Circadian Regulation of the PhCCD1 Carotenoid Cleavage Dioxygenase Controls Emission of Ionone, a Fragrance Volatile of Petunia Flowers

Circadian Regulation of the PhCCD1 CarotenoidCleavage Dioxygenase Controls Emission of b-Ionone,a Fragrance Volatile of Petunia Flowers1

Andrew J. Simkin, Beverly A. Underwood, Michele Auldridge, Holly M. Loucas, Kenichi Shibuya,Eric Schmelz, David G. Clark, and Harry J. Klee*

Horticultural Sciences, Plant Molecular and Cellular Biology Program, University of Florida, Gainesville,Florida 32611–0690 (A.J.S., M.A., H.J.K.); Environmental Horticulture, University of Florida,Gainesville, Florida 32611–0670 (B.A.U., H.M.L., K.S., D.G.C.); and United StatesDepartment of Agriculture, Agricultural Research Service, Center for MedicalAgricultural and Veterinary Entomology, Gainesville, Florida 32608 (E.S.)

Carotenoids are thought to be the precursors of terpenoid volatile compounds that contribute to flavor and aroma. One suchvolatile, b-ionone, is important to fragrance in many flowers, including petunia (Petunia hybrida). However, little is knownabout the factors regulating its synthesis in vivo. The petunia genome contains a gene encoding a 9,10(9#,10#) carotenoidcleavage dioxygenase, PhCCD1. The PhCCD1 is 94% identical to LeCCD1A, an enzyme responsible for formation of b-iononein tomato (Lycopersicon esculentum; Simkin AJ, Schwartz SH, Auldridge M, Taylor MG, Klee HJ [2004] Plant J [in press]).Reduction of PhCCD1 transcript levels in transgenic plants led to a 58% to 76% decrease in b-ionone synthesis in the corollas ofselected petunia lines, indicating a significant role for this enzyme in volatile synthesis. Quantitative reverse transcription-PCRanalysis revealed that PhCCD1 is highly expressed in corollas and leaves, where it constitutes approximately 0.04% and 0.02%of total RNA, respectively. PhCCD1 is light-inducible and exhibits a circadian rhythm in both leaves and flowers. b-Iononeemission by flowers occurred principally during daylight hours, paralleling PhCCD1 expression in corollas. The resultsindicate that PhCCD1 activity and b-ionone emission are likely regulated at the level of transcript.

Apocarotenoids are a class of compounds derivedfrom oxidative cleavage of carotenoids that are impor-tant contributors to flavor and fragrance of foods(Walhberg and Eklund, 1998). Until recently, the deri-vation of many of these compounds from carotenoidswas largely based on structural considerations andcorrelations between levels of substrates and products(Buttery et al., 1988). With more than 600 carotenoidsidentified to date, apocarotenoids constitute one of thelargest classes of molecules in nature. Some of theseapocarotenoids are essential and valuable constituentsof color, flavor, and aroma (Winterhalter and Rouseff,2002).

Recently, a family of enzymes that could potentiallygenerate many apocarotenoids has been described.This family, the carotenoid cleavage dioxygenases(CCDs), has been shown to cleave multiple carote-noids at specific double bonds within the substrate(Schwartz et al., 2001; Giuliano et al., 2003). One of thebest-characterized apocarotenoids is the hormone ab-scisic acid (ABA). ABA is a C15 compound derived

from 11,12 cleavage of the epoxy-carotenoids 9-cis-violoaxanthin and 9-cis-neoxanthin by VP14 to pro-duce xanthoxin (Schwartz et al., 1997; Tan et al., 1997).VP14 is the founding member of this unique family ofdioxygenases. In Arabidopsis (Arabidopsis thaliana),there are nine members of the CCD family, five ofwhich are believed to be involved in ABA synthesis(Tan et al., 2003). One member of the family, AtCCD1that is not involved in ABA synthesis, symmetricallycleaves the 9,10(9#,10#) double bonds of multiplecarotenoid substrates in vitro. Homologues of thisenzyme, which generates a C14 dialdehyde and twoC13 products, have been identified in Phaseolus vulgaris(Schwartz et al., 2001), crocus (Crocus sativus; Bouvieret al., 2003), and tomato (Lycopersicon esculentum;Simkin et al., 2004). When the substrate of CCD1 isb-carotene, the volatile apocarotenoid b-ionone is gen-erated (Fig. 1; Schwartz et al., 2001). b-Ionone has beenshown to be an important contributor to fragrancein the flowers of Boronia megastigma (Cooper et al.,2003) and Osmanthus fragrans (Kaiser and Lamparsky,1980). In tomato fruit, b-ionone is present in verylow concentrations (4 nL L21), but due to its odor thresh-old (0.007 nL L21), it is the second most importantvolatile contributing to fruit flavor (Baldwin et al.,2000).

In many flowers, fragrance is diurnally regulated(Loughrin et al., 1990; Kolosova et al., 2001; Pott et al.,

1 This work was supported in part by National Science Founda-tion (grant no. IBN0115004 to H.J.K.).

* Corresponding author; e-mail [email protected]; fax 352–846–2063.

Article, publication date, and citation information can be found atwww.plantphysiol.org/cgi/doi/10.1104/pp.104.049718.

This article is published in Plant Physiology Online, Plant Physiology Preview Section, which publishes manuscripts accepted for

publication after they have been edited and the authors have corrected proofs, but before the final, complete issue is published

online. Early posting of articles reduces normal time to publication by several weeks.

Plant Physiology Preview, www.aspb.org � 2004 American Society of Plant Biologists 1 of 11 www.plant.org on October 14, 2014 - Published by www.plantphysiol.orgDownloaded from

Copyright © 2004 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/

http://www.plant.org

2003; Underwood, 2003; Verdonk et al., 2003; Under-wood et al., 2004). Since b-ionone is an importantvolatile fragrance component of many flowers, wewere interested in determining whether it is synthe-sized in petunia (Petunia hybrida) and, if so, how itssynthesis is regulated. We were also interested indetermining the biochemical function of the CCD1family of enzymes in vivo. Having identified both theCCD1 transcript and b-ionone in Mitchell Diploid(MD) petunia flowers, we determined how changingdaily conditions influenced both gene expression andb-ionone formation in vivo.

RESULTS

Identification of PhCCD1 in Plants

In order to identify a petunia CCD1 homolog, thetomato LeCCD1A cDNA (AY576003) was used asa probe to screen a flower cDNA library of petunia(cv MD). Screening of this unamplified library yielded17 independent clones. Sequence analysis revealedthat all 17 clones were derived from the same gene,suggesting that only one gene is predominantlyexpressed in flowers. A full-length sequence wassubsequently obtained by 5#RACE-PCR from flower-tissue RNA. The full-length cDNA has high sequenceidentity to the CCD genes AtCCD1 (74%) and LeCCD-1A (92%). The petunia cDNA, PhCCD1, encodes anopen reading frame of 1,641 nucleotides. A compari-son of the deduced PhCCD1 protein with the proteinsfrom tomato and Arabidopsis indicates the highestidentity to LeCCD1A (94%; Simkin et al., 2004) andAtCCD1 (85%; Schwartz et al., 2001), enzymes thatcatalyze the symmetrical 9,10(9#,10#) cleavage of mul-tiple linear and cyclized carotenoids (Fig. 2). Southern-blot analysis indicated that PhCCD1 likely exists asa single copy in the petunia genome (data not shown).

Activity of PhCCD1 in Escherichia coli

The predicted PhCCD1 enzyme is 94% identical toLeCCD1A, an enzyme that we have shown catalyzessymmetric 9,10(9#,10#) cleavage of multiple carote-noids, including b-carotene (Simkin et al., 2004).Cleavage of b-carotene by CCD1 enzymes releasestwo molecules of b-ionone as well as a central C14dialdehyde (Fig. 1). To prove that PhCCD1 is alsocapable of generating b-ionone, a full-length cDNAwas cloned into the E. coli expression vector pDEST14.This plasmid was then introduced into an E. coli hostthat had been previously engineered to accumulateb-carotene (Cunningham et al., 1996). Induction ofPhCCD1 led to a loss of orange color, indicatingcatabolism of b-carotene, and synthesis of b-ionone(Fig. 3). Taken together, these results indicate thatPhCCD1, like its Arabidopsis (Schwartz et al., 2001),tomato (Simkin et al., 2004), and crocus (Bouvier et al.,2003) homologs, cleaves b-carotene at the 9,10 doublebond.

Overexpression of LeCCD1A and Analysis ofTransgenic Plants

In order to verify the role of PhCCD1 in synthesis ofb-ionone in vivo, petunia plants were transformedwith a plasmid construct designed to overexpressLeCCD1A, encoding a tomato CCD1. We chose toexpress the tomato cDNA encoding a CCD1 enzymeto reduce the possibility of cosuppression of theendogenous petunia gene. The construct utilizes thefigwort mosaic virus 35S promoter (Richins et al., 1987)to direct constitutive transcription of a tomato CCD1.To independently quantify mRNAs of PhCCD1 andLeCCD1A, gene-specific primers and probes weredesigned and tested for each of the two transcripts.Expression of LeCCD1A in the transgenic lines variedfrom 0% to 98% of wild-type PhCCD1 levels in theleaves and from 0% to 27% of wild-type levels in theflowers (Fig. 4A).

Despite the use of a heterologous gene, severalplants with significant reductions in the expressionof the PhCCD1 gene were also identified, indicatingthat these lines had undergone cosuppression due tothe high degree of identity (92%) between the genesequences. Two independent transgenic lines showingthe highest levels of expression of the tomato gene andtwo lines showing the greatest degree of cosuppres-sion of the petunia gene (92% and 96%) were selectedfor further study (Fig. 4A).

The in Vivo Activity of PhCCD1

To quantitatively determine the roles of CCD1enzymes in the formation of b-ionone in vivo, volatileanalysis was performed. Each independent vola-tile extraction was carried out using a minimum of16 newly opened flowers from at least 2 plants foreach transgenic line collected at anthesis. The two

Figure 1. Scheme for the oxidative cleavage of b-carotene catalyzed bythe recombinant CCD1 proteins, resulting in the formation of twomolecules of b-ionone and one C14 dialdehyde.

Simkin et al.

2 of 11 Plant Physiology Preview www.plant.org on October 14, 2014 - Published by www.plantphysiol.orgDownloaded from




transgenic lines showing the highest degree of over-expression of LeCCD1A (Fig. 4A) showed no signifi-cant difference in b-ionone emissions when comparedto MD (Fig. 4B). The lack of significantly increasedb-ionone production in flowers is likely due to thehigh expression of the endogenous petunia gene thatconstitutes approximately 80% of the CCD1 expressionin these tissues. By contrast, the two cosuppressedlines produced only 24% and 42% of wild-type levelsof b-ionone, indicating a major role for PhCCD1 in theformation of b-ionone in vivo.

PhCCD1 Is Expressed in All Tissues

In order to quantify PhCCD1 transcript levelsthroughout the plant, a gene-specific assay based onfluorescent real-time reverse transcription (RT)-PCR(TaqMan; Applied Biosystems, Foster City, CA) wasdeveloped. Absolute mRNA levels were quantifiedagainst a standard curve of tritiated in vitro-transcribed sense-strand RNAs. Using TaqMan, wequantified the expression of the PhCCD1 in the leaves,stem, roots, and flower organs of petunia (Fig. 5).PhCCD1 mRNA was detected in all tissues tested. The

Figure 3. Activity of E. coli-expressed PhCCD1 onb-carotene. A, GC trace showing b-ionone emittedby bacteria before (top) and following (bottom)induction of PhCCD1 expression. Collection anddetection of volatile emissions were performed asdescribed in ‘‘Materials and Methods.’’ B, Accumu-lation of b-carotene in E. coli cells without (U) andfollowing (I) induction of PhCCD1 protein.

Figure 2. Alignment of the predicted amino acid sequence of the petunia CCD and the related proteins from Arabidopsis (Neillet al., 1998: AJ005813) and tomato (Simkin et al., 2004: AY576001).

Petunia Carotenoid Cleavage Dioxygenase

Plant Physiology Preview 3 of 11 www.plant.org on October 14, 2014 - Published by www.plantphysiol.orgDownloaded from




highest transcript levels were detected in flower tis-sues, where it represented approximately 0.04% oftotal RNA in corollas, approximately 0.03% in thestigma/style, and approximately 0.02% in the ovary.

PhCCD1 Transcript Levels Are Regulated by CircadianRhythm and Light

A number of fragrance volatiles in petunia exhibitemissions peaking either at dusk or during the night(Underwood, 2003; Verdonk et al., 2003). In order todetermine how PhCCD1 transcript levels changethroughout the day, leaves were harvested from thegrowing tips of plants at 6-h intervals over 2 d. To testwhether transcript levels are regulated by an internaloscillator, plants were then transferred to either con-stant light or constant darkness and leaf samples werecollected for an additional 3 d. Flowering plants weremaintained under the same conditions, and flowerswere collected at the cognate time points so thattranscript levels and volatiles could be compared.

In leaves, PhCCD1 transcript levels increased ap-proximately 3-fold between 2:30 AM (in the middle

of subjective night) and 8:30 AM, reaching a peak at8:30 AM, 3 h after dawn. Following this increase, tran-script levels decreased steadily during the day (Fig.6A). When entrained plants were placed in constantdarkness, the initial increase between 2:30 AM and8:30 AM in PhCCD1 transcript levels was still observed,although at a reduced level. An increase was alsoobserved in constant light. However, this increase wasobserved between 8:30 PM and 2:30 AM, indicating thatconstant light is exerting an effect on the normalrhythm. In constant darkness, transcript levels de-creased significantly and dampened to a low steady-state level. Minor peaks in transcript levels were stillobserved at 8:30 AM on days 4 and 5 of the extendeddark period, coinciding with the normal peak in thelight. Furthermore, if the plants were placed in con-stant light, they continued to oscillate, although tran-script levels steadily increased to levels slightly higherthan those observed under normal conditions. Peaksin transcript levels were still observed at 8:30 AM.These data indicate that PhCCD1 is regulated by bothlight and circadian mechanisms in leaves.

In corollas, PhCCD1 transcript levels increased rap-idly in the early morning, reaching a peak at 2:30 PM.Subsequently, transcript levels decreased steadily inthe evening, before the onset of darkness, and re-mained low during the night (Fig. 6B). After 8 h ofdarkness, transcript levels again increased, followingthe previous pattern of expression. This increase inPhCCD1 transcript level was also observed when theplants were placed in constant darkness. Furthermore,if the plants were placed in constant light, the decreasein transcript normally observed just prior to the onsetof darkness (between 2:30 PM and 8:30 PM; plantshaving already missed the previous night cycle) wasstill observed. In constant light, transcript levels even-tually increased and remained high, while in constantdarkness transcript levels decreased and remained

Figure 5. Expression of PhCCD1 in different petunia tissues. Levels ofexpression were determined by quantitative RT-PCR.

Figure 4. A, Expression of PhCCD1 and LeCCD1A in the leaves and flowers of transgenic lines. Expression was determined byquantitative RT-PCR. B, b-Ionone emissions in two lines overexpressing LeCCD1A and two lines cosuppressed for PhCCD1.

Simkin et al.





low. These data indicate that PhCCD1 expression inpetunia corollas is regulated primarily by circadianrhythm, with light playing a secondary role. Thesedifferent rhythms may indicate somewhat differentroles for CCD1 in these different tissues.

To test the influence of light on the induction ofPhCCD1 and to confirm a link between transcriptregulation and b-ionone emission, plants were placedin continuous darkness for 2 d. At 7:30 AM on thethird day, plants were exposed to strong white light(coinciding with the normal onset of the light period)for 10 min and returned to darkness. Transcript lev-els were determined 3 h later. White light induced a morethan 2-fold increase in PhCCD1 transcript in bothleaves and corollas (Fig. 7A). At the same time, plantsof the same age and size were exposed to blue, red, orred/far-red light of equal fluence to the white lightexperiment. In all cases, PhCCD1 transcript levelsincreased when compared to untreated controls, al-though not to the same levels observed in white lighttreatment. These data indicate that exposure of a plantto a light source for a short period is sufficient to causean up-regulation of transcript levels. Exposure ofplants to far-red light immediately after red-light

treatment did not inhibit the induction observed un-der red light only, suggesting that phytochrome is notinvolved in regulation of CCD1 expression. The in-duction of PhCCD1 transcript accumulation was alsoaccompanied by an increase in b-ionone emission (Fig.7B). Even this transient increase in RNA after a pro-longed dark period was sufficient to bring about newsynthesis of b-ionone. This result is consistent withgene expression and not substrate availability beinglimiting for b-ionone synthesis.

Circadian Emission of b-Ionone in the Corollasof Petunia

To determine if changes in PhCCD1 transcript areparalleled by changes in the emission of b-ionone,flower volatiles were collected and analyzed at thesame time points used for RT-PCR analysis. At theonset of the light period, b-ionone levels increasedthroughout the day, reaching a peak at 8:30 PM (Fig. 8),6 h after the peak in PhCCD1 transcript. Following thisincrease, b-ionone levels decreased during the night.After 8 h of darkness, b-ionone levels increased again.This increase was also observed when the plants werenot returned to the light. After 14 h of prolongeddarkness, b-ionone levels began to decrease prior toany decrease in transcript levels. By 8:30 PM of the firstday of constant darkness, b-ionone levels had fallen to25% of the normal 8:30 PM levels. During prolongeddarkness, b-ionone levels continued to decrease untilthey became almost undetectable after 2 d of constantdarkness. Note that samples for expression and vola-tile emission analyses shown in Figures 4 and 8 werecollected in different seasons. We have observedseasonal variations in volatile emissions. Whetherthese variations are related to daylength, light inten-sity, or temperature remain to be determined.

DISCUSSION

Although b-ionone is found in low concentrationswhen compared to other more abundant volatiles suchas methylbenzoate and benzaldehyde, which havebeen detected at levels of 60 mg and 13 mg g fw21

h21, respectively (Underwood et al., 2004), b-iononehas a human odor threshold of 0.007 nL L21 (Baldwinet al., 2000). This odor threshold is significantly lowerthan that observed for many of the other more abun-dant volatiles. By comparison, the human odor thresh-old for bezaldehyde, one of the most abundant petuniavolatiles, is nearly five logs higher at 350 nL L21. Thus,b-ionone has the potential to greatly impact floweraroma.

Using plants cosuppressed for PhCCD1 expression,we have demonstrated a role for this gene in theformation of b-ionone in petunia corollas. In trans-genic lines, reduced PhCCD1 transcript levels resultedin significant decreases in b-ionone formation. This isconsistent with previously reported in vitro results for

Figure 6. Diurnal regulation of PhCCD1 transcript levels in leaves (A)and corollas (B) of petunia. The solid white line indicates when plantswere exposed to the light, and the black line shows when plants were indark conditions.






the Arabidopsis homolog AtCCD1 (Schwartz et al.,2001), the crocus homolog CsCCD (Bouvier et al.,2003), and the tomato homologs LeCCD1A andLeCCD1B (Simkin et al., 2004). A 92% to 96% reductionin PhCCD1 transcript levels did not lead to completeloss of b-ionone synthesis in petunia corollas. Evenwith that level of transcript reduction, corollas stillemitted b-ionone at approximately 25% of wild-typelevels. These results suggest that while PhCCD1 musthave a major role in b-ionone synthesis, there may beadditional mechanisms to synthesize it in vivo. Al-though it seems unlikely, we cannot rule out that theresidual PhCCD1 is responsible for this synthesis.

One possible source of the remaining b-iononecould be another CCD. Booker et al. (2004) haveidentified a second Arabidopsis CCD that can alsocleave b-carotene (AtCCD7/AtMAX3). AtCCD7 cata-lyzes the oxidative cleavage of b-carotene at the 9,10double bond, resulting in formation of b-ionone andb-apo-10-carotenal, a C27 aldehyde. In Arabidopsis,CCD1 is expressed at much higher levels than CCD7.There is significant sequence divergence between theCCD1 and CCD7 genes within both Arabidopsis andtomato (less than 30% identity). Thus, we do notexpect any cosuppression of PhCCD7 in the plants

generated for our studies. Furthermore, any loss ofCCD7 activity would be expected to have an obviousmorphological phenotype of increased lateral branch-ing based on results in Arabidopsis (Booker et al.,2004). We also cannot exclude a role of nonenzymaticphotooxidation of carotenoids as a source of b-ionone.The formation of b-ionone by nonenzymatic oxidativedegradation has been demonstrated in vitro (Wacheet al., 2003). It has been estimated that as much as 1 mgof carotenoids/g DW per day are oxidized in pepper(Capsicum annuum) leaves (Simkin et al., 2003a).

It is not surprising that loss of PhCCD1 activity didnot completely eliminate b-ionone emission becausemost carotenoids are located within plastids. In Ara-bidopsis, every member of the CCD family, exceptCCD1, is targeted to plastids (Tan et al., 2003; Bookeret al., 2004; M. Auldridge and H.J. Klee, unpublisheddata). While CCD7 is plastid localized, the evidencesuggests that AtCCD1 (Tan et al., 2003; M. Auldridgeand H.J. Klee, unpublished data), LeCCD1A. andLeCCD1B (Simkin et al., 2004) are located in thecytosol and/or attached to the outer envelope of theplastid. Bouvier et al. (2003) have used immunohisto-chemistry to show a cytoplasmic location for thecrocus CCD1. Because of the high homology to these

Figure 7. Effects of transient exposure tolight sources on PhCCD1 transcript andb-ionone emissions. A, PhCCD1 expressionin petunia leaves and flower corollas fol-lowing exposure to different light sources.Dark-adapted plants were treated withwhite, blue, red, or red/far-red light andreturned to darkness. Transcript levelswere determined 3 h postexposure. Dark-adapted, untreated plants were used asa control. B, Emission of b-ionone wasmeasured from corollas of flowers treatedin the same experiment as in A.

Simkin et al.





enzymes and the lack of an obvious transit peptide, weexpect PhCCD1 to also be cytoplasmic. However, wecannot rule out a tight association with the outerenvelope, as has been reported, for example, withtomato hydroperoxide lyase (Froehlich et al., 2001).PhCCD1 access to substrates most likely is limited tocarotenoids located in the plastid outer envelope.Significant amounts of b-carotene have been identifiedin the outer envelopes of pea (Pisum sativum; Markwellet al., 1992) and spinach (Spinacia oleracea; Block et al.,1983) chloroplasts. Our results indicate that at leasta certain level of carotenoid substrate must be avail-able to CCD1. The relationship between substrate andenzymes, both inside and outside of the plastid, is animportant and as yet unexplored aspect of the system.

In the context of substrate availability, it is interest-ing to note that within the normal day/night cycle,there is a correlation between mRNA abundance andb-ionone emissions. Peak emissions trail the peak ofgene expression by several hours, presumably due toprotein half-life. We did, however, observe that emis-sions are still rising in the afternoon, when transcriptlevels are decreasing. This suggests that there may besome limitation in substrate availability that changesthroughout the day. It has been shown that carotenoidcontent of tomato leaves remains relatively constantthroughout the day (Simkin et al., 2003b). Assumingthat carotenoid content does not fluctuate substan-tially in petunia tissues, it appears that the steady-statelevel of PhCCD1 is a major but not the only determi-nant of b-ionone emissions. Further evidence support-ing this conclusion is the transient light-inducedincrease in PhCCD1 expression (Fig. 7A) and theconcomitant increase in b-ionone emissions (Fig. 7B).Thus, the regulation of b-ionone synthesis is at least inpart controlled at the level of transcript. This result isconsistent with the observation that emission of meth-ylbenzoate by S-adenosylmethionine:benzoic acid/

salicylic acid carboxyl methyltransferase is also tran-scriptionally regulated (Negre et al., 2003).

In order to understand how changing daily condi-tions influence b-ionone emissions, we studied tran-script levels under different light conditions. Inpetunia leaves and corollas exposed to normal photo-period (without artificial conditions of constant lightor darkness), robust oscillations in the expression ofPhCCD1 were observed. It is interesting to note thatthe period of PhCCD1 expression in corollas was 6 hlonger than in leaves. This difference may be the resultof tissue-specific clocks or due to a tissue-specificresponse to the same clock. In both leaves and corollas,a reduction in transcript was observed prior to theonset of darkness, while an increase was observed justbefore dawn. These rhythms persist in corollas whenplants were transferred to either constant light orconstant darkness. The regulation of PhCCD1 appearsto fit with similar oscillations in the expression ofphytoene desaturase and j-carotene desaturase (genesinvolved in the formation of b-carotene; Simkin et al.,2003b), which were also shown to increase just prior tothe light period in tomato leaves. These oscillationpatterns are indicative of a circadian mechanism. After3 d of constant light, PhCCD1 transcript levels in-creased above the levels associated with a normalphotoperiod in both leaves and corollas. Transcriptlevels were also shown to maintain robust oscillationsin petunia leaves under these conditions. The decreasein transcript levels, in both corollas and leaves, and theresidual oscillations in transcript levels observed inconstant darkness suggest that light is required todrive the accumulation of the transcript and that theoscillator gates the circadian response.

The effect of light on PhCCD1 transcript accumu-lation in both leaves and corollas is complex. Forexample, a 10-min exposure of white light inducesa more than 2-fold increase in PhCCD1 transcript in

Figure 8. Circadian regulation ofPhCCD1 transcript levels andb-ionone emissions in petunia co-rollas.






both leaves and corollas, when given after a 2-d darkperiod. Exposing plants to blue, red, and red/far-redlight sources with equal fluence to that obtained fromthe white light source also led to an increase inPhCCD1 transcript levels, although not to the samelevels as observed with white light. One interpretationis that the white light response involves coactivationof multiple photosensory systems. Furthermore, in-duction of PhCCD1 after red followed by far-redtreatment implies that the induction of PhCCD1 isnot solely due to an acute phytochrome response(Somers et al., 1998; Devlin and Kay, 2000). These data,taken together, show that b-ionone formation is di-urnally regulated directly by light and indirectlythrough light entrainment of the circadian oscillator.

b-Ionone emission increased during the day anddecreased to basal levels at night in petunia corollas.This pattern is somewhat different than emissions ofother volatiles in MD, such as methylbenzoate, benz-aldehyde, benzylbenzoate, phenylacetaldehyde,2-phenylethanol, and isoeugenol (Underwood, 2003;Verdonk et al., 2003). Emissions of these other volatilesincrease prior to the onset of darkness and remainhigh during the night before decreasing to low levelsduring the day. It has been suggested that thisbenzenoid volatile release coincides with the activityof the natural moth pollinators of one of the progen-itors of line MD, Petunia axillaris (Verdonk et al., 2003).Comparable emission patterns are also observed inother moth-pollinated species, such as Nicotiana syl-vestris (Loughrin et al., 1990, 1991; Knudsen andTollsten, 1993; Levin et al., 2001). It is possible thatb-ionone plays a role in attracting day-active insectpollinators, and it has previously been identified as aneffective attractant for some insects (Hammack, 2001).This is further supported by the presence of b-iononein the insect-pollinated progenitor of line MD, Petuniaintegrifolia. However, a link between b-ionone andpetunia pollination remains untested. Also related toinsect attraction, the C14 dialdehyde product of CCD1activity (Fig. 1) is believed to be the precursor ofrosafluene, a highly fluorescent compound found insome varieties of roses (Eugster and Marki-Fischer,1991). Thus, PhCCD1 expression in flowers might

have a double role in terms of both visual andolfactory cues.

Finally, our results indicate that PhCCD1 is presentin all tissues tested, including roots, leaves, andflowers. This pattern of expression may indicate mul-tiple functions for b-ionone in plants. CCD1 proteinscatalyze the symmetric cleavage of multiple linear andcyclic carotenoids at the 9,10(9#,10#) double bonds.This cleavage results in formation of a diverse varietyof C13 cyclohexone apocarotenoids and a C14 dialde-hyde, corresponding to the central portion of theoriginal carotenoid (Schwartz et al., 2001; Simkinet al., 2004). In the case of b-carotene, the C14 dialde-hyde (Fig. 1) is thought to be the precursor of mycor-radicin, a yellow pigment that accumulates in the rootsof plants infected with arbuscular mycorrhizal fungi(Walter et al., 2000). Several C13 cyclohexone deriva-tives have also been identified in the same root tissue(Maier et al., 1995, 1997, 2000; Walter et al., 2000). It hasbeen shown that exogenous application of blumenin,a C13 carotenoid-derived product that also accumu-lates in roots (Maier et al., 1995; Walter et al., 2000),strongly inhibits fungal colonization and arbusculeformation, implying that cyclohexenone derivativesmight act to control fungal growth (Fester et al., 1999).b-Ionone has been shown to inhibit the growth ofthe pathogenic fungi Peronospora tabacina (Schiltz,1974) and Colletotrichum musae (Utama et al., 2002).Also, Mikhlin et al. (1983) reported that b-iononederivatives had antifungal activity against Fusariumsolani, Botrytis cinerea, and Verticillum dahliae. Thus, it ispossible that expression of PhCCD1 in vegetativetissues may have a role in protecting plants fromfungal pathogens. Furthermore, the CCD1 C13 productof zeaxanthin or lutein cleavage, 3-hydroxy-b-ionone,accumulates in etiolated bean seedlings on exposure tolight. It has been suggested that this compoundfunctions in the light-induced inhibition of hypocotylelongation (Kato-Noguchi, 1992; Kato-Noguchi et al.,1993).

In conclusion, we have shown that circadian andlight regulation of PhCCD1 transcript levels integrallycontrol the rhythmic pattern of transcript accumu-

Table II. Primers and probes used in TaqMan real-time quantitativeRT-PCR assay

Primers and probes were designed using PRIMER EXPRESS software(Applied Biosystems).

LeCCD1A Forward TTGATTACCTGCCGCCTTGTReverse CATATAGCTCATTGCAGAAATTCProbea AACCCAGACCTAGACATGGTCAATGGAGC

PhCCD1 Forward TCATATTTCACAACGCCAATGCReverse CGGAAGGCGGCAGGTAAProbea TGGGAGGAGGGAGATGAAGTCGTGTTG

aAll probes were labeled at the 5# with fluorescent reporter dye6-carboxyfluorescein and at the 3# with black hole quencher-1 fromIntegrated DNA Technologies (Coralville, IA).

Table I. Specificity of each set of TaqMan real-time RT-PCRprimers and probes in detecting the related sequence

A total of 100 pg of each in vitro-transcribed mRNA was added perreaction in a pairwise test against each primer probe set. A standardcurve was made from the corresponding messenger. The data representthe equivalent amount of signal produced by 100 pg of each specificgene.

Transcript

LeCCD1A PhCCD1

LeCCD1A 1 ,2 3 1027

PhCCD1 ,6 3 1027 1

Simkin et al.





lation during normal photoperiodic conditions. Theformation of b-ionone is temporally associated withsteady-state PhCCD1 transcript levels. In contrast withmany of the benzenoid volatiles, emission of b-iononeoccurs principally during daylight hours. b-Ionone isknown to be an important contributor to fragrance offlowers of many species, and the manipulation of itsemission is an important step toward modifyingfragrance in ornamentals.

MATERIALS AND METHODS

Plant Material and Treatment

Inbred cv MD petunia [Petunia axillaris 3 (P. axillaris 3 P. integrifolia)]

plants were grown under greenhouse conditions with a day/night temper-

ature regime of 25�C/18�C in commercial potting medium (Fafard 2B; Conrad

Fafard, Agawam, MA) in 15-cm, 1.5-L pots, and were fertilized at each

irrigation with 150 mg L21 nitrogen from 15:7:14.1 soluble fertilizer (Peter’s

Fertilizer Products, Fogelsville, PA). Upon request, all novel materials de-

scribed in this publication will be made available in a timely manner for

noncommercial research purposes.

Gene Isolation and Vector Construction

A partial PhCCD1 clone from positions 376 bp to 1,641 bp (plus poly A tail)

was recovered from a petunia flower cDNA library (Underwood et al., 2004),

using LeCCD1A (AY576001) as a probe. The remaining 5# sequence data was

recovered by 5#RACE-PCR. The full-length cDNA sequence has been de-

posited in GenBank (accession no. AY576003). Transgenic MD plants were

produced using Agrobacterium-mediated transformation of 5-week-old MD

seedlings according to the method of Jorgensen et al. (1996). A full-length

cDNA of LeCCD1Awas introduced into the pDESTOE gateway vector (Booker

et al., 2004) by recombination from the pENTRD vector (Invitrogen, Carlsbad,

CA). The LeCCD1A cDNA was under transcriptional control of the figwort

mosaic virus promoter (Richins et al., 1987) followed by the nos 3# terminator.

Introduction and inheritance of the transgenes were confirmed by PCR using

primers specific for the NPTII marker gene.

Expression and Activity of PhCCD1 in Escherichia coli

The PhCCD1 cDNA from PhCCD1/pENTRD was put into pDEST14

(Invitrogen) by recombination. The plasmid containing the carotenoid bio-

synthetic genes (courtesy of F. Cunningham, University of Maryland) for

b-carotene synthesis was cotransformed with PhCCD1/pDEST14 into the

Ara-inducible E. coli strain BL21-AI (Invitrogen). Enzyme activity was

measured as described by Booker et al. (2004). Briefly, cells were grown in

Luria-Bertani medium with 0.2% Glc at 30�C until time of induction.

Expression of PhCCD1 was induced by the addition of 0.2% Ara when cells

reached an optical density of 0.4. Uninduced and induced 100-mL cultures

were grown for 12 additional hours. Air was bubbled through the culture, and

volatiles were collected onto a SuperQ filter trap. Volatiles were eluted off the

trap with 150 mL of hexane. Volatiles were analyzed as described below.

Injection volume was normalized to the optical density of bacterial culture.

Light Treatments

For light treatments, plants were exposed to various light sources for

10 min. Fluence rates were measured with a LI-COR LI-250 photometer using

a PAR sensor (LI-COR, Lincoln, NE), and light qualities and far-red quantities

were assessed using a StellarNet EPP2000 spectroradiometer (Apogee Instru-

ments, Logan, UT). White light (380 mmol m22 s21) was used as a positive

control. Blue- and red-light fluence rates were estimated to be 100mmol m22 s21.

Plants were then exposed to a blue-light source (100 mmol m22 s21) for 10 min

or a red-light source (200 mmol m22 s21) for 5 min. A third set of plants was

exposed to the same red-light source for 5 min followed by far-red light of a

similar fluence for an additional 5 min. The plants were then returned

to darkness (0.06 mmol m22 s21) along with controls and sampled at 3 h

postexposure. Red and far-red light were generated from a Quantum

Devices (Barneveld, WI) Q-Beam LED array. The emission spectra of

light sources used in these experiments are viewable online at www.

arabidopsisthaliana.com/lightsources.

Extraction of RNA and Real-Time Quantitative RT-PCR

Leaf tissue was taken from newly developing leaves at the growing tip of

the plant every 6 h over a 5-d period. After 2 d, plants were transferred either

to continuous light (380 mmol m22 s21) or dark (0.06 mmol m22 s21) for the

remaining 3 d. Flowers were taken when fully open and roots from plants

shortly after the development of the first flower.

Total RNA was isolated from tissues using the RNeasy plant mini kit

(Qiagen, Valencia, CA). RNA samples were treated with RNase-free DNase

(Qiagen) and purified using Qiagen mini-columns. Samples were checked for

DNA contamination by TaqMan real-time RT-PCR in a reverse-minus tran-

scription reaction. Concentration and purity of total plant RNA was de-

termined by spectrophotometric analysis. The quantification was verified for

all RNA samples in each experiment by formaldehyde agarose gel electro-

phoresis and visual inspection of rRNA bands upon ethidium bromide

staining. To independently quantify mRNAs of PhCCD1 and LeCCD1A,

gene-specific primers and probes were designed and tested for each of the

two transcripts. The cross-specificity of the primers and probes is summarized

in Table I. TaqMan one-step real-time RT-PCR was carried out as recommen-

ded by the manufacturer (Perkin-Elmer Applied Biosystems, Foster City, CA).

All reactions contained 13 TaqMan buffer (Perkin-Elmer), 5 mM MgCl2,

200 mM each of dATP, dCTP, and dGTP, 400 mM dUTP, 0.625 units of AmpliTaq

Gold polymerase, and 0.25 units of MultiScribe RNA reverse transcriptase

and RNase inhibitor in a 25-mL volume. Reverse transcription was carried out

using 250 ng of total RNA, 500 nM of each gene-specific primer, forward and

reverse, and 250 nM TaqMan probe (see Table II). Reaction mixtures were

incubated for 30 min at 48�C for reverse transcription, 10 min at 95�C,

followed by 40 amplification cycles of 15 s at 95�C/1 min at 60�C. Samples

were quantified in the GeneAmp 5700 Sequence Detection system (Perkin-

Elmer). Absolute mRNA levels were quantified against a standard curve of

tritiated in vitro-transcribed sense-strand RNAs.

Volatile Analysis

Four excised flowers were placed into glass vessels and assayed under

normal light conditions or in the dark for dark-collected samples. Volatile

emissions were collected for a period of 1 h in all experiments (Booker et al.,

2004; Simkin et al., 2004; Underwood et al., 2004). Experiments utilized glass

cylinders (17 mm i.d. 3 61 cm long, 127-mL volume), and collection of

volatiles followed Turlings et al. (1991). Briefly, clean humidified air was

passed through the vessels (550 mL min21) and volatiles were trapped on 30

mg of Super Q (80/100 mesh; Alltech, Deerfield, IL). The Super Q traps were

eluted with 150 mL of dichloromethane. A total of 400 ng of nonyl acetate (in 5

mL of dichloromethane) was added to the trap as an internal standard

immediately prior to elution. Quantification of volatiles was performed on an

Agilent (Wilmington, DE) 6890N gas chromatograph as described in Schmelz

et al. (2001). The identification of peaks, including b-ionone, was initially

determined by mass spectrometry of the collected volatiles and subsequently

by coelution with a known standard (Sigma, St. Louis). The presence of

b-ionone in petunia volatiles was confirmed by gas chromatography (GC)-

mass spectrometry on an ion trap mass spectrometer (MAT ITS40; Finnigan,

Austin, TX) interfaced to a gas chromatograph (model 3400; Varian, Sunny-

vale, CA) operated in the electron impact mode as described by Pare and

Tumlinson (1997). Under these conditions, synthetic b-ionone produced the

characteristic mass spectral fragments 177 (100%), 164 (8%), 149 (8%), 135

(10%), 121 (9%), and 43 (95%). With an identical GC retention time, the

b-ionone present in the plant sample produced the same characteristic mass

spectral fragments of 177 (100%), 164 (7%), 149 (10%), 135 (11%), 121 (12%),

and 43 (100%). The parent ion of m/z 5 192 was also detected at trace levels

(1%) in both the synthetic and natural product samples.

Sequence data from this article have been deposited with the EMBL/

GenBank data libraries under accession number AY576003.






ACKNOWLEDGMENTS

We would like to thank Richard Dexter for tissue collection and

RNA extraction, Yec’han Laizet for sequence alignments, and Kevin

Folta for critical reading of the manuscript as well as advice on light

experiments. This is publication R-10461 of the Florida Agricultural Exper-

iment Station.

Received July 13, 2004; returned for revision August 20, 2004; accepted August

20, 2004.

LITERATURE CITED

Baldwin EA, Scott JW, Shewmaker CK, Schuch W (2000) Flavor trivia and

tomato aroma: biochemistry and possible mechanisms for control of

important aroma components. HortScience 35: 1013–1021

Block M, Dorne A-J, Joyard J, Douce R (1983) Preparation and character-

ization of membrane fractions enriched in outer and inner membranes

from spinach chloroplasts. J Biol Chem 258: 13281–13286

Booker J, Auldridge M, Wills S, McCarty D, Klee HJ, Leyser O (2004)

MAX3 is a carotenoid cleavage dioxygenase required for the synthesis of

a novel plant signalling molecule. Curr Biol 14: 1232–1238

Bouvier F, Suire C, Mutterer J, Camara B (2003) Oxidative remodelling of

chromoplast carotenoids: identification of a carotenoid cleavage dioxy-

genase CsCCD and CsZCD genes involved in Crocus secondary meta-

bolic biogenesis. Plant Cell 15: 47–62

Buttery RG, Teranishi R, Ling LC, Turnbaugh JG (1988) Quantitative

studies on origins of fresh tomato aroma volatiles. J Agric Food Chem

36: 1247–1250

Cooper CM, Davies NW, Menary RC (2003) C-27 apocarotenoids in

the flowers of Boronia megastigma (Nees). J Agric Food Chem 51:

2384–2389

Cunningham FX, Pogson B, Sun A, McDonald K, DellaPenna D, Gantt E

(1996) Functional analysis of the b and e lycopene cyclase enzymes of

Arabidopsis reveals a mechanism for control of cyclic carotenoid

formation. Plant Cell 8: 1613–1626

Devlin PF, Kay SA (2000) Cryptochromes are required for phytochrome

signalling to the circadian clock but not for rhythmicity. Plant Cell 12:

2499–2510

Eugster CH, Marki-Fischer E (1991) The chemistry of rose pigments.

Angew Chem Int Ed Engl 30: 654–672

Fester T, Maier W, Strack D (1999) Accumulation of secondary compounds

in barley and wheat roots in response to inoculation with an arbuscular

mycorrhizal fungus and co-inoculation with rhizosphere bacteria.

Mycorrhiza 8: 241–246

Froehlich J, Itoh A, Howe G (2001) Tomato allene oxide synthase and fatty

acid hydroperoxide lyase, two cytochrome P450s involved in oxylipin

metabolism, are targeted to different membranes of chloroplast enve-

lope. Plant Physiol 125: 306–317

Giuliano G, Al-Babili S, von Lintig J (2003) Carotenoid oxygenases: cleave

it or leave it. Trends Plant Sci 8: 145–149

Hammack L (2001) Single and blended maize volatiles as attractants for

diabroticite corn rootworm beetles. J Chem Ecol 27: 1373–1390

Jorgensen RA, Cluster PD, English J, Que QD, Napoli CA (1996) Chalcone

synthase cosuppression phenotypes in petunia flowers: comparison of

sense vs. antisense constructs and single-copy vs. complex T-DNA

sequences. Plant Mol Biol 31: 957–973

Kaiser R, Lamparsky D (1980) Volatile constituents of Osmanthus absolute.

In BD Mookheijee, CJ Mussinan, eds, Essential Oils. Allured Publishing,

Wheaton, IL, pp 159–192

Kato-Noguchi H (1992) An endogenous growth inhibitor, 3-hydroxy-b-

ionone. I. Its role in light-induced growth inhibition of hypocotyls of

Phaseolus vulgaris. Physiol Plant 86: 583–586

Kato-Noguchi H, Kosemura S, Yamamura S, Hasegawa K (1993) A growth

inhibitor, R-(-)-3-hydroxy-b-ionone, from light-grown shoots of a dwarf

cultivar of Phaseolus vulgaris Phytochemistry 33: 553–555

Knudsen JT, Tollsten L (1993) Trends in floral scent chemistry in pollina-

tion syndromes: floral scent composition in moth-pollinated taxa. Bot J

Linn Soc 113: 263–284

Kolosova N, Gorenstein N, Kish CM, Dudareva N (2001) Regulation of

circadian methyl benzoate emission in diurnally and nocturnally

emitting plants. Plant Cell 13: 2333–2347

Levin RA, Raguso RA, McDade LA (2001) Fragrance chemistry and

pollinator affinities in Nyctaginaceae. Phytochemistry 58: 429–440

Loughrin JH, Hamilton-Kemp TR, Andersen RA, Hildebrand DF (1990)

Volatiles from flowers of Nicotiana sylvestris, N. otophora and Malus3

domestica: headspace components and day/night changes in their rela-

tive concentrations. Phytochemistry 29: 2473–2477

Loughrin JH, Hamilton-Kemp TR, Andersen RA, Hildebrand DF (1991)

Circadian-rhythm of volatile emission from flowers of Nicotiana sylvest-

ris and N. suaveolens. Physiol Plant 83: 492–496

MaierW, Peipp H, Schmidt J, Wray V, Strack D (1995) Levels of a terpenoid

glycoside (Blumenin) and cell wall-bound phenolics in some cereal

mycorrhizas. Plant Physiol 109: 465–470

Maier W, Hammer K, Dammann U, Schulz B, Strack D (1997) Accumu-

lation of sesquiterpenoid cyclohexenone derivatives induced by an

arbuscular mycorrhizal fungus in members of the Poaceae. Planta 202:

36–42

Maier W, Schmidt J, Nimtz M, Wray V, Strack D (2000) Secondary

products of mycorrhizal roots of tobacco and tomato. Phytochemistry

54: 473–479

Markwell J, Bruce B, Keegstra K (1992) Isolation of a carotenoid-

containing sub-membrane particle from the chloroplastic envelope

outer membrane of pea (Pisum sativum). J Biol Chem 267: 13933–13937

Mikhlin ED, Radina VP, Dmitrovskii AA, Blinkova LP, Butova LG (1983)

Antifungal and antimicrobic activity of b-ionone and vitamin A deriv-

atives (in Russian). Prikl Biokhim Mikrobiol 19: 795–803

Negre F, Kish C, Boatright J, Underwood B, ShibuyaK,Wagner C, ClarkD,

Dudareva N (2003) Regulation of methylbenzoate emission after polli-

nation in snapdragon and petunia flowers. Plant Cell 15: 2992–3006

Neill SJ, Burnett EC, Desikan R, Hancock JT (1998) Cloning of a wilt-

responsive cDNA from Arabidopsis thaliana suspension culture cDNA

library that encodes a putative 9-cis-epoxy-carotenoid dioxygenase.

J Exp Bot 49: 1893–1894

Pare PW, Tumlinson JH (1997) De novo biosynthesis of volatiles induced

by insect herbivory in cotton plants. Plant Physiol 114: 1161–1167

Pott MB, Effmert U, Piechulla B (2003) Transcriptional and post-

translational regulation of S-adenosyl-L-methionine: salicylic acid car-

boxyl methyltransferase (SAMT) during Stephanotis floribunda flower

development. J Plant Physiol 160: 635–643

Richins RD, Scholthof HB, Shepard RJ (1987) Sequence of the figwort

mosaic virus DNA (caulimovirus group). Nucleic Acids Res 15:

8451–8466

Schiltz P (1974) Action inhibitrice de la b-ionone au cours du developpe-

ment de Peronospora tabacina. Ann Tabac 11: 207–216

Schmelz EA, AlbornHT, Tumlinson JH (2001) The influence of intact-plant

and excised-leaf bioassay designs on volicitin- and jasmonic acid-

induced sesquiterpene volatile release in Zea mays. Planta 214: 171–179

Schwartz SH, Tan BC, Gage DA, Zeevaart JAD, McCarty DR (1997)

Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276:

1872–1874

Schwartz SH, Qin X, Zeevaart JAD (2001) Characterization of a novel

carotenoid cleavage dioxygenase from plants. J Biol Chem 276: 25208–

25211

Simkin AJ, Changfu Z, Kuntz M, Sandmann G (2003a) Light-dark

regulation of carotenoid biosynthesis in pepper (Capsicum annuum)

leaves. J Plant Physiol 160: 439–443

Simkin AJ, Laboure AM, Kuntz M, Sandmann G (2003b) Modulation of

carotenoid biosynthesis in tomato leaves upon light-dark transition.

Z Naturforsch [C] 58c: 371–380

Simkin AJ, Schwartz SH, Auldridge M, Taylor MG, Klee HJ (2004) The

tomato CCD1 (CAROTENOID CLEAVAGE DIOXYGENASE 1) genes

contribute to the formation of the flavor volatiles b-ionone, pseudo-

ionone and geranylacetone. Plant J (in press)

Somers DE, Devlin PF, Kay SA (1998) Phytochromes and cryptochromes

in the entrainment of the Arabidopsis circadian clock. Science 282:

1488–1490

Tan BC, Joseph LM, Deng WT, Liu L, Li QB, Cline K, McCarty DR (2003)

Molecular characterisation of the 9-cis epoxycarotenoid dioxygenase

gene family. Plant J 35: 44–56

Tan BC, Schwartz S, Zeevaart JAD, McCarty DR (1997) Genetic control of

abscisic acid biosynthesis in maize. Proc Natl Acad Sci USA 94: 12235–

12240

Simkin et al.





Turlings TCJ, Tumlinson JH, Heath RR, Proveaux AT, Doolittle RE (1991)

Isolation and identification of allelochemicals that attract the larval

parasitoid, Cotesia marginiventris (Cresson) to the microhabitat of one of

its hosts. J Chem Ecol 17: 2235–2251

Underwood BA (2003) Effects of ethylene on floral fragrance in Petunia x

hybrida Mitchell Diploid. PhD dissertation, University of Florida,

Gainesville, FL

Underwood BA, Tieman DM, Shibuya K, Loucas HM, Dexter RJ, Schmelz

EA, Simkin AJ, Klee HJ, Clark DG (2004) Ethylene-regulated floral

volatile synthesis in petunia corollas. Plant Physiol (in press)

Utama IM, Wills RB, Ben-Yehoshua S, Kuek C (2002) In vitro efficacy of

plant volatiles for inhibiting the growth of fruit and vegetable decay

microorganisms. J Agric Food Chem 50: 6371–6377

Verdonk JC, Ric de Vos CH, Verhoeven HA, Haring MA, van Tunen AJ,

Schuurink RC (2003) Regulation of floral scent production in petunia

revealed by targeted metabolomics. Phytochemistry 62: 997–1008

Wache Y, Bosser-DeRatuld A, Lhuguenot JC, Belin JM (2003) Effect of cis/

trans isomerism of beta-carotene on the ratios of volatile compounds

produced during oxidative degradation. J Agric Food Chem 51:

1984–1987

Walhberg I, Eklund A (1998) Degraded carotenoids. In G Britton, S Liaaen-

Jensen, H Pfander, eds, Carotenoids. Birkhauser Verlag, Boston

Walter MH, Fester T, Strack D (2000) Arbuscular mycorrhizal fungi induce

the nonmevalonate methylerythritol phosphate pathway of isoprenoid

biosynthesis correlated with accumulation of the ‘‘yellow pigment’’ and

other apocarotenoids. Plant J 21: 571–578

Winterhalter P, Rouseff R (2002) Carotenoid-derived aroma compounds.

American Chemical Society, Washington, DC






Documents

Circadian Regulation of the PhCCD1 Carotenoid Cleavage Dioxygenase Controls Emission of Ionone, a Fragrance Volatile of Petunia Flowers