ORIGINAL ARTICLE

Characterization of the glyoxalase 1 gene TcGLX1 in the metalhyperaccumulator plant Thlaspi caerulescens

Marjo Tuomainen • Viivi Ahonen • Sirpa O. Karenlampi • Henk Schat •

Tanja Paasela • Algirdas Svanys • Saara Tuohimetsa • Sirpa Peraniemi •

Arja Tervahauta

Received: 8 November 2010 / Accepted: 24 January 2011 / Published online: 15 February 2011

� Springer-Verlag 2011

Abstract Stress tolerance is currently one of the major

research topics in plant biology because of the challenges

posed by changing climate and increasing demand to grow

crop plants in marginal soils. Increased Zn tolerance and

accumulation has been reported in tobacco expressing the

glyoxalase 1-encoding gene from Brassica juncea. Previ-

ous studies in our laboratory showed some Zn tolerance-

correlated differences in the levels of glyoxalase 1-like

protein among accessions of Zn hyperaccumulator Thlaspi

caerulescens. We have now isolated the corresponding

gene (named here TcGLX1), including ca. 570 bp of core

and proximal promoter region. The predicted protein con-

tains three glyoxalase 1 motifs and several putative sites for

post-translational modification. In silico analysis predicted

a number of cis-acting elements related to stress. The

expression of TcGLX1 was not responsive to Zn. There was

no correlation between the levels of TcGLX1 expression

and the degrees of Zn tolerance or accumulation among

T. caerulescens accessions nor was there co-segregation of

TcGLX1 expression with Zn tolerance or Zn accumulation

among F3 lines derived from crosses between plants from

accessions with contrasting phenotypes for these proper-

ties. No phenotype was observed in an A. thaliana T-DNA

insertion line for the closest A. thaliana homolog of

TcGLX1, ATGLX1. These results suggest that glyoxalase 1

or at least the particular isoform studied here is not a major

determinant of Zn tolerance in the Zn hyperaccumulator

plant T. caerulescens. In addition, ATGLX1 is not essential

for normal Zn tolerance in the non-tolerant, non-accumu-

lator plant A. thaliana. Possible explanations for the

apparent discrepancy between this and previous studies are

discussed.

Keywords Glyoxalase 1 � In silico analysis � Promoter �Thlaspi � Tolerance � Zn

Abbreviations

ABA Abscisic acid

GA Gibberellic acid

GLX1 Glyoxalase 1

GLX2 Glyoxalase 2

PCR Polymerase chain reaction

Q-PCR Quantitative polymerase chain reaction

TAIL-PCR Thermal asymmetric interlaced polymerase

chain reaction

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00425-011-1370-7) contains supplementarymaterial, which is available to authorized users.

M. Tuomainen (&) � V. Ahonen � S. O. Karenlampi �T. Paasela � A. Svanys � S. Tuohimetsa � S. Peraniemi �A. Tervahauta

Department of Biosciences, University of Eastern Finland,

Kuopio Campus, P.O. Box 1627, 70211 Kuopio, Finland

e-mail: marjo.tuomainen@uef.fi

H. Schat

Genetics, Faculty of Earth and Life Sciences,

Vrije Universiteit Amsterdam, De Boelelaan 1085,

1081 HV Amsterdam, The Netherlands

Present Address:T. Paasela

Department of Agricultural Sciences,

University of Helsinki, 00014 Helsingin yliopisto, Finland

Present Address:S. Tuohimetsa

Vattulantie 26, 41180 Vehnia, Finland

Present Address:A. Svanys

Coastal Research and Planning Institute, Klaipeda University,

H. Manto 84, 92294 Klaipeda, Lithuania

123

Planta (2011) 233:1173–1184

DOI 10.1007/s00425-011-1370-7

Introduction

The glyoxalase pathway is composed of two metallo-

enzymes, i.e. glyoxalase 1 (GLX1; lactoylglutathione

lyase) and glyoxalase 2 (GLX2). The enzymes convert

2-oxoaldehydes into the corresponding 2-hydroxyacids.

Methylglyoxal is the main substrate, although, e.g. glyoxal

and other acyclic a-oxoaldehydes can also serve as sub-

strates (Thornalley 1993). Methylglyoxal first reacts

spontaneously with glutathione to form hemithioacetal,

which is then converted to S-D lactoylglutathione by

GLX1. Subsequently GLX2 releases D-lactic acid and

glutathione from S-D lactoylglutathione.

The toxic metabolite methylglyoxal is a product of car-

bohydrate, lipid and amino acid (threonine, glycine) metab-

olism (reviewed by Kalapos 2008). It reacts with cellular

macromolecules (DNA, proteins) to form advanced glycation

products and thereby affects the function of these molecules

(Fleming et al. 2008; reviewed by Kalapos 2008; reviewed by

Rabbani and Thornalley 2008). Methylglyoxal may also be

involved in the generation of free radicals (reviewed by

Kalapos 2008) and in cell signaling (Maeta et al. 2005).

The function of the glyoxalase pathway has been studied

extensively in animals, primarily because of its putative

association with clinical disorders, such as cancer and

diabetes (reviewed by Thornalley 2003; reviewed by Price

and Knight 2009). In plants GLX1 has been characterized

in a number of monocot and dicot plants, including Bras-

sica juncea (Veena et al. 1999), Lycopersicon esculentum

(Espartero et al. 1995), Oryza sativa (Usui et al. 2001),

Triticum aestivum (Lin et al. 2010), Brassica oleracea

(Clugston et al. 1998) and some others (Skipsey et al. 2000;

Chen et al. 2004; Hossain and Fujita 2009; Hossain et al.

2009). Glyoxalase activity correlates with cell proliferation

(Paulus et al. 1993; Jain et al. 2002). Elevated levels of

methylglyoxal have been linked also to various abiotic

stresses (Yadav et al. 2005a, b; Singla-Pareek et al. 2006;

Hossain et al. 2009). GLX1 is up-regulated in response to

water and salt stress, heavy metals, pathogen attack or

abscisic acid (Espartero et al. 1995; Veena et al. 1999;

Fujita et al. 2004; Singla-Pareek et al. 2006; Hossain et al.

2009; Lin et al. 2010).

Whilst there is experimental evidence for the up-regu-

lation of GLX1 by various external and internal factors, not

much is known about the regulatory region of this gene.

Furthermore, there appears to be contradictory information

concerning the role of GLX1 in Zn tolerance (Singla-

Pareek et al. 2006; Lin et al. 2010; Tuomainen et al. 2010).

Together with improved Zn tolerance, enhanced Zn accu-

mulation (Singla-Pareek et al. 2006) because of boosting

the glyoxalase pathway would have important practical

implications, and the general validity of these findings in

an independent experimental system is therefore crucial.

In the present study, GLX1 was characterized in several

accessions and crosses of the naturally Zn-tolerant Zn

hyperaccumulator plant Thlaspi caerulescens with con-

trasting Zn tolerance and accumulation capacities (Baker

and Brooks 1998; Assuncao et al. 2003a). The GLX1 genes,

including core and proximal promoter regions were iso-

lated from three T. caerulescens accessions (La Calamine,

LC; Lellingen, LE; St Laurent le Minier, LM) and com-

pared in silico with their closest homolog in the related,

non-Zn-tolerant, non-Zn-accumulator plant Arabidopsis

thaliana. Expression of the gene was analyzed in the

presence and absence of Zn excess. Zn tolerance and

accumulation was studied in an A. thaliana T-DNA inser-

tion line for ATGLX1. These studies gave insight into the

putative cis-acting elements that regulate the expression of

GLX1. The role of GLX1 in Zn tolerance or accumulation

could not be confirmed either in the Zn-tolerant Zn

hyperaccumulator, or in the non-tolerant non-accumulator

species.

Materials and methods

Plant material

We used Thlaspi caerulescens from the accessions La

Calamine (LC), Lellingen (LE) and St Laurent le Minier

(LM, also known as ‘Ganges’), which have been demon-

strated to possess different metal uptake, root-to-shoot

translocation and tolerance traits (Assuncao et al. 2003a).

The LC accession originates from an area near La Cala-

mine, Belgium, from a soil contaminated with calamine ore

waste (Zn, Cd and Pb) (Assuncao et al. 2003a). The

accession St Laurent le Minier (LM) originates from cal-

amine soil in France (Zhao et al. 2002), and accession LE

from a non-metalliferous soil near Lellingen, Luxembourg

(Meerts and Van Isacker 1997). One low- and four high-

Zn-tolerant F3 lines derived from a single F1 LC 9 LE

cross through selfing (Assuncao et al. 2003b), and five low-

and five high-Zn-accumulating F3 lines of the LC 9 LM

cross (Deniau et al. 2006) were studied. The F3 lines from

the LC 9 LE cross were also characterized for Zn accu-

mulation (Assuncao et al. 2003b). For mRNA analyses, the

plants were grown as described by Assuncao et al. (2003a).

The plants were exposed to 0, 10, 100, and 1000 lM

ZnSO4 for 1 week, after which the shoots and roots were

separately collected, frozen in liquid nitrogen, and stored at

-75�C. Plants for the isolation of genomic GLX1 homo-

logues were grown in moist peat. The shoots were frozen in

liquid nitrogen and stored at -75�C. An Arabidopsis tha-

liana T-DNA insertion line for ATGLX1, locus At1g11840,

(SALK_103699.45.30.x) was obtained from the European

Arabidopsis Stock Centre (NASC; Alonso et al. 2003).

1174 Planta (2011) 233:1173–1184

123

To analyze ATGLX1 mRNA levels in the T-DNA insertion

line, the plants were grown in moist peat and the shoots

were frozen in liquid nitrogen and stored at -75�C.

Cloning and sequencing of T. caerulescens glyoxalase 1,

TcGLX1

DNA was extracted with an DNeasy� plant Mini Kit

(Qiagen) and stored at -20�C. To clone the GLX1 homolog

from the T. caerulescens accessions, a combination of

conventional PCR and TAIL-PCR was used (all primers

are listed in Table 1; Supplemental Fig. S1). In conven-

tional PCR of the central region of the gene, primers spe-

cific for GLX1 of Arabidopsis thaliana (ATGLX1; locus

At1g11840) were used. The coding 30 end of TcGLX1 (T.

caerulescens GLX1) was amplified using a primer specific

for the putative translation termination site of ATGLX1

(At1g11840.1) and a Q-PCR primer of TcGLX1 (TcGLX_

QPCR_F). To clone the non-coding 50 end of TcGLX1,

TAIL-PCR was used (Liu and Whittier 1995; Amedeo

et al. 2000; Hanhineva and Karenlampi 2007). For this,

T. caerulescens-specific primers (three) and arbitrary

primers (two) were used (Table 1). The primer concen-

trations in all TAIL-PCRs were 0.6 and 1.3 pmol/l for the

specific and arbitrary primers, respectively. The primary

TAIL-PCR reactions contained ca. 20 ng of genomic DNA.

For the secondary and tertiary reactions, 1 ll aliquots of the

primary or secondary PCR products were diluted in 100 ll

of water. The amplification program is shown in Table 2.

The PCR/TAIL-PCR reactions (25 ll) were carried out

with Go Taq� Green Master Mix (Promega) according to

manufacturer’s instructions. The genomic region of

TcGLX1 from the three T. caerulescens accessions was

amplified with primers specific for TcGLX1 and the putative

translation termination site of ATGLX1(At1g11840.1). For

the amplification of TcGLX1 cDNA, shoot samples from

the expression studies (see below), primers specific for the

putative translation initiation site of TcGLX1 and the

Table 1 Primers used for PCR, Q-PCR and TAIL-PCR

Purpose Primer Primer sequence (50 ? 30) Description

Cloning of TcGLX1 GLXR CATCTGGATCAAGGAATGAGA Amplification of central part of

TcGLX1GLXF TCCAAACTGGTTGAGAACGT

At1g11840/RP TCATTCCAGTTCCTTGAGAAA Amplification of TcGLX1 genomic

and cDNA sequences, 30 primer

TcGLX_genom1 GGTCCCTTCCTTGGTTAGTA Amplification of TcGLX1 genomic

sequences, 50 primer

TcGLX_cDNA1 ATGGCAGAAGCTTCA Amplification of TcGLX1 cDNA

sequences, 50 primer

TcGLX_TAIL_1 CACGAGTACTTCACCTTGTA TAIL-PCR, primary amplification,

TcGLX1-specific

TcGLX_TAIL_2 AGGACAACCTTTACCTTTTC TAIL-PCR, secondary amplification,

TcGLX1-specific

TcGLX_TAIL_3 ATGAGCTCAAAAGCGTAAC TAIL-PCR, tertiary amplification,

TcGLX1-specific

AD3 WGTGNAGWANCANAGAa

(Hanhineva and Karenlampi 2007)

TAIL-PCR, arbitrary primer

AD5 AWGCANGNCWGANATAa

(Amedeo et al. 2000;

Hanhineva and Karenlampi 2007)

TAIL-PCR, arbitrary primer

Characterization of A. thalianaT-DNA insertion line for ATGLX1

LBb1 GCGTGGACCGCTTGCTGCAACT T-DNA-specific primer

N603699_RP CCCAAAGCCAGTTCCAATATC ATGLX1-specific primer

N603699_LP ACCGTACATCTTCTTCCCAGG ATGLX1-specific primer

Q-PCR of ATGLX1 ATGLX1_FP CCCTGATGGCTACACTTTTGAG ATGLX1-specific primer

ATGLX1_RP TGCCCTTTGTGTACTCAGTCA ATGLX1-specific primer

AtTubq_F CAGGTCTCTACCTCCGTTGTTG TUA4-specific primer

AtTubq_R GGACCAAGTTGGTTTGGAACTC TUA4-specific primer

Q-PCR of TcGLX1 TcGLX_QPCR_F GGTGGAAGCAGTGTCATTGC TcGLX1-specific primer

TcGLX_QPCR_R TGCATTGCCCTTTGTGTACTC TcGLX1-specific primer

TcTub_F CCTACGCACCAGTCATCTCT TcTUB-specific primer

TcTub_R CGAGATCACCTCCTGGAACA TcTUB-specific primer

a IUPAC-IUP codes for the wobble bases: W = A or T, N = G or A or T or C

Planta (2011) 233:1173–1184 1175

123

termination site of ATGLX1, were used. The reaction mix-

ture contained Phusion High Fidelity DNA polymerase

(Fermentas), and the standard procedure was applied. For

sequencing, all the TAIL-PCR and PCR products were

cloned in the pJET cloning vector (Fermentas).

Analysis of nucleotide and deduced protein sequences

of TcGLX1

The nucleotide and deduced protein sequences were sub-

jected to homology searches using databases in the National

Center for Biotechnology Information (NCBI, http://www.

ncbi.nlm.nih.gov/) and in The Arabidopsis Information

Resource (TAIR, http://www.arabidopsis.org/). For pro-

moter analysis, Plant Promoter Analysis Navigator (Plant-

PAN, http://plantpan.mbc.nctu.edu.tw/; Chang et al. 2008)

was used. For multiple alignment and secondary structure

analysis of the protein sequences, PRALINE multiple

sequence alignment tool (Centre for Integrative Bioinfor-

matics VU, http://www.ibi.vu.nl/) and for nucleotide

sequences ClustalW2 (http://www.ebi.ac.uk/Tools/clustalw2/)

were used. Similarities of the aligned sequences were ana-

lyzed with ClustalW2. For the analysis of pI and molecular

weight, the Expert Protein Analysis System (ExPASy) pro-

teomics server of the Swiss Institute of Bioinformatics

(http://au.expasy.org/tools/pi_tool.html) and for the analysis of

functional motifs of the deduced peptide sequences Prosite

PPSearch—Protein motifs Search (http://www.ebi.ac.uk/

Tools/ppsearch/), available at EBI-EMBL, were used.

Expression of TcGLX1

The samples consisted of shoots or roots pooled from three

plants. RNA was extracted using the RNeasy extraction kit

with DNase I on-column digestion (Qiagen). The cDNA

was synthesized from 1 lg of total RNA with DyNAmo 2

step SYBR Green qPCR kit (Finnzymes) and an oligo(dT)

primer. Q-PCR runs were performed using Dynamo HS

SYBR Green kit (Finnzymes) in 20 ll of reaction volume

with 0.5 lM gene-specific primers (Table 1) and 5 ll of

diluted cDNA. Tubulin gene of T. caerulescens (TcTUB), a

homologue to A. thaliana alpha tubulin-encoding gene

(TUA4, At1g04820), was used as a reference. There was

one nucleotide mismatch between one TcGLX–primer

sequence (TcGLX_QPCR_F) and the homolog of the LM

accession (Supplemental Fig. S1). The reactions were

performed in triplicate using iCycler iQ Real-time PCR

(Bio-Rad). The PCR program was 95�C for 15 min, fol-

lowed by 35 cycles of 95�C for 15 s, 58�C for 20 s, and

72�C for 20 s. After the final annealing (72�C, 5 min) and

re-denaturation (95�C, 1 min), a melt curve analysis was

performed by decreasing the temperature from 95 to 66�C

at 0.5�C intervals. Change in gene expression was calcu-

lated using the comparative DCt method (Livak and

Schmittgen 2001). Statistical analyses were performed with

Linear Mixed Model ANOVA (SPSS 14.0).

Characterization of an A. thaliana T-DNA insertion line

for ATGLX1

Homozygosity with respect to the given insertion site of the

A. thaliana T-DNA insertion line for ATGLX1 (SALK_

103699.45.30.x) was verified with PCR using the standard

procedure of the Salk Institute Genomic Analysis Laboratory

(SIGnAL; http://signal.salk.edu/cgi-bin/tdnaexpress). DNA

was extracted according to Edwards et al. (1991). For PCR,

one T-DNA-specific primer and two ATGLX1-specific

primers (Table 1) were used. The left border of the

T-DNA insert was verified by cloning the PCR product

into the pDrive cloning vector (Qiagen). For expression

Table 2 Amplification

program for TAIL-PCRPrimary TAIL-PCR Secondary and tertiary TAIL-PCR

Step Number

of repeats

Thermal condition Number

of repeats

Thermal condition

1 1 95�C 3 min 1 95�C 2 min

2 5 95�C 20 s, 51�C 1 min, 72�C 2.5 min 11 95�C 15 s, 52�C 1 min, 72�C 2 min

95�C 15 s, 52�C 1 min, 72�C 2 min

95�C 15 s, 45�C 1 min, 72�C 2 min

3 1 95�C 30 s, 25�C 3 min, ramping to

72�C over 3 min, 72�C 2.5 min

1 72�C 5 min

4 5 95�C 20 s, 40�C 1 min, 72�C 2.5 min

5 15 95�C 20 s, 51�C 1 min, 72�C 2.5 min

95�C 20 s, 51�C 1 min, 72�C 2.5 min

95�C 20 s, 40�C 1 min, 72�C 2.5 min

6 1 72�C 5 min

1176 Planta (2011) 233:1173–1184

123

analysis, Q-PCR was used. RNA extraction, cDNA syn-

thesis and Q-PCR were carried out as described above,

with the following exceptions: the annealing temperature

in PCR was set at 57�C, and 0.5 lM A. thaliana ATGLX1-

specific and TUA4 (At1g04820)-specific primers (Table 1)

were used.

Zinc tolerance and accumulation of an A. thaliana

T-DNA insertion line for ATGLX1

Seeds of an A. thaliana T-DNA insertion line for ATGLX1

and wild-type A. thaliana plants (Col-0, N60000, European

Arabidopsis Stock Centre, NASC) were sterilized and sown

on 0.59 MS agar plates supplemented with 0, 200, 300,

400 or 500 lM ZnSO4. The plates were incubated hori-

zontally at 4�C in dark for 1 day and then turned into

vertical position after 2 days of growth at 22�C with light/

dark cycle of 16 h/8 h. Root length was measured using

ImageJ software (Rasband, W.S., ImageJ, US National

Institutes of Health, Bethesda, Maryland, USA, http://rsb.

info.nih.gov/ij/ 1997–2009) after 11 days of growth. For

the analysis of Zn uptake, seeds of A. thaliana wild type

and T-DNA insertion line were sown in a peat/soil/perlite/

sand mixture (20/20/30/30, by vol). 3-week-old seedlings

were transferred to 10 L of modified half-strength Hoa-

gland solution [Schat et al. 1996; 3 mM KNO3, 2 mM

Ca(NO3)2, 1 mM NH4H2PO4, 0.5 mM MgSO4, 1 lM KCl,

25 lM H3BO3, 2 lM ZnSO4, 2 lM MnSO4, 0.1 lM

CuSO4, 0.1 lM (NH4)6Mo7O24, 20 lM Fe(Na)EDTA,

2 mM Mes]. The pH was set to 5.5 using KOH. After

2 weeks, the plants were transferred for one week to the

same nutrient solution (control) or to a similar solution

supplemented with 10, 25, or 100 lM ZnSO4. The solu-

tions were aerated continuously and changed twice a week

except during the last week when the solution was chan-

ged once. The hydroponic culture was performed in a

climate chamber with 20/15�C (day/night), 65% relative

humidity, 150 lmol m-1 2 s-1 light 12 h/day. After

growth, the roots were desorbed with ice-cold 5 mM

PbNO3 for 1 h. After washing with water, the shoot and

root samples were dried at 65�C for 40 h. The samples

were decomposed with suprapur HNO3 by microwave

digestion, and the Cd and Zn contents were analyzed

using a flame atomic absorption spectrophotometer

(Perkin Elmer AAS 5100). Statistical analyses of root

lengths and metal contents were performed with two-way

ANOVA (SPSS 14.0).

Results

Comparison of GLX1 nucleotide and derived protein

sequences of T. caerulescens and A. thaliana

The close relatedness between T. caerulescens and

A. thaliana (87–88% identity in coding regions; Rigola

et al. 2006) facilitated similarity based isolation of the

genomic sequence of GLX1 in T. caerulescens, named here

as TcGLX1. Using a combination of conventional PCR and

TAIL-PCR, a genomic region of ca. 2,130 bp was retrieved

from all three T. caerulescens accessions (LC, LE, LM).

Based on the predicted translation initiation and termina-

tion sites in ATGLX1 and cloning of TcGLX1 cDNA, the

genomic sequences were concluded to contain 858 bp

coding region and ca. 560–570 bp of the 50 untranslated

region (Supplemental Fig. S1). The exon–intron structure

was rather similar to that in four ATGLX1 splicing variants

At1g11840.1–4 (Fig. 1; Supplemental Fig. S1).

The deduced TcGLX1 polypeptides (285 amino acids)

gave molecular masses (MW) of ca. 32 kDa and isoelectric

points (pI) of 5.7 for LC and LE and 6.1 for LM. These values

corresponded to those expected based on two-dimensional

electrophoresis (2-DE) of the proteins isolated from the

T. caerulescens accessions LC and LE (Tuomainen et al.

2006, 2010). The TcGLX1 sequences in the three accessions

differed only in five amino acids (1.8 %). An in silico

analysis of the deduced polypeptide sequences with PRO-

SITE pattern search revealed two glyoxalase I-1 motifs and

one glyoxalase I-2 motif for both ATGLX1 and TcGLX1

(Fig. 2; Supplemental Fig. S2). All TcGLX1 sequences

showed high level of identity with some other GLX1

sequences (Supplemental Fig. S2): 92% with Brassica rapa

(NCBI Protein database ID: 157890952), 90–91% with

A. thaliana ATGLX1 (At1g11840.1), 77 % with another

A. thaliana glyoxalase 1 paralog (At1g67280.2), 74% with

Triticum aestivum TaGly I (Lin et al. 2010) and 22–23% with

B. juncea Gly I (NCBI Protein database ID: 3334244). Based

on the length of the polypeptide sequence and similarity to

the previously published ones, TcGLX1 was classified as

long glyoxalase 1 protein (Johansen et al. 2000).

Putative regulatory sequences in the core and proximal

promoter regions of T. caerulescens TcGLX1 and A. tha-

liana ATGLX1 (At1g11840.1) were predicted with Plant-

PAN (Chang et al. 2008). The promoter region of ATGLX1

(570 bp) retrieved from TAIR (The Arabidopsis Informa-

tion Resource; http://www.arabidopsis.org/) was rather

TcGLX1

ATGLX1

100 bp

Fig. 1 Exon–intron structure of

TcGLX1 and ATGLX1

(At1g11840.1)-encoding genes.

Exons are indicated as greyboxes

Planta (2011) 233:1173–1184 1177

123

different (ca. 30% identity; Supplemental Fig. S1) from

that of TcGLX1 (LC, 564 bp; LE, 571 bp; LM, 561 bp).

However, common cis-acting regulatory elements were

predicted (Fig. 3; Table 3, Supplemental Table S1), e.g.

regions related to light response, cytokinin regulation,

gibberellic acid (GA) response, and to stresses such as salt,

pathogen, dehydration and cold. Regions found only in

ATGLX1 were, e.g. elements related to sulphur response

and salicylic acid signaling. Promoter elements that were

found in TcGLX1 of all T. caerulescens accessions but

were missing from ATGLX1 included, e.g. recognition site

for a MYB/MYC transcription factor related to drought and

abscisic acid (ABA) signaling.

Expression of TcGLX1 in T. caerulescens accessions

and inter-accession crosses

For the expression analysis, TcGLX1 cDNAs were isolated

from the T. caerulescens accessions LE, LC and LM based

on similarity to ATGLX1 (Supplemental Fig. S1). In the

shoots, the expression of TcGLX1 was ca. 2-times higher

(significant with P \ 0.05) in the LM accession (high Zn

tolerance, high Zn accumulation) compared to the LC

accession (high Zn tolerance, low Zn accumulation) and

the LE accession (low Zn tolerance, high Zn accumulation)

(Fig. 4a). In the roots, the mRNA level in the LM accession

was only slightly and not significantly higher (P [ 0.05)

than that in the LC accession and about the same as in the

LE accession (Fig. 4b). Small but significant differences

were found in the LC x LM cross-derived lines (P \ 0.05):

the low-Zn-accumulator lines had higher TcGLX1 expres-

sion in the shoots but lower in the roots compared with the

high-Zn-accumulator lines (Fig. 4c, d). No significant

differences (P [ 0.05) in TcGLX1 expression were found

between the LC 9 LE cross-derived lines that differed

in their Zn tolerance and accumulation (Fig. 4e). There

was no consistent up-regulation of TcGLX1 expression

by Zn.

T. aestivum

ATGLX1

TcGLX1

At1g67280.2

B. juncea

20 aa

1

1

Fig. 2 Structures of glyoxalase 1 proteins. Shown are the sequences

of T. caerulescens TcGLX1, A. thaliana ATGLX1 (At1g11840.1),

A. thaliana At1g67280.2, T. aestivum TaGly I (Lin et al. 2010) and

B. juncea Gly I (NCBI Protein database ID:3334244). Predicted

glyoxalase I-1 motifs are illustrated as white ellipses and glyoxalase

I-2 motifs as grey ellipses (Prosite PPSearch-Protein motifs Search,

http://www.ebi.ac.uk/Tools/ppsearch). Putative Zn and glutathione

binding sites (Johansen et al. 2000) are indicated as black and whitetriangles, respectively

a

b

Anaeroby

Sulphur

ATG

-500 -400 -300 -200 -100

Myb/Myc;ABA, drought

Cell cycle

LightSalt, pathogen

Ethylene

AnaerobyFlower

Myb;GA

CircadianEmbryo, ABA

FlowerMyb;GA EthyleneSugar

ATG

-500 -400 -300 -200 -100

Cell cycle

Flower

Myb;GA

Ethylene

CytokininCytokinin

Flower

Cytokinin

CytokininGA

Salt, pathogen

Light

Cell proliferation

GA, sugar

Ethylene

Ethylene

Fig. 3 Some predicted regulatory elements in the promoter regions

of T. caerulescens TcGLX1 (a) and A. thaliana ATGLX1 (b) (Table 3;

Supplemental Table S1). The locations of the elements correspond to

those in the accession LC. ATG transcription start codon. GAgibberellic acid. ABA abscisic acid. Grey arrow T-DNA insertion site

1178 Planta (2011) 233:1173–1184

123

Comparison of A. thaliana wild-type and a T-DNA

insertion line for ATGLX1

A. thaliana wild-type and a T-DNA insertion line for

ATGLX1, were compared for Zn tolerance and uptake.

Re-sequencing of the insertion site showed that, unlike

initially indicated, the T-DNA insert was in the 50 region of

ATGLX1 gene ca. 140 bp upstream of the putative trans-

lation initiation codon (Fig. 3) with ca. 30 bp of nonsense

sequence in the 30 flank. Q-PCR analysis indicated that the

Table 3 Putative cis-acting elements in the promoter regions of TcGLX1 in T. caerulescens accessions LC (564 nt), LE (571 nt) and LM (561 nt) and

A. thaliana ATGLX1 (AT, 570 nt) analyzed using PlantPAN (Chang et al. 2008). The number elements (?), if more than one, is indicated in brackets

Factor Consensus sequencea Function LC LE LM AT

-10PEHVPSBD TATTCT Related to light response ? ? ? ?

ABI4 SYGCYYYY Related to ABA and sugar response - - - ? (2)

ANAERO1CONSENSUS/

ANAERO2CONSENSUS/

ANAERO3CONSENSUS

AAACAAA/AGCAGC/

TCATCAC

Found in promoters of anaerobically induced

genes

? ? ? ? (3)

AP1 TTTTTRG Element found from gene related to flower

development

- - - ?

ARR1AT NGATT Related to cytokinin regulated transcription ? (8) ? (8) ? (8) ? (16)

AtMYB2 CTAACCA Recognition site to Myb/Myc, related to

drought and ABA signaling

? ? ? -

Bellringer AAATTARW Related to flower development - ? ? ?

BIHD1OS TGTCA Related to disease response ? - - ?

BOXIINTPATPB ATAGAA Element found in plastid gene - - - ?

C1MOTIFZMBZ2 YNAACYA Element found from a gene related to

anthocyanin metabolism

? (3) ? (3) ? (3) -

CANBNNAPA CNAACAC Element related to embryo and endosperm-

specific transcription

- - - ?

CAREOSREP1 CAACTC Related to gibberellin response - - - ?

CCA1/CCA1ATLHCB1 AAMAATCT Binding site for Myb-transcription factor,

involved in phytochrome regulation

? ? ? -

CDC5 NGCTCAGCGCN Binding site for Myb-related protein involved

in regulation of cell cycle

? ? ? ?

CIACADIANLELHC CAANNNNATC Related to circadian expression - - - ?

GAMYB /GAmyb NNYAACSRHM/

YAACSGMC

Recognition site of Myb; related to gibberellic

acid response

? (2) ? (2) ? (3) ? (3)

GT1GMSCAM4 GAAAAA Related to salt and pathogen response ? ? ? ?

MYB1AT/MYBATRD22 WAACCA/ CTAACCA Binding site for Myb-transcription factor; e.g.

related to ABA signaling and dehydration

? ? ? -

MYBPZM CCWACC Binding site for maize Myb homologue; related

to flavonoid metabolism

? ? - -

MYBCOREATCYCB1 AACGG Recognition site for Myb found from a gene

related to cell proliferation

- - - ?

MYCCONSENSUSAT CANNTG Recognition site for Myc, related,

e.g. to dehydration and cold response

? (8) ? (8) ? (8) ? (2)

P ACCWACCNN Found from flavonoid synthesis related genes ? ? ? -

SREATMSD TTATCC Involved in sugar metabolism ? ? ? -

SURECOREATSULTR11 GAGAC Related to sulphur response - - - ?

TAAAGSTKST1 TAAAG Recognition site for transcription factor

controlling tissue-specific expression

(guard cells) and ion exchange (K?)

- - - ?

TEIL ATGWAYCT Related to ethylene signaling ? (2) ? (2) ? (2) ? (4)

WBOXATNPR1 TTGAC Related to salicylic acid signaling and disease - - - ?

WRKY71OS TGAC Related to gibberellin ? - - ?

a W is A or T, N is any base, R is A or G, Y is C or T, S is G or C H is A, T, U, or C, K is T, U or G

Planta (2011) 233:1173–1184 1179

123

expression of ATGLX1 was effectively suppressed in the

shoots of the homozygous plants, the mRNA levels being

1–3 % of that in the wild-type (Fig. 5). This indicates that

the promoter was made almost entirely non-functional by

the T-DNA insertion. On 0.59 MS agar plates, germination

of the seeds of the homozygous plants was normal, and the

plants were fertile and morphologically indistinguishable

from the wild-type plants. Seeds of the T-DNA insertion

line and wild-type A. thaliana plants were also placed on

0.59 MS agar plates supplemented with 0, 200, 300, 400 or

500 lM ZnSO4, and root lengths were measured (Fig. 6).

Root growth was clearly retarded by the increasing Zn

concentrations. However, there was no significant differ-

ence in the root growth between the wild type plants and

3a

3

n

b

0

1

2

0 10 100

1000 0 10 10

0

1000 0 10 10

0

1000

LC LE LM

Exp

ress

ion

0

1

2

0 10 100

1000 0 10 10

0

1000 0 10 10

0

1000

LC LE LM

Exp

ress

ion

0

1

2

3

Exp

ress

ion

c

0

0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00

490L 612L 509L 411L 226L 620H 617H 424H 633H 567H

E

3d

0

1

2

0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00

411L 509L 612L 490L 226L 620H 617H 633H 567H 424H

Exp

ress

ion

1

2e

Exp

ress

ion

0

0 10 100

1000 0 10 10

010

00 0 10 100

1000 0 10 10

010

00 0 10 100

1000

6L 49L 77L 19H 70H

E

Fig. 4 Expression of TcGLX1 mRNA in T. caerulescens. Barsindicate relative expressions (mean of three replicates ± SD) in the

shoots (a) and in the roots (b) of T. caerulescens accessions LC, LE

and LM, in the shoots (c) and in the roots (d) of lines derived from

LC 9 LM cross (Deniau et al. 2006), and in the shoots (e) of lines

derived from LC 9 LE cross (Assuncao et al. 2003b) in different Zn

exposures: 0, 10, 100 and 1,000 lM ZnSO4

1180 Planta (2011) 233:1173–1184

123

the T-DNA insertion line, indicating that an almost com-

plete elimination of ATGLX1 expression had no influence

on Zn tolerance in A. thaliana. There was neither a dif-

ference in Zn accumulation between the wild-type plants

and the T-DNA insertion line.

The A. thaliana genome appears to contain at least ten

protein-coding genes of the glyoxalase 1 family (Entrez

Gene, NCBI database for gene-specific information

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene).

One of these, At1g67280.2 has ca. 72 % similarity with

TcGLX1 in the coding region while the similarity with the

other related genes is very low. The mRNA expression of

the gene encoded by the locus At1g67280 was verified with

Q-PCR by using specific primers. The expression in the

shoots of the plants analyzed was up to 1.8-fold in the

T-DNA insertion line compared to the wild-type plant

(Supplemental Fig. S3). It is thus possible that the lack of

expression of ATGLX1 was sufficiently compensated by

this gene or other genes of the glyoxalase 1 family to

provide a normal phenotype.

Discussion

A gene with high similarity to a glyoxalase 1-homolog in

A. thaliana (ATGLX1) was isolated from the Zn hyperac-

cumulator plant Thlaspi caerulescens and named as

TcGLX1. The deduced TcGLX1 polypeptide was compared

with Gly I and TaGly I from B. juncea and T. aestivum,

respectively, which have been used to increase Zn toler-

ance (Singla-Pareek et al. 2006; Lin et al. 2010) and Zn

accumulation (Singla-Pareek et al. 2006) in tobacco. While

the deduced polypeptide sequence of T. caerulescens

GLX1 shows high identity with the polypeptide in B. rapa

and ATGLX1 in A. thaliana (90–92%), the identity with

T. aestivum TaGly I is 74% (Lin et al. 2010) and with

B. juncea Gly I only 22–23% (Veena et al. 1999; Singla-

Pareek et al. 2003, 2006; Bhomkar et al. 2008; Roy et al.

2008). The Gly I polypeptide of B. juncea is short, the

deduced molecular mass being ca. 20 kDa compared to ca.

32 kDa in T. caerulescens TcGLX1 (Fig. 2). ATGLX1 has

been predicted to have several different splicing variants

with at least two different protein products (283 and 232

amino acids, TAIR, http://www.arabidopsis.org/; Supple-

mental Figs. S1, S2). Numerous post-translational modifi-

cation sites were predicted for both TcGLX1 and ATGLX1

including one putative glycosylation site and several

putative phosphorylation and myristoylation sites. Only

phosphorylation has been shown experimentally for any

GLX1. Glyoxalase 1 is phosphorylated because of GA3

treatment of rice (Khan et al. 2005). Phosphorylation

affects the enzymatic activity of ATGLX1 (Shin et al.

2007). These characteristics of the GLX1 proteins have the

potential to affect, e.g. their subcellular localization, sta-

bility and enzymatic activity and, thereby, their overall

affect in the plant.

The core and proximal promoter regions of TcGLX1

were compared in silico with the promoter region of

ATGLX1 retrieved from TAIR. Only one plant GLX1 pro-

moter has been characterized to any extent previously, i.e.

Fujita et al. (2004), but the protein has very low (ca. 11%)

similarity with TcGLX1. Promoter elements in TcGLX1

and ATGLX1, albeit not necessarily identical, suggested

that the genes respond to various phytohormonal and

abioitic stimuli (Fig. 3; Table 3; Supplemental Table S1).

Up-regulation of GLX1 gene expression has been reported

in response to abscisic acid (Espartero et al. 1995; Fujita

et al. 2004), light (Hossain et al. 2009), drought and salinity

(Espartero et al. 1995; Veena et al. 1999; Fujita et al. 2004)

and pathogen attack (Lin et al. 2010). This indicates that

the expression of the genes is under complex regulation.

No metal-responsive elements were found in the promoter

regions even though GLX1 has been reported to be induced

by Zn (Veena et al. 1999; Lin et al. 2010) and Cd (Hossain

et al. 2009). This may be because metal-responsive

0.5

1.0

1.5

0.0WT T5 T11 T12 T15 T16

Exp

ress

ion

Plant

Fig. 5 Expression of ATGLX1 in A. thaliana T-DNA insertion line

for ATGLX1 (At1g11840). Bars indicate expression (mean of three

replicates ± SD) in five individual progeny plants (T5, T11, T12,

T11) compared to the wild-type (WT) plant

2

3

4WT

0

1

2

1/2 MS 200 Zn 300 Zn 400 Zn 500 Zn

Ro

ot

len

gth

(cm

)

GLX

Fig. 6 Effect of Zn on root growth of A. thaliana wild-type (WT) and

T-DNA insertion line for ATGLX1(GLX). Shown are the root lengths

after 11 days of growth in � MS agar plates (control), supplemented

with 200, 300, 400 or 500 lM ZnSO4. Each bar indicates the mean

value (±SD) of five replicate plates, each with 7–11 plants

Planta (2011) 233:1173–1184 1181

123

elements are not well characterized. On the other hand, our

studies did not give any indications of Zn-responsiveness

of TcGLX1 (Tuomainen et al. 2006, 2010; this study).

We have shown previously that the level of TcGLX1

protein was higher in a more Zn-tolerant T. caerulescens

accession than in the less tolerant ones (Tuomainen et al.

2006, 2010). However, no significant differences were

found in lines derived from inter-accession cross with

contrasting Zn tolerance (Tuomainen et al. 2010). In the

present study, we confirm that no correlation exists

between Zn tolerance and TcGLX1 mRNA levels either.

This was supported by the finding that the T-DNA insertion

line for AtGLX1 showed no change in Zn tolerance. We

also analyzed several lines from a cross between high- and

low-Zn-accumulating T. caerulescens accessions. Even

though small differences were observed, no evidence was

found that the lines accumulating more Zn show higher

TcGLX1 expression. This seems to be in contradiction with

the findings that the introduction of Gly I and TaGly I from

two non-Zn-tolerant, non-Zn-accumulator plants, B. juncea

and T. aestivum, respectively, increase Zn tolerance (Singla-

Pareek et al. 2006; Lin et al. 2010) and Zn accumulation

(Singla-Pareek et al. 2006) in tobacco. Neither was the

growth or germination of A. thaliana T-DNA insertion line

for ATGLX1 affected, in contrast to the tobacco lines

transformed with Gly I antisense gene (Yadav et al. 2005a).

There may be several reasons for this apparent discrepancy.

One is the genetic background, as all T. caerulescens

accessions studied have naturally higher Zn tolerance and

Zn accumulation compared to, e.g. B. juncea and T. aes-

tivum. Another reason might be that different glyoxalase 1

isoforms have different effects. While it is known that

Arabidopsis has at least ten potentially redundant GLX1-

like genes such information is lacking for tobacco, Bras-

sica, Triticum and Thlaspi. The localization of GLX1

expression may also be different as the Gly I and TaGly I

genes in tobacco are under exogenous promoters. In addi-

tion, the observation that normal ATGLX1 expression is

apparently not essential for normal wild-type Zn tolerance

does, strictly speaking, not necessarily imply that homol-

ogous ATGLX1 over-expression would not yield enhanced

Zn tolerance in A. thaliana, such as found upon heterolo-

gous GLX1 expression in tobacco. Further research is

needed to clarify this.

A reasonable explanation could also be that the effect of

GLX1 transgenes on Zn tolerance is indirect and linked to

secondary stress, which might be higher in the tobacco

plants in comparison with T. caerulescens. Methylglyoxal

levels are increased because of several stresses including

Zn exposure (Singla-Pareek et al. 2006), together with the

induction of glyoxalase 1 at the protein or mRNA level

(Veena et al. 1999; Singla-Pareek et al. 2006; Lin et al.

2010). In such conditions, the glyoxalase activity may still

be the limiting factor, and the plants will benefit from

additional GLX1 genes, which increase the rate of meth-

ylglyoxal detoxification. Many studies suggest a role for

glyoxalase system in removing methylglyoxal from the

cells (Martins et al. 2001; Takatsume et al. 2004; Yadav

et al. 2005a, b; Singla-Pareek et al. 2006) and in main-

taining sufficient levels of GSH, an important cellular

reducing agent (Jain et al. 2002; Yadav et al. 1995b; Sin-

gla-Pareek et al. 2006). Methylglyoxal may also be elimi-

nated by other enzymes like aldose reductase (Rath et al.

2009).

Conclusions

Improvement of Zn tolerance and accumulation by

increased levels of glyoxalase 1 has been inferred previ-

ously from studies on transgenic plants with the glyoxalase

1-encoding genes under the control of exogenous promot-

ers. In the present study, the possible contribution of gly-

oxalase 1 in Zn tolerance and accumulation was studied for

the first time in natural plants having contrasting Zn tol-

erance and accumulation traits, with lines from their

crosses, and with a non-tolerant plant having mutation in a

glyoxalase 1-encoding gene. The evidence did not support

a significant role for glyoxalase 1 in either Zn tolerance or

Zn accumulation. There are a number of possible expla-

nations for this discrepancy including, e.g. the plant

genotype, differences in the structures of the enzymes and

in the regulatory regions, and thus the circumstances in

which glyoxalase 1 might improve Zn tolerance or accu-

mulation remain an open question.

Acknowledgments This project was funded by the EC FP5 project

‘PHYTAC’ (QLRT-2001-00429) and by the Academy of Finland

(projects 53885 and 122338). Marjo Tuomainen wishes to thank The

Finnish Cultural Foundation of Northern Savo and Central Fund,

Finnish Concordia Fund and The Kuopio Naturalists’ Society for

personal grants.

References

Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P,

Stevenson DK, Zimmerman J, Barajas P, Cheuk R, Gadrinab C,

Heller C, Jeske A, Koesema E, Meyers CC, Parker H, Prednis L,

Ansari Y, Choy N, Deen H, Geralt M, Hazari N, Hom E, Karnes

M, Mulholland C, Ndubaku R, Schmid I, Guzman P, Aguilar-

Henonin L, Schmidt M, Weigel D, Carter DE, Marchand T,

Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker

JR (2003) Genome-wide insertional mutagenesis of Arabidopsisthaliana. Science 301:653–657

Amedeo P, Habu Y, Afsar K, Scheid OM, Paszkowski J (2000)

Disruption of the plant gene MOM releases transcriptional

silencing of methylated genes. Nature 405:203–206

1182 Planta (2011) 233:1173–1184

123

Assuncao AGL, Bookum WM, Nelissen HJM, Vooijs R, Schat H,

Ernst WHO (2003a) Differential metal-specific tolerance and

accumulation patterns among Thlaspi caerulescens populations

originating from different soil types. New Phytol 159:411–419

Assuncao AGL, Ten Bookum WM, Nelissen HJM, Vooijs R, Schat H,

Ernst WHO (2003b) A cosegregation analysis of zinc (Zn)

accumulation and Zn tolerance in the Zn hyperaccumulator

Thlaspi caerulescens. New Phytol 159:383–390

Baker AJM, Brooks RR (1989) Terrestial higher plants which

hyperaccumulate metallic elements. A review of their distribu-

tion, ecology and phytochemistry. Biorecovery 1:81–126

Bhomkar P, Upadhyay CP, Saxena M, Muthusamy A, Prakash NS,

Pooggin M, Hohn T, Sarin NB (2008) Salt stress alleviation in

transgenic Vigna mungo L. Hepper (blackgram) by overexpres-

sion of the glyoxalase I gene using a novel Cestrum yellow leaf

curling virus (CmYLCV) promoter. Mol Breeding 22:169–181

Chang WC, Lee TY, Huang HD, Huang HY, Pan RL (2008)

PlantPAN: Plant promoter analysis navigator, for identifying

combinatorial cis-regulatory elements with distance constraint in

plant gene groups. BMC Genom 9:561

Chen ZY, Brown RL, Damann KE, Cleveland TE (2004) Identifica-

tion of a maize kernel stress-related protein and its effect on

aflatoxin accumulation. Phytopathology 94:938–945

Clugston SL, Daub E, Honek JF (1998) Identification of glyoxalase I

sequences in Brassica oleracea and Sporobolus stapfianus:

evidence for gene duplication events. J Mol Evol 47:230–234

Deniau AX, Pieper B, Ten Bookum WM, Lindhout P, Aarts MGM,

Schat H (2006) QTL analysis of cadmium and zinc accumulation

in the heavy metal hyperaccumulator Thlaspi caerulescens.

Theor Appl Genet 113:907–920

Edwards K, Johnstone C, Thompson C (1991) A simple and rapid

method for the preparation of plant genomic DNA for PCR

analysis. Nucl Acids Res 19:1349

Espartero J, Sanchez-Aguayo I, Pardo JM (1995) Molecular charac-

terization of glyoxalase-I from a higher plant; upregulation by

stress. Plant Mol Biol 29:1223–1233

Fleming T, Rabbani N, Thornalley PJ (2008) Preparation of

nucleotide advanced glycation endproducts—imidazopurinone

adducts formed by glycation of deoxyguanosine with glyoxal

and methylglyoxal. Ann NY Acad Sci 1126:280–282

Fujita M, Fujita Y, Maruyama K, Seki M, Hiratsu K, Ohme-Takagi

M, Tran LSP, Yamaguchi-Shinozaki K, Shinozaki K (2004) A

dehydration-induced NAC protein, RD26, is involved in a novel

ABA-dependent stress-signaling pathway. Plant J 39:863–876

Hanhineva KJ, Karenlampi SO (2007) Production of transgenic

strawberries by temporary immersion bioreactor system and

verification by TAIL-PCR. BMC Biotechnol 7:11

Hossain MA, Fujita M (2009) Purification of glyoxalase I from onion

bulbs and molecular cloning of its cDNA. Biosci Biotechnol

Biochem 73:2007–2013

Hossain MA, Hossain MZ, Fujita M (2009) Stress-induced changes of

methylglyoxal level and glyoxalase I activity in pumpkin seedlings

and cDNA cloning of glyoxalase I gene. Aust J Crop Sci 3:53–64

Jain M, Choudhary D, Kale RK, Bhalla-Sarin N (2002) Salt- and

glyphosate-induced increase in glyoxalase I activity in cell lines

of groundnut (Arachis hypogaea). Physiol Plant 114:499–505

Johansen KS, Svendsen I, Rasmussen SK (2000) Purification and cloning

of the two domain glyoxalase I from wheat bran. Plant Sci 155:11–20

Kalapos MP (2008) The tandem of free radicals and methylglyoxal.

Chem Biol Interact 171:251–271

Khan MMK, Jan A, Karibe H, Komatsu S (2005) Identification of

phosphoproteins regulated by gibberellin in rice leaf sheath.

Plant Mol Biol 58:27–40

Lin F, Xu J, Shi J, Li H, Li B (2010) Molecular cloning and

characterization of a novel glyoxalase I gene TaGly I in wheat

(Triticum aestivum L.). Mol Biol Rep 37:729–735

Liu YG, Whittier RF (1995) Thermal asymmetric interlaced PCR:

automatable amplification and sequencing of insert end frag-

ments from PI and YAC clones for chromosome walking.

Genomics 25:674–681

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2–DDCT method.

Methods 25:402–408

Maeta K, Izawa S, Inoue Y (2005) Methylglyoxal, a metabolite

derived from glycolysis, functions as a signal initiator of the high

osmolarity glycerol-mitogen-activated protein kinase cascade

and calcineurin/Crz1-mediated pathway in Saccharomycescerevisiae. J Biol Chem 280:253–260

Martins AMTBS, Cordeiro CAA, Ponces Freire AMJ (2001) In situ

analysis of methylglyoxal metabolism in Saccharomyces cere-visiae. FEBS Lett 499:41–44

Meerts P, Van Isacker N (1997) Heavy metal tolerance and

accumulation in metallicolous and non-metallicolous popula-

tions of Thlaspi caerulescens from continental Europe. Plant

Ecol 133:221–231

Paulus C, Kollner B, Jacobsen HJ (1993) Physiological and

biochemical characterization of glyoxalase I, a general marker

for cell proliferation, from a soybean cell suspension. Planta

189:561–566

Price CL, Knight SC (2009) Methylglyoxal: possible link between

hyperglycaemia and immune suppression? Trends Endocrinol

Metab 20:312–317

Rabbani N, Thornalley PJ (2008) The dicarbonyl proteome: proteins

susceptible to dicarbonyl glycation at functional sites in health,

aging, and disease. Ann N Y Acad Sci 1126:124–127

Rath J, Gowri VS, Chauhan SC, Padmanabhan PK, Srinivasan N,

Madhubala R (2009) A glutathione-specific aldose reductase of

Leishmania donovani and its potential implications for methyl-

glyoxal detoxification pathway. Gene 429:1–9

Rigola D, Fiers M, Vurro E, Aarts MGM (2006) The heavy metal

hyperaccumulator Thlaspi caerulescens expresses many species-

specific genes, as identified by comparative expressed sequence

tag analysis. New Phytol 170:753–766

Roy SD, Saxena M, Bhomkar PS, Pooggin M, Hohn T, Bhalla-Sarin

N (2008) Generation of marker free salt tolerant transgenic

plants of Arabidopsis thaliana using the gly 1 gene and cre gene

under inducible promoters. Plant Cell Tiss Organ Cult 95:1–11

Schat H, Vooijs R, Kuiper E (1996) Identical major gene loci for

heavy metal tolerances that have independently evolved in

different local populations and subspecies of Silene vulgaris.

Evolution 50:1888–1895

Shin R, Alvarez S, Burch AY, Jez JM, Schachtman DP (2007)

Phosphoproteomic identification of targets of the Arabidopsissucrose nonfermenting-like kinase SnRK2.8 reveals a connection

to metabolic processes. Proc Natl Acad Sci USA 104:6460–6465

Singla-Pareek SL, Reddy MK, Sopory SK (2003) Genetic engineering

of the glyoxalase pathway in tobacco leads to enhanced salinity

tolerance. Proc Natl Acad Sci USA 100:14672–14677

Singla-Pareek SL, Yadav SK, Pareek A, Reddy MK, Sopory SK

(2006) Transgenic tobacco overexpressing glyoxalase pathway

enzymes grow and set viable seeds in zinc-spiked soils. Plant

Physiol 140:613–623

Skipsey M, Andrews CJ, Townson JK, Jepson I, Edwards R (2000)

Cloning and characterization of glyoxalase I from soybean. Arch

Biochem Biophys 374:261–268

Takatsume Y, Izawa S, Inoue Y (2004) Identification of thermostable

glyoxalase I in the fission yeast Schizosaccharomyces pombe.

Arch Microbiol 181:371–377

Thornalley PJ (1993) The glyoxalase system in health and disease.

Mol Asp Med 14:287–371

Thornalley PJ (2003) Protecting the genome: defense against

nucleotide glycation and emerging role of glyoxalase I

Planta (2011) 233:1173–1184 1183

123

overexpression in multidrug resistance in cancer chemotherapy.

Biochem Soc Trans 31:1372–1377

Tuomainen MH, Nunan N, Lehesranta SJ, Tervahauta AI, Hassinen

VH, Schat H, Koistinen KM, Auriola S, McNicol J, Karenlampi

SO (2006) Multivariate analysis of protein profiles of metal

hyperaccumulator Thlaspi caerulescens accessions. Proteomics

6:3696–3706

Tuomainen M, Tervahauta A, Hassinen V, Schat H, Koistinen KM,

Lehesranta S, Rantalainen K, Hayrinen J, Auriola S, Anttonen

M, Karenlampi S (2010) Proteomics of Thlaspi caerulescensaccessions and an inter-accession cross segregating for zinc

accumulation. J Exp Bot 61:1075–1087

Usui Y, Nakase M, Hotta H, Urisu A, Aoki N, Kitajima K, Matsuda T

(2001) A 33-kDa allergen from rice (Oryza sativa L. Japonica).

cDNA cloning, expression, and identification as a novel

glyoxalase I. J Biol Chem 276:11376–11381

Veena, Reddy VS, Sopory SK (1999) Glyoxalase I from Brassicajuncea: molecular cloning, regulation and its over-expression

confer tolerance in transgenic tobacco under stress. Plant J

17:385–395

Yadav SK, Singla-Pareek SL, Ray M, Reddy MK, Sopory SK (2005a)

Methylglyoxal levels in plants under salinity stress are depen-

dent on glyoxalase I and glutathione. Biochem Biophys Res

Commun 337:61–67

Yadav SK, Singla-Pareek SL, Reddy MK, Sopory SK (2005b)

Transgenic tobacco plants overexpressing glyoxalase enzymes

resist an increase in methylglyoxal and maintain higher reduced

glutathione levels under salinity stress. FEBS Lett 579:6265–6271

Zhao FJ, Hamon RE, Lombi E, McLaughlin MJ, McGrath SP (2002)

Characteristics of cadmium uptake in two contrasting ecotypes

of the hyperaccumulator Thlaspi caerulescens. J Exp Bot

53:535–543

1184 Planta (2011) 233:1173–1184

123