h atroom temperature. Slides were washed three times with PBS and were incubatedwith secondary goat anti-mouse or anti-rabbit antibodies conjugated to Alexa 488or Alexa 594 for 30 min at room temperature at a dilution of 1:400. F-actin wasvisualized by being stained with phalloidin conjugated to Alexa 594 for 30 min atroom temperature. Slides were mounted with Fluoromount-G (Southern Bio-technology Associates), and confocal imaging was performed with a LeicaDMIRBE inverted epifluorescence microscope outfitted with Leica TCS NT SP1laser confocal optics at the High Resolution Imaging Facility at the University ofAlabama—Birmingham. Epifluorescence imaging was also performed with aZeiss Axiovert 200 microscope outfitted with an ApoTome for deconvolutionpurposes. The ApoTome uses the grid projection or structured illuminationprinciple to obtain images with an improved signal-to-noise ratio, and it approx-imately doubles the resolution in the axial (z) direction. Final images wereobtained by averaging four independent scans of the fields using �40, �63, or

VOL. 81, 2007 DYNEIN-DEPENDENT N TRANSPORT TO ERGIC 8635


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

�100 magnification, corrected for oil immersion. Quantification of N in slideswas calculated by measuring the area of the cell occupied by indirect labeling ofN versus the total area of the cell using Image J image analysis software (Na-tional Institutes of Health).

Determination of the effect of drug treatment of hantaviral replication andrelease of infectious virus. Vero E6 cells grown to 100% confluence in 6-wellplates were infected with HTNV at an MOI of 0.1, as described previously (69).Eight hours postinfection (p.i.), 15.0 �g/ml of BFA, CytD, NOC, or RBV wasadded, and cells were incubated at 37°C for an additional 36 h in a 5% CO2

incubator, with replenishment of drug in complete DMEM every 12 h. Levels ofinfectious virus released into the supernatant were measured using an infectiousvirus center assay, and cellular vRNA levels were quantified by a quantitativereal-time RT-PCR assay, as described previously (42, 78). For the infectious viruscenter assay, virus was allowed to adsorb to the cells for 1 h at 37°C, 5% CO2.Cells were rinsed twice with PBS and replenished with 100 �l of 0.7% methylcellulose containing complete DMEM. After 5 days, cells were fixed and treatedwith a 1:3 solution of H2O2-methanol. Cells were washed and incubated with a1:500 dilution of HTNV N MAb E-314, followed by a secondary goat anti-mouseantibody conjugated with horseradish peroxidase using a TrueBlue peroxidasestaining kit (KPL). Infectious centers were photographed with a Camedia C-50605.1-megapixel camera (Olympus) and counted after enlargement of the images.

Membrane floatation. Vero E6 cells were cultured in T-75 flasks, grown to80% confluence, and transfected with 10 �g of pcHTNVN. At 18 h posttrans-fection (p.t.), the cells were washed and resuspended in 5.0 ml of 10 mM Tris, pH7.4, containing 0.25 M sucrose and complete protease inhibitor cocktail (Roche),and were subjected to membrane floatation as described by others (6). Briefly,the extracts were brought to 1.4 M sucrose and layered onto a discontinuoussucrose gradient (0.8, 1.2, 1.4, and 1.6 M) and centrifuged at 110,000 � g

overnight at 4°C in an SW 50.1 rotor (Beckman). Fractions were collected andacetone precipitated and then resolved by sodium dodecyl sulfate (SDS)–10%polyacrylamide gel electrophoresis, followed by immunoblotting using rabbitanti-N antibody no. 143, as described previously (82), with enhanced chemilu-minescent technology (Pierce).

Microsomal membrane fractionation. Vero E6 cells were grown to 80% con-fluence in T-75 flasks and were transfected with 10 �g of pcHTNVN plasmid. At18 h p.t., cells were washed twice with ice-cold PBS and resuspended in 200 �lof 5 mM Tris, pH 7.4, 0.5 mM MgCl2, and complete protease inhibitor cocktail.Cells were homogenized by being passed 15 to 18 times through a 26-gaugeneedle and then were brought to a final concentration of 0.25 M sucrose. Celldebris and nuclei were removed by low-speed centrifugation at 1,000 � g for 10min. Postnuclear supernatant (PNS) was centrifuged at 100,000 � g for 1 h usinga TLA 100.2 rotor (Beckman) to separate the particulate pellet and solublecytosolic fractions. Pellets were resuspended in 10 mM Tris-HCl, pH 6.8, 1%SDS, and complete protease inhibitor cocktail, brought to a final concentrationof 1 M NaCl, 50 mM sodium bicarbonate, 1.0% Triton X-100, or 1.0% NP-40,and incubated for 1 h on ice. Samples were centrifuged for 1 h at 120,000 � g.Proteins from the pellet and supernatant fractions were acetone precipitated andsubjected to SDS-polyacrylamide gel electrophoresis followed by immunoblot-ting, as described previously (82).

RESULTS

Temporal distribution of HTNV N in Vero E6 cells. Themultifunctional roles of N require an understanding of itstemporal movement in the cell. To assess the temporal distri-

FIG. 1. Temporal distribution of N in Vero E6 cells infected with HTNV or transfected with plasmid expressing N. (A) To ensure maximalinfection, Vero E6 cells were infected with HTNV at an MOI of 5.0 and were examined for the presence of N at 4, 12, 24, and 72 h with (upperrow) or without (lower row) phase contrast. At each of these times, cells were acetone fixed and stained by indirect immunofluorescence for N (red)with rabbit polyclonal anti-N antibody no. 143 as described in Materials and Methods. Scale bar, 20 �m, with 63� objectives (Axiovert 200microscope). The nucleus was stained with 4�,6�-diamidino-2-phenylindole. (B) Vero E6 cells were transfected with pcHTNVN and examined forthe presence of N at 4, 12, 24, and 48 h. At each of these times, cells were acetone fixed and stained by indirect immunofluorescence for N (red)with rabbit polyclonal anti-N antibody no. 143 as described in Materials and Methods. Scale bar, 20 �m, with 63� objectives (Axiovert 200microscope).

8636 RAMANATHAN ET AL. J. VIROL.


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

bution of N during infection, Vero E6 cells were infected withHTNV, and the distribution of N was monitored by confocalmicroscopy at several time points p.i. The expression of N wasdetected as early as 4 h p.i., and by 12 h most of N was detectedpredominantly as small granular structures dispersed through-out the cell cytoplasm (Fig. 1A; the upper panels show phase

contrast/immunofluorescence, and the lower panels show im-munofluorescence only). A significant change in the distribu-tion of N was observed at 24 h p.i., at which time punctatestructures containing N accumulated in the perinuclear region.The presence of N as granular cytoplasmic particles continued,albeit at a lower rate, and by 72 h p.i. most of N was clustered

FIG. 2. Colocalization of HTNV N with ERGIC-53 and redistribution of N with BFA. Vero E6 cells were infected with HTNV at an MOI of0.1, and after 3 days slides were acetone fixed (except for Mann II staining, in which case paraformaldehyde was used). Prior to fixation, slides Fto K were treated with BFA for 1 h as described in Materials and Methods. Slides were costained with WGA (B and G) or antibodies (anti-Nmonoclonal E-314 [green] or polyclonal no. 143 antibody [red]) against EEA1 (A and F), Mann II (C and H), PDI (D and I), or ERGIC-53(E and J) as described in Materials and Methods. Enlarged merged images of the insets in panels H, I, and J are presented in panel K. Scale bars,20 �m, using 100� objectives (Leica confocal microscope).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

in the perinuclear region. At day 5 p.i., cells contained highlycondensed structures of N, some of which appeared tubular innature (data not shown).

To investigate the ability of N to accumulate in the perinu-clear region and its temporal distribution in the absence ofother viral components, we transfected Vero E6 cells with aplasmid that constitutively expressed N (pcHTNVN). N accu-mulated in the perinuclear region as early as 12 h p.t., and by24 h p.t. most cells showed perinuclear localization of N (Fig.1B). At 48 h p.t., N was highly compacted around the perinu-clear region; hence, we chose 24 h for subsequent studies. The24-h pattern of N alone was similar to the pattern observedwith HTNV-infected cells at 72 h p.i. (Fig. 1). As reported forthe BCCV and Tula virus N proteins (31, 54), our studiessuggest that the HTNV N contains the necessary intrinsic se-quences to target itself to the perinuclear compartment.

N colocalizes with ERGIC-53 and redistributes with theERGIC upon BFA treatment. It is well established that thehantaviral Gn and Gc glycoproteins traffic from the ER tothe Golgi compartment and that virions form by buddinginto the Golgi compartment (75). One unanswered questionis whether N targets the Golgi compartment directly tofacilitate replication and assembly. To identify the compart-

ment targeted following HTNV N synthesis, we performeddual-immunofluorescence labeling experiments with confo-cal laser-scanning microscopy of HTNV-infected Vero E6cells using antibodies against HTNV N and various subcel-lular organelles. Specifically, we examined the localizationof N relative to markers of the early endosome (EE), Golgicompartment, ER, and ERGIC.

We used EEA1 as a marker for the EE and looked at therelative distribution of N and EEA1 in infected cells. At 72 hp.i., N accumulated in the perinuclear region but did not co-localize with EEA1 (Fig. 2A). We chose WGA to label thetrans-Golgi compartment (Fig. 2B), Mann II to label the cis-and medial-Golgi compartments (Fig. 2C), and PDI to labelthe ER (Fig. 2D). Confocal imaging revealed that none of themarkers had colocalized with N, although a small amount ofspectral overlap was noted between PDI and N (Fig. 2D).However, our dual-labeling analysis with antibodies against Nand ERGIC-53 showed colocalization, as indicated by the yel-low signal in the merged image (Fig. 2E).

We asked whether N was associated with ERGIC mem-branes by using BFA, which rapidly and reversibly redistributesmembranes of the ERGIC and the Golgi compartment (44,49). HTNV-infected Vero E6 cells were treated with BFA at

FIG. 3. Colocalization studies of HTNV N in Vero E6 cells expressing N alone, as well as redistribution of N with BFA, with various subcellularmarkers. Vero E6 cells were transfected with pcHTNVN, which expresses N alone, and after 18 h, the cells were fixed with acetone (except forMann II staining, in which case paraformaldehyde was used). Prior to fixation, the slides shown in panels E to H were treated with BFA for 1 h.Slides were costained with anti-N monoclonal E-314 (red) or polyclonal no. 143 antibody (green) as well as WGA (A and E) and antibodies againstMann II (B and F), PDI (C and G), or ERGIC-53 (D and H). Scale bars, 20 �m, using 100� objectives (Leica confocal microscope).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

72 h p.i. for 1 h and were analyzed for the pattern of Nlocalization. Our data showed that BFA treatment redistrib-uted N in HTNV-infected cells from a perinuclearly accumu-lated pattern to a more granularly distributed pattern (forexample, compare N in Fig. 2A to N in Fig. 2F). The redis-tributed N did not colocalize with EEA1 (Fig. 2F), WGA (Fig.2G), or Mann II (Fig. 2H and K, left panels). As can be seenin Fig. 2D, a very small amount of overlap was noted with PDI(Fig. 2I and K, middle panels). As can be seen Fig. 2E, weobserved colocalization of N and ERGIC-53 in cells treatedwith BFA (Fig. 2J and K, right panels). This suggested that Nmay associate with ERGIC membranes.

Since N colocalized with ERGIC in HTNV-infected cells,we asked whether transiently expressed N could target theERGIC independent of other viral proteins. Dual-immuno-fluorescence labeling of Vero E6 cells transfected withpcHTNVN showed very little colocalization of N and theERGIC compared to that of the infected cells (Fig. 3D). Fur-thermore, we did not detect any colocalization between N andER or Golgi markers in these transfection studies in the pres-ence or absence of BFA (Fig. 3A to H). The data suggest thattransfected N alone is deficient in proper trafficking to theERGIC and requires one or more viral components. Ininfection studies, a small amount of spectral overlap wasnoted with N and the ER marker PDI (Fig. 2K), but nonewas noted in transfection studies (Fig. 3G). The differencenoted between transfection and infection studies of N pro-tein at the ER could be due to the rapidly recycling of N viathe early secretory pathway from the Golgi compartment tothe ER, promoted by the presence of Gn/Gc. Thus, N di-rectly targeted the ERGIC in virus-infected cells.

N association with membranes. To further address mem-brane association, we conducted membrane subcellular frac-tionation experiments. Vero E6 cells were transfected withpcHTNVN, which transcribes the mRNA for N from a cyto-megalovirus promoter, and were allowed to produce N for16 h. Extracts from Vero E6 cells transiently expressing N weresubjected to floatation analysis in a discontinuous sucrose gra-dient (Fig. 4A). We chose calnexin (CNX) and actin as mark-ers for membrane-containing fractions and cytosolic fractions,respectively. Most N was observed in the cytosolic fractions ofthe gradient (Fig. 4A, fractions 5 to 7). However, a very tinyfraction of N was also noted in membrane-containing fractions1 to 3 (Fig. 4A). We repeated this analysis using HTNV-infected Vero E6 cells, and we noted similar results (data notshown).

Subcellular fractionation and detergent and salt treatmentswere used to analyze the nature of the particulate fraction ofN. Cells were lysed at 18 h after transfection and subjected tohigh-speed centrifugation to separate the soluble cytosolicfraction (S) and the particulate fraction containing the micro-somal membranes (P). As shown in Fig. 4B (top left panel),PNS contained both CNX and �-tubulin bands, which markcytosolic and membrane compartments, respectively. Fol-lowing centrifugation, the cytosolic fractions contained tu-bulin and the membrane fractions contained CNX (Fig. 4B,top left panel). Interestingly, the majority of N banded inthe pellet with the microsomal membranes as expected, buta small amount was detected in the soluble fraction (Fig. 4B,lower left panel). The particulate fraction was further

treated with various chemicals and separated into solubleand particulate fractions with high-speed centrifugation. In-terestingly, treatment of the particulate fraction with 1 MNaCl resulted in partitioning of N in roughly equal amountsbetween the particulate and soluble fractions. However,treatments with 50 mM sodium bicarbonate, 1.0% TritonX-100, or NP-40 did not release the N from the particulatefraction. These results suggest that the majority of N is notprimarily membrane associated.

N associates with microtubules and not actin. Several vi-ruses employ cellular cytoskeletal machinery, such as actin,microtubules, and their associated molecular motors, to trafficto the site of replication, assembly, and egress (14, 15, 39, 53,70, 72, 74). Ravkov et al. have suggested that actin filamentsmay play a role in the biogenesis of BCCV, a New Worldhantavirus (55). To test the association of actin with N, weperformed dual-immunofluorescence analysis of N and actin inHTNV-infected cells. F-actin was stained with TRITC-conju-gated phalloidin. Our confocal microscopy studies showed apattern for N that neither colocalized nor juxtaposed with actin(Fig. 5A). As an alternative approach to probe for its interac-tion with actin, HTNV-infected Vero E6 cells were treatedwith 10.0 �g/ml of CytD, an actin-depolymerizing drug, for 1 h

FIG. 4. Association of HTNV N with membrane fractions. Vero E6cells were transfected with pcHTNVN, and after 18 h they were sub-jected to membrane floatation (A) or subcellular fractionation (B).Fractions were subjected to Western blotting and were probed withantibody to CNX, N, or actin. (A) Vero E6 cell extracts containingtransiently expressed N were brought to 1.4 M sucrose and centrifugedas described in Materials and Methods. Fractions were collected fromthe top, and proteins were precipitated. (B) Immunoblot analyses ofPNS, soluble supernatant (S), and particulate pellet (P) fractions byfollowing the treatment or no treatment (NT) and centrifugation reg-imen described in Materials and Methods. TX-100, Triton X-100.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

8640


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

(Fig. 5B). At 24 h p.i., CytD treatment disrupted most of theactin; however, the distribution of N was not affected, as shownby the unchanged, perinuclear accumulation of N (comparethe distribution of N in Fig. 5A with that of N in Fig. 5B). Toexplore the association with the microtubular cytoskeleton,NOC, a reversible microtubule-depolymerizing agent, wasused to probe HTNV-infected cells. In contrast to CytD, NOCtreatment of HTNV-infected cells resulted in extensive redis-tribution of N from perinuclear to peripheral sites (Fig. 5D).BFA is shown for comparison in Fig. 5C.

The redistribution of N upon treatment of NOC in virus-infected cells and the lack of colocalization with actin led us toexamine the possible association of N with microtubules. An-tibodies against �-tubulin and N were used to analyze therelative distribution of these proteins in HTNV-infected cells(Fig. 5E). At 24 h p.i., we observed a juxtaposition of N withthe microtubules that resembled a classic bead-on-a-string pat-tern (Fig. 5E, left panel and middle panel). Further, treatmentof HTNV-infected cells with NOC for 1 h redistributed N intoa pattern that resembled depolymerized microtubules (Fig. 5E,right panel).

Microtubules promote transport of N in the absence ofother viral proteins. Since N was redistributed from the peri-nuclear region upon NOC treatment, and not upon CytD treat-ment, in HTNV-infected cells, we repeated the drug treatmentstudies to analyze the distribution of the HTNV N protein intransiently expressed cells in the absence of other viral pro-teins. Dual-immunofluorescence labeling of Vero E6 cellstransfected with pcHTNVN showed perinuclear accumulationof N that did not coincide with the F-actin staining (Fig. 6A).Furthermore, we did not see any redistribution of N upontreatment of cells with CytD, although the drug affected theactin distribution (Fig. 6B). In contrast, treatment of Vero E6cells with BFA or NOC for 1 h resulted in redistribution of Nproteins without affecting the distribution of the actin filaments(Fig. 6C and D). Overall, our data support the transport of Nvia microtubules expressed alone or in the context of otherviral components.

Involvement of dynein in microtubule-mediated HTNV Ntransport. The molecular motors kinesin and dynein play im-portant roles in cellular trafficking (63, 79), including traffick-ing of viruses (14, 21). Cytoplasmic dynein, together with itsactivator dynactin, is a multisubunit macromolecular complexnecessary for cargo transport (21, 63, 80, 81). Overexpressionof dynamitin (p50), a component of the dynein complex, re-sults in disruption of dynein-dependent transport by a domi-nant-negative effect (9, 16, 35, 77). The accumulation of Nwithin a perinuclear region suggested the involvement ofdynein motor activity for transport of N. Hence, we overex-pressed dynamitin in the presence of N to explore the involve-ment of dynein in trafficking of N to the perinuclear region.

Vero E6 cells were transfected with a plasmid expressing aGFP-tagged dynamitin, and after 4 h they were infected withHTNV. Two days after viral infection, cells were treated andprocessed for immunofluorescence. Representative images ofthree treatments are shown in Fig. 7A (N alone [left], N plusNOC [central], and N plus dynamitin [right]). We quantifiedthe area of the cell occupied by N in untreated cells and in cellstreated with NOC or expressing dynamitin (Fig. 6B). Ten to 20cells were randomly chosen, and the intracellular distributionof N was quantified by measuring the ratio of the area occupiedby N in the cells (Fig. 7A, inner circle) to the total cell area(Fig. 7A, outer circle), as depicted. The area of the HTNV-infected cells occupied by N was 14.7% of the total cell area(Fig. 7B, column 1). In HTNV-infected cells treated withNOC, the area of the cell occupied by N was 42% (Fig. 7B,column 2). In cells expressing N and dynamitin (p50), the areaof the cell occupied by N was 44.3% (Fig. 7B, column 4). NOCwashout (recovery) after a 1-h treatment of infected cells withNOC resulted in a decrease in the area of the cell occupied byN to 24.9% (Fig. 7B, column 3). Such a decrease was absent orwas negligible in HTNV-infected cells expressing dynamitin(Fig. 7B, column 5). Finally, in experiments that coexpressed Nalone or with p50-GFP, we observed the absence of perinu-clear N distribution in transfected Vero E6 cells (data notshown). This suggests that motor-mediated transport via mi-crotubules facilitates N delivery to the perinuclear region ofthe cell. Cells expressing dynamitin limited accumulation of Nin the perinuclear region.

BFA and NOC affect viral replication. Our experimentsshowed that N in HTNV-infected cells was redistributed uponBFA or NOC treatment. We hypothesized that redistributionof N and associated structures may inhibit virus replication.We also expected that BFA and NOC would inhibit virusproduction, since an intact Golgi compartment is required forHTNV maturation. To determine the requirement for ERGICand associated perinuclear structures in virus replicationand virus production, we compared the effects of BFA,NOC, CytD, and RBV on vRNA levels and virus producedat 1 h prior to HTNV infection (pretreatment) and 8 h p.i.(posttreatment). RBV inhibits HTNV replication andserved as a positive control of vRNA inhibition (69). Theconcentrations of the drugs used showed no cytotoxicity(data not shown). Relative HTNV vRNA levels were mea-sured by quantitative RT-PCR from total RNA extractionsof Vero E6 cells, and infectious virus production was mea-sured by infectious virus center assay.

As expected, all of the drug pretreatments inhibited thelevel of infectious virus released to nearly 100% (data notshown). Posttreatment with BFA or NOC inhibited infec-tious virus production; however, CytD had a reduced effect(Table 1). These results were not unexpected, since the main

FIG. 5. Redistribution of N in HTNV-infected Vero E6 cells and redistribution upon treatment with CytD, BFA, or NOC. Vero E6 cells wereinfected with HTNV at an MOI of 0.1, and after 3 days the cells were treated for 1 h with a mock vector (A), CytD (B), BFA (C), or NOC (Dand E). Slides were acetone fixed and processed for indirect immunofluorescence. Cells were costained either with anti-N E-314 antibody to detectN (green) and TRITC-conjugated phalloidin to detect filamentous actin (red) (A to D) or with rabbit polyclonal anti-N no. 143 antibody to detectN (red) and anti-�-tubulin to detect the microtubules (green) (E). Scale bars: panels A to D, 20 �m, using 63� objectives; panel E, 20 �m, with100� objectives (Leica confocal microscope). �-tub, �-tubulin.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

inhibitory target of CytD is virus entry and BFA would beexpected to affect assembly and/or budding, which requiresan intact Golgi compartment. Interestingly, both NOC andBFA reduced levels of vRNA in posttreatment studies (Ta-ble 1). CytD had no effect on replication. This suggests a

requirement for microtubules and an intact ERGIC in theproduction of vRNA.

Infection with HTNV causes vimentin rearrangement. Vi-mentin is a major component of type III intermediate filaments(5, 18), and it has been implicated as a structural component in

FIG. 6. Distribution of N in Vero E6 cells and redistribution upon treatment with CytD, BFA, or NOC. Vero E6 cells were transfected withpcHTNVN, which expresses N, and after 18 h the cells were treated with a mock vector (A), CytD (B), BFA (C), or NOC (D). Slides were acetonefixed, stained, and processed for indirect immunofluorescence as mentioned for infected cells in the legend to Fig. 5. Scale bars, 20 �m, with 100�objectives (Leica confocal microscope).



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the replication processes of several viruses (10–12, 40, 50, 51,77). We noted in our studies that N did not completely colo-calize with ERGIC, although the majority of N did. Therefore,it was worth asking whether vimentin was associated with N inHTNV-infected cells.

We employed confocal microscopy and costained HTNV-infected Vero E6 cells with antibodies against vimentin and N.We analyzed the relative distribution of these proteins on day5 p.i. (Fig. 8A). Cross-sections of vimentin with N in the z axisshowed localization in the same plane (Fig. 8A, bottom pan-els). Interestingly, vimentin filaments appeared to form cagesaround highly condensed N that had accumulated in the pe-

FIG. 7. Overexpression of dynamitin abrogated accumulation of N in the perinuclear region. Vero E6 cells were cotransfected with p50-GFP(green) and pcHTNVN (red). (A) Vero E6 cells infected with HTNV are shown, either mock treated (left panel), treated for 1 h with NOC (centerpanel), or cotransfected with p50 (right panel). Scale bars, 20 �m, using 63� objectives (Axiovert 200 microscope). (B) Examples of measurementsthat were used to obtain values for various treatments. The following equation was used: % HTNV N area/cell � (total area of N occupied in thecell/total area of the cell) � 100. The percentage of N found in the perinuclear region and/or p50-GFP in the presence or absence of NOC isindicated. Error bars for each treatment condition were calculated as the means standard deviations of measurements of 10 to 20 cells pickedrandomly from different fields within the respective treatment groups.

TABLE 1. Relative percentages of inhibition of HTNV vRNAS-segment levels and levels of infectious virus in the

absence and presence of drugs

Treatment % Inhibition of vRNAat 8 h p.i.a

Level of infectiousvirusb (PFU/ml)

None 0 0BFA 52 100CytD 0 71NOC 56 92RBV 73 91

a Relative HTNV vRNA levels were quantified using the 2��CT method and18S rRNA as an internal control.

b Wild-type infection levels corresponded to 2.5 � 105 PFU/ml.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

rinuclear region (see the merged image in Fig. 8A). Addi-tionally, vimentin remodeling was observed in cells tran-siently expressing N (Fig. 8B). In the absence of HTNVinfection, vimentin filaments were distributed throughout

the cell (Fig. 8C, left and central panels), unlike what wasseen with HTNV-infected cells (Fig. 8C, right panel). Thissuggests that N alone can induce the formation of thesevimentin structures.

FIG. 8. Relationship of N and vimentin in HTNV-infected and pcHTNVN-transfected Vero E6 cells. Vero E6 cells were infected with HTNV at an MOIof 0.1 (A) or were transfected with pcHTNVN (B), and after 5 days or 24 h, respectively, slides were acetone fixed and processed for indirect immunofluores-cence. (A) Infected cells were costained for N (red) and vimentin (green); (B) transfected cells were costained for N (green) and vimentin (red). (C) Enlarge-ments of uninfected (left and middle panels) and infected (right panel) Vero E6 cells. Scale bars, 20 �m, using 63� objectives (Leica confocal microscope).(A) The yellow arrow points to vimentin cages. The cell in the upper middle panel (marked by the yellow arrow) was enlarged, and a z section was performedon the xzy axes to demonstrate the plane of cage formation around N. Note the distinct small circles formed upon cage formation. The white arrows point tovimentin redistribution and aster formation.

8644


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

DISCUSSION

Herein we address where and how hantaviral N trafficswithin the cell and how this may be important for virus repli-cation. Using antibodies to various subcellular compartmentsand the HTNV structural N, we show that N colocalized withERGIC but not with the Golgi compartment, ER, F-actin, orEE. These data suggest that N directly targeted the ERGICprior to movement to the Golgi compartment and imply thatonce HTNV N traffics to the Golgi compartment, it rapidlyassembles into the virion. The ERGIC constitutes an indepen-dent structure that is not continuous with the ER or the cis-Golgi compartment (7, 37, 67). ERGIC is maintained by acontinuous flow of membranes mediated by molecular motorproteins that include the microtubule-minus-end-directed pro-tein dynein, the microtubule-plus-end-directed motor kinesin,microtubules, actin, and various Rab GTPases. Together, theyferry cargo bidirectionally to the ER and to the cis-Golgi bodyfrom ERGIC (4, 58). ERGIC participates in the biogenesis ofmany viruses (36, 45, 56, 57, 60–62, 73). Within the Bunyaviri-dae family, Uukuniemi virus (UUKV) particles localize to pe-ripherally and centrally localized elements within the ERGIC.Further, budding of UUKV has been reported to begin in theERGIC and continue in the Golgi compartment (24). Addi-tional immunocytochemical and electron microscopic studiesof other genera in the Bunyaviridae are warranted to determinethe use of this compartment in morphogenesis in general.

The redistribution of N from the perinuclear region upontreatment with NOC and BFA suggested a possible associationof N with membranes. There is no evidence so far for any kindof membrane-associated, posttranslational modifications in Nfor any of the hantaviruses (66). However, the N proteinsexpressed from plasmids from UUKV (24) and BCCV (54) aswell as the N and L proteins of the Tula virus (38) have beenshown to associate with microsomal membranes. Our mem-brane floatation and subcellular fractionation of N, expressedfrom a plasmid or from HTNV-infected cells, showed that onlya tiny fraction of HTNV N associated with membranes. Be-cause of the very small amount, it will be difficult to determineexperimentally the composition of the membrane in the frac-tion that floated with N; however, it is highly likely that this Nfraction is associated with the Golgi compartment.

BCCV N colocalizes with actin microfilaments, and actin hasbeen proposed to be involved in BCCV biogenesis (55). Sim-ilarly, actin colocalizes with N of Crimean-Congo hemorrhagicfever virus (CCHFV), a member of the Nairovirus genus withinthe Bunyaviridae. Treatment of CCHFV-infected cells with 1�g/ml CytD resulted in the redistribution of CCHFV N fromthe perinuclear region (3). In our studies, NOC, but not CytD,caused a rapid redistribution of N in virus-infected cells andtransfected cells, suggesting that microtubules, but not actin,are involved in N trafficking and/or retention at the ERGIC.Further, coexpression of dynamitin with N resulted in the ab-rogation of perinuclear N transport, thus providing evidencefor dynein-mediated microtubule transport of N.

We asked if microtubules and the ERGIC were necessaryfor HTNV replication. We examined vRNA levels in the ab-sence or presence of BFA, NOC, and CytD. BFA and NOCinhibited HTNV replication at the level of RNA synthesiswhen added at 8 h p.i., while CytD had no effect on vRNA

synthesis. BFA is known to inhibit replication of poliovirus, apositive-stranded RNA virus (13, 23, 46), and vesicular stoma-titis virus, a negative-stranded RNA virus (22). Microtubule-depolymerizing drugs such as NOC interfere with the deliveryof many unrelated viral proteins to the intracellular sites ofreplication (reviewed in reference 71). BFA- and NOC-medi-ated inhibition of hantaviral RNA synthesis suggests that theERGIC is important for viral replication. Further studies arerequired to understand the mechanism by which BFA andNOC inhibit HTNV vRNA replication.

Several studies have shown targeting of N to the perinuclearregion, and based on early electron microscopy work, it hasbeen assumed that hantaviral N targets the Golgi body (29, 31,38, 54, 76). Our studies show the involvement of microtubulesin HTNV N transport and that HTNV N initially targets theERGIC region and not the Golgi compartment. These find-ings, and the decrease in viral replication with BFA or NOCtreatment, suggest a function for this region in the virus lifecycle. Further, we show that N accumulation coincided withthe remodeling of the vimentin structure and formation ofcage-like structures that surround N. Vimentin remodeling hasbeen reported to play important roles in many aspects of virusreplication (10–12, 40, 50, 51, 77). It is possible that duringHTNV infection, vimentin generates a unique scaffold to en-hance replication of the virus or to create an environmentinside or outside of these structures that facilitates virus rep-lication and transcription. Clearly, additional studies with cel-lular and viral markers at the ultrastructural level could yieldvaluable insight into these structures. In summary, our studiessupport a central role for the ERGIC in the hantaviral lifecycle prior to assembly. Future studies will address the inter-play of the ERGIC and the Golgi compartment and how theseinteractions lead to the assembly of this fascinating emergingvirus.

ACKNOWLEDGMENTS

We thank William Britt for providing the p50-GFP construct.H.N.R. was supported by an internship made available through the

Southern Research Institute.

REFERENCES

1. Alfadhli, A., Z. Love, B. Arvidson, J. Seeds, J. Willey, and E. Barklis. 2001.Hantavirus nucleocapsid protein oligomerization. J. Virol. 75:2019–2023.

2. Alfadhli, A., E. Steel, L. Finlay, H. P. Bachinger, and E. Barklis. 2002.Hantavirus nucleocapsid protein coiled-coil domains. J. Biol. Chem. 277:27103–27108.

3. Andersson, I., M. Simon, A. Lundkvist, M. Nilsson, A. Holmstrom, F. Elgh,and A. Mirazimi. 2004. Role of actin filaments in targeting of CrimeanCongo hemorrhagic fever virus nucleocapsid protein to perinuclear regionsof mammalian cells. J. Med. Virol. 72:83–93.

4. Appenzeller-Herzog, C., and H. P. Hauri. 2006. The ER-Golgi intermediatecompartment (ERGIC): in search of its identity and function. J. Cell Sci.119:2173–2183.

5. Azumi, N., and H. Battifora. 1987. The distribution of vimentin and keratinin epithelial and nonepithelial neoplasms. A comprehensive immunohisto-chemical study on formalin- and alcohol-fixed tumors. Am. J. Clin. Pathol.88:286–296.

6. Balch, W. E., W. G. Dunphy, W. A. Braell, and J. E. Rothman. 1984.Reconstitution of the transport of protein between successive compartmentsof the Golgi measured by the coupled incorporation of N-acetylglucosamine.Cell 39:405–416.

7. Bannykh, S. I., T. Rowe, and W. E. Balch. 1996. The organization of endo-plasmic reticulum export complexes. J. Cell Biol. 135:19–35.

8. Bishop, D. H. L. 1996. Biology and molecular biology of bunyaviruses, p.19–61. In R. M. Elliot (ed.), The Bunyaviridae. Plenum Press, New York, NY.

9. Burkhardt, J. K., C. J. Echeverri, T. Nilsson, and R. B. Vallee. 1997. Over-expression of the dynamitin (p50) subunit of the dynactin complex disrupts



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

dynein-dependent maintenance of membrane organelle distribution. J. CellBiol. 139:469–484.

10. Carvalho, Z. G., A. P. De Matos, and C. Rodrigues-Pousada. 1988. Associ-ation of African swine fever virus with the cytoskeleton. Virus Res. 11:175–192.

11. Chen, M., R. Goorha, and K. G. Murti. 1986. Interaction of frog virus 3 withthe cytomatrix. IV. Phosphorylation of vimentin precedes the reorganizationof intermediate filaments around the virus assembly sites. J. Gen. Virol.67:915–922.

12. Cordo, S. M., and N. A. Candurra. 2003. Intermediate filament integrity isrequired for Junin virus replication. Virus Res. 97:47–55.

13. Doedens, J., L. A. Maynell, M. W. Klymkowsky, and K. Kirkegaard. 1994.Secretory pathway function, but not cytoskeletal integrity, is required inpoliovirus infection. Arch. Virol. Suppl. 9:159–172.

14. Dohner, K., C. H. Nagel, and B. Sodeik. 2005. Viral stop-and-go alongmicrotubules: taking a ride with dynein and kinesins. Trends Microbiol.13:320–327.

15. Dohner, K., and B. Sodeik. 2005. The role of the cytoskeleton during viralinfection. Curr. Top. Microbiol. Immunol. 285:67–108.

16. Dohner, K., A. Wolfstein, U. Prank, C. Echeverri, D. Dujardin, R. Vallee,and B. Sodeik. 2002. Function of dynein and dynactin in herpes simplex viruscapsid transport. Mol. Biol. Cell 13:2795–2809.

17. Flick, K., J. W. Hooper, C. S. Schmaljohn, R. F. Pettersson, H. Feldmann,and R. Flick. 2003. Rescue of Hantaan virus minigenomes. Virology 306:219–224.

18. Franke, W. W., E. Schmid, S. Winter, M. Osborn, and K. Weber. 1979.Widespread occurrence of intermediate-sized filaments of the vimentin-typein cultured cells from diverse vertebrates. Exp. Cell. Res. 123:25–46.

19. Gavrilovskaya, I. N., E. J. Brown, M. H. Ginsberg, and E. R. Mackow. 1999.Cellular entry of hantaviruses which cause hemorrhagic fever with renalsyndrome is mediated by �3 integrins. J. Virol. 73:3951–3959.

20. Gavrilovskaya, I. N., M. Shepley, R. Shaw, M. H. Ginsberg, and E. R.Mackow. 1998. �3 Integrins mediate the cellular entry of hantaviruses thatcause respiratory failure. Proc. Natl. Acad. Sci. USA 95:7074–7079.

21. Greber, U. F., and M. Way. 2006. A superhighway to virus infection. Cell124:741–754.

22. Irurzun, A., L. Perez, and L. Carrasco. 1993. Brefeldin A blocks proteinglycosylation and RNA replication of vesicular stomatitis virus. FEBS Lett.336:496–500.

23. Irurzun, A., L. Perez, and L. Carrasco. 1992. Involvement of membranetraffic in the replication of poliovirus genomes: effects of brefeldin A. Virol-ogy 191:166–175.

24. Jantti, J., P. Hilden, H. Ronka, V. Makiranta, S. Keranen, and E. Kuis-manen. 1997. Immunocytochemical analysis of Uukuniemi virus buddingcompartments: role of the intermediate compartment and the Golgi stack invirus maturation. J. Virol. 71:1162–1172.

25. Jin, M., J. Park, S. Lee, B. Park, J. Shin, K. J. Song, T. I. Ahn, S. Y. Hwang,B. Y. Ahn, and K. Ahn. 2002. Hantaan virus enters cells by clathrin-depen-dent receptor-mediated endocytosis. Virology 294:60–69.

26. Johnson, K. 1999. Introduction, p. 1–6. In C. C. Ho Wang Lee and ConnieSchmaljohn (ed.), Manual of hemorrhagic fever with renal syndrome andhantavirus pulmonary syndrome. WHO Collaborating Center for Virus Ref-erence and Research (Hantaviruses), Asian Institute for Life Sciences,Seoul, Korea.

27. Jonsson, C. B., J. Gallegos, P. Ferro, W. Severson, X. Xu, and C. S. Schmal-john. 2001. Purification and characterization of the Sin Nombre virus nu-cleocapsid protein expressed in Escherichia coli. Protein Expr. Purif. 23:134–141.

28. Jonsson, C. B., and C. S. Schmaljohn. 2001. Replication of hantaviruses.Curr. Top. Microbiol. Immunol. 256:15–32.

29. Kariwa, H., H. Tanabe, T. Mizutani, Y. Kon, K. Lokugamage, N. Lokugam-age, M. A. Iwasa, T. Hagiya, K. Araki, K. Yoshimatsu, J. Arikawa, andI. Takashima. 2003. Synthesis of Seoul virus RNA and structural proteins incultured cells. Arch. Virol. 148:1671–1685.

30. Kaukinen, P., V. Koistinen, O. Vapalahti, A. Vaheri, and A. Plyusnin. 2001.Interaction between molecules of hantavirus nucleocapsid protein. J. Gen.Virol. 82:1845–1853.

31. Kaukinen, P., V. Kumar, K. Tulimaki, P. Engelhardt, A. Vaheri, andA. Plyusnin. 2004. Oligomerization of hantavirus N protein: C-terminal�-helices interact to form a shared hydrophobic space. J. Virol. 78:13669–13677.

32. Kaukinen, P., A. Vaheri, and A. Plyusnin. 2005. Hantavirus nucleocapsidprotein: a multifunctional molecule with both housekeeping and ambassa-dorial duties. Arch. Virol. 150:1693–1713.

33. Kaukinen, P., A. Vaheri, and A. Plyusnin. 2003. Mapping of the regionsinvolved in homotypic interactions of Tula hantavirus N protein. J. Virol.77:10910–10916.

34. Kaukinen, P., A. Vaheri, and A. Plyusnin. 2003. Non-covalent interactionbetween nucleocapsid protein of Tula hantavirus and small ubiquitin-relatedmodifier-1, SUMO-1. Virus Res. 92:37–45.

35. Kim, S., H.-Y. Kim, S. Lee, S. W. Kim, S. Sohn, K. Kim, and H. Cho. 2007.

Hepatitis B virus X protein induces perinuclear mitochondrial clustering inmicrotubule- and dynein-dependent manners. J. Virol. 81:1714–1726.

36. Klumperman, J., J. K. Locker, A. Meijer, M. C. Horzinek, H. J. Geuze, andP. J. Rottier. 1994. Coronavirus M proteins accumulate in the Golgi complexbeyond the site of virion budding. J. Virol. 68:6523–6534.

37. Klumperman, J., A. Schweizer, H. Clausen, B. L. Tang, W. Hong, V.Oorschot, and H. P. Hauri. 1998. The recycling pathway of proteinERGIC-53 and dynamics of the ER-Golgi intermediate compartment. J. CellSci. 111:3411–3425.

38. Kukkonen, S. K., A. Vaheri, and A. Plyusnin. 2004. Tula hantavirus L proteinis a 250 kDa perinuclear membrane-associated protein. J. Gen. Virol. 85:1181–1189.

39. Lakadamyali, M., M. J. Rust, and X. Zhuang. 2006. Ligands for clathrin-mediated endocytosis are differentially sorted into distinct populations ofearly endosomes. Cell 124:997–1009.

40. Lake, J. A., J. Carr, F. Feng, L. Mundy, C. Burrell, and P. Li. 2003. The roleof Vif during HIV-1 infection: interaction with novel host cellular factors.J. Clin. Virol. 26:143–152.

41. Lee, H. W., and G. van der Groen. 1989. Hemorrhagic fever with renalsyndrome. Prog. Med. Virol. 36:62–102.

42. Lee, P. W., C. J. Gibbs, Jr., D. C. Gajdusek, and R. Yanagihara. 1985.Serotypic classification of hantaviruses by indirect immunofluorescent anti-body and plaque reduction neutralization tests. J. Clin. Microbiol. 22:940–944.

43. Li, X. D., T. P. Makela, D. Guo, R. Soliymani, V. Koistinen, O. Vapalahti, A.Vaheri, and H. Lankinen. 2002. Hantavirus nucleocapsid protein interactswith the Fas-mediated apoptosis enhancer Daxx. J. Gen. Virol. 83:759–766.

44. Lippincott-Schwartz, J., L. C. Yuan, J. S. Bonifacino, and R. D. Klausner.1989. Rapid redistribution of Golgi proteins into the ER in cells treated withbrefeldin A: evidence for membrane cycling from Golgi to ER. Cell 56:801–813.

45. Mackenzie, J. M., M. K. Jones, and E. G. Westaway. 1999. Markers fortrans-Golgi membranes and the intermediate compartment localize to in-duced membranes with distinct replication functions in flavivirus-infectedcells. J. Virol. 73:9555–9567.

46. Maynell, L. A., K. Kirkegaard, and M. W. Klymkowsky. 1992. Inhibition ofpoliovirus RNA synthesis by brefeldin A. J. Virol. 66:1985–1994.

47. Mir, M. A., and A. T. Panganiban. 2005. The hantavirus nucleocapsid pro-tein recognizes specific features of the viral RNA panhandle and is altered inconformation upon RNA binding. J. Virol. 79:1824–1835.

48. Mir, M. A., and A. T. Panganiban. 2004. Trimeric hantavirus nucleocapsidprotein binds specifically to the viral RNA panhandle. J. Virol. 78:8281–8288.

49. Misumi, Y., Y. Misumi, K. Miki, A. Takatsuki, G. Tamura, and Y. Ikehara.1986. Novel blockade by brefeldin A of intracellular transport of secretoryproteins in cultured rat hepatocytes. J. Biol. Chem. 261:11398–11403.

50. Murti, K. G., R. Goorha, and M. W. Klymkowsky. 1988. A functional role forintermediate filaments in the formation of frog virus 3 assembly sites. Vi-rology 162:264–269.

51. Nedellec, P., P. Vicart, C. Laurent-Winter, C. Martinat, M. C. Prevost, andM. Brahic. 1998. Interaction of Theiler’s virus with intermediate filaments ofinfected cells. J. Virol. 72:9553–9560.

52. Peters, C. J., and A. S. Khan. 2002. Hantavirus pulmonary syndrome: thenew American hemorrhagic fever. Clin. Infect. Dis. 34:1224–1231.

53. Radtke, K., K. Dohner, and B. Sodeik. 2006. Viral interactions with thecytoskeleton: a hitchhiker’s guide to the cell. Cell. Microbiol. 8:387–400.

54. Ravkov, E. V., and R. W. Compans. 2001. Hantavirus nucleocapsid protein isexpressed as a membrane-associated protein in the perinuclear region. J. Vi-rol. 75:1808–1815.

55. Ravkov, E. V., S. T. Nichol, C. J. Peters, and R. W. Compans. 1998. Role ofactin microfilaments in Black Creek Canal virus morphogenesis. J. Virol.72:2865–2870.

56. Risco, C., J. R. Rodriguez, C. Lopez-Iglesias, J. L. Carrascosa, M. Esteban,and D. Rodriguez. 2002. Endoplasmic reticulum-Golgi intermediate com-partment membranes and vimentin filaments participate in vaccinia virusassembly. J. Virol. 76:1839–1855.

57. Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodriguez.1997. Characterization of early stages in vaccinia virus membrane biogenesis:implications of the 21-kilodalton protein and a newly identified 15-kilodaltonenvelope protein. J. Virol. 71:1821–1833.

58. Roghi, C., and V. J. Allan. 1999. Dynamic association of cytoplasmic dyneinheavy chain 1a with the Golgi apparatus and intermediate compartment.J. Cell Sci. 112:4673–4685.

59. Rowe, R. K., and A. Pekosz. 2006. Bidirectional virus secretion and noncili-ated cell tropism following Andes virus infection of primary airway epithelialcell cultures. J. Virol. 80:1087–1097.

60. Salanueva, I. J., J. L. Carrascosa, and C. Risco. 1999. Structural maturationof the transmissible gastroenteritis coronavirus. J. Virol. 73:7952–7964.

61. Salmons, T., A. Kuhn, F. Wylie, S. Schleich, J. R. Rodriguez, D. Rodriguez,M. Esteban, G. Griffiths, and J. K. Locker. 1997. Vaccinia virus membraneproteins p8 and p16 are cotranslationally inserted into the rough endoplas-



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

mic reticulum and retained in the intermediate compartment. J. Virol. 71:7404–7420.

62. Sanchez, V., E. Sztul, and W. J. Britt. 2000. Human cytomegalovirus pp28(UL99) localizes to a cytoplasmic compartment which overlaps the endo-plasmic reticulum-Golgi-intermediate compartment. J. Virol. 74:3842–3851.

63. Schliwa, M., and G. Woehlke. 2003. Molecular motors. Nature 422:759–765.64. Schmaljohn, C. 1996. Molecular biology of hantaviruses, p. 63–90. In R.

Elliot (ed.), The Bunyaviridae. Plenum Press, New York, NY.65. Schmaljohn, C., and B. Hjelle. 1997. Hantaviruses: a global disease problem.

Emerg. Infect. Dis. 3:95–104.66. Schmaljohn, C. S., and J. W. Hooper. 2001. Bunyaviridae: the viruses and

their replication, p. 1581–1633. In B. N. Fields and D. M. Knipe (ed.), Fieldsvirology, 4th ed., vol. 2. Lippincott Williams & Wilkins, Philadelphia, PA.

67. Sesso, A., F. P. de Faria, E. S. Iwamura, and H. Correa. 1994. A three-dimensional reconstruction study of the rough ER-Golgi interface in serialthin sections of the pancreatic acinar cell of the rat. J. Cell Sci. 107:517–528.

68. Severson, W., X. Xu, M. Kuhn, N. Senutovitch, M. Thokala, F. Ferron, S.Longhi, B. Canard, and C. B. Jonsson. 2005. Essential amino acids of theHantaan virus N protein in its interaction with RNA. J. Virol. 79:10032–10039.

69. Severson, W. E., C. S. Schmaljohn, A. Javadian, and C. B. Jonsson. 2003.Ribavirin causes error catastrophe during Hantaan virus replication. J. Virol.77:481–488.

70. Smith, A. E., and A. Helenius. 2004. How viruses enter animal cells. Science304:237–242.

71. Smith, G. A., and L. W. Enquist. 2002. Break ins and break outs: viralinteractions with the cytoskeleton of mammalian cells. Annu. Rev. Cell Dev.Biol. 18:135–161.

72. Sodeik, B. 2000. Mechanisms of viral transport in the cytoplasm. TrendsMicrobiol. 8:465–472.

73. Sodeik, B., R. W. Doms, M. Ericsson, G. Hiller, C. E. Machamer, W. van’t

Hof, G. van Meer, B. Moss, and G. Griffiths. 1993. Assembly of vacciniavirus: role of the intermediate compartment between the endoplasmic retic-ulum and the Golgi stacks. J. Cell Biol. 121:521–541.

74. Sodeik, B., M. W. Ebersold, and A. Helenius. 1997. Microtubule-mediatedtransport of incoming herpes simplex virus 1 capsids to the nucleus. J. CellBiol. 136:1007–1021.

75. Spiropoulou, C. F. 2001. Hantavirus maturation. Curr. Top. Microbiol. Im-munol. 256:33–46.

76. Spiropoulou, C. F., C. S. Goldsmith, T. R. Shoemaker, C. J. Peters, andR. W. Compans. 2003. Sin Nombre virus glycoprotein trafficking. Virology308:48–63.

77. Stefanovic, S., M. Windsor, K. I. Nagata, M. Inagaki, and T. Wileman. 2005.Vimentin rearrangement during African swine fever virus infection involvesretrograde transport along microtubules and phosphorylation of vimentin bycalcium calmodulin kinase II. J. Virol. 79:11766–11775.

78. Sun, Y., D. H. Chung, Y. K. Chu, C. B. Jonsson, and W. B. Parker. 2007.Activity of ribavirin against Hantaan virus correlates with production ofribavirin-5�-triphosphate, not with inhibition of IMP dehydrogenase. Anti-microb. Agents Chemother. 51:84–88.

79. Vallee, R. B., J. C. Williams, D. Varma, and L. E. Barnhart. 2004. Dynein:an ancient motor protein involved in multiple modes of transport. J. Neu-robiol. 58:189–200.

80. Vaughan, K. T., and R. B. Vallee. 1995. Cytoplasmic dynein binds dynactinthrough a direct interaction between the intermediate chains andp150Glued. J. Cell Biol. 131:1507–1516.

81. Vaughan, P. S., J. D. Leszyk, and K. T. Vaughan. 2001. Cytoplasmic dyneinintermediate chain phosphorylation regulates binding to dynactin. J. Biol.Chem. 276:26171–26179.

82. Xu, X., W. Severson, N. Villegas, C. S. Schmaljohn, and C. B. Jonsson. 2002.The RNA binding domain of the Hantaan virus N protein maps to a central,conserved region. J. Virol. 76:3301–3308.



http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Documents

Dynein-Dependent Transport of the Hantaan Virus Nucleocapsid Protein to the Endoplasmic Reticulum-Golgi Intermediate Compartment