Clonal descent and microevolution of Neisseria meningitidis during 30 years of epidemic spread

Clonal descent and microevolution of Neisseriameningitidis during 30 years of epidemic spread

Giovanna Morelli, Burkhard Malorny, Kerstin Mu ¨ ller,Andrea Seiler, Jian-Fu Wang, † Jesus del Valle ‡ andMark Achtman *

Max-Planck Institut fur molekulare Genetik, Ihnestraße73, D-14195 Berlin, Germany.

Summary

Serogroup A meningococci of subgroups III, IV-1 andIV-2 are probably descended from a common ancestorthat existed in the nineteenth century. The 10.5 kbsequences spanning five distinct chromosomal loci,encoding cell-surface antigens, a secreted proteaseor housekeeping genes and intergenic regions, werealmost identical in strains of those subgroups iso-lated in 1966, 1966 and 1917 respectively. During thesubsequent two to three decades, all of these loci var-ied as a result of mutation, translocation or import ofDNA from unrelated neisseriae. Thus, microevolutionoccurs frequently in naturally transformable bacteria.Many variants were isolated only once or within asingle geographical location and disappeared there-after. Other variants achieved genetic fixation withinmonths or a few years. The speed with which sequ-ence variation is either eliminated or fixed may reflectsequential bottlenecks associated with epidemicspread and contrasts with the results of phylogeneticanalyses from bacteria that do not cause epidemics.

Introduction

Neisseria meningitidis, the meningococcus, causes menin-gitis and other invasive diseases on a global scale (Cart-wright, 1995). The clonal descent of diverse, unrelatedmeningococci causing endemic disease is often obscuredby the frequent import of foreign DNA via natural transfor-mation (Maynard Smith et al., 1993; Spratt et al., 1995).However, epidemic disease has been associated with clo-nal groupings, in particular of meningococci expressing the

serogroup A capsular polysaccharide (Achtman, 1995a).Results from multilocus enzyme electrophoresis (MLEE)have subdivided serogroup A meningococci into nine sub-groups, I–III, IV-1, IV-2 and V–VIII (Wang et al., 1992),each with distinctive epidemiological behaviour. The sub-groups are also associated with uniform epitopes for other-wise variable cell surface-exposed antigens. SubgroupIV-1 has largely been restricted to Africa where it hascaused endemic disease and occasional epidemics sincethe early 1960s (Olyhoek et al., 1987); subgroup IV-2was isolated from epidemics before World War II andhas since become rare. These two subgroups are closelyrelated to each other and their closest relatives are bac-teria in subgroup III (Wang et al., 1992).

Subgroup III meningococci have caused two pandemicwaves. The first pandemic wave affected China, northernEurope and Brazil between the 1960s and the 1970s(Olyhoek et al., 1987; Wang et al., 1992). A second pan-demic wave began in China and Nepal in the early 1980s(Wang et al., 1992) and extended to Mecca, Saudi Arabiaduring the annual Haj pilgrimage of 1987 (Moore et al.,1988; 1989). Pilgrims carried subgroup III bacteria backto their countries of origin, including the USA (Moore etal., 1988; 1989), and isolated cases of subgroup III diseaseoccurred for 1–2 years in Muslim populations in England,Israel and France (Denamur et al., 1987; Slater et al.,1989; Jones and Sutcliffe, 1990). Subgroup III diseasehad never been noted in Africa before 1987 (Wang etal., 1992; Olyhoek et al., 1987) but since 1988, major epi-demics caused by subgroup III have progressed fromEastern Africa (Moore et al., 1989; Haimanot et al.,1990; Salih et al., 1990) to Central and western Africa(Guibourdenche et al., 1994; 1996; Auriol et al., 1995).Subgroup III meningococci isolated before the Meccaepidemic differed somewhat in pulsed-field gel electro-phoresis (PFGE) restriction pattern from those isolatedafter that epidemic (Bygraves and Maiden, 1992).

The epidemic spread of subgroup III, serogroup A menin-gococci provides an exemplary opportunity to investigatebacterial microevolution. Epidemics of meningococcal dis-ease are publicized as a result of their medical importance(Haimanot et al., 1990; Hjetland et al., 1990; Salih et al.,1990; Riou et al., 1991; Guibourdenche et al., 1994;1996) and isolates are routinely sent for MLEE typing tothe WHO reference laboratory in Oslo, Norway. In indus-trialized countries, serogroup A meningococci are isolated

Molecular Microbiology (1997) 25(6), 1047–1064

Q 1997 Blackwell Science Ltd

Received 13 March, 1997; revised 14 June, 1997; accepted 9 July,1997. Present address: †BioGenex Laboratories, 4600 Norris Can-yon Rd, San Ramon, CA 94583, USA. ‡Max Planck Institut fur Infek-tionsbiologie, Monbijoustr. 2, D-10117 Berlin, Germany. *Forcorrespondence. E-mail [email protected];Tel. (30) 8413 1262; Fax (30) 8413 1387.

m

sufficiently rarely that even small outbreaks are investi-gated (Moore et al., 1988; Jones and Sutcliffe, 1990;Riou et al., 1991). Thus, strains are available from mostcountries where subgroup III outbreaks have occurredsince the 1960s, yielding an extensive collection repre-senting three decades of pandemic spread (Achtman etal., 1992).

Expression of Opa (opacity) outer membrane proteins isvariable as a result of slipped-strand mispairing changingthe number of pentanucleotide repeats within the signalpeptide region of opa alleles (Stern et al., 1986; Sternand Meyer, 1987; Murphy et al., 1989; Belland et al.,1997). In addition, extensive sequence differences thatare most concentrated in two regions called HV1 andHV2 distinguish many opa alleles. Sequence variation ofopa loci has been used for the fine typing of Neisseriagonorrhoeae (O’Rourke et al., 1995). Meningococci con-tain three to four distant chromosomal loci encoding opaalleles (Aho et al., 1991; Hobbs et al., 1994; Dempsey etal., 1995; Gaher et al., 1996) but the sequences of thesealleles have not yet been analysed from extensive straincollections. The Opa proteins called 5a, 5f and 5 h wereexpressed by subgroup III meningococci isolated beforethe Mecca outbreak, whereas the Opa proteins 5a, 5fand 5i (but not 5h) were expressed by those isolated dur-ing or after the Mecca outbreak (Achtman et al., 1992),suggesting that horizontal genetic exchange have ledto the replacement of an opa allele encoding 5h by anallele encoding 5i from an unrelated strain. The opa allelesfrom subgroup III meningococci have not yet been sequ-enced but three loci designated opaA, opaB and opaDhave been defined in subgroup IV-1 (Hobbs et al., 1994;Dempsey et al., 1995). Furthermore, Opa proteins resem-bling 5a, 5f and 5h in size and reactivity with monoclonalantibodies (mAbs) had been detected in subgroup IV-1 bac-teria isolated in the 1960s and the 1970s (Achtman et al.,1992) and the opa alleles encoding the 5a and 5f proteinshave been sequenced from such strains (Hobbs et al.,1994).

Similarly to the Opa proteins, IgA1 protease differedantigenically between subgroup III meningococci isolatedbefore and after the Mecca outbreak (Morelli et al.,1994). IgA1 protease from the older subgroup III strains(and in subgroup IV-1 strains) contained one epitope (epi-tope 4) that was lacking in the newer subgroup III bac-teria. Partial iga sequences from one subgroup III strainisolated before the Mecca outbreak and one strain iso-lated after the Mecca outbreak (Lomholt et al., 1995) dif-fered by numerous polymorphisms, indicating that at leastpart of the iga gene had been replaced by horizontalgenetic exchange.

We present the results of detailed sequence analyses ofopa and iga alleles from our extensive strain collection per-formed to clarify these phenomena. The data indicate that

repeated genetic changes have occurred in subgroups III,IV-1 and IV-2 after their recent descent from a commonancestor.

Results

Numbers of opa loci in subgroups III, IV-1 and IV-2

The numbers of opa loci were determined by hybridiza-tion of an opa probe to chromosomal DNA separated byPFGE after digestion with rare cutting enzymes (NheI inFig. 1, SpeI, data not shown). The results confirmed theexistence of three opa loci (opaA, opaB, opaD ) in sub-group IV-1 and demonstrated the existence of four opaloci in the bacteria of subgroups III (Fig. 1) and IV-2 (datanot shown). The fourth opa locus is distant from thethree other opa loci (data not shown) and was namedopaJ.

The ingA region

Sequencing the opa alleles from the individual loci (seeExperimental procedures) showed that the opaB locuswas associated with a 179 kb NheI fragment in subgroupIII meningococci isolated before 1987 (‘pre-Mecca’) andin older subgroup IV-1 meningococci, whereas it was asso-ciated with a 41 kb fragment in most subgroup III meningo-cocci isolated in 1987 or thereafter (‘post-Mecca’) and inrecent isolates of subgroup IV-1 (Fig. 1). Chromosomesyielding the 41 kb fragment also yielded a 142 kb fragmentas if a novel NheI site had been introduced into the 179 kbfragment in the vicinity of opaB in both subgroups, result-ing in both cases in two smaller NheI fragments.

If the 41 kb NheI fragment were a result of horizontalgenetic exchange, then one of the ends should differ insequence between older and newer strains of subgroupsIII and IV–1. Both ends of the 41 kb NheI fragment werecloned and sequenced. Oligonucleotides derived fromthese sequences were used to cycle sequence undigestedchromosomal DNA over the positions corresponding to theends of the 41 kb fragment and these two regions weresequenced from different strains. One region (411 bp) wasidentical in pre- and post-Mecca strains, whereas theother (ingA, 407 bp) was an intergenic region with differentallelic variants in pre-Mecca (ingA1 ) and post-Mecca(ingA2 ) strains. The ingA2 allele differs from ingA1 byseven nucleotides, confirming that the NheI site was intro-duced by horizontal genetic exchange; two nucleotidesresult in an NheI site (GCTAGC, ingA2 versus GCGTGC,ingA1 ). As predicted, an ingA probe hybridized with the179 kb fragment in pre-Mecca subgroup III strains and oldsubgroup IV-1 strains and with both the 142 kb and the41 kb fragments in post-Mecca subgroup III and newersubgroup IV-1 strains (Fig. 1).

Q 1997 Blackwell Science Ltd, Molecular Microbiology, 25, 1047–1064

1048 G. Morelli et al.

Import of DNA in the opaB–ingA region

A 4.7 kb product was amplified by PCR using oligonucleo-tides specific to the ingA region and the HV2 region ofopaB. The sequence of this product showed that opaBwas separated from ingA by two ORFs (open reading

frames) of unknown function, orf185 and orf544, and anORF with homology to the serC gene encoding 3-phos-phoserine aminotransferase (Fig. 2). Each of these geneswas separated from neighbouring genes by short inter-genic regions containing DNA uptake sequences thatcan also serve as transcriptional terminators (Goodmanand Scocca, 1988) (Fig. 2). Potential promoters and ribo-somal binding sites were found upstream of orf185, orf544and serC.

The sequences of the 5137 bp region from the beginningof opaB to the end of ingA (see Experimental procedures,Sequence numbering) were identical in subgroup III andIV-1 strains isolated in 1966 and differed by one nucleotidein a subgroup IV-2 strain isolated in 1917 (Fig. 2), suggest-ing inheritance of an identical sequence in this region froma common ancestor. The sequence from a post-Meccasubgroup III strain isolated in 1988 possessed numerouspolymorphisms throughout the whole 5 kb except for the1635 bp spanning orf544. In addition to the different ingAalleles, the 740 bp opaB alleles differed by 45 bp plustwo 3 bp indels (insertion/deletion) (6.1% difference), theDNA encompassing orf185 plus the flanking intergenicregions differed by 20/832 bp (2.4%) and the DNA encom-passing serC plus the intergenic region between orf544and serC differed by 20/1512 bp (1.4%). The opaB allelein the original sequence encoded the protein formerlycalled 5h and the allele from the strain isolated in 1988encoded 5i (Table 1, see Experimental procedures).

DNA transformation is the only known form of horizontalgenetic exchange in the neisseriae and these results indi-cate that these sequences arose by recombination aftertransformation of a subgroup III bacterium with at least5 kb of DNA from an unrelated strain. The unrelated strainmight have possessed an orf544 sequence that was iden-tical to the original sequence. Alternative explanations are


Fig. 1. Restriction patterns. DNA from 19 subgroup III and twosubgroup IV-1 strains was digested with NheI and separated byPFGE. The gels were stained with EtBr (top) or hybridized againstDIG-labelled opa, iga or ingA probes. Positions of molecular weightstandards are shown at the top left, whereas the positions ofindividual fragments that hybridized are indicated at the right. Forassignment of opa loci to individual fragments, PCR productsamplified from individual fragments from strain Z2491 (track 21)were sequenced and compared with the published sequences ofopaA, opaB and opaD (Hobbs et al., 1994). For other strains,sequences obtained after amplification of individual loci fromchromosomal DNA using primers from flanking regions werecompared with the sequences of PCR products amplified fromPFGE fragments. Strains (track: strain, country, year): 1: Z3910,China, 1966; 2: Z5828, China, 1964; 3: Z6330, Nigeria, 1996; 4:B124, Holland, 1973; 5: Z3735, Norway, 1971; 6: Z3719, Sweden,1978; 7: Z3921, China, 1984; 8: Z3507, USA, 1987; 9: Z4318,Israel, 1988; 10: Z3773, England, 1987; 11: Z3515, USA, 1987; 12:Z3506, USA, 1987; 13: Z3524, Chad, 1988; 14: Z5955: Morocco,1989; 15: Z5642, Niger, 1991; 16: Z5710, Zambia, 1993; 17:Z6324, Nigeria, 1996; 18: Z3915, China, 1984; 19: Z3918, China,1985; 20: B362: Cameroon, 1966; 21: Z2491, The Gambia, 1983.

Microevolution among epidemic meningococci? 1049

that the opaB-orf185 and the serC-ingA regions wereintroduced in independent transformation events by DNAfrom one or more donors or that two double-crossoverevents led to independent integration of opaB-orf185and the serC-ingA regions.

Screening subgroup III and IV-1 for other bacteria withnovel NheI sites within the 179 kb fragment revealedfurther examples of horizontal genetic exchange. Atleast parts of the opaB–ingA region were imported inde-pendently into two pre-Mecca subgroup III strains isolated


Fig. 2. Map and sequences of the opaB-ingA region. Map: the map shows the open reading frames (grey) and intergenic regions within a5137 bp alignment spanning opaB to ingA. When present, the NheI site was at nucleotides 4884–4889. Arrows indicate the direction oftranscription from consensus ¹35/ –10 promoter sequences, whereas U represents inverted DNA uptake sequences (Goodman and Scocca,1988). The predicted protein Orf185 was 44% identical to YDJA (Sawers et al., 1991) from E. coli ; Orf544 was 45% identical to YJDB(Burland et al., 1995) from E. coli and SerC was 44–48% identical to SerC proteins from Haemophilus influenzae, Yersinia enterocolitica andSalmonella gallinarum. Sequenced regions: the designations of individual opaB and ingA alleles are indicated above each bar. Sequencesubstitutions from a consensus are indicated by vertical lines within the bars except that the position of a single nucleotide difference in thesubgroup IV-2 strain isolated in 1917 is indicated by an arrowhead. A 1 bp insertion in subgroup III (1985) is indicated by an elongated blacktriangle and a 125 bp deletion in subgroup IV-1 (1983) is indicated by D. The sources of the strains from which these regions were sequencedare indicated at the left and the presence of an NheI site within the ingA alleles is indicated at the right. The region was sequenced from thefollowing sources (GenBank accession code: subgroup, year, country, strain): AF004820: subgroup III, 1966, China, Z3906 and Z3910;subgroup III, 1987, USA, Z3515; subgroup IV-1, 1966, Cameroon, B362. AF004821 (arrowhead): subgroup IV-2, 1917, USA, B293.AF004822: subgroup III, 1988, Chad, Z3524. AF004823: subgroup III, 1984, China, Z3915. AF004824: subgroup III, 1985, China, Z3918.AF004825: subgroup IV-1, 1983, The Gambia, Z2491. AF004826: serogroup I, 1983, The Gambia, C755.

Table 1. Correspondence between formerand current designations of opa alleles andproteins.

Former designation Current designation

Protein Allele Allele Protein

5a opaAZ2491 opaA132 Opa1325b opaBZ2491 opaB136 Opa1365d opaDZ2491 opaD137 Opa1375e opaBZ2142 opaB138 Opa1385f opaDZ1213 opaD100 or opaD131 Opa100/Opa1315g opaBZ1213 opaB133 Opa1335h opaB92 Opa925i opaB94 Opa94

opaDZ4153 opaD134 Opa134opaBZ4153 opaB135 Opa135

Former designation of Opa proteins and alleles refers to the designations used by Achtman etal. (1992) and Hobbs et al. (1994). Opa proteins were assigned to individual opa alleles aftertesting expressed recombinant opa genes for reactivity with monoclonal antibodies that distin-guish each Opa protein and comparison of the sequences from the cloned alleles with thesequences from DNA amplified from meningococcal chromosomes. Opa100 and Opa131 differonly by one amino acid and were not formerly distinguished.


in 1984 and 1985 in China and a subgroup IV-1 strain iso-lated in 1983 (Fig. 1, lanes 18 and 19; Fig. 2). In addition todifferent patterns of polymorphic sites, a 1 bp insertion(subgroup III, 1985) and a 125 bp deletion (subgroup IV-1,1983) were found in the intergenic region between orf544and serC. Each novel NheI site was associated with a dif-ferent sequence variant of the ingA region, designatedingA3–ingA5. The opaB alleles were also distinct andwere assigned unique designations (Fig. 2). These resultsshow that in subgroups III and IV-1, at least four indepen-dent recombinational events involving DNA from differentdonors had been responsible for the acquisition of anopaB-ingA region containing a NheI site. Four polymorphicsites in orf544 were identical between the subgroup IIIstrain isolated in 1984 and the subgroup IV-1 strain from1983. This identity might represent repeated transforma-tion with DNA from a widespread donor strain but ismore simply explained by this sequence being present indiverse bacteria and representing another example ofthe global gene pool in the neisseriae (Maiden et al.,1996).

We were unable to identify a potential source of theopaB94–ingA2 region of post-Mecca strains. ingA wasamplified by PCR from 46 diverse strains (serogroups A(21 strains), B (4), C (5), 29E (7) I (1), W-135 (1), Y (2)and Neisseria lactamica (5)). A total of 27 (55%) of thesestrains contained an NheI site, unlike the old strains ofsubgroups III, IV-1 and IV-2, which lacked it. Primersthat specifically amplify the opaB94 allele were used forPCR reactions with the 27 strains but only one strainyielded a PCR product. That strain was from serogroup Iand had been isolated in The Gambia in 1983. However,the region between opaB and ingA differed at numeroussites between that serogroup I strain and the post-Meccastrains (Fig. 2), and represents yet another sequence vari-ant within this region.

A common ancestor of subgroups III, IV-1 and IV-2

The (almost) identical 5 kb opaB–ingA sequences withinold isolates of the three subgroups contrast with the obser-vation that the three subgroups differ by up to 5 of the 15cytoplasmic enzymes examined using MLEE (Wang etal., 1992), as well as with other disparate properties (seeDiscussion ). Two alternative explanations could recon-cile these contradictory observations: (i) after the descentof the subgroups from a common ancestor, they weresubjected to numerous events of microevolution. In thatcase, other variable loci might still be identical within oldisolates of the subgroups and additional examples ofmicroevolution should be found within later isolates. (ii)the opaB–ingA regions might reflect independent trans-fer of this block of DNA to the three subgroups and thesequences of other variable loci should be divergent.

The 750 bp opaA, opaD and opaJ loci and the 3 kbregion of iga encoding the mature protein were sequencedfrom the old isolates of the three subgroups. A deletion haseliminated the opaJ locus in all subgroup IV-1 strains (datanot shown). Otherwise, identical sequences were found atall these loci for the subgroup III and IV-1 isolates from1966 and the subgroup IV-2 isolate from 1917. Further-more, microevolution was common at these loci amonglater isolates (see below). These data are more consistentwith explanation (i) and the alleles present in the subgroupIII strain from 1966 will henceforth be considered to repre-sent ancestral alleles.

Microevolution in the three subgroups

The opa, iga and ingA alleles were sequenced from 18additional strains from the three subgroups to characterizethe types of genetic events that have occurred over a 30year period. Nine of these strains represent the diversityrevealed within subgroup III by analysis of restriction frag-ment polymorphism and other techniques in a large collec-tion (see below). Eight subgroup IV-1 strains were chosento represent the known phenotypic diversity of Opa pro-teins among those bacteria and one subgroup IV-2 strain,isolated in 1937, expressed Opa proteins that were pheno-typically similar to those of subgroup IV-1. The ancestralalleles were found repeatedly, as were multiple sequencevariants that were interpreted as representing microevolu-tion with respect to the ancestral alleles. Each sequencevariant was assigned an unique allele designation (seeExperimental procedures, genetic nomenclature).

The sequence variants arose by point mutations (red inFig. 3), leading to novel alleles that differ from the ances-tral alleles by 1–2 bp or by a deletion of 12 bp (opaB93 ), orby horizontal genetic exchange reflecting import of foreignDNA (blue), as indicated by numerous nucleotide differ-ences. Translocation of opa alleles from one locus toanother (green) was also found. The relationships betweenthe individual opa alleles and possible genealogies aresummarized in Figs 4 and 5. Sequence relationshipsbetween the iga alleles are shown in Fig. 6, and thosebetween the ingA alleles in Fig. 2.

Subgroup IV-2

The subgroup IV-2 strain isolated in 1937 was identical tothe strain isolated in 1917 at the opaA, ingA and iga locibut differed at opaJ (translocation of the opaA132 alleleto yield opaJ132 ), opaD (opaD91 differs by 1 bp from apossible recombinant between opaA132 and opaD131(Fig. 4)) and opaB (import of a novel allele). None of the11 other subgroup IV-2 strains isolated since 1936 pos-sessed the opaB92 allele present in the strain from 1917and four lacked opaJ101.



Subgroup IV-1

The oldest subgroup IV-1 isolate tested, isolated in Nigerin 1963, differed from the parental pattern in the opaB–ingA region (opaB133, ingA5 ), possibly reflecting acquisi-tion of the whole region by horizontal genetic exchange;ingA5 was present in all subgroup IV-1 strains isolatedsince 1973. The point mutation, iga4, was also presentin all subgroup IV-1 strains isolated since 1973. TheopaB136 allele (possibly generated by recombinationbetween opaB133 with opaA132 ) and the opaD137 allele(recombination between opaB133 with opaD131 ) wereboth found in The Gambia in the early 1980s. As describedpreviously (Hobbs et al., 1994), opaD134 was importedinto subgroup IV-1 strain Z4153 in The Gambia andaccompanied by translocation to the opaB locus to yieldthe recombinant allele opaB135. The opaD117 allele(Mali, 1990) also seems to represent recombinationbetween the opaD137 and opaB136 alleles, coupled witha point mutation. Three opa alleles with point mutationswere also found in individual strains.

Genetic fixation within subgroup III

The frequency of microevolution events in subgroups IV-1and IV-2 could not be characterized in detail because ourstrain collection was not sufficiently comprehensive. Incontrast, numerous subgroup III isolates are availablefrom almost all outbreaks reported during 1966–96 encom-passing two pandemic waves and different continents.Therefore, 316 subgroup III strains from diverse sourceswere tested for opa, iga and ingA alleles (Table 2). TheopaJ101 allele was present in all but one of the bacteriatested and opaA132 was present in the majority.

The opaB92, opaD131, iga2 and ingA1 alleles weretypical of bacteria isolated during the first pandemicwave and at the beginning of the second pandemicwave. Such bacteria continued to be isolated in Chinathrough to 1993.

Epidemics caused by subgroup III have continued tospread in Africa since the Mecca outbreak of 1987(Nejmi et al., 1992; Guibourdenche et al., 1994; 1996;Auriol et al., 1995). The opaB94, opaD100, iga3 and


Fig. 3. opa, iga and ingA alleles in 20 strains.Sources of the prototype strains and straindesignations (Zxxxx or Byyy) are indicatedabove each combination of alleles. Forsubgroup IV-2 and IV-1 strains (top), completedata are only available for the strain indicated,whereas for subgroup III (bottom) the numberof strains with a similar constellation of alleles(Table 2) is indicated at the bottom. Theancestral alleles are indicated by black allelenumbers, whereas colours highlight alteredalleles as indicated (Code). Note thatopaB115 can be accounted for byrecombination between opaA132 and opaB92but is linked to DNA imported together withingA4 (Fig. 2).

Fig. 4. Comparison of opa sequences. Top: map of the general organization of opa alleles, showing the positions in the sequence alignmentof the N-terminal pentanucleotide repeats indicated as (CTCTT)n and the HV1 and HV2 regions. The remainder of the figure consists ofsketches representing the sequence differences between the opa alleles indicated at the left. The black diamonds at 120 bp indicate thepresence of two copies of GACAAA in opaJ101 vs. one copy of AACAAC in other alleles. Elongated black triangles at 414 bp indicate thepresence of one or two copies of GATAAATTC at that position. Descriptions of the evolutionary sources of these opa alleles are at the right,with recombinants being abbreviated as ‘source allele 1/source allele 2’. Coloured sections indicate regions of identity between individualalleles, whereas differences from a consensus are shown by thin vertical lines as in Fig. 2. The positions of mutations in which only one ortwo sites have changed (opaA99, opaA98, opaA96, opaA97, opaB118, opaD119, opaD100 ) or a 12 bp deletion has occurred (opaB93 ) areindicated above the opaA132, opaB133, opaD137, opaD131 and opaB92 alleles. The two nucleotides differentiating opaA98 from opaA132could have been introduced by recombination with opaD131 and this observation has resulted in the parsimonious assignment of these twopolymorphic nucleotides to translocation in Fig. 3. GenBank accession numbers: opaJ101, AF001179; opaA132, AF001180; opaA99,AF001181; opaA98, AF001182; opaA96, AF001183; opaA97, AF001184; opaB133, AF001185; opaB118, AF001186; opaB136, AF001187;opaB138, AF001188; opaD137, AF001189; opaD119, AF001190; opaD117, AF001191; opaB135, AF001192; opaD134, AF001193; opaD131,AF001194; opaD100, AF001195; opaD91, AF001196; opaA105, AF001197; opaB115, AF001198; opaB92, AF001199; opaB93, AF001200;opaB94, AF001201; opaB90, AF001202; opaB5202, AF001203; opaB102, AF001204.


ingA2 alleles were typical of such strains. opaB94 andingA2 were apparently introduced by import of foreignDNA (Fig. 2). Similarly, iga3 was introduced by importbecause it differs from the iga2 allele typically found inpre-Mecca bacteria by 56 bp plus a 12 bp indel in the

region from bp 1038–2992 (Fig. 6). In contrast, opaD100(post-Mecca) differs from opaD131 (pre-Mecca) by onenucleotide. Of the 118 strains isolated in Africa since1988, only one strain (of 14) isolated in Nigeria in 1996had the pre-Mecca pattern of these alleles. Thus, genetic




Fig. 5. Microevolution of opa alleles. Vertical lines indicate the time periods during which strains carrying individual opa alleles were isolatedaccording to the non-linear time scale on the left. The branched lines indicate the presumptive relationships to ancestral alleles. Alleles thatwere only found once or within a short time period are indicated by horizontal lines. The presumptive mechanism resulting in the formation ofeach opa allele is indicated by a diamond (translocation), triangle (mutation) or star (import).

Fig. 6. Comparison of eight iga sequences from serogroup A strains. The location of single base pair point mutations that differentiate iga1and iga4 from iga2 are indicated along the top. Vertical bars indicate sequence differences from the consensus, as in Fig. 2. Strainscontaining iga1–iga4 (GenBank accession numbers AF012205, AF012204, AF012207 and AF012203 respectively) are summarized in Fig. 3.Other alleles (allele: GenBank accession number, subgroup, country, year, strain): iga6 : AF012206, subgroup VI, East Germany, 1985,Z4024; iga7 : AF012211, subgroup I, Morocco, 1967, B40 and subgroup II, Djibouti, 1966, B439; iga8 : AF012210, subgroup VIII, China,1975,Z4099; iga9 : AF012209, subgroup V, China, 1979, Z4081 and subgroup VII, China, 1979, Z4063.


events at three distant loci distinguish most pre-Meccaisolates from most post-Mecca isolates.

Of 68 subgroup III meningococci isolated from countrieswith epidemiological links to the Mecca outbreak, 87%were of the post-Mecca pattern but four strains (isolatedin Israel and the USA) contained the pre-Mecca combi-nation of alleles (Table 2). Two intermediate strains werealso found (USA, 1987; England, 1987), in which theopaD and iga alleles were of the post-Mecca type butopaB and ingA were of the pre-Mecca type (Fig. 3).These results indicate that the Mecca epidemic was asso-ciated with a mixture of strains. The uniformity of strainsisolated since 1988 from epidemics in Africa showsthat the post-Mecca pattern achieved fixation within thatsubgroup III population within one year.

Disappearance of genetic variants during epidemicspread of subgroup III

Numerous isolates among the 316 subgroup III strains didnot fall into the pre-Mecca or post-Mecca patterns (Table2). In most of these strains, one of the four opa alleles hadbeen fully or partially replaced as a result of recombination

with and/or translocation of an opa allele from a differentlocus within the subgroup III chromosome. Detailed obser-vations will be presented elsewhere as a full descriptionwould involve more epidemiological discussion thanseems appropriate here.

Novel sequence variants arose through point mutations(iga1, opaA96, opaA97, opaB93 ) or import of foreignalleles (opaB5202, opaB102–ingA3, opaB115–ingA4 )from unrelated donors (Figs 2 and 3). opaB5202 mighthave been acquired from serogroup C meningococcibecause it differs by only 1 bp from opaD5200 (accessionU77881), found in a serogroup C strain of the ET-37 com-plex isolated in Mali in 1990 (Hobbs et al., 1997). Figure 3also shows examples of translocation events in whichparts of opa alleles have recombined with alleles at otherloci (opaA98, opaA105 (also contains a point mutation)and opaB115 (linked to the imported ingA4 allele)).

It is noteworthy that none of these variants was found inmore than one country and each is represented by onlyone or a few strains. Thus, these results confirm theimpressions obtained with the more limited data fromsubgroups IV-1 and IV-2, namely that many genetic vari-ants are lost during bacterial spread between countries.


Table 2. Numbers (%) of subgroup III strains from different sources carrying individual opa, iga and ingA alleles.

First pandemic Second pandemic Related to Meccawave wave outbreak Africa

Years 1966–85 1983–93 1987–89 1988–96Countries China, Russia, China, Nepal USA, England, Sudan, Chad,

Norway, Israel, France, Morocco,Sweden, Sweden Ethiopia, Niger,Finland, Burundi, CAR,Denmark, Rwanda,Holland, Zambia, Mali,Brazil, France Guinea, Burkina

Faso, Nigeria

Total 79 51 68 118opaA132 71 (90) 50 (98) 68 (100) 117 (99)opaB92 58 (73) 20 (39) 6 (9) 1 (1)opaB94 0 (<1) 0 (<2) 61 (90) 117 (99)opaD131 75 (95) 50 (98) 4 (6) 1 (1)opaD100 0 (<1) 0 (<2) 62 (91) 75 (64)opaJ101 79 (100) 51 (100) 68 (100) 117 (99)iga2 77 (97) 51 (100) 4 (6) 1 (1)iga3 0 (<1) 0 (<2) 64 (94) 117 (99)ingA1 79 (100) 49 (96) 6 (9) 1 (1)ingA2 0 (<1) 0 (<2) 62 (91) 117 (99)Pre-Mecca 50 (63) 19 (37) 4 (6) 1 (1)Post-Mecca 0 (<1) 0 (<2) 59 (87) 74 (63)

Pre-Mecca refers to the combination of the opaA132, opaB92, opaD131, opaJ101, iga2 and ingA1 alleles, whereas Post-Mecca refers to the com-bination of the opaA132, opaB94, opaD100, opaJ101, iga3 and ingA2 alleles. The data for opa alleles are based primarily on the results from PCRamplification followed by restriction enzyme digestion. All the opaA alleles were compared with known allelic variants by SSCP (single-strand con-formational polymorphism). In addition, all four opa alleles were sequenced from ten representative strains chosen to represent the diversity ofcountries and periods (Fig. 3). The opa alleles were also sequenced from other strains in which translocation and horizontal genetic exchangehad occurred, resulting in a total of repeated identical sequences for the following alleles (allele, number of independent sequences):opaA132, 22; opaB92, 15; opaB94, 6; opaD131, 20; opaD100, 6; opaJ101, 31. The data for iga are based on tests with the monoclonal antibodyAH623 (Morelli et al., 1994) for all strains and on T-nucleotide sequencing of the variable regions for 58 strains with iga2, 61 strains with iga3 andtwo strains with iga1. The whole 3 kb of the mature iga gene was sequenced from 11 strains for iga2 and from three strains for iga3. The data foringA are based on susceptibility of PCR products to digestion with NheI and on sequencing of ingA1 (nine strains) and ingA2 (one strain).


iga alleles in serogroup A subgroups

In contrast to the extreme sequence variability of the opaalleles, iga had remained fairly constant within subgroupsIII, IV-1 and IV-2. Only two point mutations and one case ofimport have been detected. Therefore, it seemed possiblethat sequence variation of the iga gene in serogroup Ameningococci might reflect its phylogeny. The iga geneencoding the mature IgA1 protease was sequenced fromone representative of each of the subgroups of serogroupA. Subgroups V and VII possessed iga9 and subgroups Iand II possessed iga7 (Fig. 6), as if these pairs of sub-groups were each descended from a common ancestor.Subgroups VI (iga6 ) and VIII (iga8 ) contained other alleles.There was no obvious evolutionary relationship betweenthe iga2, iga3 or iga6–iga9 alleles, except for mosaicblocks that seemed to be randomly assorted, suggestingthat each arose from horizontal genetic exchange, ratherthan from progressive accumulation of mutations. In sup-port of this interpretation, an unrelated serogroup C strainof the ET-37 complex possesses iga5 (accession numberAF012208), which differs from iga9 by a 12 bp indel andthree polymorphic sites.

Discussion

The variability of the opa alleles at four loci encoding vari-able outer membrane proteins, the iga allele encoding theIgA1 protease and the ingA intergenic region was investi-gated by sequencing 184 kb of DNA from three subgroupsof serogroup A meningococci. An additional 1.9 Mb con-taining those alleles were screened from an extensive,globally representative collection of subgroup III strainsfor uniformity of restriction sites. No additional variantswere detected by SSCP analysis of the opaA allelesfrom all subgroup III strains, by T-nucleotide sequencingof the variable regions of the iga gene from half of thestrains or by sequencing additional opa loci from a varietyof strains (Table 2). However, additional sequence vari-ability may still remain undetected among the alleles thatwere not sequenced. The results demonstrated therepeated presence of certain alleles in numerous strainsand also identified novel alleles that seem to have arisenby point mutations, import of foreign DNA and/or trans-location and recombination between opa loci.

Point mutations

No mutations were observed within 4 kb of sequence fromfive related Escherichia coli strains (Guttman and Dykhui-zen, 1994) and it was calculated that the last commonancestor of those strains existed within the last 2400years. Similarly, only a few synonymous mutations werefound among diverse genes of 30 strains from Mycobac-terium tuberculosis and it was calculated that the species

may have arisen 15 000 years ago (Kapur et al., 1994). Incontrast, point mutations resulting from nine independentevents (Table 3) were detected within the 6.5 kb of opa,iga and ingA DNA among 325 subgroup III and IV-1 strainsisolated over a period of 33 years, yielding a minimalmutation frequency of 1.4 ×10¹7 mutational events perbp per strain per year. Four of the mutations were synon-ymous, corresponding to 45 substitutions per synonymoussite per million years (KS) (Li, 1993) among opa and igaalleles (Table 3). Clearly, the frequency of point mutationsin the current analysis was unusually high, such that pointmutations were observed in a period of decades ratherthan millennia. However, these data are not strictly similarto the results from the other species because the synony-mous mutations in opa alleles were only found within indi-vidual strain variants, whereas mutation frequencies arenormally calculated for alleles that are assumed to haveachieved fixation.

Horizontal genetic exchange

Import of foreign DNA into subgroups III and IV-1 occurredat least seven times, a frequency similar to that of pointmutations but with greater functional importance as sev-eral of these events involved numerous polymorphismsspanning over 5 kb of DNA. Translocation and/or recombi-nation between the four opa loci was at least as frequent,as documented here for subgroup IV-1 and as will be pre-sented in detail elsewhere for subgroup III. The formationof recombinant opa alleles may reflect intrachromosomalrecombination or interchromosomal recombination aftertransformation with DNA released by lysed sister cells,similar to pil genes in N. gonorrhoeae (Gibbs et al., 1989).DNA transformation also supplies an alternative mech-anism for the generation of point mutations, namely thatthey represent recombination with short DNA stretchesfrom related or unrelated bacteria. Alternatively, DNAtransformation could also lead to point mutations in the


Table 3. Properties of point mutations.

Allele Position Codon change Amino acid change

opaA96 284 GTA → GTG NoneopaA97 551 AAT → AAC NoneopaA99 57 GAT → AAT D → NopaB118 355 CAC → CCC H → PopaD100 403 AAC → AGC N → SopaD119 620 GCC → GCT Noneiga1 691 CCA → CTA P → Liga4 2331 CAG → AAG Q → Korf185 (IV-2) 3008 CTG → CTT None

Comparison of the sequences of the opa and iga mutations to theparental alleles opaA132, opaB133, opaD131, opaD137 and iga2yielded an average value of 0.0015 for KS (Li, 1993), the frequencyof substitutions per synonymous site and 0.001 for KA, the frequencyper non-synonymous site.


neisseriae if mismatch repair during recombination wereerror prone.

Clonal descent of the subgroups from a commonancestor

Except for opaJ101, which was deleted in subgroup IV-1,the opa, ingA and iga sequences were identical amongsubgroup III, IV-1 and IV-2 bacteria isolated in 1966,1966 and 1917 respectively. Similarly, the 4 kb regionbetween opaB and ingA was identical, except for a synony-mous point mutation in the subgroup IV-2 strain. We arguethat this pre-Mecca pattern of genes was inherited by directdescent from a common ancestor of these subgroups.Only one strain in each of subgroups IV-1 and IV-2 wasidentified with the pre-Mecca complement of genes, anda subgroup IV-1 strain isolated in Niger in 1963 differedfrom the strain isolated in 1966 at opaB and ingA. Further-more, of the seven oldest subgroup III isolates from China(1966), two differed by a point mutation in iga (Fig. 3) andtwo possessed a recombinant opaD allele (data notshown). It might therefore be argued that the subgroupswere not descended from a mutual common ancestorbut instead had independently imported the putativelyancestral genes by horizontal genetic exchange.

To test this possibility, the opaB allele was sequencedfrom five other subgroup IV-1 strains isolated in Nigerbetween 1963 and 1965 to determine whether they con-tained the putatively ancestral opaB92 allele or the puta-tively imported opaB133 allele. Four contained opaBalleles derived from recombination between opaA132 andopaB92 and one possessed opaB133. These results sup-port the interpretation that opaB92 was inherited by clonaldescent from a common ancestor and that opaB133 wasintroduced in the early 1960s.

The opa, iga and ingA sequences tested here arelocated at five regions of the chromosome that are toowidely separated to have been introduced together by sin-gle transformation events. Even if identity at one or moreof them were to reflect horizontal genetic exchange ratherthan clonal descent, it seems almost impossible that allcould have arisen by this mechanism. None of the putativeancestral alleles has been identified in any meningococcusoutside these subgroups. Furthermore, even though indi-vidual alleles differed in some old subgroup IV-1 and IIIstrains, most of their alleles were identical to the pre-Mecca pattern putatively present in the last commonancestor.

Evolution of the subgroups

Bacteria with identical opa alleles at all four loci might beexpected to be identical at less variable loci also, suchas those of housekeeping genes. However, subgroups

III, IV-1 and IV-2 differ in approximately 5 out of the 15cytoplasmic housekeeping enzymes examined by MLEE(Wang et al., 1992). The subgroups also differ in theirporA genes (Suker et al., 1994) and conserved epitopeson the PorB proteins and pilin (Wang et al., 1992). Sub-groups III and IV-1 are known to express different lipo-polysaccharides (Achtman et al., 1992) and the 1148 bpregion surrounding the opc gene differs by 2 bp betweensubgroup IV-2 and subgroups III or IV-1 (Seiler et al.,1996). In enteric bacteria, such differences have beenattributed to gradual accumulation of mutations or rarehorizontal genetic exchanges that have occurred over mil-lions of years (Milkman and Bridges, 1993; Reeves, 1993;Ochman and Lawrence, 1996). However since the 1960s,strain variants of subgroups III and IV-1 have been identi-fied that have essentially altered each of these properties(Wang et al., 1992). Therefore, these properties, too, aresufficiently variable in meningococci that multiple microe-volutionary events and genetic fixation could result in theknown differences between the three subgroups aftertheir descent from a mutual common ancestor (Fig. 7).

How recently did the last common ancestor exist?Microevolution has been sufficiently frequent that recentlyisolated strains of subgroups III and IV-1 differ at four ofthe five loci that were identical in the 1960s and subgroupIV-2 strains isolated after 1936 differed at three of the sixloci from a strain isolated in 1917. The subgroups cannothave evolved very much earlier than the oldest isolatesavailable because similar rates of microevolution wouldhave led to loss of identity. Thus, the last common ances-tor of the three subgroups may have existed as recently asthe 19th century (Fig. 7). A better estimate of that datemay be possible after comparative sequencing of moreand larger DNA regions from the earliest isolates.

Because subgroups I and II possessed identical igaalleles, as did subgroups V and VII, these pairs of sub-groups may also have inherited other, otherwise variable,alleles from a last common ancestor. Because the opcregion is identical or highly related in almost all serogroupA bacteria (Seiler et al., 1996), all serogroup A bacteriamight be descended from a common ancestor, some ofwhose properties might be revealed by comparative sequ-encing of conserved DNA regions.

Reduction of sequence diversity

No subgroup III strain isolated before the Mecca epidemicof 1987 possessed the opaB94–ingA2, opaD100 and iga3alleles associated with post-Mecca strains, whereas themajority of the bacteria isolated during that epidemicalready possessed these three genetic changes. It hasbeen inferred that the Mecca epidemic was importedfrom Asia where subgroup III had caused epidemic dis-ease in the early 1980s in China and in Nepal (Moore et



al., 1989; Wang et al., 1992). It is possible that the post-Mecca strain arose during the spread from Asia toMecca. Alternatively, the bacteria arose elsewhere in alocality that has not been sampled by current strain collec-tions and that has not reported epidemic meningococcaldisease. Two strains isolated in 1987 contained the pre-Mecca opaB and ingA alleles in combination with thepost-Mecca opaD100 and iga3 alleles and might be inter-mediates on the evolutionary pathway to the post-Meccabacteria. The entire opaB–ingA region was sequencedfrom one of these strains (Z3515) and was indeed identicalto that of the pre-Mecca pattern.

The isolation from patients linked to the Mecca outbreakof four strains with the pre-Mecca pattern and 59 with thepost-Mecca patterns suggests that genetic fixation of thepost-Mecca pattern had not progressed to completionwithin the geographical area where those genetic changeshad arisen, or could reflect subgroup III bacteria havingreached Mecca from two or more independent geographi-cal sources. The two intermediate strains might evenrepresent back recombinants in which the post-Meccabacteria had reacquired the 5 kb opaB–ingA region typicalof pre-Mecca bacteria. Identifying other chromosomalregions that differentiate pre-Mecca from post-Mecca iso-lates might resolve this question.

All but 1 of 118 bacteria isolated from Africa between1988 and 1996 were of the post-Mecca pattern. Theexceptional African strain, isolated in Nigeria in 1996,might represent import of a pre-Mecca strain from asource such as China, where such strains continued to

exist in the 1990s, or might only indicate that the frequencyof pre-Mecca strains in Africa was an order of magnitudelower than during the Mecca outbreak.

Uniformity of the post-Mecca pattern in Africa resem-bles the results found with a much smaller sample of sub-group IV-1 strains, which will be interpreted here as if theearliest isolate with a novel allele indicating the yearwhen that genetic change occurred (Fig. 5). The ingA5allele was present in almost all isolates after its import inthe early 1960s, as was the opaB133 allele or its recombi-national variants. All strains isolated since the 1970s car-ried the iga4 allele. Similarly, opaB136 was present inbacteria isolated after 1980 in The Gambia and Mali.Thus, genetic fixation seems to have happened indepen-dently for several different alleles, even including inter-genic regions (ingA5 ) that are probably not underselection pressure.

The evidence for genetic fixation of some alleles com-plements the observation that for both subgroups III andIV-1, other variant alleles were found in individual strainsor in single countries and seem to have been lost duringepidemic spread. These observations attest to mechan-isms that reduce sequence diversity, such as sequentialbottlenecks or periodic selection (Achtman, 1995b). Peri-odic selection might be expected to result in an increasedfrequency of fitter variants during epidemics within indivi-dual countries. Sequential bottlenecks must occur whenonly a few bacteria spread between geographical areas.Bottlenecks would quickly reduce genetic diversity andcould readily account for changes in frequency such as


Fig. 7. Possible evolution of subgroups III, IV-1 and IV-2. The figure presents a summary of the available sequence and serological datasupporting descent of the three subgroups from a common ancestor followed by multiple events of microevolution. Import of foreign allelesbefore the earliest isolation of meningococcal strains is indicated by horizontal curved and straight arrows. As all three subgroups differ in theporA gene type and in the type of pilin antigen they express, it is impossible to decide which alleles might be ancestral and both porA and pilinantigens are indicated as having been imported after descent from a last common ancestor. In contrast, both opc1 and opaJ102 are indicatedas being present in the last common ancestor because opc1 is present in almost all serogroup A meningococci and opaJ102 was present inold subgroup III and IV-2 strains. The opc3 allele in subgroup IV-2 differs from opc1 by 2 bp in an intergenic region and all subgroup IV-1strains have a deletion of the opaJ locus. Loci at which microevolution are known to have occurred subsequently are summarized in the table.Data sources: pilin antigens, Wang et al. (1992); porA, Suker et al. (1994); opc, Seiler et al. (1996); other data, this publication.


distinguish subgroup III bacteria related to the Mecca out-break and those isolated from Africa. Even genetic vari-ants with no selective advantage might be randomlyamplified under conditions in which extreme bottleneckingoccurred.

Epidemic spread, genetic variation and clonal descent

The high frequency of genetic variation observed withinsubgroups III and IV-1 might have been expected tohave increased genetic diversity and led to a loss of clonalcoherence (Milkman and Bridges, 1990; Maynard Smith etal., 1993). However, bacterial population biology has lar-gely ignored the consequences of epidemic spread onbacterial uniformity, except in regard to the speed withwhich such clonal groupings can expand (Maynard Smithet al., 1993). Epidemic spread will probably always beassociated with bottlenecks that reduce sequence diver-sity, and thus spread from one geographical area to thenext should purify bacterial populations and lead to appar-ent clonal uniformity with occasional clonal replacement.Clearly, the importance of such mechanisms reflects theratio between the frequency with which genetic variantsarise to that of spread from country to country. Temporalpersistence of bacterial clones in any one geographicalarea will also be an important factor.

Can the observations made with epidemic clonal group-ings of N. meningitidis be applied to other bacterial patho-gens? Only a few bacterial pathogens, most notably Vibriocholerae, Yersinia pestis and some strains of E. coli andSalmonella enterica, are associated with epidemic disease.Clonal replacement can be inferred from recent data onO139 V. cholerae (Bik et al., 1995; Comstock et al.,1996) and O157 E. coli (Karch et al., 1993; Whittam etal., 1993) and future analyses may reveal phenomenaamong these organisms similar to those described here.It is unclear whether repeated purification of clonal group-ings is relevant to other bacterial pathogens, in particularas the quantitative relation between persistence, spreadand genetic variation will differ with the epidemiological fea-tures associated with each pathogen. However, it seemslikely that geographical spread will reduce the geneticdiversity of any clonal grouping below the levels that canaccumulate during prolonged residence in any one area.

Experimental procedures

Genetic nomenclature. The locus designations opaA,opaB, opaD correspond to the loci mapped by Dempsey etal. (1995), whereas opaJ is described here for the first time;oligonucleotide primers are described below that allow PCRamplification of the alleles at these loci from all meningo-coccal strains tested. Each unique opa, iga and ingA sequencewas assigned an arbitrary, unique allele number (Demerec etal., 1966). The full nomenclature of opa alleles includes both

the locus designation and the allele number, for exampleopaA132.

Sequence numbering

In Figs 2, 4 and 6, the opa and iga alleles are oriented fromleft to right in the direction of transcription. For opa alleles,nucleotide 1 corresponds to the first nucleotide after therepeated CTCTT pentamers within the region encoding thesignal peptide and the sequences extend to the TGA stopcodon. For iga, nucleotide 1 corresponds to the beginningof the codon encoding amino acid 11 within the signal peptideand the sequence extends through the regions encodingthe mature IgA1 protease and the g-peptide through to thefirst five amino acids of the a-protein. Nucleotide positions inthe figures were assigned after alignment of the sequencesshown in the figures, including gaps as necessary to accountfor indels. For opa alleles, gaps within the HV1 and HV2regions were introduced manually in order to avoid disruptionof amino acids within an Opa protein alignment.

Bacterial strains

Serogroup A subgroup III strains of N. meningitidis came fromthe following countries (number of strains, years): Brazil (five,1974–76), Burkina Faso (10, 1996), Burundi (one, 1992),Central African Republic (21, 1992), Chad (27, 1988–93),People’s Republic of China (53, 1966–93), Denmark (three,1974), England and Wales (27, 1987–88), Ethiopia (two,1989), Finland (15, 1973–82), France (14, 1980–88), Guinea(nine, 1993), Holland (one, 1973), Israel (11, 1987–89), Mali(seven, 1993–94), Morocco (four, 1989), Nepal (five, 1983),Niger (seven, 1991), Nigeria (14, 1996), Norway (14, 1969–73), Russia (11, 1969–77), Rwanda (one, 1993), Sudan(eight, 1988–93), Sweden (22, 1973–87), USA (17, 1987)and Zambia (eight, 1993). These strains have been describedelsewhere (Achtman et al., 1992; Guibourdenche et al.,1996), except for the strains from Africa isolated since 1993that were from Dr Dominique Caugant, WHO Neisseria Refer-ence Laboratory in Oslo, Norway and eight strains from anoutbreak in Henan, China in 1992–93.

Strains isolated during the 1960s in China or before 1986 inBrazil or Europe were assigned to the first pandemic wave,whereas those isolated after 1983 in China or Nepal wereassigned to the second pandemic wave. Bacteria isolatedbetween 1987 and 1989 in Europe, Israel or the USA wereassigned to the Mecca outbreak. There were epidemiologicallinks between most of these cases and pilgrims returning fromMecca (Moore et al., 1988; Slater et al., 1989; Jones and Sut-cliffe, 1990; Riou et al., 1991). All bacteria isolated from Africasince 1988 were pooled as African isolates despite epidemio-logical links associating the earlier isolates and the Meccaepidemic.

Other serogroup A strains used came from the laboratorystrain collection and have been described elsewhere (Croweet al., 1989; Wang et al., 1992; 1993; Achtman, 1994;Hobbs et al., 1994; Seiler et al., 1996).

DNA techniques

Meningococcal chromosomal DNA was isolated as described



previously (Sarkari et al., 1994). Table 4 summarizes the oli-gonucleotide primer sequences used.

PFGE. Cells grown on supplemented GC agar plates for16 h were suspended in phosphate-buffered saline (10 ml,5 × 108 cells ml¹1), centrifuged and resuspended in 1 ml of1% agarose (ImBed LMP, New England Biolabs, USA).Plugs (0.1 ml) were chilled in plastic moulds (Pharmacia) for20 min. The plugs were incubated overnight at 378C in 50 mlof lysis buffer (1 mg ml¹1 RNAse, 1% Sarkosyl, 6 mm Tris-HCl, 100 mm EDTA, pH 8), and overnight at 508C in 2.5 ml ofESP solution (1% Sarkosyl, 1 mg ml¹1 proteinase K, 500 mmEDTA, pH 8). They were washed four times in 50 ml of TEbuffer (378C) and stored for up to 3 months at 48C. Quarteredplugs were equilibrated with 0.5 ml of digestion buffer for15 min before overnight incubation at 378C with 15 units ofNheI or 5 units of SpeI (New England Biolabs). The plugswere melted at 658C and loaded on gels containing 1%agarose (Seakem GTG FMC). Electrophoresis (PharmaciaPulsaphor) was performed in 0.5 ×TBE at 108C, at 165 V withpulse ramping from 6 to 13 s over 16 h followed by rampingfrom 13 to 30 s over 8 h. The gels were stained with EtBr andphotographed under UV light. Molecular weight standards

were Mid Range I and Low Range PFG Markers (NewEngland Biolabs).

DNA probes. DIG-labelled probes for opa (612 bp, opaA132,oligonucleotides O3510, O221), iga (941 bp, iga2, O103,O115) and ingA (350 bp, ingA1, O329, O320) were made byPCR amplification (25 cycles of 1 min at 958C, 1 min at 558C,1 min at 728C followed by 4 min at 728C) from chromosomalDNA using the PCR Digoxigenin (DIG) Labelling Mix (Boeh-ringer). The iga probe was prepared using 30 PCR ampli-fication cycles.

Hybridization. DNA was transferred from PFGE gels toHybond N positively charged nylon membranes (Amersham)by capillary action and hybridized to DIG-labelled DNAprobes. Bound probes were recognised by chemolumines-cence (DIG Luminescent Detection Kit, Boehringer).

DNA sequencing. Sequencing was performed by the auto-mated cycle sequencing (ABI 377) of unlabelled PCRproducts made as descibed above using primers whosesequences are available on request. opa alleles from PFGEbands excised from gels were amplified (oligonucleotides


Table 4. List of oligonucleotide primers.Primer Sequence Position

O52 GGTTTGGTAACCGAACTTGGG opaB94, 568–545O80 AAGCAACCGGTGCAAACAACACAAGC opa, 100–131O87 GCGCACGCCCAATGAGACTTCGTGGG opa, 737–712O88 GCAAGTGAAGACGGCAGCCGCAGCCCG opa, 40–15O103 CGCCATATCCTTATCCATCT iga, ¹20–¹2O113 CGCCGGCACCGTCAAAGG iga, 905–922O115 CCTTTGACGGTGCCGGC iga, 921–905O151 TTGTGCTTGAGAAGCCGTG iga, 2912–2894O152 GGCGGAGGAATTCTTCGGCTTGAT iga, 3012–2989O210 AGTAAACCAAGTGGTAGCACTACAAA opaB94, 507–532O211 AGGTTTGCTGAACGGACCTTCTAC opaB92, 619–596O220 TGTGTTAGCAGCACCGGCGACGGTAAC opaJ101, 530–504O221 GGTGTTCCGCCAGGAATATTGGTGGG opaA132, 539–515O222 ACCTTGGGGACAGGGCCTCCATTGTTAG opaD131, 554–508O251 GGTATTTCATAGTATTATGCTCGG opaD 38 flanking DNAO258 GTCGTGGCGGCGGCACAGG opaA 38 flanking DNAO278 CCATTGCTTTTATTCACC opaA132, 304–287O279 CAATACCGGTTCCCGCTT opaA132, 395–412O280 CGACAATAAATATTCCGTC opaA132, 301–319O301 GACAATAATGGTGGCGACGACTCCTGGAGCCCGAGAASynthetic linker

TTCCACTAAAGGGAGO302 CTAGCTCCCTTTAGTGGAATTCTCGGGCTCCAGGAGTSynthetic linker

CGTCGCCACCAATATTGTCO320 GTGCAAGGATGGAAAATACCTGTCCTCC opaB–ingA, 4788–4816O321 CTCATCTGTTCATAAGCGATACGGCTCCAG opaB–ingA, 4393–4422O322 CTGCCAGCCTAAAATCGGGCGGGTTATTG opaB–ingA, 4779–4751O329 GTTGGAAATCGACCAGTTCGTAGC opaB–ingA, 5161–5138O464 AAGGCGAGGTAGGATTGC opaB 38 flanking DNAO503 TCCATCTGCAACATAATCCAGCCG opaJ 38 flanking DNAO3510 TACGCTGCAGAAAATGAATCCAGCCCCC opa, ¹73–¹46

Sequences are shown in the 58 to 38 direction. Forward primers are indicated by increasingnumbers under position, whereas reverse primers are indicated by decreasing numbers,except for primers from 38 flanking DNA, which were all reverse primers. The nucleotide num-bering system is explained in Experimental procedures, Sequence numbering. Sequences thatare common to all opa alleles are indicated as opa, whereas sequences specific to individualloci or alleles are indicated by locus or allele designations. The oligonucleotides from flankingDNA are derived from sequences that will be published elsewhere. Primers O210, O211,O220, O221, O222 and O301 were biotinylated.


O3510 (Hobbs et al., 1994), O87) after treatment with b-Agarase (New England Biolabs). In addition, the sequence ofunique downstream chromosomal DNA was determined foreach of the four opa loci (in preparation) to allow theiranalysis in unrelated strains. Each opa locus could then beamplified directly from chromosomal DNA by PCR using anoligonucleotide from the downstream flanking region (opaA :O258; opaB : O464; opaD : O251; opaJ : O503) paired with aconserved upstream primer (O3510). The iga gene (primersO103, O152), the ingA region (O329, O321) and the 4.7 kbdownstream region flanking the opaB allele (O322, O210)were also amplified from chromosomal DNA. For T-nucleo-tide sequencing of variable regions of the iga gene, PCRproducts were amplified using oligonucleotides O113 andO151, and manual sequencing terminated by dideoxy thy-midine bases was performed with the USB sequencing kit.

Recombinant techniques

The expression of recombinant Opa proteins. opa geneswere cloned from a pre-Mecca and from a post-Mecca strainusing vector pTRC99 A (Kupsch et al., 1993) and expressedin E. coli DH5 (Hanahan, 1983). The expressed Opa proteinswere tested by immunoblotting with mAbs: 7out of 73 clonesreacted as if they comprised recombinants generated by thePCR reaction but the others had reactivity patterns that corre-sponded to those of Opa proteins expressed by subgroup IIImeningococci. For each of the four distinct Opa proteins, theopa alleles were sequenced from two clones per meningo-coccal source strain. Approximately half of these clonedinserts contained sequences that were identical to those latersequenced directly from the meningococcal chromosome,whereas the other half differed by 1–5 bp, indicating that thistechnique often results in PCR cloning artefacts.

NheI ends. Chromosomal DNA from a post-Mecca sub-group III isolate was digested with NheI and separated in 1%agarose gels (Sea Plaque GTG, FMC) by Field Inversion GelElectrophoresis (FIGE mapper system, Biorad, program 5).The 41 kb fragment was excised from the gel, treated with b-Agarase and the DNA (120 ng) was ligated (90 min at 208C,10 min 758C) using T4 DNA ligase (1 unit, Boehringer) to asynthetic double-stranded NheI linker (9 ng) obtained byallowing the biotinylated oligonucleotide O301 to hybridizewith O302. The NheI-linker contains the sequence of thelgt11 forward primer for subsequent manipulations plus a38-GATC single-strand overhang, and will hybridize to the58-CTAG overhang generated by NheI digestion. The ligationproducts were digested with TaqI or NlaIII and adsorbed tomagnetic beads containing streptavidin (Dynabeads M-280,Dynal). Beads that had bound the NheI–TaqI or NheI–NlaIIIfragments were removed from the reaction mixture magne-tically, washed and a linker with one end compatible withTaqI and the other compatible with NlaIII (30 ng of the SphI-ClaI restriction fragment from plasmid pBR322) was ligatedto the bound DNA (1 unit, 90 min at 208 C). PCR amplificationwas performed using the washed beads with lgt11 forwardand pBR322 primers (Biolabs) (1223 for the NlaIII end or1239 for the TaqI end). PCR products were cloned in theTA cloning vector (Invitrogen), and insert DNA was prepared

by single colony PCR using M13 reverse and T7 primers.Inserts that contained an NheI site were sequenced. Twodistinct inserts were obtained from each experiment, corre-sponding to both ends of the 41 kb fragment.

Screening for sequence variability

Restriction analyses. opa alleles were amplified by PCRusing oligonucleotide O80 (O88 for opaJ101 ), which corre-sponds to the N-terminus of Opa proteins, and oligonucleo-tides specific for each of the HV2 regions (opaA132 : O221;opaD131 or opaD100 : O222; opaB92 : O211; opaB94 : O52;opaJ101 : O220). PCR products were tested for restrictionendonuclease sites that distinguish the standard opa allelesfrom variant alleles. A DraI site in the HV1 region is specificfor opaD131 and opaD100. The PCR products from thesetwo alleles were distinguished by a DdeI site in opaD100 thatis lacking in opaD131. A BanI site in HV1 was used as amarker for opaB94. A HindII site in HV1 is characteristic ofopaA132, opaB92 and opaJ101. These alleles were furtherdistinguished by a HpaII site at 179 bp lacking in opaA132, aHpaII site in HV2 exclusively present in opaJ101, and anRsaI site in HV1 lacking in opaB92.

PCR products from iga (O103, O115) were tested for theexistence of a BfaI site that is characteristic of iga1. PCR pro-ducts from ingA (O320, O329) were tested for the presence ofan NheI site.

SSCP. opaA was PCR amplified in three sections usingoligonucleotide combinations O88/O278 (284 bp), O280/O221 (344 bp) and O279/O87 (274 bp). These were sepa-rated by SSCP gels (Michaud et al., 1992), stained with silvernitrate (Bassam et al., 1991) and examined for electrophore-tic variants that differed from known opaA alleles. All the opaalleles described here yielded a distinct electrophoreticpattern under these conditions.

Comparison of DNA sequences to publishedsequences

The alleles from strain Z2491 at the opaB and opaD loci wereidentical to previously published sequences from that strain(Hobbs et al., 1994) but the allele at the opaA locus differedby 2 bp from Genbank accession number U03405, whichhad been obtained from a cloned PCR product and might con-tain PCR-generated mistakes. The opaD allele in the pre-Mecca subgroup III strains (opaD131 ) was indistinguishablefrom a partial opa sequence (Hobbs et al., 1994) (formerlyopaDZ1213, accession number U03408) from the subgroupIV-1 strain Z1213, isolated in Ghana in 1973 (see Fig. 3).

Acknowledgements

B. M. was supported by Grant Ac36/6 from the Deutsche For-schungsgemeinschaft. We gratefully acknowledge receipt ofoligonucleotides and plasmid pTRC99A from Johannes Pohl-ner and Thomas F. Meyer, Max-Planck Institut fur Biologie,Tubingen and receipt of strains from Dominique Caugant,National Institute of Public Health, Oslo, Norway and Jean-Yves Riou, Institut Pasteur, Paris. The presentation of data



benefited from Martin Maiden’s constructive comments andthe requests by two anonymous reviewers that we dot ouri’s and cross our t’s.

References

Achtman, M., Kusecek, B., Morelli, G., Eickmann, K.,Wang, J., Crowe, B., Wall, R.A., Hassan-King, M.,Moore, P.S., and Zollinger, W. (1992) A comparison ofthe variable antigens expressed by clone IV-1 and sub-group III of Neisseria meningitidis serogroup A. J InfectDis 165: 53–68.

Achtman, M. (1994) Clonal spread of serogroup A meningo-cocci. A paradigm for the analysis of microevolution inbacteria. Mol Microbiol 11: 15–22.

Achtman, M. (1995a) Global epidemiology of meningococcaldisease. In Meningococcal Disease. Cartwright, K. (ed).Chichester: John Wiley & Sons, pp. 159–175.

Achtman, M. (1995b) Epidemic spread and antigenic variabil-ity of Neisseria meningitidis. Trends Microbiol 3: 186–192.

Aho, E.L., Dempsey, J.A.F., Hobbs, M.M., Klapper, D.G., andCannon, J.G. (1991) Characterization of the opa (class 5)gene family of Neisseria meningitidis. Mol Microbiol 5:1429–1437.

Auriol, J., Guesdon, J.-L., Guibourdenche, M., and Riou, J.Y.(1995) Characterization of serogroup A Neisseria meningi-tidis strains by rRNA gene restriction patterns and PCR:Correlation with the results of serotyping, subtyping andmultilocus enzyme electrophoresis. FEMS Immunol MedMicrobiol 10: 219–226.

Bassam, B.J., Caetano-Anolles, G., and Gresshoff, P.M.(1991) Fast and sensitive silver staining of DNA in polya-crylamide gels. Anal Biochem 196: 80–83.

Belland, R.J., Morrison, S.G., Carlson, J.H., and Hogan,D.M. (1997) Promotor strength influences phase variationof neisserial opa genes. Mol Microbiol 23: 123–135.

Bik, E.M., Bunschoten, A.E., Gouw, R.D., and Mooi, F.R.(1995) Genesis of the novel epidemic Vibrio choleraeO139 strain: Evidence for horizontal transfer of genesinvolved in polysaccharide synthesis. EMBO J 14: 209–216.

Burland, V., Plunkett III, G., Sofia, H.J., Daniels, D.L.X., andBlattner, F.R. (1995) Analysis of the Escherichia coli gen-ome VI: DNA sequence of the region from 92.8 through100 min. Nucleic Acids Res 23: 2105–2119.

Bygraves, J.A., and Maiden, M.C.J. (1992) Analysis of theclonal relationships between strains of Neisseria meningiti-dis by pulsed field gel electrophoresis. J Gen Microbiol138: 523–531.

Cartwright, K. (1995) Meningococcal Disease, Chichester:John Wiley & Sons.

Comstock, L.E., Johnson, J.A., Michalski, J.M., Morris, J.G.,Jr., and Kaper, J.B. (1996) Cloning and sequence of aregion encoding a surface polysaccharide of Vibrio cho-lerae O139 and characterization of the insertion site inthe chromosome of Vibrio cholerae O1. Mol Microbiol 19:815–826.

Crowe, B.A., Wall, R.A., Kusecek, B., Neumann, B.,Olyhoek, T., Abdillahi, H., Hassan-King, M., Greenwood,B.M., Poolman, J.T., and Achtman, M. (1989) Clonal andvariable properties of Neisseria meningitidis isolated from

cases and carriers during and after an epidemic in theGambia, West Africa. J Infect Dis 159: 686–700.

Demerec, M., Adelberg, E.A., Clark, A.J., and Hartman, P.E.(1966) A proposal for a uniform nomenclature in bacterialgenetics. Genetics 54: 61–76.

Dempsey, J.A.F., Wallace, A.B., and Cannon, J.G. (1995)The physical map of the chromosome of a serogroup Astrain of Neisseria meningitidis shows complex rearrang-ments relative to the chromosomes of two mapped strainsof the closely related species N. gonorrhoeae. J Bacteriol177: 6390–6400.

Denamur, E., Pautard, J.C., Ducroix, J.P., Masmoudi, K., Eb,F., Riou, J.Y., and Orfila, J. (1987) Meningococcal diseasedue to group A Neisseria meningitidis in contacts of Meccapilgrims. Lancet ii: 1211.

Gaher, M., Einsiedler, K., Crass, T., and Bautsch, W. (1996)A physical and genetic map of Neisseria meningitidisB1940. Mol Microbiol 19: 249–259.

Gibbs, C.P., Reimann, B.-Y., Schultz, E., Kaufmann, A.,Haas, R., and Meyer, T.F. (1989) Reassortment of pilingenes in Neisseria gonorrhoeae occurs by two distinctmechanisms. Nature 338: 651–652.

Goodman, S.D., and Scocca, J.J. (1988) Identification andarrangement of the DNA sequence recognized in specifictransformation of Neisseria gonorrhoeae. Proc Natl AcadSci USA 85: 6982–6986.

Guibourdenche, M., Caugant, D.A., Herve, V., Debonne,J.M., Lanckriet, C., Merlin, M., Mathiot, C., Roungou,J.B., Martet, G., and Riou, J.Y. (1994) Characteristics ofserogroup A Neisseria meningitidis strains isolated in theCentral African Republic in February 1992. Eur J ClinMicrobiol Infect Dis 13: 174–177.

Guibourdenche, M., Høiby, E.A., Riou, J.-Y., Varaine, F.,Joguet, C., and Caugant, D.A. (1996) Epidemics of ser-ogroup A Neisseria meningitidis of subgroup III in Africa,1989–94. Epidemiol Infect 116: 115–120.

Guttman, D.S., and Dykhuizen, D.E. (1994) Clonal diver-gence in Escherichia coli as a result of recombination,not mutation. Science 266: 1380–1383.

Haimanot, R.T., Caugant, D.A., Fekadu, D., Bjune, G.,Belete, B., Frøholm, L.O., Høiby, E.A., Rosenqvist, E.,Selander, R.K., and Bjorvatn, B. (1990) Characteristicsof serogroup A Neisseria meningitidis responsible for anepidemic in Ethiopia, 1988–89. Scand J Infect Dis 22:171–174.

Hanahan, D. (1983) Studies on transformation of Escherichiacoli with plasmids. J Mol Biol 166: 557–580.

Hjetland, R., Caugant, D.A., Hofstad, T., Frøholm, L.O., andSelander, R.K. (1990) Serogroup A Neisseria meningitidisof clone III-1 in western Norway, 1969–73. Scand J InfectDis 22: 241–242.

Hobbs, M.M., Seiler, A., Achtman, M., and Cannon, J.G.(1994) Microevolution within a clonal population of patho-genic bacteria: recombination, gene duplication and hori-zontal genetic exchange in the opa gene family ofNeisseria meningitidis. Mol Microbiol 12: 171–180.

Hobbs, M.M., Malorny, B., Prasad, P., Morelli, G., Kusecek,B., Heckels, J.E., Cannon, J.G., and Achtman, M. (1997)Recombinational reassortment among opa genes fromET-37 complex Neisseria meningitidis isolates of diversegeographical origins. Microbiology (in press).



Jones, D.M., and Sutcliffe, E.M. (1990) Group A meningo-coccal disease in England associated with the Haj. JInfect 21: 21–25.

Kapur, V., Whittam, T.S., and Musser, J.M. (1994) Is Myco-bacterium tuberculosis 15 000 years old. J Infect Dis 170:1348–1349.

Karch, H., Bohm, H., Schmidt, H., Gunzer, F., Aleksic, S.,and Heesemann, J. (1993) Clonal structure and pathogeni-city of Shiga-like toxin-producing, sorbitol-fermentingEscherichia coli O157: H¹. J Clin Microbiol 31: 1200–1205.

Kupsch, E.-M., Knepper, B., Kuroki, T., Heuer, I., and Meyer,T.F. (1993) Variable opacity (Opa) outer membrane pro-teins account for the cell tropisms displayed by Neisseriagonorrhoeae for human leukocytes and epithelial cells.EMBO J 12: 641–650.

Li, W.-H. (1993) Unbiased estimation of the rates of synony-mous and non-synonymous substitution. J Mol Evol 36:96–99.

Lomholt, H., Poulsen, K., and Kilian, M. (1995) Comparativecharacterization of the iga gene encoding IgA1 protease inNeisseria meningitidis, Neisseria gonorrhoeae and Hae-mophilus influenzae. Mol Microbiol 15: 495–506.

Maiden, M.C.J., Malorny, B., and Achtman, M. (1996) Aglobal gene pool in the neisseriae. Mol Microbiol 21:1297–1298.

Maynard Smith, J., Smith, N.H., O’Rourke, M., and Spratt,B.G. (1993) How clonal are bacteria? Proc Natl Acad SciUSA 90: 4384–4388.

Michaud, J., Brody, L.C., Steel, G., Fontaine, G., Martin, L.S.,Valle, D., and Mitchell, G. (1992) Strand-separating confor-mational polymorphism analysis: efficacy of detection ofpoint mutations in the human ornithine delta-aminotrans-ferase gene. Genomics 13: 389–394.

Milkman, R., and Bridges, M.M. (1990) Molecular evolution ofthe Escherichia coli chromosome. III. Clonal frames.Genetics 126: 505–517.

Milkman, R., and Bridges, M.M. (1993) Molecular evolution ofthe Escherichia coli chromosome. IV. Sequence compari-sons. Genetics 133: 455–468.

Moore, P.S., Harrison, L.H., Telzak, E.E., Ajello, G.W., andBroome, C.V. (1988) Group A meningococcal carriage intravelers returning from Saudi Arabia. JAMA 260: 2686–2689.

Moore, P.S., Reeves, M.W., Schwartz, B., Gellin, B.G., andBroome, C.V. (1989) Intercontinental spread of an epi-demic group A Neisseria meningitidis strain. Lancet ii:260–263.

Morelli, G., del Valle, J., Lammel, C.J., Pohlner, J., Muller, K.,Blake, M., Brooks, G.F., Meyer, T.F., Koumare, B.,Brieske, N., and Achtman, M. (1994) Immunogenicity andevolutionary variability of epitopes within IgA1 proteasefrom serogroup A Neisseria meningitidis. Mol Microbiol11: 175–187.

Murphy, G.L., Connell, T.D., Barritt, D.S., Koomey, M.,and Cannon, J.G. (1989) Phase variation of gonococcalprotein II: Regulation of gene expression by slipped-strandmispairing of a repetitive DNA sequence. Cell 56: 539–547.

Nejmi, S., Belhaj, A., Guibourdenche, M., and Riou, J.Y.(1992) Etude de quatre-vingt dix souches de Neisseria

meningitidis de serogroupe A isolees du liquide cephalora-chidien (25) et du rhinopharynx (65) au Maroc (decembre,1989 – avril, 1990). Pathologie Biologie 40: 993–998.

O’Rourke, M., Ison, C.A., Renton, A.M., and Spratt, B.G.(1995) Opa-typing: a high-resolution tool for studying theepidemiology of gonorrhoea. Mol Microbiol 17: 865–875.

Ochman, H., and Lawrence, J.G. (1996) Phylogenetics andthe amelioration of bacterial genomes. In Escherichia coliand Salmonella typhimurium: Cellular and Molecular Biol-ogy. Neidhardt, F.C., Curtiss III, R., Ingraham, J.L., Lin,E.C.C., Low, K.B., Magasanik, B., Reznikoff, W.S., Riley,M., Schaechter, M., and Umbarger, H.E. (eds). Washing-ton, DC: American Society for Microbiology, pp. 2627–2637.

Olyhoek, T., Crowe, B.A., and Achtman, M. (1987) Clonalpopulation structure of Neisseria meningitidis serogroupA isolated from epidemics and pandemics between 1915and 1983. Rev Infect Dis 9: 665–692.

Reeves, P.R. (1993) Evolution of Salmonella O antigen var-iation by interspecific gene transfer on a large scale.Trends Genet 9: 17–22.

Riou, J.Y., Caugant, D.A., Selander, R.K., Poolman, J.T.,Guibourdenche, M., and Collatz, E. (1991) Characteriza-tion of Neisseria meningitidis serogroup A strains from anoutbreak in France by serotype, serosubtype, multilocusenzyme genotype and outer membrane protein pattern.Eur J Clin Microbiol Infect Dis 10: 405–409.

Salih, M.A.M., Danielsson, D., Backman, A., Caugant, D.A.,Achtman, M., and Olcen, P. (1990) Characterization of epi-demic and non-epidemic Neisseria meningitidis serogroupA strains from Sudan and Sweden. J Clin Microbiol 28:1711–1719.

Sarkari, J., Pandit, N., Moxon, E.R., and Achtman, M. (1994)Variable expression of the Opc outer membrane protein inNeisseria meningitidis is caused by size variation of a pro-moter containing poly-cytidine. Mol Microbiol 13: 207–217.

Sawers, G., Heider, J., Zehelein, E., and Bock, A. (1991)Expression and operon structure of the sel genes ofEscherichia coli and identification of a third selenium-con-taining formate dehydrogenase isoenzyme. J Bacteriol173: 4983–4993.

Seiler, A., Reinhardt, R., Sarkari, J., Caugant, D.A., andAchtman, M. (1996) Allelic polymorphism and site-specificrecombination in the opc locus of Neisseria meningitidis.Mol Microbiol 19: 841–856.

Slater, P.E., Roitman, M., and Costin, C. (1989) Meningitis inIsrael: An imported outbreak. Israel J Med Sci 25: 41–42.

Spratt, B.G., Smith, N.H., Zhou, J., O’Rourke, M., and Feil, E.(1995) The population genetics of the pathogenic Neis-seria. In Population Genetics of Bacteria. Baumberg, S.,Young, J.P.W., Saunders, J.R., and Wellington, E.M.H.(eds). Cambridge: Cambridge University Press, pp. 143–160.

Stern, A., Brown, M., Nickel, P., and Meyer, T.F. (1986) Opa-city genes in Neisseria gonorrhoeae: Control of phase andantigenic variation. Cell 47: 61–71.

Stern, A., and Meyer, T.F. (1987) Common mechanism con-trolling phase and antigenic variation in pathogenicneisseriae. Mol Microbiol 1: 5–12.

Suker, J., Feavers, I.M., Achtman, M., Morelli, G., Wang, J.,and Maiden, M.C.J. (1994) The porA gene in serogroup A



meningococci: evolutionary stability and mechanism ofgenetic variation. Mol Microbiol 12: 253–265.

Wang, J., Caugant, D.A., Li, X., Hu, X., Poolman, J.T.,Crowe, B.A., and Achtman, M. (1992) Clonal and antigenicanalysis of serogroup A Neisseria meningitidis with parti-cular reference to epidemiological features of epidemicmeningitis in China. Infect Immun 60: 5267–5282.

Wang, J., Caugant, D.A., Morelli, G., Koumare, B., and

Achtman, M. (1993) Antigenic and epidemiological proper-ties of the ET-37 complex of Neisseria meningitidis. JInfect Dis 167: 1320–1329.

Whittam, T.S., Wolfe, M.L., Wachsmuth, I.K., Ørskov, F.,Ørskov, I., and Wilson, R.A. (1993) Clonal relationshipsamong Escherichia coli strains that cause hemorrhagiccolitis and infantile diarrhea. Infect Immun 61: 1619–1629.



Documents

Clonal descent and microevolution of Neisseria meningitidis during 30 years of epidemic spread