Cloning and characterisation of chs-specific DNA and cDNAsequences from hop (Humulus lupulus L.)

J. Matousek a,*, P. Novak a,b, J. Brıza a, J. Patzak c, H. Niedermeierova a

a Institute of Plant Molecular Biology AS CR, Branisovska 31, 37005 Ceske Budejovice, Czech Republicb South Bohemian University, Biological Faculty, Branisovska 31, 37005 Ceske Budejovice, Czech Republic

c Hop Research Institute GmbH, Kadanska 2525, 438 46 Zatec, Czech Republic

Received 16 November 2001; received in revised form 11 March 2002; accepted 12 March 2002

Abstract

A complete sequence of chalcone synthase (CHS) gene from hop was cloned. The gene designated chs_H1 consists of two exons

and one 187 bp intron. CHS protein predicted from chs_H1 cDNA has 42.5 kDa and retains conserved domains and residues

including 26 amino acids at positions identical to those identified by crystallography as characteristic for catalytic domains of alfalfa

CHS (EC 2.3.1.74). Cloned CHS_H1 protein shows specific CHS activity with 4-coumaroyl-CoA. Structure modelling revealed clear

differences between CHS_H1 and phlorisovalerophenone synthase, the only published CHS-like homologue from hop. Conserved

motifs like H, and G boxes characteristic for the light regulated and stress inducible genes were identified within promoter region of

chs_H1 gene. Highly specific expression of chs_H1 mRNA was detected by quantitative RT PCR in glandular trichomes during

cone maturation. Much lower, but significant levels of chs_H1 mRNA were detected at the stage of hop flowering in petioles

(100%), developed flowers (96%), and in stem apexes (78%), while the lowest levels of mRNA were found in the roots (31%) and leaf

blades (9%). Southern blot analyses predicted at least five additional chs -like genes related to chs_H1. A genomic arrangement

different from phlorisovalerophenone synthase sequences was found for these genes. RFLP analyses using DNA from 15 genotypes

revealed several distinct dendrogram clusters, suggesting specific re-arrangements of hop chs -like genes during evolution and/or

during the breeding and selection processes. # 2002 Elsevier Science Ireland Ltd. All rights reserved.

Keywords: Chalcone synthase; Phlorisovalerophenone synthase; Prenylated flavonoids; Plant genome; RFLP analysis

1. Introduction

Chalcone synthase (CHS) is a polyketide synthase

with a specificity for the sequential condensation of one

p-coumaroyl-CoA and three malonyl-CoA molecules to

yield naringenin chalcone, the precursor for a large

number of flavonoids which are widely distributed in the

plant kingdom (for review see Martin [1]). Chalcone

sythase is a member of the CHS superfamily of

polyketide synthases (for review see Schroder [2]), where

as much as 150 CHS-related sequences have been cloned

[3]. CHS homologues play an essential role in the

biosynthesis of a wide spectrum of biologically active

compounds including antimicrobial phytoalexins, flavo-

noid inducers and cancer chemopreventive phenylpro-

panoids (for review see Schroder [4]). The best

characterised CHS-related enzymes by molecular genetic

methods are stilbene synthases (STS) [5], acridone

synthase (ACS) [6], bibenzyl synthase (BBS) [7], 2-

pyrone synthase (2PS) [8], p-coumaroyltriacetic acid

synthase [9] and phlorisovalerophenone synthase (VPS)

[10,11].

VPS was recently isolated and cloned as the first CHS

homologue from hop Humulus lupulus cones. This

enzyme was proven to be involved in the first steps of

biosynthesis of hop bitter acids by formation of

aromatic intermediates which are then prenylated and

converted to lupulone/colupulone and humulone/cohu-

mulone isomers that play major role in the taste of beer

[10,11]. Bitter acids are synthesised during the develop-

ment of hop female inflorescences into cones and are

accumulated in peltate glandular trichomes forming

* Corresponding author. Tel.: �/42-38-777-5529; fax: �/42-38-530-

0356.

E-mail address: jmat@umbr.cas.cz (J. Matousek).

Plant Science 162 (2002) 1007�/1018

www.elsevier.com/locate/plantsci

0168-9452/02/$ - see front matter # 2002 Elsevier Science Ireland Ltd. All rights reserved.

PII: S 0 1 6 8 - 9 4 5 2 ( 0 2 ) 0 0 0 5 0 - X

lupulin [12,13]. Lupulin is known to contain many other

compounds, including complex spectrum of essential

oils and aromatic compounds that changes during cone

maturation [14]. Recently, prenylated flavonoids [15]and in particular, prenylated chalcones were isolated

from hop extracts [16,17]. These compounds are in-

vestigated as potential antiproliferative and anti-cancer

drugs [18,19]. The presence of prenylflavonoids suggests

that hop cones also express an enzyme that is specifically

involved in flavonoid biosynthesis and is more closely

related to typical CHS (EC 2.3.1.74) than the VPS

identified so far. CHS activity has been demonstrated incone extracts by Zuurbier et al. [20], but no sequence

information was available. For the purpose of this work,

the CHS predicted for flavonoid biosynthes will be

called ‘true’ CHS in order to distinguish it from other

CHS-related enzymes.

Many plant species are found to contain small multi-

gene families of chs genes. For example, 12 chs

sequences have been reported in Petunia hybrida [21],Southern blot analysis of the barley genome for chs

sequences suggested that there may be as many as seven

gene copies [22] and six genes are known in the morning

glory (Ipomoea purpurea ) genome [23]. Analysis of chs

multigene family as shown on the example of morning

glory genome suggests recurrent gene duplications and

subsequent adaptive differentiation among duplicated

chs copies. As a result of this evolution tissue anddevelopmental specificity of chs genes is observed [23].

Although functional differences among individual mem-

bers of chs multifamilies remain unknown, structure

analysis of CHS from alfalfa which was recently

performed by crystallography [3] could provide the

molecular basis for detailed comparative analysis of

polyketide synthases within CHS superfamily, as well as

within multifamilies of individual chs homologues.In this study we aimed to fish for ‘true’ chs homo-

logue from H. lupulus valuable in relation to the

biotechnology of medicinal hops. We characterise a

complete gene chs_H1 encoding ‘true’ CHS type of

enzyme from hop, which shows highly specific expres-

sion in glandular trichomes. Furthermore, we describe

the existence of the polymorphism of chs -specific

sequences in the hop genome. Our sequential, structuraland genomic analyses suggest the presence of a multi-

family of chs -related genes in hops, which clearly differ

from the previously described chs homologue encoding

VPS.

2. Materials and methods

2.1. Plant material

Hop (H. lupulus) plants were maintained in breeding

hopgarden in the Hop Research Institute, Zatec. Sam-

ples were collected in June and July of 1999�/2001.

Czech semi-early red-bine hop Osvald’s clone 72 and the

following comprehensive hop cultivars Magnum, Yeo-

man, Southern Brewer, Northern Brewer, Wye Target,Fuggle, Galena, Eroica, Taurus, Hersbrucker, Spalt and

Brewers Gold were analyzed in our experiments. In

addition, we used two newly established hybrid cultivars

having some genetic background from Osvald 72, cvs.

Premiant and Sladek. For some comparisons we col-

lected samples from field grown Humulus neomexicanus

species.

For some experiments we collected samples from invitro culture of hop mericlone Osvald’s 72 maintained

on MS medium as described previously [24]. In vitro

plants were supplied with illumination (16 h) (70 mmol

m�2 s�1 PAR). Day/night temperatures were 25/18 8C.

Preparation of peltate glands from hop cones was

performed similarly as described by Okada and Ito [11].

2.2. Isolation of genomic DNA and Southern blot

analysis

Genomic DNA from leaves was isolated as described

by Tai and Tanksley [25]. Southern analyses were

perfomed by using Qiabrane Nylon Plus membrane

(Qiagen, Hilden, Germany). Hybridisation was con-

ducted according to Church and Gilbert [26] at 65 8Cin 0.4 M phosphate buffer pH 7.2 containing 7% SDS,

1% bovine serum albumin, 1 mM EDTA pH 8.3 andprobe labelled with RedivueTM [a-32P]dCTP, 3000 Ci

mmol�1 random prime labelling kit RediprimeTM

(Amersham Pharmacia Biotech, Freiburg, Germany).

After overnight hybridisation washing at 65 8C 3 times

for 30 min with 100 mM phosphate buffer pH 7.2, 1%

SDS, 1 mM EDTA pH 8.3 was performed. If necessary,

the membranes were stripped by washing in 0.4 M

NaOH at 42 8C for 15 min and then in 0.1�/ SSC, 0.1%SDS, 0.2 M Tris HCl pH 7.5 at 42 8C for 30 min. Three

DNA probes were prepared in order to detect different

regions of the chs_H1 gene. Probe H1Ex1Ex2 covered

gene region from position 489 to position 1852 and was

prepared using primers CHS_H1Nde (5?AGGAC¯

A-

T¯

ATGGTTACCGTCGAGGAA3?) and CHS_H1Bam

(5?CTAGGATCCCACACTGTGAAGCAC3?) (base

changes to create NdeI and BamH1 sites for the cloningpurposes are underlined). Probe H1Ex1 (positions 489�/

893) was prepared using the primers CHS_H1Nde and

CHSJ5 (5?GCATGTAACGCTTTCTAATCATGG3?).The third probe H1Ex2 covered exon 2 of chs_H1

gene in positions 1154�/1824 and was prepared using the

combination of CHSJ3 (5?ATGATGTACCAA-

CAAGGTTG3?) and CHSJ4 (5?GTCTCAACAGTGA-

GTCCAGG3?) primers. The probe for analysis ofphlorisovalerophenone synthase (vps) was homologous

to the probe H1Ex2 and was amplified from genomic

DNA of clone Osvald’s 72 based on the sequence

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181008

published in GeneBank (AC: AB047593). The following

primers were used for vps probe amplification: 5?vh1

(5?ATGCTGTATCAACTCGGCTG3?) and 3?vh1

(5?CAGAGGTGGCAGTCTGGGCC3?).

2.3. PCR amplifications, cloning and sequencing

For PCR amplification of the CHS-specific DNA

fragment H1 from the hop genome, we used primers

designated as ‘consensus primers’ CHSJ3 and CHSJ4

(see above). The coding region of chs_H1 was amplified

with primers CHSH1Nde and CHSH1Bam. This frag-

ment was cloned in pET15b for its expression inEscherichia coli [BL21(DE3)]. The full length chs_H1

gene was amplified using CHSH1PROM (5?GATCA-

CGACCGTCCATTCT3?) and CHSH13?END (5?GA-

AATTGACCTTTA CTCCAAA3?) primers. Forward

primer CHSJ6 (5?GAGCACAAAACTGAGCTCAA-

GG3?) and reverse primer CHSJ5 (5?GCAT-

GTAACGCTTTCTAATCATGG3?) were used for the

analysis of intron length polymorphism in CHS genes. Ifnot stated otherwise, Pwo polymerase (Angewandte

Gentechnologie Systeme GmbH, Germany) was used

for PCR reactions. In a typical experiment we used the

following amplification conditions: 2 min at 94 8C,

35�/ (30 s at 94 8C; 30 s at 52 8C, 60 s at 72 8C); 10

min at 72 8C.

In order to identify the chs_H1 promoter sequence,

inverse PCR reaction was performed using the primersINV1 (5?GGTACTCACTCTGGAGGATGCA3?) and

INV2 (5?GGACGGTTTCGTTTTGTGG3?). For in-

verse PCR, genomic DNA was digested with MboI

and re-ligated into circular form. The amplification

conditions were: 2 min at 94 8C, 35�/ (30 s at 94 8C;

30 s at 54 8C, 2 min at 72 8C).

DNA fragments were cloned in the vector pCR-Script

SK(�/) (pCR-Script Cloning Kit, Stratagene). Auto-matic sequencing was performed with an ALF II system

(Amersham-Pharmacia) using a sequencing kit with

Cy5-labelled standard primers.

2.4. RNA isolation and RT-PCR

For the reverse transcription-polymerase chain reac-

tion (RT PCR) total RNA was isolated using RNeasyPlant Total RNA kit (Qiagen). RT PCR reactions were

performed using Titan One Tube RT PCR system

(Roche Molecular Biochemicals). If not stated other-

wise, reverse transcription run for 30 min at 48 8C.

After 2 min denaturation at 94 8C the polymerase chain

reaction started 30 s at 94 8C, 30 s at 55 8C and 60 s at

68 8C for 38 cycles.

RT PCR amplification of 3? portion of chs_H1 cDNAwas performed from mRNA purified with oligo dT

coupled to magnetic beads (Dynal, Great Neck, NY). A

combination of oligo dT15 and CHS_H1 A1

(5?ATCACTGCCGTCACTTTC3?) was used for this

reaction. Prior to the amplification of the 5? portion of

chs_H1 cDNA, G-tailed first strand cDNA was pre-

pared according to the principle of the method describedby Lee and Vacquier [27]. An Oligo dC adapter

(5?AAGGAGATATCCACACCCCCCCCC3?) was

then used in combination with the CHS_H1 A2 primer

(5?AAATAAGCCCAGGAACATC3?) in Titan One

Tube RT PCR reaction to amplify specific cDNA

fragment. This fragment was cleaved with EcoRV

before cloning.

Quantitative RT PCR (Q RT PCR) was used to assaythe specific expression of chs_H1 mRNA in different

tissues. Q RT PCR reactions were performed using 5 mg

of total RNA per reaction as template and [g-32P] ATP-

labeled primers CHS_H1 A1 and CHS_H1 A2. The

reaction conditions were the same as described above,

except that 31 instead of 38 cycles were used for Q RT

PCR. Under these reaction conditions, a linear relation

was observed between the amount of RT PCR productand the amount of RNA in a reaction mixture. Q RT

PCR of cellular 7SL RNA as the reference sample was

performed in parallel, using [g-32P] ATP-labeled primers

a (5?TGTAACCCAAGTGGGGG3?) and anti-b(5?GCACCGGCCCGTTATCC3?) [28]. A primer desig-

nated UCR (5?CATGTATAAACTTTCTGC3?) [28]

was used in combination with primer a to test the purity

of RNA samples from DNA.

2.5. GenBank database sequences, computer analyses and

other methods

For comparative analyses we selected sequence data

for alfalfa chs2, petunia chsA, Arabidopsis thaliana

chalcone sythase and phlorisovalerophenone synthase

from the GenBank database (see e.g. [29]) under

accession numbers L02902, X14591, M20308 andAB047593, respectively. The cloned sequence chs_H1

from our experiments has AC AJ304877.

Sequence data comparisons were carried out with

DNASIS for Windows, version 2.5 (Hitachi) and using

OMIGA software (Oxford Molecular). The cluster

analysis was performed using NTSYS-pc v. 2.02 for

WINDOWS (Exeter Software, US). Only sharp, strong

and reproducible radioactivity signals and silver stainedbands were considered for the analyses. Similarity was

estimated using Jaccard’s [30] similarity coefficient

(JCS�/a /(n�/d)), which ranges from 0 (all fragments

between accessions were different) to 1 (all fragments

among evaluated genotypes were identical). The den-

drograms were generated using the unweighted pair

group method with arithmetic mean (UPGMA) cluster-

ing procedure.Comparative protein modelling of the 3-D structures

of CHS_H1 and VPS was performed using SWISS-

MODEL Version 36.0002 [31,32]. The theoretical struc-

J. Matousek et al. / Plant Science 162 (2002) 1007�/1018 1009

tures were portrayed against the template of CHS2 of

Medicago sativa (PDB ID 1BI5). This structure was

determined by Ferrer et al. [3] using crystallography.

Alignments of 3-D structures and structural analyseswere performed using Swiss-PdbViewer v3.7b2 [33].

Intron regions of chs genes were analyzed in 6%

acrylamide gels buffered by 1�/TBE pH 8.3 (PAAGE)

and stained for nucleic acids with AgNO3 [34]. The

activity of cloned CHS_H1 with 4-coumaroyl-CoA was

determined according to Zuurbier [35].

All autoradiograms were scanned and quantified

using STORM device and ImageQuaNT software (Mo-lecular Dynamics, USA).

3. Results

3.1. Cloning and sequence analysis of chs_H1 gene

We aimed to clone ‘true’ CHS-specific fragment (Fig.

1) from the hop genome which could serve for identi-

fication of authentic hop sequence and as a hybridisa-

tion probe for further experiments. Because of the high

homology of various CHS-like proteins, we did not

design degenerate primers. Instead, the primers were

derived from the comparisons of ‘true’ CHSs onnucleotide (nt) level. Sixteen chs sequences from differ-

ent plant species were aligned (not shown) and con-

sensus primers were assembled as a sequence of

nucleotides that have the highest incidence at each

individual nucleotide position. 5? primer CHSJ3 had

95% conservation and covered position 1154�/1173,while 87% conservation was calculated for 3? primer

CHSJ4, which covered position 1805�/1824 on chs_H1

gene (not shown). PCR performed using these primers

yielded a single band of 670 bp. Three clones containing

a 670 bp fragment were sequenced and found to be

identical. This genomic fragment was designated H1. It

exhibited about 75% homology to various chs sequences

on the nucleotide level and, therefore, we used thatsequence further to fish for a hop chs -specific gene. RT

PCR was performed using mRNA isolated from young

hop female inflorescences to ascertain the expression of

H1 sequence and to clone corresponding cDNA (Fig. 1,

step II). Primers A1 and A2 surrounding the unique

restriction site ClaI were designed to obtain two over-

handed cDNA fragments which enabled us to perform

easy amplification, sequencing, and re-constitution ofthe full-length H1 coding region. An authentic cistron

was then amplified from the hop genome in the next step

(Fig. 1, step III) which fully corresponded to the original

H1 fragment and chs -specific cDNA. A single intron

was identified in the chs_H1 coding region in a

conserved position characteristic for the majority of

chs genes, between the first and second base of the

cysteine residue at position 60. To obtain the promoterregion, inverse PCR was carried out with primers from

the exon I and intron sequence (step IV, Fig. 1). A single

fragment of about 700 bp containing 495 nucleotides

upstream of the coding region, was obtained from this

reaction. In the last step, a 2093 bp fragment was

amplified from hop genome (step V, Fig. 1) using

primers derived from an upstream promoter region

and from the 3? region including polyadenylation siteidentified by cDNA sequencing. The scheme of chs_H1

gene and putative promoter and terminator sequences

are shown in Fig. 2.

It was predicted that the cDNA of chs_H1 encodes

for 399 aa protein of 42.5 kDa. The coding region (exon

1 plus exon 2) of chs_H1 gene is 74, 75 and 77% identical

to Arabidopsis , alfalfa chs2 and petunia chsA CHS

genes at the nt level, respectively. This identity wascalculated to be 85, 84 and 87% for Arabidopsis , alfalfa

CHS2 and petunia CHSA chalcone synthase at the aa

level, respectively. Very high aa homology of CHS_H1

to different CHSs was found providing that groups of

equivalent residues were included in the calculations.

For instance, this homology was 93% for CHS_H1 and

alfalfa CHS2, which was analyzed in detail by crystal-

lography. Significantly less identity, 70 and 73%, wasfound between CHS_H1 to VPS at nt and aa levels,

respectively. A total of 87% aa homology between these

two hop proteins was achieved if equivalent residues

were considered in calculations.

Fig. 1. Schematic drawing of PCR amplifications of chs_H1 gene. (I)

PCR amplification of chs_H1 fragment with ‘consensus’ primers. (II)

An amplification of 5? and 3? cDNA fragments using RT PCR. Oligo

dT was used as RT primer to amplify 3? end portion of cDNA from

Poly A tail. Oligo dC adapter was used as PCR primer for the second

strand reaction with G-tailed first cDNA strand template. The

restriction site Cla I within the exon 2 is shown. (III) PCR amplifica-

tion of chs_H1 genomic fragment including the coding region and

intron. (IV) Inverse PCR using Mbo I-cleaved and circularised genomic

fragments to fish for chs_H1 promoter region. (V) PCR amplification

of full length chs_H1 from hop genome. Position of primers described

in Section 2 are indicated by the arrows. The scheme is not in scale.

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181010

Various conserved regulatory motifs reviewed by

Martin [1] and Rushton and Somssich [36] were

identified within the promoter region of chs_H1 gene

(Fig. 2). For instance, upstream from the TATA signal

(5?TATAAATA3?), two G-boxes (5?CACGTG3?) were

found, which are characteristic for chs genes responding

to UV irradiation or pathogen attack. H-box

(5?CTACCA3?) which falls in the same category of

regulatory elements as the G-box was identified at

position 22�/27. A CHS-like box (5?TACCACTACC-

AACAT3?), whose sequence is close to the CHS-box

consensus TACC[N7]CT, was identified 25 nucleotides

downstream from the TATA signal. In addition, a motif

for tissue-specific expression (5?TACTAT3?) having

general consensus TACPyAT, was identified within the

promoter region. A polyadenylation signal-like element

(5?AATAATA3?) was identified at position 2055�/2061on the chs_H1 gene (Fig. 2), 34 nucleotides upstream

from the polyadenylation site.

3.2. Comparative modelling, structure analysis of hop

CHS homologues and activity of recombinant CHS_H1

protein

In order to better characterise the CHS_H1 protein, acomparative modeling approach (see Section 2 for

details) was used to predict the theoretical structure

for CHS_H1 (Fig. 3). Important residues, which form

Fig. 2. Sequence organisation of chs_H1gene within cloned 2093 bp DNA fragment and putative regulatory elements. Putative regulatory signals are

shown within the 5? (promoter) region (A) and 3? region (C) of the gene (see text for further details). The scheme of cloned chs_H1 gene (position 1�/

2093) is depicted in part B. Positions of individual chalcone synthase probes are shown on the top of the scheme. Ex1, Int, Ex2 and PA designate exon

1, intron, exon 2, and polyadenylation signal, respectively.

J. Matousek et al. / Plant Science 162 (2002) 1007�/1018 1011

the geometry of the active site, active center, coumaroyl

binding site and cyclisation pocket, were found in

CHS_H1 at positions identical to those determined for

alfalfa CHS by crystallography [3]. With the exception

of T132 and T197, all conserved residues under con-

sideration were also found in VPS. According to our

homology plots, conserved CHS-specific residue T132

within the cyclisation pocket corresponds to G134 in

VPS. However, T197, which contributes to the coumar-

oyl binding site in CHSs, has no homologous position in

VPS. Apart from these amino acid differences, no

obvious differences between CHS_H1 and VPS at

positions 132 and 197 were detected in the structural

alignment. Some differences, however, were detectable

in several other regions (Fig. 3), including the short

region surrounding the nucleophile attachment site of

the catalytic center formed by residues C164 and C166

in CHS_H1 and VPS, respectively. The difference close

to the catalytic cysteine involved the change of turnlike

glutamine in CHS_H1 (position 162) for leucine in VPS

(position 164). The biggest loops designated I, II and III

(Fig. 3), which were detected on aligned structures, are

obviously due to the presence of non homologous amino

acid residues in these regions. According to our com-

parisons, non-homologous residues at CHS/VPS posi-

tions from N45/K47 to K49/M51 should contribute to

differences within loop I, where a b turn motif is

predicted in CHS, and an a helix is formed in VPS.

Loop II at CHS/VPS positions from N82/H84 to A88/

A90 shows an a helix in CHS, while a b turn-like

structure is predicted in VPS. Loop III indicates some

structural differences in the region extending from I229/

D231 to I236/I239 on the CHS/VPS alignment. These

differences include the prediction of a longer a helix

predicted in CHS as compared to VPS. No 3-D

structural differences between CHS_H1 and VPS were

readily detected by the comparative analysis of the

structure of the cyclisation pocket, which dictates the

specificity of the condensation reaction. Indeed, the

recombinant CHS_H1 protein clearly showed the activ-

ity with 4-coumaroyl-CoA producing naringenin chal-

cone, which under the conditions of the assay cyclises to

naringenin. At the same time, no byproducts were

observed, suggesting high specificity of the reaction. In

contrast, CHS_H1 reaction with isovaleryl-CoA led to

the appearance of phloroisovalerophenone peak accom-

panied with the major prematurely terminated product

(6-isobutyl-4-hydroxy-2-pyrone) (results not shown).

Fig. 3. An alignment of a single-line ribbon monomer models of CHS_H1 and phlorisovalerophenone synthase. The view is oriented from the

optimal angle to give visualisation on calculated structural differences. These differences are indicated by the arrows. The largest loops are marked by

Roman numerals I, II and III and within the loops VPS-specific strands are indicated. The positions of catalytical cysteine C164 and CHS_H1-

specific T197 were identified by the analogy to alfalfa chalcone sythase crystallography [3] and mapped on the structures, using swiss viewers as

described in Section 2.

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181012

Thus, it can be concluded from our analyses that the

characterised chs_H1 gene encodes for ‘true’ CHS and

clearly differs from the VPS homologue which was

isolated from hop.

3.3. CHS_H1 mRNA expression in different tissues

We characterised chs_H1 as a CHS encoding gene

that has various regulatory boxes characteristic for light

regulated, pathogen inducible and tissue specific expres-

sion. In further experiments we addressed the question

concerning the possible tissue specific expression of

CHS_H1 mRNA at the stages of hop flowering andcone maturation. In order to achieve the required

sequence specificity and sensitivity we used the quanti-

tative RT PCR approach. The relative levels of

CHS_H1 mRNA were assessed according to the accu-

mulation of 250 bp fragment amplified by 32P-gATP

end-labelled A1 and A2 primers (Fig. 1). These primers

were specific for chs_H1 clones and no product

appeared from reactions with cloned vps sequences(not shown). In parallel, we determined the level of

7SL RNA in the samples using end-labelled primers aand anti-b, described previously [28]. It is known that

the levels of cellular 7SL RNA do not change signifi-

cantly in the young tissue [37] therefore, we used this

system for reference purposes.

While we found no significant quantitative differences

for 7SL RNA expression (not shown), CHS_H1 mRNAlevels exhibited clear differences. At the stage of hop

flowering (Fig. 4), the highest levels of specific radio-

activity signals were detected for petioles (100%),

developed female flowers (97%), young stems (79%)

and in stem apexes (78%), while low levels were found in

young anthers (35%), roots (31%), and leaf blades (9%).

Specific CHS_H1 mRNA expression we found in

maturating cones, where about 100 times highermRNA level was detected than in hop petioles (not

shown). No signals were obtained for different tissues

from hop mericlones grown in vitro in glass boxes under

artificial illumination conditions. Taken together, these

results suggest that there is strong tissue specific

regulation of the chs_H1 gene in field grown plants.

Because no expression was seen in in vitro plants, one

can assume strong inducibility of chs_H1 under naturallight conditions. Expression of chs_H1 is clearly induced

in glandular tissue, however, we did not further specify

the factors which may influence the levels of chs_H1.

3.4. Analysis of hop genomic DNA for the variability of

chs-like sequences

It is known that chs genes are usually organised insmall multigene families. In further experiments, South-

ern blot analyses were performed with the aim of

estimating the number of genes related to chs_H1 and

the variability of chs -related sequences in several hop

genotypes. Southern blot patterns specific for chs_H1,

and the chs homologue-vps, were obtained using chs -

and vps-specific probes (Fig. 5). These results clearly

show 2-4 chs_H1 specific HindIII fragments in different

genotypes ranging from 13.5 to 5.3 kb. The distribution

of vps -specific HindIII fragments was quite different

from the chs_H1 distribution (Fig. 5A). It is known

from GenBank information that there is a HindIII site

within the exon II of vps */this is the reason why the

small (approximately 0.8 kb) fragment was detectable in

all genotypes after the HindIII cleavage. The appearance

of additional genomic fragments in the range of 3.8�/4.8

kb strongly hybridising to vps probe in cvs. Yeoman,

Galena, Taurus and Brewers Gold (Fig. 5A), suggests an

existence of at least one additional vps gene in these

genotypes. Various double digested DNA samples from

the genotype of Osvald’s 72 that probed for chs or vps

genes (Fig. 5B), confirmed different distribution of

genomic fragments hybridising to the respective probes.

While at least four chs -specific fragments were seen for

Osvald’s 72 genotype (the cleavage with HindIII�/

EcoRI), only one vps -specific band was detectable for

Osvald’s 72.

Because a restriction cleavage of the chs_H1 sequence

(Fig. 2) with BstYI should split exon 1 from the

majority of exon 2, we used this restriction enzyme for

more detailed RFLP analysis of chs_H1-related se-

quences from 15 hop genotypes and H. neomexicanus

species. The membranes were probed either with the

Fig. 4. Quantitative RT PCR of hop chs RNA. RNA was isolated

from different tissues at stage of hop flowering and applied in RT PCR

reactions with 5? end-labeled primers A1 and A2 as described in

Section 2. PCR products were analysed in 5% native acrylamide gels

and quantified using STORM in the ‘volume’ units which characterise

pixel intensities (U) within the zone. The mean values of radioactivity

signal are given in percents (100% corresponds to 79�/103 U).

Confidence intervals for individual measurements are given at level

a�/0.05. RNA from the following tissues was extracted: 1, young

stem; 2, young female flower (1�/1.8 cm); 3, stem apex; 4, young leaf

blade (5 cm2); 5, leaf petioles; 6, roots; 7, young anthers (2�/2.5 mm).

J. Matousek et al. / Plant Science 162 (2002) 1007�/1018 1013

hybridisation probe H1Ex1, H1Ex2 or H1Ex1Ex2,

covering exone 1, 2 or the whole chs_H1 coding region,

respectively (Fig. 6). A wide genetic polymorphism of

chs_H1-related sequences was revealed among various

hop genotypes, suggesting specific re-arrangements of

hop chs -like genes during evolution and/or during

breeding and selection processes (Fig. 6). The variability

of chs_H1 related genes was also proved by PCR

analysis of intron regions (not shown). In this case,

specific primers were derived from exon 1 and exon 2 of

chs_H1 and used to amplify intron regions. Surpris-

ingly, no uniform intron sequence was revealed and

instead, various polymorphic fragments ranging from

260 to 400 bp were detected for different cultivars (not

shown). These fragments hybridised strongly to the

chs_H1 probe and showed similar distributions even if

different combinations of nested primers were used for

PCR (not shown), suggesting chs -specific PCR pro-

ducts.

RFLP data were combined and treated by cluster

analysis procedures as described in Section 2. The

Fig. 5. Southern analysis of genomic DNA from hop with chalcone

synthase (chs ) and phlorisovalerophenone synthase (vps ) exone 2-

specific DNA fragments as probes. (A) DNA from seven hop cultivars

was cleaved with Hind III and probed either for chs or vps . Lane 1,

Osvald’s 72; lane 2, Yeoman; lane 3, Southern Brewer; lane 4, Eroica;

lane 5, Galena; lane 6, Taurus; lane 7, Brewers Gold. (B) Analysis of

Osvald’s 72 genomic DNA cleaved with different restriction endonu-

cleases and probed either for chs or vps . Lanes 1�/4, DNA double

digested with EcoRI�/HindIII, Eco RI�/Dra I, Eco RI�/BstYI and

Eco RI�/BamHI, respectively. DNA marker is aligned on the right side

of the autoradiogram.

Fig. 6. Southern blots of 15 H. lupulus genotypes and species H.

neomexicanus. DNA was digested with BstY I, electrophoresed,

blotted and probed with H1Ex1Ex2 probe (A), H1Ex1 probe (B) or

H1Ex2 probe (C). Probes are positioned on chs_H1 sequence as shown

in Fig. 7. Lane 1, Brewers Gold; lane 2, Eroica; lane 3, Galena; lane 4,

Magnum; lane 5, Fuggle; lane 6, Southern Brewer; lane 7, Northern

Brewer; lane 8, Sladek; lane 9, Premiant; lane 10, Osvald 72; lane 11,

Wye Target; lane 12, Yeoman; lane 13, Taurus; lane 14, Spalt; lane 15,

Hersbrucker; lane 16, H. mexicanus ; lanes kb, marker DNA (1 kb

ladder, BRL).

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181014

corresponding dendrogram is depicted in Fig. 7. Several

clusters were formed on this dendrogram. As expected,

Osvald’s hop showed the highest relation to cv. Spalt.

Cultivars originating from Osvald’s hop, i.e. cvs. Pre-

miat and Sladek, fell to related cluster together with

some hops of American origin such as Northern Brewer,

which was used to prepare these cultivars. Other closely

related genotypes, e.g. Galena, Eroica and Brewers

Gold, formed quite a distinct cluster, suggesting lower

homology to hops, which have a genetic background

similar to Osvald’s 72. The lowest level similarity was

found in the wild hop H. neomexicanus, which roots the

dendrogram (Fig. 7).

Different methods, i.e. Southern blot, RFLP and

PCR analyses suggested that there is a family of genes

related to chs_H1 that are distinct from vps, and

showing some degree of genetic polymorphism in their

arrangement in the hop genome. In addition to results in

Figs. 5 and 6, two fragments having 3.1 and 6.5 kb were

obtained after the single EcoRI cleavage. Four HindIII

fragments hybridising to H1Ex2 probe (Fig. 2) and

having 11.5, 9.6, 8.5 and 5.5 kb (Fig. 6), as well as four

DraI fragments having 14.1, 11.8, 2.5 and 2.4 kb, were

detected on Southern blots, (not shown) suggesting the

presence of at least four genes closely related to chs_H1

in the genome of Osvald’s 72. However, double cleavage

of DNA with EcoRI and DraI revealed five specific

bands of 12.5, 3.4, 2.3, 2.2 and 2.1 kb hybridising to the

H1Ex2 probe (Fig. 5B) and six distinct bands were

found on the autoradiograms, where DNA was cleaved

with BstYI and hybridised to the H1Ex1 probe (Fig.

6B). These results suggest that at least six sequences

related to chs_H1 are present in the hop genome and

that some of them are arranged tandemly.

4. Discussion

4.1. Cloning and properties of ‘true’ CHS from hop

In this study we aimed to fish a hop gene encoding

CHS (EC 2.3.1.74). The main reasons to characterise

hop CHS(s) is its role in biosynthesis of prenylated

chalcones [16] either as a natural component in hop or in

medicinal hops modified by biotechnology approaches.VPS, which was identified to be involved in biosynthesis

of hop bitter acids [11] has no or low specificity for

chalcone synthesis, as no significant CHS activity was

found in purified VPS fractions [10].

We cloned a gene designated chs_H1 encoding ‘true’

CHS type of enzyme from hop. Its coding region shows

high identity*/approximately 75% at nucleotide and

about 90% at amino acid level, with known CHSs. Thededuced CHS_H1 protein retained conserved amino

acid residues, which according to the crystallography

analysis of the CHS homologue from alfalfa [3],

contribute to the catalytic properties of CHS. In

addition, the recombinant protein was determined as

CHS by the enzymatic assay.

From our comparisons of aa sequences and substrate

specificities we concluded that the characterised chs_H1gene encodes for protein, which clearly differs from hop

Fig. 7. Genetic diversity analysis of hop based on genomic fragments hybridising to chs_H1 specific probes. The results in Figs. 5 and 6 were

subjected to cluster analysis as described in Section 2. The dendrogram was generated using the unweighted pair group method with arithmetic mean

(UPGMA) clustering procedure. H. neomexicanus species was included to root the dendrogram. Coefficient of genetic similarity is given.

J. Matousek et al. / Plant Science 162 (2002) 1007�/1018 1015

VPS. For the activity of CHS_H1 we got TLC patterns

practically identical to those described by Zuurbier et al.

[35] for CHS from Pinus sylvestris. Differences between

CHS_H1 and VPS include some non-homologous

amino acid changes that surround conserved residues

of the cyclisation pocket; and a set of conserved amino

acid residues forming part of the coumaroyl binding site

in CHS. T197 was mainly found to have no adequate

counterpart in VPS. This amino acid difference is

consistent with the different initial capture specificity

of VPS, which utilises isovaleryl-CoA or isobutyryl-CoA

as substrate components, instead of 4-coumaroyl-CoA,

which is a natural component of the CHS substrate [see

e.g. [10] for substrate specificities]. It is interesting to

mention in this respect the recent work published by Jez

et al. [38], who performed site-specific mutagenesis of

several plant-specific polyketide synthases. In this work

the mutation T197L changed the volume of active site

cavity and catalytical properties of corresponding mu-

tant. In addition to this particular aa difference, several

minor structural deviations and at least three bigger

loops were detected on the CHS_H1/VPS structure

alignment. These bigger loops do not apparently include

the predicted catalytic domains of CHS_H1 or VPS.

However, it is possible that some of these differences

include structural domains responsible for the interac-

tion of CHS_H1 or VPS with various proteins. It is

known that CHS functions in cells as a homodimer (for

review see Martin [1]). Some recent data support the

idea that CHS interacts with other flavonoid enzymes

[39]. Similar protein�/protein interactions can also be

assumed for the VPS homologue.

4.2. Expression of chs_H1 gene

The entire cloned sequence of chs_H1 gene has 2093

bp including upstream promoter sequence and the

termination signal. The main characteristics of promoter

regulatory elements of chs_H1, are the presence of CHS,

H and G boxes which are known for light regulated, and

stress-, and pathogen-inducible genes (for reviews see

[1,34]), and these are consistent with CHS regulation.

The characteristics of CHS_H1 mRNA expression

suggests tissue specificity, which is often observed for

CHS isoforms encoded by chs gene families

[21,23,40,41]. It is not known, however, whether or not

the TACPyAT motif of organ-specific expression [42],

which was found in chs_H1, is responsible for the

differences in mRNA levels that we observed by

quantitative RT PCR. The high expression level of

CHS_H1 in glandular trichomes is consistent with the

assumption that this enzyme is responsible for ‘true’

CHS activity in glandular hop tissue as detected by

Zuurbier et al. [20].

4.3. chs_H1 gene family and variability of chs-like

sequences in hop genome

This research demonstrates the presence of at least sixsequences strongly hybridising to chs_H1 in Osvald’s 72

genome and a polymorphism of chs -specific intron

sequences. These results suggest the existence of a family

of genes related to chs_H1. According to recent EMBL

database entries AB061020 and AB061022, there are

known cDNAs of at least two additional, but still not

characterised chs -homologues in hop. Southern blot

patterns of vps genes clearly differed from those ofchs_H1-like genes, suggesting different organisation of

vps gene(s) within the hop genome. It can be predicted

from our Southern blots that there are at least two vps

genes, because there is one monomorphic and one

polymorphic band ranging from 3.8 to 4.8 kb. The

polymorphic band is seen in cvs. Yeoman, Galena,

Taurus and Brewers Gold. The monomorphic band

obviously appeared due to HindIII restriction cleavagewithin an internal restriction site that is localised in the

coding region of vps , as can be predicted from the

sequence described by Okada and Ito [10].

A wide genetic polymorphism of chs_H1-hybridising

fragments was revealed when fifteen hop genotypes and

H. neomexicanus were analyzed on genomic blots. This

polymorphism suggests specific re-arrangements of chs -

like genes in hop during evolution and/or during thebreeding and selection processes. Several clusters were

formed on the constructed dendrogram and this cluster-

ing corresponded with the genetic origins of analysed

hop genotypes, as also documented by other molecular

genetic methods [43]. Some of the cultivars analyzed

belong to hops that produce high levels of bitter acids,

whereas others like Osvald’s clone 72 belong to fine

aromatic hops. Although it can be assumed that thereare genetic differences in the expression and activity of

CHS, VPS or other CHS-like homologues that could be

involved in the biosynthesis of valuable secondary

metabolites in hop, another study is necessary to analyse

this possibility.

Acknowledgements

The authors thank Drs Gudrun and Joachim Schro-der (University Freiburg, Germany) for the enzyme

assays determining activity of cloned CHS_H1 protein.

The authors would like to thank Aaron O. Richardson

(Indiana University, Jordan Hall, Bloomington, USA)

and Sandie King (University of Glasgow, Scotland) for

their help in preparation of this manuscript. We thank

Ing. Lidmila Orctova, Helena Matouskova and VlastaTetourova (Institute of Plant Molecular Biology AS

CR, Ceske Budejovice, Czech Republic) for their

excellent technical assistance. The work was supported

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181016

by grant 521/99/1591 from the Grant Agency of Czech

Republic.

References

[1] C.R. Martin, Structure, function and regulation of the chalcone

synthase, Int. Rev. Cytol. 147 (1993) 233�/284.

[2] J. Schroder, A family of plant-specific polyketide synthases. Facts

and predictions, Trends Plant. Sci. 2 (1997) 373�/378.

[3] J.L. Ferrer, J.M. Jez, M.E. Bowman, R.A. Dixon, J.P. Noel,

Structure of chalcone synthase and the molecular basis of plant

polyketide biosynthesis, Nat. Struct. Biol. 6 (1999) 775�/784.

[4] J. Schroder, Probing plant polyketide biosynthesis, Nat. Struct.

Biol. 6 (1999) 714�/716.

[5] G. Schroder, J.W.S. Brown, J. Schroder, Molecular analysis of

resveratrol synthase: cDNA, genomic clones and relationship with

chalcone synthase, Eur. J. Biochem. 172 (1988) 161�/169.

[6] K.T. Junghanns, R.E. Kneusel, A. Baumert, W. Maier, D.

Groger, U. Matern, Molecular cloning and heterologous expres-

sion of acridone synthase from elicited Ruta graveolens cell

suspension cultures, Plant Mol. Biol. 27 (1995) 681�/692.

[7] R. Preisig-Mueller, P. Gnau, H. Kindl, The inducible 9,10-

dihydrophenantrene pathway: characterization and expression

of bibenzyl synthase and 5-adenosylhomocysteine hydrolase,

Arch. Biochem. Biophys. 317 (1995) 201�/207.

[8] Y. Helariutta, P. Elomaa, M. Kotilainen, R.J. Griesbach, J.

Schroder, T.H. Teeri, Chalcone synthase-like genes active during

corolla development are differentially expressed and encode

enzymes with different catalytic properties in Gerbera hybrida

(Asteraceae), Plant Mol. Biol. 28 (1995) 47�/60.

[9] T. Akiyama, M. Shibuya, H.-M. Liu, Y. Ebizuka, p-Coumaroyl-

triacetic acid synthase, a new homologue of chalcone synthase,

from Hydragea macrophylla var. thunbergii , Eur. J. Biochem. 263

(1999) 834�/839.

[10] N.B. Paniego, K.W.M. Zuurbier, S.Y. Fung, R. van der Heijden,

J.J.C. Scheffer, R. Verpoorte, Phlorisovalerophenone synthase, a

novel polyketide synthase from hop (Humulus lupulus L.) cones,

Eur. J. Biochem. 262 (1999) 612�/616.

[11] Y. Okada, K. Ito, Cloning and analysis of valerophenone

synthase gene expressed specifically in lupulin gland of hop

(Humulus lupulus L.), Biosci. Biotechnol. Biochem. 65 (2001)

150�/155.

[12] T. Hirosawa, T. Saito, T. Tanaka, H. Matsushima, SEM

Observation and HPLC analysis of the accumulation of alpha-

and beta-acids in the fresh developing hop (Humulus lupulus L.)

peltate glandular trichomes, J. Electron Microsc. 44 (1995) 145�/

147.

[13] E.S. Kim, P.G. Mahlberg, Early development of the secretory

cavity of peltate glands in Humulus lupulus L. (Cannabaceae ),

Mol. Cells 10 (2000) 487�/492.

[14] R.C. Menary, P.E. Doe, Some morphological and chemical

changes in hops during maturation, J. Sci. Food Agric. 34

(1983) 921�/929.

[15] J.F. Stevens, M. Ivancic, V.L. Hsu, M.L. Deinzer, Prenylflavo-

noids from Humulus lupulus , Phytochemistry 44 (1997) 1575�/

1585.

[16] N. Etteldorf, N. Etteldorf, H. Becker, New chalcones from hop

Humulus lupulus L, Z. Naturforsch. 54c (1999) 610�/612.

[17] J.F. Stevens, A.W. Taylor, G.B. Nickerson, M. Ivancic, J.

Henning, A. Haunold, M.L. Deinzer, Prenylflavonoid variation

in Humulus lupulus : distribution and taxonomic signifcance of

xanthogalenol and 4?-O-methylxanthohumol, Phytochemistry 53

(2000) 759�/775.

[18] C.L. Miranda, J.F. Stevens, A. Helmrich, M.C. Henderson, R.J.

Rodriguez, Y.H. Yang, M.L. Deinzer, D.W. Barnes, D.R. Buhler,

Antiproliferative and cytotoxic effects of prenylated flavonoids

from hops (Humulus lupulus ) in human cancer cell lines, Food

Chem. Toxicol. 37 (1999) 271�/285.

[19] C.L. Miranda, Prenylated chalcones and flavanones as inducers of

quinone reductase in mouse Hepa 1c1c7 cells, Cancer Lett. 149

(2000) 21�/29.

[20] K.W.M. Zuurbier, S.Y. Fung, J. Johannes, C. Scheffer, R.

Verpoorte, In vitro prenylation of aromatic intermediates in the

biosynthesis of bitter acids in Humulus lupulus , Phytochemistry 49

(1998) 2315�/2322.

[21] R.E. Koes, C.E. Spelt, P.J.M. van Den Elzen, J.N.M. Mol,

Cloning and molecular characterization of the chalcone synthase

multigene family of Petunia hybrida , Gene 81 (1989) 245�/257.

[22] A.B. Christensen, P.L. Gregersen, J. Schroder, D.B. Collinge, A

chalcone synthase with an unusual substrate preference is

expressed in barley leaves in response to UV light and pathogen

attack, Plant Mol. Biol. 37 (1998) 849�/857.

[23] M.L. Durbin, B. McCaig, M.T. Clegg, Molecular evolution of the

chalcone synthase multigene family in the morning glory, Plant

Mol. Biol. 42 (2000) 79�/92.

[24] J. Matousek, L. Trnena, P. Svoboda, P. Oriniakova, C.P.

Lichtenstein, The gradual reduction of viroid levels in hop

mericlones, Biol. Chem. 376 (1995) 715�/721.

[25] T. Tai, S. Tanksley, A rapid and inexpensive method for isolation

of total DNA from dehydrated plant tissue, Plant. Mol. Biol.

Rep. 8 (1991) 297�/303.

[26] G.M. Church, W. Gilbert, Genomic sequencing, Proc. Natl.

Acad. Sci. USA 81 (1984) 1991�/1995.

[27] Y.-H.o. Lee, V.D. Vacquier, Reusable cDNA libraries coupled to

magnetic beads, Anal. Biochem. 206 (1992) 206�/207.

[28] J. Matousek, V. Junker, L. Vrba, J. Schubert, J. Patzak, G.

Steger, Molecular characterization and genome organization of

7SL RNA genes from hop (Humulus lupulus L.), Gene 239 (1999)

173�/183.

[29] D. Benson, D.J. Lipman, J. Ostell, GenBank, Nucleic Acids Res.

21 (1993) 2963�/2965.

[30] P. Jaccard, Nouvelles rescherches sur la distribution florale, Bull.

Soc. Vaud. Sci. Nat. 44 (1908) 223�/270.

[31] M.C. Peitsch, Protein modeling by E-mail, Bio/Technology 13

(1995) 658�/660.

[32] M.C. Peitsch, ProMod and Swiss-Model: internet-based tools for

automated comparative protein modelling, Biochem. Soc. Trans.

24 (1996) 274�/279.

[33] N. Guex, M.C. Peitsch, SWISS-MODEL and the Swiss-

PdbViewer: an environment for comparative protein modelling,

Electrophoresis 18 (1997) 2714�/2723.

[34] J. Schumacher, N. Meyer, D. Riesner, H.L. Weidemann, Diag-

nostic procedure for detection of viroids and viruses with circular

RNAs by ‘return’-gel electrophoresis, J. Phytopathol. 115 (1986)

332�/343.

[35] K.W.M. Zuurbier, J. Leser, T. Berger, A.J.P. Hofte, G. Schroder,

R. Verpoorte, J. Schroder, 4-Hydroxy-2-pyrone formation by

chalcone and stilbene synthase with nonphysiological substrates,

Phytochemistry 49 (1998) 1945�/1951.

[36] P.J. Rushton, I.E. Somssich, Transcriptional control of plant

genes responsive to pathogens, Curr. Opin. Plant Biol. 1 (1998)

311�/315.

[37] L. Riedel, U. Volger, R. Luckinger, A. Putz, H.L. Sanger, M.

Wassenegger, Molecular analysis of the gene family of the signal

recognition particle (SRP) RNA of tomato, Plant Mol. Biol. 31

(1996) 113�/125.

[38] J.M. Jez, M.B. Austin, J.-L. Ferrer, M.E. Bowman, J. Schroder,

J.P. Noel, Structural control of polyketide formation in plant-

specific polyketide synthases, Chem. Biol. 7 (2000) 919�/930.

[39] I.E. Burbulis, B. Winkel-Shirley, Interactions among enzymes of

the Arabidopsis flavonoid biosynthetic pathway, Proc. Natl.

Acad. Sci. USA 96 (1999) 12929�/12934.

J. Matousek et al. / Plant Science 162 (2002) 1007�/1018 1017

[40] Y. Johzuka-Hisatomi, A. Hoshino, T. Mori, Y. Habu, S. Iida,

Characterization of the chalcone synthase genes expressed in

flowers of the common and Japanese morning glories, Genes

Genet. Syst. 74 (1999) 141�/147.

[41] A.A. Hirner, H.U. Seitz, Isoforms of chalcone synthase in Daucus

carota L. and their differential expression in organs from the

European wild carrot and in ultraviolet-A-irradiated cell cultures,

Planta 210 (2000) 993�/998.

[42] I.M. van der Meer, M. Brouwer, C.E. Spelt, J.N.M. Mol, The

tacpyat repeats in the chalcone synthase promoter of Petunia

hybrida act as a dominant negative cis-acting module in

the control of organ-specific expression, Plant J. 2 (1992) 525�/

535.

[43] J. Patzak, Comparison of RAPD, STS, ISSR and AFLP

molecular methods used for assessment of genetic diversity in

hop (Humulus lupulus L.), Euphytica 121 (2001) 9�/18.

J. Matousek et al. / Plant Science 162 (2002) 1007�/10181018