DNA markers for identifying biotypes Band Q of Bemisia tabaci

(Hemiptera: Aleyrodidae) and studyingpopulation dynamics

V. Khasdan1, I. Levin2, A. Rosner2, S. Morin3,S. Kontsedalov2, L. Maslenin2 and A.R. Horowitz1 *1Department of Entomology, Agricultural Research Organization,

Gilat Research Center, M.P. Negev, 85280, Israel: 2The Volcani Center,Bet Dagan, 50250, Israel: 3Department of Entomology, Hebrew University

of Jerusalem, Faculty of Agriculture, Rehovot, 76100, Israel

Abstract

The two most widespread biotypes of Bemisia tabaci (Gennadius) in southernEurope and the Middle East are referred to as the B and Q-type, which aremorphologically indistinguishable. In this study various DNA markers have beendeveloped, applied and compared for studying genetic diversity and distributionof the two biotypes. For developing sequence characterized amplified regions(SCAR) and cleaved amplified polymorphic sequences (CAPS) techniques, singlerandom amplified polymorphic DNA (RAPD) fragments of B and Q biotypes,respectively, were used. The CAPS were investigated on the basis of nuclearsodium channel and the mitochondrial cytochrome oxidase I genes (mtCOI)sequences. In general, complete agreement was found between the differentmarkers used. Analysis of field samples collected in Israel for several years, usingthese markers, indicated that the percentage of the Q biotype tends to increase infield populations as time progresses. This may be attributed to the resistance of theQ biotype to neonicotinoids and pyriproxyfen and the susceptibility of the Bbiotype to these insecticides.

Keywords: whitefly, biotypes, DNA markers, population dynamics

Introduction

The whitefly Bemisia tabaci (Gennadius) (Hemiptera:Aleyrodidae) is a serious pest that damages many agricul-tural crops (Byrne & Bellows, 1991); it is a known vector formore than 100 emergent plant virus species (Jones, 2003).Bemisia tabaci consists of several biotypes (Brown et al., 1995)that have been distinguished largely on the basis ofbiochemical or molecular diagnostics, but whose biologicalsignificance is still unclear. The two most widespread

biotypes of B. tabaci in southern Europe and the MiddleEast are referred to as the B and Q types (Guirao et al., 1997;Rosell et al., 1997; Elbert & Nauen, 2000; Nauen et al., 2002;Horowitz et al., 2003a; Pascual & Callejas, 2004). The fielddynamics and geographical dispersal of the differentbiotypes of B. tabaci have a practical importance becausethese biotypes may differ in several biological traits thataffect host range, their capacities to inflict plant disordersand/or viral diseases, and their susceptibility to variousinsecticides.

Conventional taxonomy and identification of B. tabaci isbased on morphological criteria that cannot entirely distin-guish among biotypes. DNA markers, which have been usedfor defining biotypes, can be divided into two groupsaccording to the specific technology used: hybridization and

*Author for correspondenceFax: ++972-8-9926 485E-mail: hrami@volcani.agri.gov.il

Bulletin of Entomological Research (2005) 95, 605–613 DOI: 10.1079/BER2005390

polymerase chain reaction (PCR)-based polymorphisms.Hybridization techniques include restriction fragment lengthpolymorphisms (RFLP) (Botstein et al., 1980), which isgenerally co-dominant, in particular when single copy DNAprobes are used.

Random DNA polymorphism identification uses mul-tiple arbitrary amplicon profiling (MAAP) techniques, suchas random amplified polymorphic DNA (RAPD) (Williamset al., 1990). This procedure was used to investigate B. tabacigenetic variations (Gawel & Barlett, 1993; De Barro & Driver,1997; Guirao et al., 1997; Calvert et al., 2001; Horowitz et al.,2003a), for taxonomic studies (Perring et al., 1993), and forbiotype identification and geographical distribution (Limaet al., 2002; Horowitz et al., 2003a). While this method isrelatively simple, enabling simultaneous analysis of a largenumber of samples, the banding patterns obtained are oftendifficult to interpret and at times irreproducible. Amplifiedfragment length polymorphism (AFLP) is another PCR-based random technology used for genetic study of B. tabacipopulations (Vos et al., 1995; Cervera et al., 2000). AFLP isbased on RFLP following selective PCR and allows a higherresolution of genetic differences than RAPD (Cervera et al.,2000). However, this technique is relatively complex, timeconsuming, labour intensive, and expensive.

Specific PCR-based polymorphism can be detected bymolecular phylogenetic studies based on comparativesequence analysis of mitochondrial (mtCOI, 16S rDNA) ornuclear DNA (ITS, 18S rDNA). Such analyses have beenperformed to determine the genetic relationships among anumber of B. tabaci populations (Campbell, 1993; Brownet al., 1995; De Barro et al., 1999; Frohlich et al., 1999; Calvertet al., 2001). Because these techniques require sequencing ofthe PCR products, they are relatively expensive and at timesnot practical for large scale analysis of B. tabaci populationdynamics.

Microsatellites are simple sequence repeats (SSRs) thatcan be used to develop locus-specific markers for a widerange of genetic analyses. Recently, microsatellite markerswere also isolated and characterized in B. tabaci (De Barroet al., 2003; Tsagkarakou & Roditakis, 2003). Microsatellitemarkers are highly polymorphic and codominant; howeverthey share a relatively high mutation rate. These markerssometimes have slight differences in length (10–20 oligonu-cleotides) which are possible to detect only by using poly-acrylamide gel electrophoresis (PAGE). Clarification of theevolutionary significance of SSR genomic elements calls fornew critical evidence from the field and laboratory, es-pecially by testing natural populations inhabiting ecologicallyheterogeneous and stressful environments (Li et al., 2002).

Specific PCR primers can also be designed followingsequence analysis of RAPD or AFLP fragments. Suchprimers tend to amplify single loci and are therefore locus-specific (Ohmori et al., 1996; Agusti et al., 2000). Theamplification of such specific PCR markers is usuallyreferred to as sequence characterized amplified regions(SCAR) (Paran & Michelmore, 1993). When the amplifiedfragment does not show size polymorphism betweengenotypes, restriction endonucleases can be further used tovisualize inter-sequence polymorphism. Such polymorph-ism is usually referred to as cleaved amplified polymorphicsequences (CAPS) (Konieczny & Ausubel, 1993).

Israel, a relatively small country with diverseclimatic conditions on one hand and highly intensive andcoordinated agricultural practices on the other, offers a

unique location to study the population dynamics of B. tabaciand its interaction with environmental conditions, host plantspecificity, insecticides applied, and virus transmissioncapability. Such a study can have immense implications forcrop protection. Following screening of several B. tabacipopulations in Israel during 1999–2000, Horowitz et al.(2003a) noted the appearance of the Q biotype at severalgeographical locations previously occupied solely by the Bbiotype. Interestingly, most populations that were defined asthe Q biotype were also resistant to pyriproxyfen andneonicotinoids, while populations defined as B biotype weresusceptible to these insecticides (Horowitz et al., 2003a, 2005).Hence, it is possible that levels of resistance to insecticidesmay have contributed to this population dynamics andcurrent distribution of B and Q biotypes in Israel andelsewhere (i.e. Spain – Guirao et al., 1997; Nauen et al., 2002).

In this manuscript we report the development of simpleand cost-effective markers that distinguish between the twoB. tabaci biotypes (B and Q) using locus-specific DNAmarkers(SCAR and CAPS). These markers were compared withpreviously developed markers, and used to carry out amolecular survey of B. tabaci populations in Israel during2002–2004. The results obtained are compared with an earliersurvey and the shift in the populations’ structure is discussed.

Materials and methods

Standards

As references for Q and B biotypes, B. tabaci individualsfrom the following populations were used: (i) Israeli lab-oratory populations, designated Pyri-R and Pyri-S for Q andB biotypes, respectively (Horowitz et al., 2003a,b); (ii) UK lab-oratory populations (John Innes Centre) designated B- andQ-type; and (iii) Italian populations (Istituto per la Protezionedelle Piante, Consiglio Nazionale delle Richerche (CNR))comprising B-type taken from tomatoes and Q-type fromeggplants. At least 50 individuals of each biotype werescored using the techniques described herein to elucidatetheir suitability as a diagnostic tool.

Bemisia tabaci field populations

The whiteflies used in this study were obtained fromestablished colonies previously described (Horowitz et al.,2003a,b) and also from B. tabaci populations collected during2002–2004 from field and protected crops located in severalregions of Israel. The country was divided into eight areasfrom north to south: Western Galilee, Carmel Coast, Yizre’elValley, Central Israel, Ayalon Valley, South District, WesternNegev and Arava Valley (see table 2). The numbers assignedfor the various B. tabaci populations in table 2 appear on themap of Israel (fig. 5).

In-field random samples of leaves infested with B. tabaciadults and pupae were detached from the plants, confined ina wooden rearing cage (50 by 35 by 35 cm), containing cottonseedlings, and returned to the laboratory within 2–3 h. Thecolonies were maintained on cotton seedlings (‘Acala’) understandard controlled conditions of 26+2�C, 60% RH, and aphotoperiod of 14 : 10 (L:D). Approximately 100 individualsfrom each field population were preserved in 80% ethanol atx30�C until DNA extraction and analysis were performed.In other tests, fresh specimens were used. At least tenindividuals were tested from each field population usingdifferent DNA markers.

606 V. Khasdan et al.

DNA extraction

Two methods were used for DNA extraction throughoutthe course of this study. The first method was according toMorin et al. (2002). Although this method offers a quickextraction procedure, we found it more suitable for freshspecimens. The DNA extraction efficiency for samples storedin ethanol was, however, low and ranged between 40 and70%. The second method was according to Cenis et al. (1993).This methodology was used throughout this study with highefficiency (80–100%), and was, with some modifications, asfollows. Single insects were crushed with a conical grinder in50ml extraction buffer (200mM Tris�HCl pH 8.5, 250mM

NaCl, 25mM EDTA, 0.5% SDS) then 50ml of 3 M sodiumacetate (pH 5.2) were added, and tubes were placed for10min at x20�C. This mixture was subjected to centrifuga-tion for 5min and the resulting supernatant was treated withequal volumes of chloroform-isoamylalcohol (24 : 1, v/v),followed by isopropanol precipitation. The pellet wasrecovered by centrifugation at 13,000 rpm, washed with70% ethanol, dried and resuspended in 12ml of TE buffer(10mM Tris�HCl, 1mM EDTA pH 8.0) with 40mgmlx1

RNase. Two ml of this DNA solution were used as a templatein the PCR reactions.

Recombinant DNA methods and PCR analysisof genomic DNA

DNAmodification and restriction enzymes (MBI Fermen-tas) were used as recommended by the manufacturer andcarried out as described by Sambrook & Russell (2001).Competent cells were prepared and plasmids isolated bystandard procedures. Transformants of Escherichia coli strainXL-Blue MRF’ were selected on Luria-Bertani (LB) platescontaining ampicillin (100 mgmlx1).

Amplification was carried out with 1.5U of Taq DNApolymerase (MBI Fermentas) in a T Gradient Thermocycler(Biometra, Gottingen, Germany). DNA was analysed byelectrophoresis on horizontal 1–2% agarose slab gels with1rTBE buffer for 2 h at 70V and visualized with ethidiumbromide.

For DNA analysis, PCR products were recovered fromagarose gels using the QIAquick gel extraction kit (Qiagen),cloned using the pGEM-T easy vector system (Promega,Wisconsin, USA) and fully sequenced. All sequencingreactions of genomic fragments were carried out by theDNA sequencing facility of the Ben-Gurion University of theNegev using an Applied Biosystems 373 DNA sequencer(Foster City, California, USA). DNA sequence files werevisualized using Chromas version 1.45 (Technelysium PtyLtd) and analysed using software from the National Centerfor Biotechnology Information (NCBI) Basic Blast Search, SanDiego Supercomputer Center (SDSC) and DNAMAN(Lynnon BioSoft, Montreal, Canada).

RAPD–PCR reactions

The reactions were denatured at 94�C for 2min, followedby 30 cycles (1min at 94�C, 1min at 37�C and 2min at 72�C)and a final extension at 72�C for 5min.

The following single 10-mer oligonucleotide primers ofarbitrary sequence were tested: OPA-04, -05, -06, -09, -11;OPB-20; OPC-03; F-12; H-9 (Operon Technologies, Alameda,California, USA). The primer OPA-06 amplified five and

seven PCR products in Q and B biotypes, respectively (fig. 1).The two PCR products, 931 and 1329 bp were selected andprocessed into SCAR or CAPS markers.

Design of locus specific primers and development ofSCAR for biotype B

The biotype B specific RAPD fragment (1329 bp) (fig. 1)was purified from an agarose gel following electrophoresis,cloned and sequenced. The resulting sequences, depositedas GenBank accession AY615707, were analysed and thefollowing oligonucleotide primers were designed: D1-B1 andR2-B1new (table 1). These primers generated a B biotypespecific band (fig. 2A; lanes 1 and 2), following PCRamplification of 30 cycles consisting of: 1min at 94�C(extended to 2min in the first cycle), 1min at 70�C, and1min at 72�C (extended to 5min at the last cycle).

Development of CAPS on the basis of RAPD

The biotype Q specific RAPD fragment, 931 bp in size(fig. 1), was purified from the agarose gels followingelectrophoresis, cloned and sequenced. The resultingsequences were determined and analysed (deposited asGenBank accession AY632696), and the following oligo-nucleotide primers were designed: D1-Q6, R1-Q6 and R2-Q6(table 1).

PCR products were: 477 bp (D1-Q6/R1-Q6) and 683 bp(D1-Q6/R2-Q6). These primers amplified PCR productswhich were monomorphic between the two biotypes.Following sequence comparison of the B and Q biotypes,MspI endonuclease was selected to generate the polymorph-ism suitable for further analysis of these two biotypes(fig. 2B, lanes 2 and 4).

Development of CAPS for sodium channel gene sequences

Two primers, kdr-1 and kdr-A970 (table 1), wereemployed for the PCR amplification and analysis of sodiumchannel gene sequences (850 bp) from B and Q biotypes of B.tabaci. PCR amplification was carried out for 30 cycles

bp

2000

1200 800

500 400 300

Standard

M 1 2 3 C Q B

1329931

Fig. 1. Random amplified polymorphic DNA–polymerase chainreaction (RAPD-PCR) analysis of individual Bemisia tabaci DNAsamples with Operon primer OPA-06. M, 100 bp DNA LadderPlus; lanes 1–3, samples obtained from Sede Eliyyahu (2002),Carmel Coast (2000), and Bet Dagan (2000), respectively; C, acontrol without DNA; Q, biotype Q from population Pyri-R; B,biotype B from population Pyri-S. Arrows mark the position ofQ and B specific bands.

DNA markers for Bemisia tabaci biotypes 607

consisting of 1min at 94�C, 45 s at 50�C and 1min at72�C. An initial cycle of denaturation was carried out for2min at 94�C, and the reaction was terminated by anextension reaction at 72�C for 5min. Following sequenceanalysis of sodium channel gene from both biotypes, AsuIendonuclease was found to distinguish between the twohaplotypes (fig. 3).

Development of CAPS for cytochrome oxidase I gene(mtCOI) sequences

Two primers, C1-J-2195 and L2-N-3014 (table 1), wereused for the PCR amplification and analysis of mtCOI genesequences (816 bp) from the two biotypes (uncut (–) in fig. 4).The PCR amplification reaction was carried out for 30 cyclesconsisting of 1min at 94�C, 1min at 52�C and 1min at 72�C.The first cycle of denaturation was carried out at 94�C for2min, and the reaction was followed by an extension at 72�C

for 7min. DNA fragments of the expected size (816 bp)were recovered from a 1% agarose gel and cloned usingthe pGEM-T easy system. Multiple cloned fragments fromeach strain were fully sequenced (fig. 4). The mtCOIgene sequences of some B. tabaci strains from Israel areavailable in the EMBL and GenBank databases under thefollowing accession numbers: ISR1.1PyriS87 – AY747688;ISR1.2PyriS87 – AY766369; ISR2.1PyriR92 – AY766370;ISR2.2PyriR92 – AY766371; ISR3.2HC00 – AY766372;ISR4.2Ayav99 – AY66373. These sequences were analysedand compared with other mtCOI sequences of B. tabaci,collected from various world locations, and available in theGenBank database. Based on this analysis we developedCAPS markers for the mtCOI gene sequence.

PCR amplification followed by restriction endonucleasedigestion with VspI, generated a clear polymorphismbetween biotypes B and Q. From the PCR products of themtCOI gene (fig. 4, lanes 1, 9 and 11) only a short fragment(�100 bp) was cut out of biotype B (lanes 2, 5–7 and 10),while PCR products of biotype Q yielded two fragments ofabout 500 and 300 bp (lanes 3, 4, 12), respectively.

B Q

1 2 3 4 M Cbp

3000

2000

1000

500

250

A

PrimersD1/R2 D1/R1B Q B Q M C

BB

bp

1500

900

700

400

200

1 2 3 4

AA

D

BBBBBB

Fig. 2. A. Sequence characterized amplified regions (SCAR)analysis based on primers D1-B1 and R2-B1new. Lanes 1 and 2,samples from Bemisia tabaci population Pyri-S (B biotype); lanes3 and 4, samples of populations from Pyri-R (Q biotype); M, 1 kbDNA Ladder; C, control without DNA. Arrow marks theposition of biotype B specific band. B. Cleaved amplifiedpolymorphic sequences (CAPS) analysis using different primercombinations, following digestion with MspI. Lanes 1 and 2,samples from population Pyri-S and Pyri-R, respectively,amplified by D1-Q6 and R2-Q6 primers; lanes 3 and 4, samplesfrom population Pyri-S and Pyri-R, respectively, amplified byD1-Q6 and R1-Q6 primers; M, 100 bp DNA Ladder Plus; C,control without DNA.

Standard B Q

Israel UK Israel UK

1 2 M – + – + – + – + Cbp750

500

250

Fig. 3. Cleaved amplified polymorphic sequences (CAPS)analysis based on primers complementary to the sodiumchannel gene sequence (uncut (–) and digested with AsuI (+)).Lanes 1 and 2, samples of Bemisia tabaci populations fromMa’ayan Zevi, Israel (2003) digested with AsuI; M, 1 kb DNALadder; B, biotype B from population Pyri-S, Israel and biotypeB from John Innes Centre (JIC), UK; Q, biotype Q frompopulation Pyri-R and biotype Q from JIC, UK. C, controlwithout DNA. Arrow marks the position of a B specific band.

Table 1. Polymerase chain reaction (PCR) primers used in this study.

Primer Sequence (50 to 30) Biotype specificity (technique) Gene Reference/origin

OPA-06 GGTCCCTGAC (RAPD–PCR) – Operon Technologies

D1-B1 CCGGTTTCTCAGACCGCCGGCA B (SCAR) – This studyR2-B1new CAAACTTGATGCGACTGGGTC

D1-Q6 CACTATGGGAAGCCTTTACC Q following digestion with – This studyR1-Q6 CTAACAAGAATTTTTCATTTTCG MspI (CAPS)R2-Q6 GTGACTTATTTTATTGCCACGCTC

kdr-1 GCCAAATCCTGGCCAACT B and Q following digestion Sodium Morin et al., 2002kdr-A970 TAGAAGATACTCGGACTGTAC with AsuI (CAPS) channel

C1-J-2195 TTGATTTTTTGGTCATCCAGAAGT B and Q following digestion mtCOI Frohlich et al., 1999L2-N-3014 TCCAATGCACTAATCTGCCATATTA with VspI (CAPS)

CAPS, cleaved amplified polymorphic sequences; RAPD–PCR, random amplified polymorphic DNA–polymerase chain reaction; SCAR,sequence characterized amplified regions.

608 V. Khasdan et al.

Results

DNA markers of B. tabaci biotypes

The DNA markers used in the course of this study arevisually presented in figs 1–4. The considerations which ledto the development of these markers were detailed above, inthe Materials and methods section.

From the field and laboratory B. tabaci whitefly popula-tions examined for their biotype, five were diagnosed usingall four techniques (tables 2 and 3). Many others wereexamined with more than one method. The B and Q biotypeswere successfully identified in all the samples with the fourtechniques, except for a few samples (approximately 11%)that could not be determined with the RAPD technique(table 3).

Comparison of field populations of B. tabacibiotypes in Israel

Table 2 presents populations of B. tabaci collected mainlyduring 2003–2004 from the different areas in Israel. Based oncomparisons with commonly used standards, all methodsdescribed in this study indicate that the B and Q biotypes ofB. tabaci were present in different areas of Israel (table 2;fig. 5) and the definition of the biotypes using the fourtechniques was consistently uniform. In general, 18 collec-tions were found to be Q-type or a mixture with B where Q ispredominant; 15 collections were B-type or a mixture withsmaller amount of Q-types. In most cotton field populations,the Q-type was predominant (11 Qs as compared with 6 Bs).Two areas clearly showed in their population samples aunique biotype (excluding the standards): the Ayalon Valleywith Q and the western Negev with B-types (table 2).

Discussion

In order to distinguish between different biotypes ofB. tabaci, several biochemical and molecular markers werepreviously applied (e.g. Gawel & Barlett, 1993; Vos et al.,1995; De Barro & Driver, 1997; Guirao et al., 1997; Cerveraet al., 2000; De Barro et al., 2003; Horowitz et al., 2003a). In the

present study rapid molecular diagnostic tools for B and Qbiotypes of B. tabaci were developed and used in populationstudies of this pest. First, two RAPD–PCR products, specificto B and Q biotypes were cloned and sequenced. Thesequences obtained did not show significant homology withany known genes. Nevertheless, a set of specific PCRprimers was designed on the basis of these sequences andfound useful in distinguishing B biotype from Q.

Morin et al. (2002) identified two mutations in the IIS4-5linker of the para-type sodium channel in B biotype strains ofB. tabaci from Arizona resistant to a pyrethroid and anorganophosphate. The nuclear DNA marker that wasdeveloped on the basis of this gene was found useful indistinguishing between biotypes B and Q, whether obtainedfrom field or laboratory stocks (fig. 3). For developingreliable single-locus DNA markers (CAPS) we also usedmtCOI sequences, which are widely used for phylogeneticstudies based on comparative sequence analyses (Brownet al., 1995; Frohlich et al., 1999). However, this comparativesequence analysis technique is relatively complex because itrequires sequencing of the specific gene, and is thereforelaborious and time consuming. The present study demon-strates that these CAPS markers produced reliable resultswithout the need for large-scale sequencing efforts.

The markers developed in the course of the present studywere found to be highly informative in efforts to screen andcompare field populations of B. tabaci. The results obtainedherein were in agreement with former studies (Horowitzet al., 2003a,b) and hence, the comparisons of the variousmethods (tables 2 and 3) are true validation tests of ourfindings as compared with other methods used previously.

These markers have been used for identifying biotypes Band Q of B. tabaci in laboratory experiments (Horowitz et al.,2005) as well as for population dynamics studies of this pest(Khasdan et al., 2004). In our ongoing studies, the use of theCAPS technique for mtCOI sequence is preferable due to itsreliability and relative simplicity. Similar procedures couldbe developed for other biotypes of B. tabaci elsewhere.

Although B. tabaci populations collected in cotton fieldswere mostly defined as Q-types, we assume that thedistribution of B and Q biotypes in Israel is probably notdependent on the crop (table 2) but rather, and to someextent, on the geographic location. For instance, in theAyalon Valley most populations were defined as Q-typesand in the western Negev most samples were diagnosed asB. In the Carmel Coast area only biotype Q was sampled incotton fields during 2000–2002 (Horowitz et al., 2003a; A.R.Horowitz, unpublished data), but during the mid-2003cotton season (July) B-types were discovered (table 2). Thereason for the B-types appearance is not entirely clear, butcan probably be related to seasonal migrations of B. tabacipopulations. Indeed, treatment with insecticides (especiallyneonicotinoids and diafenthiuron) reselected for Q-types latein the cotton season (Horowitz et al., 2005). Similar trendsemerged in 2004 collections (table 2). We assume thatinsecticide applications have played an important role inaffecting the balance of both biotypes (Nauen et al., 2002;Rauch & Nauen, 2003; Horowitz et al., 2005).

Among most B. tabaci populations collected recently(table 2), populations that were defined as Q biotype werealso resistant to the insect growth regulator pyriproxyfen,and those consisting of the B biotype were susceptible to thisinsecticide (Horowitz et al., 2003a, 2005). It is possible thatinherent levels of resistance to insecticides differ in the B and

Uncut

B Q

– + + + + + + M – + – + C

B Q

bp

2000

1000

500

250

1 2 3 4 5 6 7 8 9 10 11 12 13

Fig. 4. Cleaved amplified polymorphic sequences (CAPS)analysis based on primers complementary to the mtCOI genesequence (uncut (–) and digested with VspI (+)). Lanes 1–7,samples of Bemisia tabaci populations from Kfar Menachem,Israel (2004); M, 1 kb DNA Ladder; B, biotype B from CNR, Italy;Q, biotype Q from CNR, Italy; C, control without DNA. Arrowsmark the positions of uncut polymerase chain reaction (PCR)products of B and Q specific bands, respectively.

DNA markers for Bemisia tabaci biotypes 609

Q biotypes and these levels may have contributed to thedynamics and current distribution of B and Q biotypes inIsrael and elsewhere. Elbert & Nauen (2000) hypothesizedthat in southeastern Spain, where insecticides such asorganophosphates, pyrethroids, neonicotinoids or insectgrowth regulators are commonly used; higher resistance toinsecticides is the main factor that underlines the dominationof biotype Q. Moreover, Horowitz et al. (2005) showed thatapplications of either pyriproxyfen or neonicotinoids mayselect for biotype Q, which would survive to a greater degreewhere these insecticides are applied.

Results obtained by Pascual & Callejas (2004) indicated ahigher reproductive potential of biotype B populations,

grown on tomato plants under laboratory conditions, ascompared with biotype Q. Higher mortality of females andimmatures of Q biotype along with lower fecundity andprogeny size, as compared with B-type, may explain thecompetition advantage of the latter on tomatoes. Our recentresults (Horowitz et al., 2005) also indicate that on cotton,where no treatments with insecticide are applied, biotype Bshould displace biotype Q. Hence, under non-insecticidalregimes, B biotype is apparently more competitive than theQ-type.

Another finding that may support our assumptions thatthe Q-type has higher tolerance to various insecticides thanthe B-type and that the B-type is favoured in untreated fields

Table 2. Comparison of field populations of Bemisia tabaci in Israel collected mainly during 2003–2004 and then diagnosed for biotypestatus using different techniques.

Area and collection site Assignmentno. in fig. 5

Date ofcollection

Crop bBiotype cTechnique

Western GalileeKefar Masaryk 1 Jul 2003 Cotton Q 1Evron 1 Jul 2004 Cotton B<Q 4Evron 1 Aug 2004 Cotton Q 1, 2, 4

Carmel CoastMe’ir Shefe’ya 2 Jul 2003 Cotton (organic) B 1, 2, 3, 4Ma’ayan Zevi 3 Jul 2003 Cotton B 1, 2, 3, 4Ma’ayan Zevi 3 Sep 2003 Cotton Q 1, 4Ma’agan Mikha’el 3 Sep 2003 Cotton Q 1, 4Me’ir Shefe’ya 2 Jun 2004 Cotton B>Q 4Ma’ayan Zevi 3 Jun 2004 Cotton B<Q 4

Yizre’el ValleyGinnegar 4 Aug 2003 Cotton B 1, 4Sarid 5 Aug 2003 Cotton B<Q 4

Central IsraelAhituv 6 Jul 2003 Cucumber dGH B 1, 2, 4Ahituv 6 Jun 2004 Cucumber GH B>Q 1, 4Ahituv 6 Jun 2004 Solidago GH B<Q 1, 4

Ayalon ValleyaPyri-S (laboratory) 7 1987 Cotton B 1, 2, 3, 4Sha’alvim 8 Jul 2003 Sunflower Q 1, 2, 3, 4Sha’alvim 8 Sep 2003 Cotton Q 2, 4Sha’alvim 8 Sep 2004 Cotton Q 2, 4

South DistrictTalme’ Yehiel 9 Jul 2003 Eggplant GH Q 1, 4‘En Zurim 9 Sep 2003 Cotton Q 1, 4Kefar Menachem 10 Jul 2004 Watermelon B>Q 4Kefar Menachem 10 Jul 2004 Cotton Q 4

Western NegevaPyri-R (laboratory) 11 1991 Rose GH Q 1, 2, 3, 4Ashalim 12 Jul 2002 Melon B 1, 4Nahal Oz 11 Aug 2003 Potato B 1, 2, 4Nahal Oz 11 Jul 2004 Cotton B 4Revivim 12 Oct 2004 Potato B 4

Arava ValleyHazeva 13 Jun 2003 Basil GH Q 4Havat Yair 13 Feb 2004 Sage GH Q 2, 3, 4Havat Yair 13 Feb 2004 Sage GH (organic) B 2, 3, 4Havat Yair 13 Dec 2004 Cucumber GH (organic) B 4Havat Yai 13 Dec 2004 Eggplant GH Q 4’En Yahav 13 Dec 2004 Pepper GH (organic) B 4

aPyri-S and Pyri-R strains were reared in the laboratory and used as standards (Horowitz et al., 2003a,b).bAngle-brackets < or >mark domination of B or Q biotype in this whitefly population.c1, RAPD–PCR reactions; 2, SCAR and CAPS on basis of RAPD; 3, CAPS for sodium channel gene sequence; 4, CAPS for mtCOIsequence.dGH, greenhouse.

610 V. Khasdan et al.

Table 3. Comparison of different techniques for detection of Bemisia tabaci biotype (two standard- and three field-populations werecompared using four techniques).

Population Technique

RAPD–PCR SCAR and CAPSon basis of RAPD

CAPS for sodiumchannel gene

CAPS formtCOI sequence

Pyri-S (laboratory) 182 B (a26) 56 B 55 B 119 BPyri-R (laboratory) 137 Q (17) 68 Q 78 Q 129 QbMa’ayan Zevi (Jul 2003) 20 B 15 B 15 B 20 BSha’alvim (Jul 2003) 10 Q 10 Q 10 Q 20 QMe’ir Shefe’ya (Jul 2003) 10 B 10 B 10 B 15 B

aIn parenthesis, undetectable biotype (RAPD–PCR).bDNA from the same individuals was used for comparing all the techniques.CAPS, cleaved amplified polymorphic sequences; RAPD–PCR, random amplified polymorphic DNA–polymerase chain reaction; SCAR,sequence characterized amplified regions.

Egypt

Dea

d S

ea

Med

iterr

anea

n S

ea

Jordan

Lebanon

Syria

Elat

Gaza

Tel-Aviv

Jerusalem

Jericho

HaifaNazareth

25 km

11

13

10 9

6

453

2

87

1

Beer-Sheva12

Fig. 5. Provisional distribution of some field populations of Bemisia tabaci in Israel described in table 2.

DNA markers for Bemisia tabaci biotypes 611

was the collections of B. tabaci samples that were takensimultaneously from organic fields and from neighbouring‘conventional’ fields. In the two collections, from cotton in2003 and from greenhouse sage in 2004, the B-type waspredominant in organic fields, while Q-types were wide-spread in the fields heavily treated with insecticides. Recentadditional collections in organic fields (H.Breslauer, unpub-lished data) were in concordance with our previous samples.

Further studies on B. tabaci biotype distribution, migra-tion, and interactions are needed in order to design effectivecrop protection strategies. These studies should focus ondifferences in biochemical, physiological and life-historytraits that may affect their phenology, host plant specificity,insecticide resistance and efficiency of virus transmission.Simple and cost-effective DNA markers that distinguishbetween B. tabaci biotypes, such as those developed andapplied in this study, are usable for these goals.

Acknowledgements

The authors thank the Drs I. Bedford (John Innes Centre,UK) and G. Parrella (Istituto per la Protezione delle Piantedel CNR, Italy) who kindly provided reference Q and Bbiotypes; Ms J. Joseph (Agricultural Research Organization(ARO), Gilat Research Center, Israel) for her valuable editingof the paper; and H. Bhatt, M. Rippa, S. Kleitman, R. Mori, H.Breslauer and O. Segev (ARO, Israel) for their technicalassistance. The authors acknowledge with thanks the ChiefScientist of the Ministry of Agriculture and the Israeli CottonBoard for their partial support of this study.

References

Agusti, N., de Vicente, M.C. & Gabarra, R. (2000) DevelopingSCAR markers to study predation on Trialeurodes vaporar-

iorum. Insect Molecular Biology 9, 263–268.Botstein, D., White, R.L., Skolnick, M. & Davis, R.W. (1980)

Construction of a genetic map in man using restrictionfragment length polymorphism. American Journal of Human

Genetics 32, 314–331.Brown, J.K., Frohlich, D.R. & Rossell, R.C. (1995) The

sweetpotato or silverleaf whiteflies: biotypes of Bemisiatabaci or a species complex? Annual Review of Entomology 40,511–534.

Byrne, D.N. & Bellows, T.S. (1991) Whitefly biology. AnnualReview of Entomology 36, 431–457.

Calvert, L.A., Cuervo, M., Arroyave, J.A., Constantino, L.M.,

Bellotti, A. & Frohlich, D. (2001) Morphological andmitochondrial DNA marker analyses of whiteflies (Homo-ptera: Aleyrodidae) colonizing cassava and beans inColombia. Annals of the Entomological Society of America 94,512–519.

Campbell, B.C. (1993) Congruent evolution between whiteflies(Homoptera: Aleyrodidae) and their bacterial endosym-bionts based on respective 18S and 16S rDNAs. Current

Microbiology 26, 129–132.Cenis, J.L., Perez, P. & Fereres, A. (1993) Identification of aphid

(Homoptera: Aphididae) species and clones by randomamplified polymorphic DNA. Annals of the Entomological

Society of America 86, 545–550.Cervera, M.T., Cabezas, J.A., Simon, B., Martınez-Zapater, J.M.,

Beitia, F. & Cenis, J.L. (2000) Genetic relationships amongbiotypes of Bemisia tabaci (Hemiptera: Aleyrodidae)

based on AFLP analysis. Bulletin of Entomological Research90, 391–396.

De Barro, P.J. & Driver, F. (1997) Use of RAPD PCR todistinguish the B biotype from other biotypes of Bemisiatabaci (Gennadius) (Hemiptera: Aleyrodidae). Australian

Journal of Entomology 36, 149–152.De Barro, P.J., Driver, F., Trueman, J.W.H. & Curran, J. (1999)

Phylogenetic relationships of world populations of Bemisiatabaci (Gennadius) using ribosomal ITS 1. Molecular

Phylogenetics and Evolution 16, 29–36.De Barro, P.J., Scott, K.D., Graham, G.C., Lange, C.L. &

Curran, J. (2003) Isolation and characterization ofmicrosatellite loci in Bemisia tabaci. Molecular Ecology Notes

3, 40–43.Elbert, A. & Nauen, R. (2000) Resistance of Bemisia tabaci

(Homoptera: Aleyrodidae) to insecticides in southern Spainwith special reference to neonicotinoids. Pest Management

Science 56, 60–64.Frohlich, D.R., Torres-Jerez, I., Bedford, I.D., Markham, P.G. &

Brown, J.K. (1999) A phylogeographical analysis of theBemisia tabaci species complex based on mitochondrialDNA markers. Molecular Ecology 8, 1683–1691.

Gawel, N.J. & Barlett, A.C. (1993) Characterization ofdifferences between whiteflies using RAPD–PCR. Insect

Molecular Biology 2, 33–38.Guirao, P., Beitia, F. & Cenis, J.L. (1997) Biotype determination

of Spanish populations of Bemisia tabaci (Hemiptera:Aleyrodidae). Bulletin of Entomological Research 87, 587–593.

Horowitz, A.R., Denholm, I., Gorman, K., Cenis, J.L., Kontse-

dalov, S. & Ishaaya, I. (2003a) Biotype Q of Bemisia tabaciidentified in Israel. Phytoparasitica 31, 94–98.

Horowitz, A.R., Gorman, K., Ross, G. & Denholm, I. (2003b)Inheritance of pyriproxyfen resistance in the whitefly,Bemisia tabaci (Q biotype). Archives of Insect Biochemistryand Physiology 54, 177–186.

Horowitz, A.R., Kontsedalov, S., Khasdan, V. & Ishaaya, I.

(2005) Biotypes B and Q of Bemisia tabaci and their relevanceto neonicotinoid and pyriproxyfen resistance. Archives ofInsect Biochemistry and Physiology 58, 216–225.

Jones, D.R. (2003) Plant viruses transmitted by whiteflies.European Journal of Plant Pathology 109, 195–219.

Khasdan, V., Levin, I., Rosner, A., Kontsedalov, S., Morin, S. &

Horowitz, A.R. (2004) Development and use of DNAmarkers to distinguish between B and Q biotypes of Bemisia

tabaci in Israel. p. 55 in 2nd European Whitefly SymposiumEWSII Abstract Compendium, Cavtat, 5–9 October 2004

Croatia, European Whitefly Studies Network.Konieczny, A. & Ausubel, F.M. (1993) A procedure for mapping

Arabidopsis mutations using co-dominant ecotype specificPCR-based markers. Plant Journal 4, 403–410.

Li, Y.C., Korol, A.B., Fahima, T., Beiles, A. & Nevo, E. (2002)Microsatellites: genomic distribution, putative functionsand mutational mechanisms: a review.Molecular Ecology 11,2453–2465.

Lima, L.H.C., Campos, L., Moretzsohn, M.C., Navia, D. & de

Oliveira, M.R.V. (2002) Genetic diversity of Bemisia tabaci(Genn.) populations in Brazil revealed by RAPD markers.Genetics and Molecular Biology 25, 217–223.

Morin, S., Williamson, M.S., Goodson, S.J., Brown, J.K.,

Tabashnik, B.E. & Dennehy, T.J. (2002) Mutations inthe Bemisia tabaci para sodium channel gene associatedwith resistance to a pyrethroid plus organophosphatemixture. Insect Biochemistry and Molecular Biology 32,1781–1791.

612 V. Khasdan et al.

Nauen, R., Stumpf, N. & Elbert, A. (2002) Toxicological andmechanistic studies on neonicotinoids cross resistance inQ-type Bemisia tabaci (Hemiptera: Aleyrodidae). Pest

Management Science 58, 868–875.Ohmori, T., Murata, M. & Motoyoshi, F. (1996) Molecular

characterization of RAPD and SCAR markers linked to theTm-1 locus in tomato. Theoretical and Applied Genetics 92,151–156.

Pascual, S. & Callejas, C. (2004) Intra- and interspecificcompetition between biotypes B and Q of Bemisia tabaci

(Hemiptera: Aleyrodidae) from Spain. Bulletin of Entomo-

logical Research 94, 369–375.Paran, I. & Michelmore, R.W. (1993) Development of reliable

PCR-based markers linked to downy mildew resistancegenes in lettuce. Theoretical and Applied Genetics 85, 985–986.

Perring, T.M., Cooper, A.D., Rodriguez, R.J., Farrar, C.A. &

Bellows, T.S.J. (1993) Identification of a whitefly species bygenomic and behavioral studies. Science 259, 74–77.

Rauch, N. & Nauen, R. (2003) Identification of biochemicalmarkers linked to neonicotinoid cross-resistance inBemisia tabaci (Hemiptera: Aleyrodidae). Archives of Insect

Biochemistry and Physiology 54, 165–176.

Rosell, R.C., Bedford, I.D., Frohlich, D.R., Brown, J.K. &

Markham, P.G. (1997) Analysis of morphological variationin distinct populations of Bemisia tabaci (Homoptera:Aleyrodidae). Annals of the Entomological Society of America90, 575–589.

Sambrook, J. & Russell, D.W. (2001) Molecular cloning: a

laboratory manual. 3rd edn. Cold Spring Harbor, New York,Cold Spring Harbor Laboratory Press.

Tsagkarakou, A. & Roditakis, N. (2003) Isolation and char-acterization of microsatellite loci in Bemisia tabaci (Hemi-ptera: Aleyrodidae). Molecular Ecology Notes 3, 196–198.

Vos, P., Hogers, R., Bleeker, M., Reijians, M., Lee, T., Hornes,

M., Frijters, A., Pot, J., Peleman, J., Kuiper, M. & Zabeau,

M. (1995) AFLP, a new technique for DNA fingerprinting.Nucleic Acids Research 23, 4407–4414.

Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. &

Tingey, S.V. (1990) DNA polymorphism amplified byarbitrary primers are useful as genetic markers. Nucleic

Acids Research 18, 6531–6535.

(Accepted 1 August 2005)� CAB International, 2005

DNA markers for Bemisia tabaci biotypes 613