Differential Expression of CYP6A5 and CYP6A5v2 in Pyrethroid-Resistant House Flies, Musca domestica

Archives of Insect Biochemistry and Physiology 67:107–119 (2008)

© 2007 Wiley-Liss, Inc.DOI: 10.1002/arch.20225Published online in Wiley InterScience (www.interscience.wiley.com)

Differential Expression of CYP6A5 and CYP6A5v2 inPyrethroid-Resistant House Flies, Musca domestica

Fang Zhu1 and Nannan Liu1,2*

Two cytochrome P450 alleles, CYP6A5 and CYP6A5v2, were isolated from a pyrethroid-resistant house fly stain, ALHF. Thetwo alleles shared 98% similarity in amino acid sequence. To understand the importance of these two alleles in resistance andexamine the expression profile of the two alleles between resistant and susceptible strains, quantitative real-time PCR (qRT-PCR) was performed and compared with the Northern blot analysis. We found that qRT-PCR was an efficient method tocharacterize the expression profiles between these two sequence-closely-related P450 genes between resistant and susceptiblehouses flies. One of them, CYP6A5v2, was constitutively overexpressed in ALHF house flies compared with susceptible housefly strains. Moreover, this gene was predominately expressed in the abdominal tissues of ALHF, in which the primary detoxifi-cation organs of insects are located. However, there was no significant difference in the expression of CYP6A5 between ALHFand susceptible house flies. The genetic linkage analysis was conducted to determine the possible link between the constitu-tively overexpressed CYP6A5v2 and insecticide resistance. CYP6A5v2 was mapped on autosome 5, which is correlated withthe linkage of resistance in ALHF. Taken together, the study suggests the importance of CYP6A5v2 in increasing metabolicdetoxification of insecticides in ALHF. The distinct expression of CYP6A5 and CYP6A5v2 in resistant and susceptible house fliesimplies the functional difference of theses two genes in house flies and suggests that they are two recently diverged P450genes presented in a single organism. Arch. Insect Biochem. Physiol. 67:107–119, 2008. © 2007 Wiley-Liss, Inc.

KEYWORDS: cytochrome P450s; constitutive overexpression; insecticide resistance; genetic linkage analysis

1Department of Entomology and Plant Pathology, Auburn University, Auburn, Alabama2Cellular and Molecular Biosciences Program, Auburn University, Auburn, Alabama

Abbreviations used: qRT-PCR = quantitative real-time PCR; RT-PCR = reverse transcription-mediated polymerase chain reaction; RACE = rapid amplification ofcDNA ends; ANOVA = a one-way analysis of variance; BC1 = back-cross generation 1; ORF = open reading frame; PBO = piperonyl butoxide.

Contract grant sponsor: U.S. Department of Agriculture National Research Initiative (USDA-NRI) Competitive Grants Program; Contract grant numbers: 2001-35302-10956; Contract grant sponsor: Hatch Project; Contract grant number: ALA08-045.

*Correspondence to: Dr. Nannan Liu, Department of Entomology & Plant Pathology, 301 Funchess Hall, Auburn University, Auburn, AL 36849-5413.E-mail: [email protected]

Received 20 July 2007; Accepted 27 August 2007

INTRODUCTION

Insect cytochrome P450s are known to play animportant role in detoxifying insecticides (Feyer-eisen, 2005; Scott, 1999) and plant toxins (Beren-baum, 1991; Schuler, 1996), resulting in thedevelopment of resistance to insecticides (Brattstenet al., 1986; Carino et al., 1994; Feyereisen, 2005;Kasai et al., 2000; Liu and Scott, 1997, 1998) andfacilitating the adaptation of insects to their planthosts (Li et al., 2002; Wen et al., 2003). A signifi-

cant characteristic of insect P450s that is associ-ated with enhanced metabolic detoxification of in-secticides in insects is the constitutively increasedP450 proteins and P450 activities that result fromconstitutively transcriptional overexpression ofP450 genes in insecticide resistant insects (Carinoet al., 1994; Feyereisen, 2005; Kasai et al., 2000;Liu and Scott, 1997, 1998). Cytochrome P450sconstitute the largest gene superfamily found inall living organisms examined (Feyereisen, 2005).There are more than 1,000 P450s that have been

108 Zhu and Liu

Archives of Insect Biochemistry and Physiology March 2008

identified in insects, distributed throughout morethan 150 subfamilies of 40 known P450 gene fami-lies (http://dmelson.utmem.edu/nelsonhomepage.html). For example, 90 P450 genes (including 7pseudogenes) are present in the Drosophila melano-gaster genome (Tijet et al., 2001), 111 P450 genes(including 5 pseudogenes) are present in Anoph-eles gambiae (Ranson et al., 2002), and 86 P450genes are present in Bombyx mori (Li et al., 2005).Because these P450 genes perhaps evolve from acommon ancestor by gene duplication (Gonzalezand Nebert, 1990; Feyereisen, 1999), some of themshare very high similarity at both nucleotide andamino acid sequence levels. For example, twoDrosophila melanogaster P450 genes, CYPq3l1 andCYPq3l2, share 99.8% nucleotide similarity result-ing in only one amino acid difference (Ranson etal., 2002). A question emerging from such a highsequence similarity shared by P450 genes is: howcan the expression of each of these P450 genes withhigh sequence similarity be precisely examined?

A house fly strain, ALHF, exhibits very high lev-els of resistance to pyrethroids (Liu and Yue, 2000).Early studies in our laboratory on permethrin re-sistance in ALHF house flies had led to the identi-fication of permethrin resistance that could belargely suppressed by piperonyl butoxide (PBO),an inhibitor of cytochrome P450s (Liu and Yue,2000, 2001). These studies suggest that cytochromeP450-mediated detoxification might be one of themajor mechanisms involved in pyrethroid resis-tance in ALHF. Furthermore, genetic linkage stud-ies had linked PBO-suppressible resistance (orP450-mediated resistance) to autosome 5, withminor factors linked to autosomes 1 and 2 (Liuand Yue, 2001). In the current study, we isolatedtwo P450 alleles, CYP6A5v2 and CYP6A5 (Cohenand Feyereisen, 1995) from ALHF house flies.CYP6A5v2 and CYP6A5 share 98% similarity inamino acid sequence. To accurately evaluate theexpression profiles of CYP6A5 and CYP6A5v2 be-tween resistant and susceptible house flies, quan-titative real-time PCR (qRT-PCR) was chosen tocharacterize the expression patterns of these twoP450 genes. The expression profiles of these twogenes in different tissues and in both resistant and

susceptible house flies were characterized. Geneticlinkage studies were conducted to provide the fur-ther information on a possible genetic link ofCYP6A5v2 and the pyrethroid resistance in ALHF.

MATERIALS AND METHODS

House Fly Strains

Three house fly strains were used in this study.ALHF, a wild-type strain collected from a poultryfarm in Alabama in 1998, selected with permethrinfor 6 generations after collection to reach a 6,600-fold resistance, and maintained under biannual se-lection with permethrin (Liu and Yue, 2000, 2001).CS is a wild type insecticide-susceptible strain.aabys is an insecticide-susceptible strain with re-cessive morphological markers ali-curve (ac),aristapedia (ar), brown body (bwb), yellow eyes(ye), and snipped wings (sw) on autosomes 1, 2,3, 4, and 5, respectively. Both CS and aabys wereobtained from Dr. J. G. Scott (Cornell University).

RNA Extraction, cDNA Preparation, andP450 Gene Fragment Isolation

Total RNAs were extracted from house flies us-ing the acidic guanidine thiocyanate-phenol-chlo-roform method (Liu and Scott, 1997). mRNA wasisolated with oligotex-dT suspension (QIAGEN). Thefirst-strand cDNA was synthesized with SuperScriptII reverse transcriptase and an antisense 5′-anchoredoligo(dT) primer (5′ TAATACGACTCACTATAGGGAGATTTTTT TTTTTTTTTT 3′) (Tomita and Scott,1995), using ALHF mRNAs as templates. The first-strand cDNA products were amplified by PCR withthe C2 primer (5′ TAA TACGACTCACTATAGGGA-GA 3′) and internal degenerated sense primer,Flyh1 (5′ GGICCI AGIAACTGCATIGG 3′, Fig. 1).The Flyh1 was designed based on the heme bind-ing consensus sequence (Liu and Zhang, 2002).The PCR products were cloned into PCR™ 2.1Original TA cloning vector (Invitrogen) and se-quenced (Genomic & Sequencing Lab, Auburn Uni-versity). Cloning and sequence analyses of P450gene fragments were repeated at least three times

CYP6A5 and CYP6A5v2 in House Flies 109


with different preparations of mRNAs. Three TAclones from each replication were sequenced.

Rapid Amplification of 5′′′′′ cDNA ends (5′′′′′-RACE)of the Putative P450 Gene Fragments

To clone the 5′ half of the putative P450 genefragments, 5′-RACE was carried out using the Mara-thon™ cDNA Amplification Kit (Clontech) as de-scribed by the manufacturer and Liu and Zhang(2002). The first-strand cDNAs were synthesizedwith AMV reverse transcriptase using ALHF mRNAsas templates. The double-strand cDNA was synthe-sized following the protocol described by themanufacturer (Clontech). Adaptors were ligated toboth ends of each double-strand cDNA using T4DNA ligase as described by the manufacturer. The5′ end of the P450 cDNA fragment was amplifiedby PCR using the primer pair, P450HF10R/AP1(based on the sequence of the adaptor). The primerP450HF10R (5′ TCGCAGCAGGGATAC CAAAC 3′,Fig. 1) was generated based on the 5′ end se-quences of the putative P450 cDNA fragment asdescribed by the manufacture (Clontech). The full-length of the P450 cDNA was subsequently gener-ated in the ALHF and susceptible aabys strains byRT-PCR using a specific primer pair, AP450HF10-3F/AP450HF10-3R (Fig. 1), synthesized based onthe 5′ and 3′ end sequences of the putative P450gene from ALHF. Cloning and sequence analysesof the P450 cDNAs were repeated at least threetimes with different preparations of mRNAs, andthree TA clones from each replication were veri-fied by sequencing.

Northern Blot Analyses

Northern blot analyses were performed accord-ing to Sambrook et al. (1989). Twenty microgramsof total RNA from adults of CS, aabys, and ALHFwere fractionated on 1% formaldehyde denatur-ing agarose gel and transferred to Nytran mem-branes (Schleicher and Schuell) (Sambrook et al.,1989). The P450 cDNA fragments were labeledwith [α-32P] dCTP using a Primer-It II RandomPrimer Labeling kit (Stratagene) and hybridized

with RNA blots using QuickHyb solution (Strata-gene). The amount of RNA loaded in each lanewas standardized by comparing the density of the18S ribosomal RNA band on agarose gel under UVlight before transfer (Spiess and Ivell, 1998). AllNorthern blot analyses were repeated three timeswith different preparations of RNA samples. The ra-diographic signal intensity was quantitatively ana-lyzed by QuantiScan v3.0 (Biosoft) as previouslydescribed by Liu and Zhang (2004). Statistical sig-nificance of the gene expressions was calculated us-ing a Student’s t-test for all 2-sample comparisonsand a one-way analysis of variance (ANOVA) formultiple sample comparisons (SAS v9.1 software);a value of P ≤ 0.0 5 was considered statisticallysignificant.

Gene Expression Analysis by QuantitativeReal-Time PCR (qRT-PCR)

Total RNA samples (0.5 µg/sample) were re-verse-transcribed using SuperScript II reverse tran-scriptase (Stratagene) in a total volume of 20 µl.The quantity of cDNAs was measured using aspectrophotometer prior to qRT-PCR. qRT-PCRwas performed with the SYBR Green master mixKit and ABI 7500 Real Time PCR system (AppliedBiosystems). Each qRT-PCR reaction (25 µl finalvolume) contained 1× SYBR Green master mix,1 µl of cDNA, and a gene-specific primer pair,RTP450HF10-3F/RTP450HF10-3R (for CYP6A5v2,Fig. 2A) or RTP450HF10-10F/RTP450HF10-10R (forCYP6A5, Fig. 2B) at a final concentration of 3–5 µM. Each P450 gene-specific primer pair was de-signed based on the specific sequence of each geneby placing a specific nucleotide at the 3′ end ofeach primer to permit preferential amplificationof that specific P450 gene (Fig. 2). A “no-template”negative control and all samples were performedin triplicate. The reaction cycle consisted of a melt-ing step of 50°C for 2 min then 95°C for 10 min,followed by 40 cycles of 95°C for 15 sec and 60°Cfor 1 min. Specificity of the PCR reactions was as-sessed by a melting curve analysis for each PCRreaction using Dissociation Curves software (Witt-wer et al., 1997). Relative expression levels for spe-

110 Zhu and Liu




Fig.

1.

The

cDN

A/d

edu

ced

pro

tein

seq

uen

ces

of

CY

P6A

v2 i

n A

LHF

and

aab

ys.

Hem

e b

ind

ing

mo

tif

that

is

hig

hly

co

nse

rved

in

all

P45

0 p

rote

ins

isd

ou

bly

un

der

lin

ed. N

ucl

eoti

de

po

lym

orp

his

ms

bet

wee

n A

LHF

and

aab

ys a

re h

igh

ligh

ted

. Th

e p

rim

ers

use

d f

or

gen

erat

ing

the

CY

P6A

v2 c

DN

A f

ragm

ents

,q

RT-

PC

R r

eact

ion

s, a

nd

AS-

PC

R a

re i

nd

icat

ed b

y ar

row

hea

ds.

112 Zhu and Liu


cific genes were calculated by the 2–∆∆C(t) methodusing SDS RQ software (Livak and Schmittgen,2001). The β-actin gene, an endogenous control,was used to normalize expression of target genes(Aerts et al., 2004; Dorak, 2006). The preliminaryassay had shown that the β-actin gene remainedconstant in different tissues and in both resistantand susceptible house flies. Thus, it could there-fore be used for internal normalization in qRT-PCRassays. Each experiment was repeated three timeswith different preparations of RNA samples. Thestatistical significance of the gene expressions wascalculated using a Student’s t-test for all 2-samplecomparisons and a one-way analysis of variance(ANOVA) for multiple sample comparisons (SASv9.1 software); a value of P ≤ 0.05 was consideredstatistically significant.

Genetic Linkage Analysis of CYP6A5v2

To determine the genetic linkage of CYP6A5v2,a genetic cross-experiment was conducted (Liu andScott, 1995; Liu and Yue, 2001). Briefly, reciprocalcrosses between ALHF and aabys were conductedand F1 males were back-crossed to aabys females.

Five lines were saved from the back-cross genera-tion (BC1) with the genotypes of ac/ac, +/ar, +/bwb,+/ye, +/sw (A2345); +/ac, ar/ar, +/bwb, +/ye, +/sw(A1345); +/ac, +/ar, bwb/bwb, +/ye, +/sw (A1245);+/ac, +/ar, +/bwb, ye/ye, +/sw (A1235); and +/ac, +/ar, +/bwb, +/ye, sw/sw (A1234). Since crossing overdoes not or very rarely occurs in male flies (Gaoand Scott, 2006), the presence of a mutant phe-notype indicated that the respective autosome witha mutant-type marker was derived from the aabysfemales. The genotype of each line was homozy-gous for the recessive mutant allele from aabys andheterozygous for the dominant wild-type allelesfrom ALHF. These lines were named according tothe autosomes bearing wild-type markers fromALHF. For example, the A1234 strain had wild-typemarkers on autosomes 1, 2, 3, and 4 from ALHFand the recessive mutant marker on autosome 5from aabys.

Allele-specific PCR was conducted for geneticmapping of P450 genes (Liu and Scott, 1995). Tworounds of PCR were conducted. For the first PCRreaction, the allele-independent primer pair,AP450HF10-3F/AP450HF10-3R (Fig. 1), was used togenerate CYP6A5v2 cDNA fragments. The second

Fig. 2. Graphic representation of CYP6A5v2 and CYP6A5,showing locations and sequences of each gene specificprimer pair for qRT-PCR. A: The locations and sequencesof CYP6A5v2 allele-specific primer pair in CYP6A5v2.**The sequences of CYP6A5 at the corresponding sets of

the CYP6A5v2 allele-specific primer pair. B: The locationsand sequences of CYP6A5 allele-specific primer pair inCYP6A5. **The sequences of CYP6A5v2 at the correspond-ing sets of the CYP6A5 allele-specific primer pair.



PCR was employed with 0.5 µl of the first roundPCR reaction solution with 1,000-fold dilution andan allele-specific primer pair, AP450HF10-3NLF/AP450HF10-3NLR (Fig. 1; see also Fig. 6A). Theallele-specific primer pair was designed based onthe specific sequence of CYP6A5v2 in ALHF byplacing a specific nucleotide polymorphism at the3′ end of each primer to permit preferential am-plification of the P450 allele from ALHF. Each ex-periment was repeated three times with differentpreparations of mRNAs. To confirm that the PCRproducts were in fact the P450 gene fragments, thePCR products were sequenced at least once each.

RESULTS AND DISCUSSION

Cloning and Sequencing of CytochromeP450 cDNAs From House Flies

One partial putative house fly P450 cDNA frag-ment was amplified from ALHF by 3′ RACE usinga 5′-anchored oligo(dT) primer and an internal de-generate primer, Flyh1. BLAST analysis of theamino acid sequence predicted from the partialputative P450 cDNA fragment showed that the se-quence encoded the C-terminal end of a novelputative P450 with 98% identity to CYP6A5 (ac-cession number: U09343) from a susceptible housefly strain, sbo (Cohen and Feyereisen, 1995). Toisolate and amplify the 5′ end of this P450 gene,5′-RACE was conducted using a specific antisenseprimer synthesized based on the sequence of thenovel putative P450 cDNA and a sense primer, AP1,synthesized based on the sequences of the adap-tor (Clontech). Two cDNA products were ampli-fied by 5′-RACE. One was 100% overlapped withits corresponding 3′ putative P450 cDNA fragment,identifying it as the 5′ end of the novel P450 gene.The other, however, was 98% overlapped with itscorresponding 3′ putative P450 cDNA but was100% identical to the sequence of CYP6A5, indi-cating that it was CYP6A5. Because of the perfectlymatched sequences at the 3′ and 5′ ends of boththe putative P450 gene and CYP6A5, entire cDNAfragments for both genes were subsequently am-plified from ALHF and aabys house flies by PCR

using a primer pair of AP450HF10-3F/AP450HF10-3R (Fig. 1) synthesized based on the respective 5′and 3′ end sequences sharing by both genes. TenTA clones generated from the full-length of PCRproducts were sequences from each house fly strain.The sequences of 6 clones of the entire cDNA frag-ment from ALHF was perfectly overlapped with the3′ and 5′ sequences of the novel putative P450 genegenerated by RACE. The sequence was namedCYP6A5v2 (accession number: EF615004) by theP450 nomenclature committee (Dr. D. Nelson, per-sonal communication), while the other 4 cloneswere identical as CYP6A5. Comparison of thenucleotide and deduced protein sequences ofCYP6A5v2 between ALHF and aabys revealed sev-eral nucleotide polymorphisms, 6 of which resultedin 6 amino acid substitutions (Fig. 1).

Comparison of the cDNA sequences of bothCYP6A5 and CYP6A5v2 revealed an identical openreading frame of 1521 nucleotides encoding pro-teins of 507 residues (Fig. 3). The putative proteinsequences of CYP6A5 and CYP6A5v2 deduced fromthe cDNA sequences shared 98% identity. Five con-sensus motifs that were found in insect P450 pro-teins (Feyereisen, 2005) were identified in bothCYP6A5 and CYP6A5v2 (Fig. 3). WxxR motif lo-cated in C-helix is presented at amino acid resi-dues 27–30 and the arginine (R) in this motif canform a charge pair with the propionate of the heme(Feyereisen, 2005). GxE/DTT/S motif that is pre-sented at amino acid residues 313–317 is locatedin I-helix and this motif is thought to be involvedin proton delivery and catalysis (Gorokhov et al.,2003). ExLR and PxxFxPE/DRF motifs, which arelocated at amino acid residues 336–339 and 421–429, respectively, are thought to form a set of saltbridge interactions (E-R-R) for stabilizing the over-all structure of protein (Hasemann et al., 1995).The P450 heme binding motif, FXXGXRXCXG(Gotoh and Fujii-Kuriyama, 1989), is presented atamino acid residues 444–454 of both CYP6A5 andCYP6A5v2. The cysteine residue in this motif isknown to be an important ligand for heme bind-ing. Finally, another conserved 17-residue se-quence, corresponding to the central part of the

114 Zhu and Liu


I-helix, is found at amino acid residues 307–323of CYP6A5 and CYP6A5v2 (Fig. 3). This motif isparticularly conserved among family 6 (Cornetteet al., 2006) and is thought to be involved in pro-ton delivery (Gorokhov et al., 2003).

Expressional Analysis of CYP6A5 and CYP6A5v2Among CS, aabys, and ALHF House Flies

To investigate the possible role of CYP6A5 andCYP6A5v2 in the resistance of ALHF, Northern blotanalysis and qRT-PCR were performed to examinethe expression patterns of these two alleles in sus-ceptible CS and aabys and resistant ALHF houseflies. Northern blot analysis revealed a similar ex-pression pattern for both alleles (data not shown).In contrast, qRT-PCR with an allele specific primerpair for each allele (Fig. 1) revealed different ex-pression patterns for two alleles. We found no sig-nificant difference in the expression of CYP6A5among CS, aabys, and ALHF strains (Fig. 4A),which was consistent with a previous study on

other house fly strains by Cohen and Feyereisen(1995). However, we identified significant over-expression (~1,000-fold) of CYP6A5v2 in ALHFcompared to both susceptible strains of CS andaabys (Fig. 4B). It has been proposed that consti-tutive overexpression of P450s is one of the re-sponses for the adaptation of insects to theirenvironment (Terriere, 1983, 1984). Furthermore,in many cases, increased levels of P450 gene ex-pression have resulted in increased levels of bothtotal P450 contents and the P450 activities, whichhave been strongly suggested as a major cause forinsecticide resistance (Brattsten, 1986; Carino et al.,1992; Festucci-Buselli et al., 2005; Feyereisen, 2005;Liu and Scott, 1997; Scott, 1999). Accordingly,overexpression of CYP6A5v2 only in ALHF maysuggest the importance of the gene in increasingmetabolic detoxification of insecticides in ALHFhouse flies compared with the susceptible ones.

Our inconsistent results generated by Northenblot analyses and qRT-PCR is likely because thatthe probes used in Northen blot analyses for de-

Fig. 3. Alignment of the de-duced amino acid sequencesof CYP6A5 and CYP6A5v2.All identical amino acid resi-dues are shaded. Five impor-tant consensus motifs areframed, including motif I(WxxR motif), motif II (GxE/DTT/S motif), motif III (ExLRmotif), motif IV (PxxFxPE/DRF motif), motif V (hemebinding motif). A conserved17-residue sequence for fam-ily 6 is underlined.



tecting both genes shared the high sequence simi-larity, resulting in lacking the sensitivity of probesto specifically detect their own RNA transcripts.Thus, the similar expression patterns for bothCYP6A5 and CYP6A5v2 detected by Northen blotanalyses actually resulted from the hybridizationof both trascripts by each of probes. The sameshortcoming of detecting expression of genes thatshare high sequence similarity by Northen blotanalysis has also been pointed out by Wen et al.(2001). In contrast, because of primer specificityfor each gene, qRT-PCR allows the amplificationand quantification of a specific product for a givenDNA template. In addition, the specificity of theqRT-PCR products can be verified by sequencing.These two advantages make qRT-PCR a preferredtechnique to compare the expression levels of thegenes with a high degree of sequence similarity.

Tissue-Specific Expression of CYP6A5v2Among CS, aabys, and ALHF House Flies

In insects, the midgut and fat body tissue havegenerally been considered to be the primary detoxi-fication organs (Hodgson, 1985) where most in-

sect detoxification P450s are expressed (Scott et al.,1998). To investigate whether the overexpressionof CYP6A5v2 in ALHF specifically occurs in thisdetoxification tissue, we examined the expressionof the gene in the abdomen and head+thorax tis-sues among susceptible CS and aabys and resistantALHF strains by qRT-PCR. Our results revealed ~13-,16-, and 5-fold higher expression of CYP6A5v2 inthe abdominal tissue of CS, aabys, and ALHF flies,respectively, compared with their head+thorax tis-sues (Fig. 5). However, significant overexpressionwas more evident in both tissues of ALHF com-pared with both CS and aabys. The expression ofCYP6A5v2 was ~500- and ~160–170-fold higher inboth head+thorax and abdominal tissues, respec-tively, of ALHF compared to the corresponding tis-sues in CS and aabys (Fig. 5). As the midgut andfat body tissue have generally been considered tobe the primary detoxification organs and as bothcomponents are located in the abdomen of insects,relatively high levels of CYP6A5v2 in the abdomenof ALHF may suggest the importance of the genesin increasing metabolic detoxification of insecti-cides in ALHF house flies compared with the sus-ceptible CS and aabys strains.

Fig. 4. Expression analysis of CYP6A5 and CYP6A5v2 inCS, aabys, and ALHF house flies. The expression of thetwo genes was analyzed by qRT-PCR as described in Ma-terials and Methods. A: Relative expression of CYP6A5 insusceptible CS and aabys and resistant ALHF house flies.B: Relative expression of CYP6A5v2 in CS, aabys, and ALHF

house flies. The relative levels of gene expression areshown as a ratio in comparison with that in CS flies. Theresults are shown as the mean ± S.E. There was no signifi-cant difference (P ≤ 0.05) in the levels of P450 gene ex-pression among the samples with the same alphabeticletter.

116 Zhu and Liu


Chromosomal Linkage of CYP6A5v2

Genetic linkage between an overexpressed P450gene and insecticide resistance is an important stepin establishing a possible link between a P450 geneand its role in resistance (Carino et al., 1994;Feyereisen, 2005; Guzov et al., 1998; Liu and Scott,1996; Maitra et al., 2000; Rose et al., 1997). Ourprevious research indicated that resistance in theALHF strain could be largely suppressed by PBO,an inhibitor of cytochrome P450s. Further, geneticlinkage studies had linked PBO-suppressible resis-tance (or P450-mediated resistance) to autosome5, with minor factors linked to autosomes 1 and 2(Liu and Yue, 2001). To confirm a likely link be-tween CYP6A5v2 and insecticide resistance inALHF, an allele specific PCR (AS-PCR) determina-tion was performed to examine the genetic link-age of CYP6A5v2 with 5 house fly lines derivedfrom crosses of ALHF and a susceptible morpho-logical marker strain, aabys. To increase primerspecificity and avoid false-negative results, tworounds of PCR amplification were performed. Inthe first PCR reaction, a universal primer set,AP450HF10-3F/AP450HF10-3R (Fig. 1), was usedand the expected products were obtained in allstrains tested (Fig. 6B). The second PCR reactionswere conducted using the first PCR products as thetemplates and an ALHF allele-specific primer pairof AP450HF10-3NLF/AP450HF10-3NLR (Fig. 6A).

The ALHF allele-specific primer pair was designedbased on the specific sequence of the P450 genefrom ALHF by placing a specific nucleotide poly-morphism at the 3′ end of each primer to permitpreferential amplification of P450 allele fromALHF. Our results showed that the ALHF allele-specific primer set for CYP6A5v2 amplified specificDNA fragments only in flies having the autosome5 wild-type marker from ALHF (Fig. 6C). The PCRproducts were further sequenced and revealed thatthey were CYP6A5v2 fragments. This study dem-onstrates that CYP6A5v2 is located on autosome 5.Given that CYP6A5v2 is overexpressed in ALHF, spe-cifically in abdominal tissue, and that CYP6A5v2 islocated on autosome 5, which is correlated with thelinkage of P450-mediated resistance in ALHF (Liuand Yue, 2001), it suggests that the overexpressionof CYP6A5v2 plays an important role in insecticideresistance in ALHF house flies. CYP6A5, on the otherhand, has also been linked to autosome 5 (Cohenand Feyereisen, 1995). However, the lack of a sig-nificant difference in the expression of CYP6A5among CS, aabys, and ALHF house flies indicatesthe reduced importance of CYP6A5 in resistance inALHF compared with that of CYP6A5v2.

CONCLUSION

In the current study, we have characterized theexpression of CYP6A5 and CYP6A5v2 from a pyre-

Fig. 5. Relative expression ofCYP6A5v2 in head+thorax and ab-dominal tissue of CS, aabys andALHF adult house flies. The ex-pression of these two genes wasanalyzed by qRT-PCR as describedin Materials and Methods. Therelative levels of gene expressionare shown as a ratio in compari-son with that in CS flies. The re-sults are shown as the mean ± S.E.There was no significant difference(P ≤ 0.05) in the levels of P450gene expression among the sampleswith the same alphabetic letter.



throid-resistant house fly strain, ALHF. Our studyprovides the first direct evidence that two sequence-closely-related CYP6A5 genes are differentially ex-pressed in insecticide resistant house flies, suggestingthe dissimilar functions of these two genes in a re-sistant organism. Taken together with the significantconstitutive overexpression of CYP6A5v2 only in re-sistant house flies, the expression of the gene indetoxification-related specific tissue, and the corre-lation of the linkage of the gene with that of P450-mediated resistance in ALHF, this study stronglysuggests the functional importance of CYP6A5v2 inthe increased detoxification of insecticides in ALHF.It has been proposed that the cytochrome P450 su-perfamily likely evolved through extensive duplica-tion and differentiation (Gonzalez and Nebert, 1990;Hung et al., 1996; Ranson et al., 2002), and P450genes, which share high similarity and are originallyattributed to allelic variation, may represent recentlydiverged P450 genes (Ranson et al., 2002). It hasbeen proposed also that the simplest way for anenzyme to gain new functions is to duplicate the

entire genes and differentiate them into other genesthrough nucleotide substitution (Ohta, 1991). Ac-cordingly, the significant difference in the expres-sion of CYP6A5 and CYP6A5v2 in the resistant houseflies identified in the current study suggest that thesetwo genes may be of recently diverged P450 genesthrough gene duplication with different functionsin insecticide resistance.

ACKNOWLEDGMENTS

This study was supported by U.S. Departmentof Agriculture National Research Initiative (USDA-NRI) Competitive Grants Program Grants 2001-35302-10956 to N.L. and L.Z. We thank Dr. Nelsonfor naming the P450 genes.

LITERATURE CITED

Aerts JL, Gonzales MI, Topalian SL. 2004. Selection of ap-

propriate control genes to assess expression of tumor an-

tigens using real-time RT-PCR. Biotechniques 36:84–86.

Fig. 6. Genetic linkage analysis of CYP6A5v2. A: Graphicrepresentation of CYP6A5v2, showing locations and se-quences of ALHF allele-specific primers. B: PCR fragmentsgenerated using the CYP6A5v2 allele-independent primerset. C: PCR fragments generated using the CYP6A5v2 al-

lele-specific primer set. The DNA templates used in thePCR reaction were from the following house flies: ALHF,aabys, and the 5 house fly lines—A2345, A1345, A1245,A1235, and A1234—generated from reciprocal crosses be-tween ALHF and aabys.

118 Zhu and Liu


Berenbaum MR. 1991. Coumarins. In: Rosenthal GA, Beren-

baum MR, editors. Herbivores: their interaction with sec-

ondary plant metabolites. New York: Academic Press. p

221–249.

Brattsten LB, Lee YH, Keeley LL. 1986. Insecticide resistance:

challenge to pest management and basic research. Science

231:1255–1260.

Carino F, Koener JF, Plapp FWJ, Feyereisen R. 1992. Expres-

sion of the cytochrome P450 gene CYP6A1 in the house-

fly, Musca domestica. In: Mullin CA, Scott JG, editors.

Molecular mechanisms of insecticide resistance: diversity

among insects, Vol. ACS Symposium series 505. Washing-

ton, DC: American Chemical Society. p 31–40.

Carino FA, Koener JF, Plapp FWJ, Feyereisen R. 1994. Consti-

tutive overexpression of the cytochrome P450 gene

CYP6A1 in a house fly strain with metabolic resistance to

insecticides. Insect Biochem Mol Biol 24:411–418.

Cohen MB, Feyereisen R. 1995. A cluster of cytochrome P450

genes of the CYP6 family in the housefly. DNA Cell Biol

14:73–82.

Cornette R, Koshikawa S, Hojo M, Matsumoto T, Miura T.

2006. Caste-specific cytochrome P450 in the damp-wood

termite Hodotermopsis sjostedti (Isoptera, Termopsidae). In-

sect Mol Biol 15:235–244.

Dorak MT. 2006. Real-Time PCR. In: Dorak MT, editor. Real-

time PCR (Advanced Methods Series). Oxford: Taylor &

Francis.

Festucci-Buselli RA, Carvalho-Dias AS, de Oliveira-Andrade

M, Caixeta-Nunes C, Li H-M, Stuart JJ, Muir W, Scharf ME,

Pittendrigh BR. 2005. Expression of Cyp6g1 and Cyp12d1

in DDT resistant and susceptible strains of Drosophila

melanogaster. Insect Mol Biol 14:69–77.

Feyereisen R. 1999. Insect P450 enzymes. Annu Rev Entomol

44:507-533.

Feyereisen R. 2005. Insect cytochrome P450. In: Gilbert LI,

Iatrou K, Gill SS, editors. Comprehensive molecular in-

sect science. Oxford: Elsevier. p 1–77.

Gao J, Scott JG. 2006. Role of the transcriptional repressor mdGfi-

1 in CYP6D1v1-mediated insecticide resistance in the house

fly, Musca domestica. Insect Biochem Mol Biol 36:387–395.

Gonzalez FJ, Nebert DW. 1990. Evolution of the P450 gene

superfamily: animal-plant “warfare,” molecular drive and

human genetic differences in drug oxidation. Trends Genet

6:182–186.

Gorokhov A, Negishi M, Johnson EF, Pedersen LC, Perera L,

Darden TA, Pedersen LG. 2003. Explicit water near the cata-

lytic I helix Thr in the predicted solution structure of

CYP2A4. Biophys J 84:57–68.

Gotoh O, Fujii-Kuriyama Y. 1989. Evolution, structure, and

gene regulation of cytochrome P450. In: Ruckpaul K, Rein

H, editors. Frontiers in biotransformation. New York: Tay-

lor and Francis. p 195–243.

Guzov VM, Unnithan GC, Chernogolov AA, Feyereisen R.

1998. CYP12A1, a mitochondrial cytochrome P450 from

the house fly. Arch Biochem Biophys 359:231–240.

Hasemann CA, Kurumbail RG, Boddupalli SS, Peterson JA,

Deisenhofer J. 1995. Structure and function of cytochrome

P450: a comparative analysis of three crystal structures.

Structure 3:41–62.

Hodgson E. 1985. Microsomal mono-oxygenases. In: Kerkut

GA, Gilbert LI, editors. Comprehensive insect physiology,

biochemistry and pharmacology, Vol. 11. Oxford: Perga-

mon. p 225–321.

Hung C-F, Holzmacher R, Connolly E, Berenbaum MR,

Schuler MA. 1996. Conserved promoter elements in the

CYP6B gene family suggest common ancestry for cyto-

chrome P450 monooxygenases mediating furanocoumarin

detoxification. Proc Natl Acad Sci USA 93:12200–12205.

Kasai S, Weerashinghe IS, Shono T, Yamakawa M. 2000. Mo-

lecular cloning, nucleotide sequence and gene expression

of a cytochrome P450 (CYP6F1) from the pyrethroid-

resistant mosquito, Culex quinquefasciatus Say. Insect

Biochem Mol Biol 30:163–171.

Li B, Xia Q, Lu C, Zhou Z, Xiang Z. 2005. Analysis of cyto-

chrome P450 genes in silkworm genome (Bombyx mori).

Sci China C Life Sci 48:414–418.

Li X, Schuler MA, Berenbaum MR. 2002. Jasmonate and sali-

cylate induce expression of herbivore cytochrome P450

genes. Nature 419:712–715.

Liu N, Scott JG. 1995. Genetics of resistance to pyrethroid

insecticides in the house fly, Musca domestica. Pestic

Biochem Physiol 52:116–124.

Liu N, Scott JG. 1996. Genetic analysis of factors controlling



elevated cytochrome P450, CYP6D1, cytochrome b5, P450

reductase and monooxyenase activities in LPR house flies,

Musca domestica. Biochem Genet 34:133–148.

Liu N, Scott JG. 1997. Phenobarbital induction of CYP6D1

is due to a trans acting factor on autosome 2 in house

flies, Musca domestica. Insect Mol Biol 6:77–81.

Liu N, Scott JG. 1998. Increased transcription of CYP6D1

causes cytochrome P450-mediated insecticide resistance

in house fly. Insect Biochem Mol Biol 28:531–535.

Liu N, Yue X. 2000. Insecticide resistance and cross-resistance

in the house fly (Diptera:Muscidae). J Econ Entomol

93:1269–1275.

Liu N, Yue X. 2001. Genetics of pyrethroid resistance in a

strain (ALHF) of house flies (Diptera:Muscidae). Pestic

Biochem Physiol 70:151–158.

Liu N, Zhang L. 2002. Identification of two new cytochrome

P450 genes and their 5’-flanking regions from the house-

fly, Musca domestica. Insect Biochem Mol Biol 32:755–764.

Liu N, Zhang L. 2004. CYP4AB1, CYP4AS1 and Gp-9 over-

expression in workers of the red imported fire ant,

Solenopsis invicta. Gene 327:81–87.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene ex-

pression data using Real-time quantitative PCR and the

2–∆∆CT method. Methods 25:402–408.

Maitra S, Dombrowski SM, Basu M, Raustol O, Waters LC,

Ganguly R. 2000. Factors on the third chromosome affect

the level of Cyp6a2 and Cyp6a8 expression in Drosophila

melanogaster. Gene 248:147–156.

Ohta T. 1991. Multigene families and the evolution of com-

plexity. J Mol Evol 33:34–41.

Ranson H, Claudianos C, Ortelli F, Abgrall C, Hemingway J,

Sharakhova MV, Unger MF, Collins FH, Feyereisen R. 2002.

Evolution of supergene families associated with insecti-

cide resistance. Science 298:179–181.

Rose RL, Goh D, Thompson DM, Verma KD, Heckel DG,

Gahan LJ, Roe RM, Hodgson E. 1997. Cytochrome P450

(CYP) 9A1 in Heliothis virescens: the first member of a new

CYP family. Insect Biochem Mol Biol 27:605–615.

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning,

a laboratory manual. Cold Spring Harbor, NY: Cold Spring

Harbor Laboratory Press.

Schuler MA. 1996. The role of cytochrome P450 monooxy-

genases in plant-insect interactions. Plant Physiol 112:1411–

1419.

Scott JG. 1999. Cytochromes P450 and insecticide resistance.

Insect Biochem Mol Biol 29:757–777.

Scott JG, Liu N, Wen Z. 1998. Insect cytochrome P450: di-

versity, insecticide resistance and tolerance to plant tox-

ins. Comp Biochem Physiol 121C:147–155.

Spiess AN, Ivell R. 1998. Normalization of RNA hybridiza-

tion signals by means of SYBR Green II-stained 28S or

18S ribosomal RNA and phosphor imager. BioTechniques

26:46–50.

Terriere LC. 1983. Enzyme induction, gene amplification, and

insect resistance to insecticides. In: Georghiou GP, Saito

T, editors. Pest resistance to pesticides. New York: Plenum

Press. p 265–297.

Terriere LC. 1984. Induction of detoxication enzymes in in-

sects. Annu Rev Entomol 29:71–88.

Tijet N, Helvig C, Feyereisen R. 2001. The cytochrome P450

gene superfamily in Drosophila melanogaster: annotation, in-

tron-exon organization and phylogeny. Gene 262:189–198.

Tomita T, Scott JG. 1995. cDNA and deduced protein se-

quence of CYP6D1: the putative gene for a cytochrome

P450 responsible for pyrethroid resistance in house fly.

Insect Biochem Mol Biol 25:275–283.

Wen Z, Horak CE, Scott JG. 2001. CYP9E2, CYP4C21 and re-

lated pseudogenes from German cockroaches, Blattella

germanica: implications for molecular evolution, expression

studies and nomenclature of P450s. Gene 272:257–266.

Wen Z, Pan L, Berenbaum MB, Schuler MA. 2003. Metabo-

lism of linear and angular furanocoumarins by Papilio

polyxenes CYP6B1 co-expressed with NADPH cytochrome

P450 reductase. Insect Biochem Mol Biol 33:37–947.

Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. 1997.

Continuous fluorescence monitoring of rapid cycle DNA

amplification. Biotechniques 22:130–131.

Documents

Differential Expression of CYP6A5 and CYP6A5v2 in Pyrethroid-Resistant House Flies, Musca domestica