ORIGINAL PAPER

Altered fast- and slow-twitch muscle fibre characteristicsin female mice with a (S248F) knock-in mutation of the brainneuronal nicotinic acetylcholine receptor

David J. Cannata Æ David I. Finkelstein ÆIlse Gantois Æ Yaroslav Teper ÆJohn Drago Æ Jan M. West

Received: 5 January 2009 / Accepted: 15 April 2009 / Published online: 29 April 2009

� Springer Science+Business Media B.V. 2009

Abstract We generated a mouse line with a missense

mutation (S248F) in the gene (CHRNA4) encoding the a4

subunit of neuronal nicotinic acetylcholine receptor

(nAChR). Mutant mice demonstrate brief nicotine induced

dystonia that resembles the clinical events seen in patients

with the same mutation. Drug-induced dystonia is more

pronounced in female mice, thus our aim was to determine

if the S248F mutation changed the properties of fast- and

slow-twitch muscle fibres from female mutant mice.

Reverse transcriptase-PCR confirmed CHRNA4 gene

expression in the brain but not skeletal muscles in normal

and mutant mice. Ca2? and Sr2? force activation curves

were obtained using skinned muscle fibres prepared from

slow-twitch (soleus) and fast-twitch (EDL) muscles. Two

significant results were found: (1) the (pCa50 - pSr50)

value from EDL fibres was smaller in mutant mice than in

wild type (1.01 vs. 1.30), (2) the percentage force produced

at pSr 5.5 was larger in mutants than in wild type (5.76 vs.

0.24%). Both results indicate a shift to slow-twitch char-

acteristics in the mutant. This conclusion is supported by

the identification of the myosin heavy chain (MHC) iso-

forms. Mutant EDL fibres expressed MHC I (usually only

found in slow-twitch fibres) as well as MHC IIa. Despite

the lack of spontaneous dystonic events, our findings sug-

gest that mutant mice may be having subclinical events or

the mutation results in a chronic alteration to muscle neural

input.

Keywords Ca2?/Sr2?-activation � Dystonia �Nicotinic acetylcholine receptor � S248F mutation �Skinned muscle fibre

Introduction

We have generated a mouse model of autosomal dominant

nocturnal frontal lobe epilepsy [ADNFLE] (Scheffer et al.

1995) originally described to be due to a missense mutation

(S248F) in the gene (CHRNA4) encoding the a4 subunit of

neuronal nicotinic acetylcholine receptor [nAChR] (Stein-

lein et al. 1995). Although spontaneous seizures are not

observed in these knock-in mice, they do exhibit nicotine-

induced behaviours that mimic the brief dystonic events

reported in ADNFLE (Teper et al. 2007).

Brain nAChRs are ligand-gated ion channels which can

be divided into muscle and neuronal receptor types. These

receptors are involved in fast synaptic transmission and are

located in both the peripheral and central nervous system

(Hogg et al. 2003). The receptors are composed of five

subunits surrounding a central pore and are made up of

different combinations of the acetylcholine binding sub-

units (a2–a10 and b2–b4; Hogg et al. 2003). The nAChRs

Electronic supplementary material The online version of thisarticle (doi:10.1007/s10974-009-9177-x) contains supplementarymaterial, which is available to authorized users.

D. J. Cannata (&) � J. M. West

School of Life and Environmental Sciences, Deakin University,

221 Burwood Highway, Melbourne, VIC 3125, Australia

e-mail: djcan@deakin.edu.au

D. I. Finkelstein

The Mental Health Research Institute of Victoria, Melbourne,

VIC 3052, Australia

I. Gantois

Laboratory of Biological Psychology, Katholieke Universiteit

Leuven, Tiensestraat 102, 3000 Leuven, Belgium

Y. Teper � J. Drago

Howard Florey Institute, The University of Melbourne,

Melbourne, VIC 3010, Australia

123

J Muscle Res Cell Motil (2009) 30:73–83

DOI 10.1007/s10974-009-9177-x

with a ratio of (three) a4:(two) b2 subunit stoichiometry

are only found in the brain (Hogg et al. 2003); nAChRs

found in the peripheral nervous system including skeletal

muscles of adult animals lack a4 or b2 subunits, thus a

mutation in the a4 or b2 subunit of the nAChRs should

only directly involve receptors expressed in the brain

(Phillips et al. 1995; Wong et al. 2002).

In ADNFLE, the functional changes in the receptor

complex results from mutations in either the gene encoding

the a4 (CHRNA4) or b2 subunit (CHRNB2) of the nAChR

(Phillips et al. 1995; Wong et al. 2002). Five mutations

have been identified associated with an ADNFLE disease

phenotype, three in the a4 and two in the b2 subunit (Hogg

et al. 2003).

The S248F mutation of CHRNA4 causes the nAChR to

display an abnormal desensitization profile. The wild type

receptor does not desensitize whereas the S248F receptor

does (Teper et al. 2007). Synaptosome function was inves-

tigated in wild type, heterozygous S248F and homozygous

S248F mutant mice by assessing the release of 86Rb?,

GABA and dopamine from synaptosomes. The EC50 was

reduced in a gene dose dependent manner in mutant mice

suggesting that the mutation confers an increased sensitivity

to neuronal nicotine receptor agonists. The net biological

effect is difficult to predict and depends on the location of

the receptor on the neuron (i.e., pre-synaptic or post-syn-

aptic), the neurotransmitter species of the neuron and the

location of the neuron within a neural circuit (i.e., inhibitory

or excitatory). The S248F mutant mouse was generated to

address these complex questions in an in vivo context.

S248F mutant mice were shown to exhibit a stereotyp-

ical nicotine-induced dystonic arousal complex [DAC]

(Teper et al. 2007). The DAC is brief in duration and

involves exploratory-type side-to-side head and body

darting, dystonic forelimb posturing and an accentuated

Straub tail. In some cases, the dystonic forelimb posturing

is associated with digital clasping (Teper et al. 2007).

Although not highlighted in the original description of the

model, the DAC also involved bilateral hind limb midline

abduction (see supplementary video) resulting in the

hindquarters coming into close contact with the ventral

surface and at times rolling to the side. Despite the robust

nature of the DAC, S248F mice were not observed to have

spontaneous behavioural events. The DAC was not asso-

ciated with a change in the electroencephalogram and there

were no electroencephalographic changes in S248F mice

monitored over an extended period (Teper et al. 2007). The

DAC is considered a valid model of the dystonic episodes

seen in ADNFLE because of the phenotypic similarities

and the observation that both the DAC and the human

attacks are ameliorated by the prototypical anticonvulsant

carbamazepine and by the administration of low dose

nicotine.

We had shown in a Parkinson’s disease model that

changes are readily detected in contralateral muscles fol-

lowing a partial lesion of the substantia nigra using the

neurotoxin 6-hydroxydopamine. These changes were

identified in muscles despite the lack of abnormality in

spontaneous motor function (Sliwinski et al. 2005). As

there were no spontaneous dystonic events in S248F

knock-in mice we therefore sought to use a range of well

established assays of hind limb muscle physiology to

determine if the primary S248F brain mutation was asso-

ciated with changes in parameters indicative of sustained

alteration in neural output. This conclusion could be drawn

as CHRNA4 is not expressed in muscle and any changes

identified could be linked to changes in brain activity.

In this study we used female S248F mice as these ani-

mals have a higher penetrance of DAC (Teper et al. 2007).

In a recent study, 100% of the female animals displayed all

three previously described component behaviours of DAC

(saccadic behaviour, Straub tail and fore-limb dystonia),

compared to only 75% of male animals (Teper et al. 2007).

Females also obtained significantly higher scores than

males in all three DAC behaviours (Teper et al. 2007).

The pattern of motor neuron activation of skeletal

muscles exerts a powerful influence on muscle contractile

speed (Syrovy 1987). In vivo, rat slow-twitch muscles

(e.g., the soleus) are stimulated by a tonic frequency in the

range of 20–25 Hz and contract and relax slowly (Gun-

dersen et al. 1988). In contrast, fast-twitch muscles such as

the extensor digitorum longus (EDL) have considerably

faster twitch contraction and relaxation times and are

subject to phasic stimulation over the range of 60–90 Hz

(Hennig and Lomo 1985). These differences in neural

activation influence the distinction observed in the func-

tional properties of the muscle fibres.

The effect of changing the neural input on the phenotype

of the muscle has been extensively studied using various

experimental techniques. Cross-reinnervation studies ele-

gantly showed that when the slow-twitch soleus muscle

was reinnervated with a motor neuron previously supplying

a fast-twitch muscle the contractile speed of the slow-

twitch muscle became faster (Buller et al. 1960; Close

1969). Similarly, when the fast-twitch muscle was inner-

vated with a nerve previously supplying the soleus muscle

the speed of contraction slowed (Buller et al. 1960; Close

1969). Cross-reinnervation also resulted in changes in the

expression of the myofibrillar protein isoforms (Hoh 1975)

and their distribution within a particular fibre type (Pette

and Staron 1990).

Chronic low frequency stimulation mimics the tonic

nerve impulse patterns that a slow-twitch muscle receives

in the rabbit (10 Hz) and converts fast-twitch fatigable

muscles into slower contracting muscles that are more

fatigue resistant (Salmons and Vrbova 1969; Salmons and

74 J Muscle Res Cell Motil (2009) 30:73–83

123

Sreter 1976). Conversely, a slow-twitch muscle that has

undergone a transition to fast via cross-reinnervation can

revert back to its slow-twitch properties when stimulation

is used to restore tonic activity (Salmons and Sreter 1976).

The presence of changes in muscle tone in extrapyra-

midal diseases such as Parkinson’s disease and its modu-

lation by basal ganglia surgery is well recognised (Hayashi

et al. 2001). A number of other studies have investigated

the complex interaction between volitional movement

originating in the motor cortex and inputs from the basal

ganglia and brain stem on neural tone (Takakusaki et al.

2003, 2004b, 2004c) whereby descending pathways ulti-

mately influence muscle tone by altering excitability of

motor neurons (Takakusaki et al. 2004a). There are only a

few studies that directly investigated the secondary effects

in muscles at the physiological, histological or biochemical

level in humans with central nervous system diseases such

as Parkinson’s disease or rarer basal ganglia diseases

associated with limb dystonia such as dentatorubral pal-

lidoluysian atrophy and primary dystonia (Edstrom et al.

1979; Rossi et al. 1996; Cox et al. 2000; Sharott et al.

2008). Results from these studies suggest that chronic

changes in centrally mediated neural tone can impact on

muscle phenotype.

The aim of this study was to assess changes in the

properties of individual fast- and slow-twitch fibres from

the hind limb muscles of wild type and S248F knock-in

mice as an indirect measure of altered peripheral neural

tone. This is a unique study as it observes changes in

muscle fibre properties by possibly altering neural impulse

activity without electrical stimulation or physical detach-

ment/reattachment of motor neurons. Any changes

observed in muscle fibre properties are the result of the

S248F mutation of the nAChR in the brain and not from

any mechanical or surgical intervention.

Materials and methods

Ethical approval

All procedures involving transgenic and wild type mice con-

formed to the Australian National Health and Medical Research

Council (NHMRC) code of practice and were approved by the

Howard Florey Institute Animal Ethics Committee. All pre-

cautions were taken to minimise pain or discomfort.

Animals and tissue collection

The mouse model used in this study was developed and

housed at the Howard Florey Institute, Melbourne Uni-

versity (Teper et al. 2007). Mice had access to food and

water ad libitum. The development and genetic background

of these mice has been previously described (Teper et al.

2007). Briefly, heterozygous mice from the knock-in strain

(S248F mutated CHRNA4 gene expressed) and their cor-

responding wild type counterparts were on a 50:50 (129:

CD1) genetic background (Teper et al. 2007). PCR analysis

was used to genotype the knock-in mice. A total of eigh-

teen female animals (9, S248F knock-in; 9, wild type) were

used in this study. Mice were eight to twelve months old

and were drug naıve for this study.

On the day of tissue collection, mice were killed by

cervical dislocation, the entire hind limb was skinned,

dissected and placed directly into storage solution con-

taining 50% glycerol and 50% of relaxing solution con-

taining (mmol l-1): HEPES, 20; ATP, 2; MgCl2, 3; EGTA,

10; Propionic acid, 150; and stored at -20�C until use

(West et al. 1999).

RT-PCR

A qualitative reverse transcriptase-polymerase chain reac-

tion (RT-PCR) was performed to confirm the tissue loca-

tion of CHRNA4 containing nAChRs. Total RNA isolation

from tissue samples of the brain, soleus and EDL muscles

were obtained using a combined RNeasy Micro Kit (Qia-

gen) with TRIzolTM Reagent (Life technologies-BRL)

method. Complementary DNA synthesis was obtained

using the SuperScriptTM First-Strand Synthesis System for

RT-PCR (Invitrogen). Actin primers were used to confirm

the integrity of RNA in the samples (data not shown).

A buffer only negative control was run with all samples

to confirm that samples were not contaminated (data

not shown). The forward primer had the sequence

ATGTCACCTCCATCCGCATCC and the reverse primer

had the sequence AGATCATGGTGAAGAGCAG. These

primers are located at position 430 and 1,056 bp on the

cDNA sequence of NCBI BC053013.

Preparation of skinned fibres

Hind limbs taken from the storage solution were washed

with relaxing solution (solution A, Table 1) and the soleus

and EDL muscles were dissected. The muscles were thor-

oughly blotted and pinned under slight tension on a Sylgard

plate and submerged in paraffin oil. The plasma membrane

of the muscle fibres had been rendered permeable by pro-

longed exposure to glycerol in the storage solution. Single

fibres were isolated from the muscles, by teasing them from

the muscle using fine forceps (No. 5). Individual fibres

were then mounted between two pins of a force recording

apparatus using surgical silk (Deknatel, 9.0, USA) as pre-

viously described (West et al. 1999). One pin was attached

to a micromanipulator and the other to a force transducer

(SensorNor AME-802, Norway).

J Muscle Res Cell Motil (2009) 30:73–83 75

123

The dimensions (length and diameter) of individual

fibres were measured under paraffin oil. The fibre was then

removed from the paraffin oil, blotted with filter paper and

placed in a spectrophotometric vial containing solution A

(Table 1). Sarcomere length was determined by passing

the beam of a HeNe laser (JDS Uniphase, USA) through

the fibre as previously described (West et al. 1999). The

average sarcomere length for the fibres in each experi-

mental group has been summarised in Table 2.

Solutions to activate skinned fibres

Solutions used to activate and relax the muscle fibres have

been previously described (Ashley and Moisescu 1977;

West and Stephenson 1993) and are summarised in Table 1.

Previously determined apparent affinity constants (Kapp)

were used (Ashley and Moisescu 1977). The amount of free

EGTA (i.e., not complexed with Ca2? or Sr2?) in each

solution was determined by titration (Ashley and Moisescu

1977). Solutions were made containing Ca2? at concen-

trations between 3.88 9 10-8 and 2.55 9 10-5 M L-1

(pCa = - log10[Ca2?] between 7.41 and 4.59) and Sr2? at

concentrations between 2.35 9 10-8 and 4.65 9 10-4

M L-1 (pSr = -log10[Sr2?] between 7.62 and 3.33).

Experimental protocol

Single muscle fibres from adult fast- and slow-twitch

muscle can be identified physiologically based on their

sensitivity to Ca2? and Sr2? when the fibres are activated

(Fink et al. 1986, 1990; West and Stephenson 1993; Lynch

et al. 1995; West et al. 1999). Fast-twitch muscles typically

have a greatly different sensitivity to Ca2? and Sr2?,

whereas the sensitivity of the contractile apparatus to these

two divalent cations in slow-twitch muscles is similar.

Thus, Sr2? is a physiological tool used to characterise

individual muscle fibres as either fast- or slow-twitch.

Fibres were activated using the previously described

‘‘Ca2?/Sr2?-jump-technique’’ (Stephenson and Williams

1982). Each fibre was activated in a series of activating

solutions, containing increasing concentrations of Ca2? or

Sr2? (Moisescu 1976; Stephenson and Williams 1982) and

the force output recorded on a chart recorder (WR-3701,

Graphtec, Japan). Once a steady state force level was

achieved in one solution the fibre was then rapidly trans-

ferred to the next activating solution until a maximum

activation force response was obtained. To accommodate

any decrease in the ability of the fibres to develop force

during a staircase activation, a maximum force response

with either Ca2? or Sr2? was determined at the beginning

and end of a series of contractions by submerging the fibre

in solution containing sufficient Ca2? or Sr2? to maximally

activate (Po) the fibre (pCa, 4.59; pSr, 3.33). If the initial

and final forces differed by more than 10% the results were

discarded. If the decrease in force from the initial to the

final activation was \10%, force was assumed to have

declined linearly with time and the force measured at each

sub-maximal Ca2? and Sr2? concentration was normalised

to the estimated maximum force response at that time

(Rees and Stephenson 1987). Each fibre was activated in

both sets of solutions containing either Ca2? or Sr2?. The

order in which fibres were activated (i.e., Ca2? then Sr2? or

vice versa) was divided equally among preparations to

avoid any systematic effects due to the order of presenta-

tion. Maximum Ca2?- or Sr2?-activated force was

determined from the first maximum activation with the

respective divalent cation in each experimental run.

All experiments were conducted at room temperature

(23–25�C).

Data analysis for skinned fibre experiments

Steady-state isometric force production was measured over

a range of Ca2? and Sr2? concentrations. Force developed

when activated by either Ca2? or Sr2? has been expressed

relative to the maximum force (Po) measured using that

ion. This relationship between the force output (Pr = P/Po)

and the concentration of Ca2? and Sr2? can be described

by the Hill equation (Hill 1910); Pr = [x]n/([x]n50 ? [x]n),

where [x] = concentration of either Ca2? or Sr2?; n =

the Hill coefficient which is proportional to the slope of the

curves relating to Pr to pCa or pSr and [x]50 = the

Table 1 Composition of solutions for skinned fibres

Solution [K?] [EGTA] [HDTA] [Mg2?]total [Ca]total [Ca2?]free [Sr]total [Sr2?]free

A 117 50 – 10.3 – \10-6 – –

B 117 50 – 8.12 49.5 0.02 – –

H 117 0.2 49.8 8.51 – \1.7 9 10-6 – –

S 114 50 – 5.95 – – 40 0.283

Concentrations are in (mmol l-l). All solutions contained (mmol l-l): Na?, 36; HEPES, 60; total ATP, 8; creatine phosphate (CP), 10; sodium

azide (NaN3), 1; Mg2?, 1. pH was 7.10 ± 0.01 at 23–25�C. A = relaxing, B = activating (containing Ca2?), H = pre-activating, S = activating

(containing Sr2?). 1-6-diaminohexane-N-N-N0,N0-tetraacetic acid (HDTA). Solutions were titrated using a pH metric method (Ashley and

Moisescu 1977)

76 J Muscle Res Cell Motil (2009) 30:73–83

123

concentration that produces 50% of the maximum force

response when activated by either Ca2? or Sr2?.

All the data in this study have been presented with

relative force expressed as a function of pCa or pSr. Curves

were fitted to the experimental data using a Marquardt non-

linear regression algorithm using SigmaPlot 9.0. The

quantitative characteristics obtained when activating the

fibres with the physiological cations Ca2? and Sr2? are:

pCa10 (pSr10); the concentration of Ca2? (Sr2?) that

produces 10% of the maximum Ca2?- (Sr2?)-activated

force, giving an indication of the concentration of these

divalent cations that produces threshold levels of force.

pCa50 (pSr50); the concentration of Ca2? (Sr2?) that

produces 50% of the maximum Ca2?- (Sr2?)-force, which

is indicative of the sensitivity of the contractile apparatus

to these divalent cations.

nCa (nSr); a parameter reflecting the maximum slope of

the force–pCa (force–pSr) curve.

Parameters used for characterising muscle fibres based

on their activation profiles

The difference in Sr2? sensitivity of fast- and slow-twitch

fibres is directly related to the different Troponin C (TnC)

isoforms that are expressed in fast- and slow-twitch fibres

(O’Connell et al. 2004b). In this study the following

quantitative characteristics were used to classify the fibres

as fast- or slow twitch (1) pCa50 - pSr50; the difference

between the midpoints of the force–pCa (pCa50) and force–

pSr curves (pSr50). This quantifies the relative sensitivity of

the fibre to Ca2? and Sr2?. To accurately determine this

parameter, it was necessary to obtain a complete activation

profile for Ca2? and Sr2?. (2) The level of activation when

the concentration of Sr2? in the solution is 3.0 9

10-6 M L-1 (pSr 5.5). At this level of activation with Sr2?

slow-twitch fibres produce a force response at least 70% of

the maximum Sr2?-activated force whereas the fast-twitch

fibres produce less than 1% of the maximum Sr2?-activated

force.

Thus using our classification scheme a fibre dissected

from the EDL muscle was classified as fast-twitch, if

the pCa50 - pSr50 value was greater than 1.25 log units

and the force produced at pSr 5.5 was less than 1% of

the maximum Sr2?-activated force. A fibre dissected

from the soleus muscle was classified as slow-twitch, if

the pCa50 - pSr50 value was less than 0.75 log units

and the pSr 5.5 value was greater than 70% of the

maximum Sr2?-activated force. If fibres did not meet

the classification criteria for both parameters they were

considered to be neither fast- or slow-twitch. Fibres

dissected from the soleus muscle that met the criteria of

being classified as a fast-twitch fibre were not used in

the final analysis.

Myosin heavy chain separation

Myosin heavy chain (MHC) isoforms were separated via

SDS–PAGE, using a previously described method (Tal-

madge and Roy 1993). Briefly, single muscle fibres were

dissected from the EDL and soleus that were stored in 50%

glycerol and 50% relaxing solution, and were placed in a

SDS-reducing buffer (62.5 mM Tris–HCl (pH 6.8), 12.5%

Glycerol (v/v), and 2.3% SDS (w/v)) overnight at room

temperature (23–25�C). Single fibres were pooled from

three animals for analysis. Samples were then heated to

94�C for 5 min and stored at -20�C until required. MHC

separation was carried out using a Bio-Rad mini-Protean

III cell apparatus at 110 V (constant) at 4�C for 24 h.

Bands were visualised using a silver-staining kit (161-

0443, Bio-Rad).

Results

RT-PCR

Figure 1 shows RT-PCR analysis of the CHRNA4 gene.

This clearly shows that the nAChRs with the a4 subunit are

only located in the brain of the animal models. Expression

of the gene is evident by the strong band displayed at

626 bp. None of the other tissues (knock-in—EDL, soleus;

and wild type—EDL, soleus) expressed the CHRNA4

WT EDL

WT SOL

KIEDL

KISOL

KIBrain

Lane 1

600bp

100bp

Fig. 1 RT-PCR analysis of the CHRNA4 gene. WT wild-type, KI

knock-in, EDL extensor digitorum longus, SOL soleus. Lane 1 is

loaded with a 100 bp protein ladder. The only expression of the

CHRNA4 gene is evident in the lane loaded with brain tissue from the

knock-in mouse (626 bp)

J Muscle Res Cell Motil (2009) 30:73–83 77

123

gene. We used an intron spanning molecular amplification

paradigm to determine that mRNA rather than genomic

DNA was being amplified. The forward primer is com-

plementary to sequence located in exon 4 and the reverse

primer is complementary to sequence in exon 5.

Ca2?- and Sr2?- activation profiles of soleus and EDL

fibres from wild type animals

Typical activation profiles of a slow-twitch and a fast-

twitch fibre from a wild type animal are shown in Fig. 2A,

C. A summary of the parameters measured from wild type

and knock-in animals are shown in Table 2. In wild type

animals, all fast-twitch fibres from the EDL (n = 5) and all

slow-twitch fibres from the soleus (n = 5) met the classi-

fication criteria described in the method; fast-twitch fibres;

pCa50 - pSr50 [ 1.25 (1.30 ± 0.03) and pSr 5.5 \ 1%

(0.24 ± 0.11); slow-twitch; pCa50 - pSr50 \ 0.75 (0.55 ±

0.15) and pSr 5.5[75% (84.25 ± 2.53). In addition acti-

vation profiles of both fibre-types were consistent with other

well established parameters used to help identify fibre types

from other mammalian skeletal muscles (Lynch et al. 1995;

West et al. 1999; Bortolotto et al. 2000); the force–pCa curves

were steeper in fast-twitch fibres (nCa, 2.87 ± 0.21) than in

slow-twitch fibres (nCa, 1.51 ± 0.30; P\0.01; Table 2); and

slow-twitch fibres activated at lower concentrations of Ca2?

(pCa10) i.e., higher pCa values (7.36 ± 0.06) than fast-twitch

fibres (6.12 ± 0.06; P\0.01; Table 2).

Ca2?- and Sr2?- activation profiles of slow-twitch fibres

from knock-in animals

Activation profiles of the slow-twitch fibres from the wild

type and knock-in animals are significantly different

(Fig. 2A, B). According to the classification criteria, five of

the six slow-twitch fibres from knock-in animals had a

pCa50 - pSr50 value\0.75, but none of them had a pSr 5.5

value greater than 70%. Thus based on our scheme, none of

the fibres from the soleus of knock-in animals can be

considered typical slow-twitch nor can they be considered

fast-twitch as they do not meet the typical fast-twitch

classification either. In contrast, all fibres dissected from

the soleus of wild type animals can be considered typical

slow-twitch fibres based on our classification. Both force–

pCa and force–pSr curves of the fibres from knock-in

animals are shifted to the right (Fig. 2B) of the curves

obtained from the wild type animals (Fig. 2A). This indi-

cates that the contractile apparatus of the fibres from

knock-in animals is less sensitive to both Ca2? and Sr2?.

The pCa50 - pSr50 values of the slow-twitch fibres from

the knock-in and wild type animals were not significantly

different (P [ 0.05; Table 2). As the entire curves have

shifted to the right, the pCa10 value from fibres in the

knock-in animals was significantly less (7.18 ± 0.08;

P \ 0.01; Table 2) than wild type animals (7.36 ± 0.06;

Table 2). This means a higher concentration of Ca2? (pCa

7.18 = 6.6 9 10-8 M L-1) was needed to produce 10% of

the maximum force in the muscles from knock-in animals

than wild type animals (pCa 7.36 = 4.3 9 10-8 M L-1).

The pCa50 values for the slow-twitch fibres from the

knock-in animals were also significantly lower than those

from wild animals (P \ 0.05). A similar trend was shown

for Sr2?-activation properties (where pSr 5.5 decreased

from 84.25 to 54.16%; P \ 0.05; Table 2). The difference

in sensitivity of the fibres to Ca2? and Sr2? observed in this

study, cannot be due to different sarcomere lengths of the

fibres between groups (not significantly different P [ 0.05;

Table 2), which is known to have a significant effect on the

sensitivity of the fibres to Ca2? and Sr2? (Stephenson and

Williams 1982).

Table 2 Activation parameters of individual fibres from knock-in and wild type animals

Parameters Slow-twitch Fast-twitch

Wild-type Knock-in Wild-type Knock-in

pCa10 7.36 ± 0.06 7.18 ± 0.08* 6.12 ± 0.06 6.08 ± 0.03

pCa50 6.59 ± 0.18 6.00 ± 0.12** 5.78 ± 0.04 5.80 ± 0.01

nCa 1.51 ± 0.30 0.85 ± 0.09* 2.87 ± 0.21 3.62 ± 0.32*

pSr 5.5 (% force) 84.25 ± 2.53 54.16 ± 5.47* 0.24 ± 0.11 5.76 ± 1.18**

pCa50 - pSr50 0.55 ± 0.15 0.44 ± 0.09 1.30 ± 0.03 1.01 ± 0.04**

Max force (Ca/Sr) 0.96 ± 0.06 1.03 ± 0.05 0.99 ± 0.03 1.01 ± 0.05

SL (lm) 2.69 ± 0.30 2.56 ± 0.11 2.67 ± 0.05 2.56 ± 0.05

Values represented are the mean ± SE. Number of fibres from knock-in animals (soleus n = 6, EDL n = 8); number of fibres from wild type

animals (soleus n = 5, EDL n = 5). * P \ 0.05, ** P \ 0.01 indicates significant differences between wild type and knock-in groups for the

same muscle type. Max force (Ca/Sr) = maximum Ca2?-activated force/maximum Sr2?-activated force. This shows there is no significant

difference between the amount of force produced when maximally activated by Ca2? or Sr2?. SL sarcomere length. All slow-twitch fibres were

dissected from the soleus. All fast-twitch fibres were dissected from the EDL

78 J Muscle Res Cell Motil (2009) 30:73–83

123

Ca2?- and Sr2?- activation profiles of fast-twitch fibres

from knock-in animals

The activation profiles of fast-twitch fibres from wild type

and knock-in animals also displayed significant differ-

ences. Out of the eight fibres from the EDL of knock-in

animals, not one of them met the classification parameters

for either fast- or slow-twitch fibres. In direct contrast,

100% of fibres dissected from the EDL of wild type ani-

mals met the classification parameters for fast-twitch; (wild

type values listed first) pCa50 - pSr50 [ 1.25; 1.30 ±

0.03, 1.01 ± 0.04 (P \ 0.01; Table 2) pSr 5.5 \ 1%;

0.24 ± 0.11, 5.76 ± 1.18 (P \ 0.01; Table 2). Thus, no

fibre from the EDL of knock-in animals can be considered

a typical fast- or slow-twitch fibre based on these criteria.

This suggests that the properties of muscle fibres have

changed. The pCa10 and the pCa50 values of the fast-twitch

fibres from the knock-in animals were not significantly

different to wild type animals, indicating that the sensi-

tivity of the contractile apparatus to Ca2? is similar

(Table 2). However, the profiles of muscles fibres from

knock-in animals are different from the fast-twitch muscle

fibres found in the wild type. The profiles obtained fall

between a fast- and slow-twitch fibre as their pSr 5.5 values

are [1% but \70%. While the curves are closer together

than that expected for a typical fast-twitch fibre, the

separation between the curves is still significantly larger

than that of a typical slow-twitch fibre profile. These dif-

ferences in sensitivity cannot be attributed to differences in

sarcomere length as the sarcomere length was not signifi-

cantly different between the two groups (P [ 0.05;

Table 2).

MHC isoform separation

The separation of MHC isoforms revealed that muscle

fibres from the EDL of knock-in mice express a combi-

nation of isoforms that is not seen in muscle fibres from

wild type animals (Fig. 3). As expected, wild type animals

only express MHC I in fibres from the soleus, and MHC IIa

and/or MHC IIb in fibres from the EDL. In knock-in ani-

mals, fibres from the EDL expressed a combination of

MHC IIa and MHC I, and did not express MHC IIb. Fibres

from the soleus of knock-in animals expressed MHC I, the

same as wild type animals.

Discussion

This study confirmed previous published data that the

CHRNA4 gene is not expressed in skeletal muscles

(Mishina et al. 1986; Corriveau et al. 1995; Sala et al.

3.03.54.04.55.05.56.06.57.07.58.0

For

ce (

% o

f Max

.)

0

20

40

60

80

100

pCa (pSr) pCa (pSr)

3.03.54.04.55.05.56.06.57.07.58.0 3.03.54.04.55.05.56.06.57.07.58.0

3.03.54.04.55.05.56.06.57.07.58.0

For

ce (

% o

f Max

.)

0

20

40

60

80

100

0

20

40

60

80

100

0

20

40

60

80

100 DB

A C

Fig. 2 Ca2?- and Sr2?-activation profiles from wild type and knock-

in mice. Representative force–pCa (d) and force–pSr (s) curves for

slow- (A, B) and fast-twitch (C, D) fibres from a wild type animal (A,

C) and a knock-in animal (B, D). (j) pSr 5.5 parameter (the amount

of force developed at a Sr2? concentration of 3.0 9 10-6 M L-1).

This parameter is used to categorise the fibres as fast- or slow-twitch.

The sarcomere lengths of the fibres are A 2.67 lm, B 2.63 lm, C2.63 lm, D 2.59 lm. The amount of calcium, pCa = -log10 [Ca2?]

and strontium, pSr = -log10 [Sr2?] are plotted against relative force

expressed as a percentage of the maximum Ca2?- (Sr2?-) activated

force. The data has been fitted by the Hill equation

J Muscle Res Cell Motil (2009) 30:73–83 79

123

1996; Hogg et al. 2003). The assay used was designed to

detect both the mutant and wild type allele and we there-

fore also conclude that there is no aberrant expression of

the knock-in mutation in muscle of adult mice. Skeletal

muscles express a4 subunits transiently during very early

development (Corriveau et al. 1995). In this study, muscle

samples were taken from adult animals; thus the changes

observed in the properties of the skeletal muscles are

probably the result of the altered function of brain

expressed nAChRs. The skeletal muscles are not directly

affected by the S248F mutation as they do not express the

CHRNA4 gene. Transient expression of the mutant allele

during early development is unlikely to have a sustained

effect evident on analysis of adult muscle tissue.

The major finding in this study was that a mutation in

the nAChRs expressed in the brain induced changes in the

properties of the fast- and slow-twitch skeletal muscle

fibres in knock-in animals. These changes suggest the

neural impulse activity has been altered, which has been

clearly established to play a role in determining muscle

phenotype (Salmons and Sreter 1976; Salmons 1980;

Salmons and Henriksson 1981). This finding is highly

significant in terms of our model of ADNFLE. Mice with

the S248F mutation do not display spontaneous clinical

events suggestive of seizures or episodes of dystonia. A

very large number of mice were assessed over a long

period both by video recording of behaviour and epidural

and/or depth electrode electroencephalography. Dystonic

events resembling the brief nocturnal events seen in attacks

of ADNFLE in humans were only seen in the setting of

nicotine injection (Teper et al. 2007). The finding of the

current study suggest that mutant mice may either be

experiencing brief dystonic events that are not apparent by

simple behavioural observation or that the mutation is

associated with chronic modulation of neural input to the

muscles.

Fast-twitch fibres from the EDL and slow-twitch fibres

from the soleus of wild type animals showed the charac-

teristic activation properties observed for mammalian

muscles, exhibiting a greatly different sensitivity to Ca2?

and Sr2? in fast-twitch fibres, and a similar sensitivity in

Ca2? and Sr2? in slow-twitch fibres (Fink et al. 1986;

Bortolotto et al. 1999; West et al. 1999). The activation

profiles from the muscle fibres of the EDL from knock-in

animals were clearly different and not typical of fast-twitch

fibre profiles seen in wild type animals. The fibres showed

an increase in sensitivity to Sr2? which resulted in a

decreased pCa50 - pSr50 value and a higher pSr 5.5 value;

hence no fibre was classified as a typical fast- or slow-

twitch. A smaller separation between the force–pCa and

force–pSr curve is indicative of a greater contribution of

the slow-twitch component to the activation profile, as it is

known single fibres can express both fast- and slow-twitch

isoforms (Pette and Schnez 1977; Rubinstein et al. 1978;

Salmons and Henriksson 1981). MHC separation con-

firmed fibres from the EDL of knock-in animals

co-expressed MHC slow (MHC I) and fast (MHC IIa)

isoforms. MHC isoforms have been shown to have a strong

influence on the force–pSr curves (Bortolotto et al. 2000).

The expression of MHC I and possibly the emergence of

other slow isoforms being expressed in these fibres may be

responsible for changes in the activation properties. Due to

these changes, fibres from the EDL of knock-in animals

could be considered intermediate fibres. An increase in the

number of intermediate fibres in a muscle is considered an

indicator that a muscle is undergoing remodelling even

if the function of the muscle is not greatly affected

(Stephenson 2006).

In contrast, a different effect was seen in the properties

of slow-twitch fibres. The activation profiles of fibres from

the soleus muscle of knock-in animals showed a dramatic

change in sensitivity to both Ca2? and Sr2?. At pSr 5.5 the

force expressed as a percentage of the maximum signifi-

cantly decreased by over 30%. This, along with no sig-

nificant difference in the distance between the curves

(pCa50 - pSr50) of knock-in and wild type animals indi-

cates a decreased sensitivity to both Ca2? and Sr2?. This

may be due to a change in the TnC isoforms expressed,

changing the sensitivity of the contractile apparatus to

Ca2? and Sr2? (Grabarek et al. 1992; O’Connell et al.

2004a). There was no difference in the MHC isoforms

expressed (both groups expressed MHC I only).

Changes in the activation characteristics of muscle fibres

are due to the expression of the contractile and regulatory

proteins. The contribution of the different proteins

expressed in a fibre to the relationship between force and

Ca2? and Sr2? has been studied using single fibres from an

SOLEUS EDL WT KI WT KI

* * ******

Fig. 3 Myosin heavy chain isoform expression of single fibres.

Myosin heavy chain (MHC) isoforms were separated via SDS–PAGE.

Wild type (WT); knock-in (KI); MHC I (*); MHC IIa (**); MHC IIb

(***).10 fibres from three animals were pooled for analysis of WT

and KI soleus. 14 fibres from three animals were pooled for analysis

of WT and KI EDL. Fibres from the soleus of both groups only

expressed MHC I. In the EDL, fibres from knock-in animals

expressed MHC I and MHC IIa only. Fibres from the EDL of wild

type animals expressed varying amounts of MHC IIa and/or MHC IIb

but never expressed MHC I

80 J Muscle Res Cell Motil (2009) 30:73–83

123

EDL and a soleus from the hind limbs of rats which had

been tied in either series or parallel (Lynch et al. 1995).

When two individual fast-twitch fibres were tied in parallel

the Ca2?- and Sr2?-activation curves were typical of the

profile for a single fast-twitch muscle fibre (Lynch et al.

1995). However, different profiles were obtained when a

single fast-twitch and a single slow-twitch fibre were tied

together in parallel. Theoretical curves were used to predict

the contribution of the fast and slow twitch components of

the curve. When the prediction was a 30% contribution

from fast-twitch and 70% from slow-twitch, the separation

between the force–pCa and force–pSr curves (pCa50 -

pSr50) was 0.38 log units compared to when the prediction

was 90% from a fast-twitch and 10% from a slow-twitch

fibre, where the separation between the force–pCa and

force–pSr curves was 1.18 log units. Therefore, a separa-

tion of 1.30 log units between the force–pCa and force–pSr

curves (observed in fast-twitch fibres of wild type animals)

is indicative of a fast-twitch component greater than 90%

and a slow-twitch component smaller than 10%. Fibres

from the EDL of knock-in animals had a pCa50 - pSr50

value of 1.01 ± 0.04; therefore it could be predicted that

this may result from a 75% contribution from fast-twitch

and a 25% contribution from slow-twitch.

Differences observed in the activation profiles are

probably the result from changes to a combination of iso-

forms and their interaction, rather than just a change to one

specific protein. For example, the change in sensitivity to

Ca2? and Sr2? is probably due to alterations of TnC iso-

forms being expressed and their interactions with the dif-

ferent MHC isoforms. TnC is the subunit to which Ca2?

and Sr2? bind to activate muscle fibre contraction. Tro-

ponin together with tropomyosin forms the Ca2? regulatory

complex of the thin filament. Troponin consists of three

subunits, the tropomyosin binding subunit, troponin T

(TnT), the inhibitory subunit, troponin I (TnI) and the

calcium binding subunit, troponin C (TnC). Isoforms for all

subunits exist for fast- and slow-twitch muscle fibres (Pette

and Staron 1990). TnC expressed with different TnT iso-

form(s) have been correlated with changes in the force–

pCa profiles (O’Connell et al. 2004a; Kischel et al. 2005)

as well as with the different combination of myosin heavy

chain isoforms (Piquet et al. 1997; Geiger et al. 1999;

O’Connell et al. 2004a). It has been established that the

isoforms expressed can be influenced by neural impulse

activity (Sreter et al. 1973; Brown et al. 1983).

The slope of the force–pCa curve was also significantly

different in the muscles from knock-in animals which

further suggests changes in the isoforms and subunits

expressed (Pette and Staron 1990; Bicer and Reiser 2004).

Different combinations of TnT isoforms in combination

with tropomyosin subunits are thought to determine the

slope of the force–pCa curve (Schachat et al. 1987).

Multiple isoforms for all the subunits of tropomyosin and

troponin exist for both slow- and fast-twitch muscles (Pette

and Staron 1990; West et al. 1999).

Our results provide evidence for a change in neural

impulse activity received by skeletal muscles associated

with a knock-in mutation in the a4 subunit of nAChRs

expressed in the brain. How the nAChRs induce a change

in neural impulse activity is not fully understood. It has

been shown that the S248F mutation results in a signifi-

cantly higher affinity of the nAChR to ACh as observed by

shifts in the EC50 values (Teper et al. 2007). This suggests

that the mutated receptors are more sensitive to ACh and

would be activated at lower concentrations of ACh.

These results are in line with the proposal that centrally

mediated neural tone is a major determinant of biochemical

and ultimately the biophysical properties of muscles.

Despite the lack of spontaneous dystonic events, our find-

ings suggest that mutant mice may be having subclinical

events or the mutation may chronically alter neural input to

the muscles.

Acknowledgments This study was supported by a project grant

from the National Health and Medical Research Council (NHMRC).

J.D. is a NHMRC practitioner fellow. Authors would like to thank Jim

Massalas (Howard Florey Institute) for his assistance with the S248F

mouse strain and Prof. George Stephenson (La Trobe University) for

helpful suggestions and critically reading the manuscript.

References

Ashley CC, Moisescu DG (1977) Effect of changing the composition

of the bathing solutions upon the isometric tension–pCa

relationship in bundles of crustacean myofibrils. J Physiol 270:

627–652

Bicer S, Reiser PJ (2004) Myosin light chain isoform expression among

single mammalian skeletal muscle fibers: species variations.

J Muscle Res Cell Motil 25:623–633. doi:10.1007/s10974-004-

5070-9

Bortolotto SK, Stephenson DG, Stephenson GM (1999) Fiber type

populations and Ca2?-activation properties of single fibers in

soleus muscles from SHR and WKY rats. Am J Physiol 276:

C628–C637

Bortolotto SK, Cellini M, Stephenson DG, Stephenson GM (2000)

MHC isoform composition and Ca(2?)- or Sr(2?)-activation

properties of rat skeletal muscle fibers. Am J Physiol Cell Physiol

279:C1564–C1577

Brown WE, Salmons S, Whalen RG (1983) The sequential replace-

ment of myosin subunit isoforms during muscle type transfor-

mation induced by long term electrical stimulation. J Biol Chem

258:14686–14692

Buller AJ, Eccles JC, Eccles RM (1960) Interactions between

motoneurones and muscles in respect of the characteristic speeds

of their responses. J Physiol 150:417–439

Close R (1969) Dynamic properties of fast and slow skeletal muscles

of the rat after nerve cross-union. J Physiol 204:331–346

Corriveau RA, Romano SJ, Conroy WG, Oliva L, Berg DK (1995)

Expression of neuronal acetylcholine receptor genes in verte-

brate skeletal muscle during development. J Neurosci 15:

1372–1383

J Muscle Res Cell Motil (2009) 30:73–83 81

123

Cox H, Costin-Kelly NM, Ramani P, Whitehouse WP (2000) An

established case of dentatorubral pallidoluysian atrophy

(DRPLA) with unusual features on muscle biopsy. Eur J Paediatr

Neurol 4:119–123. doi:10.1053/ejpn.2000.0279

Edstrom L, Gremski W, Wroblewski R (1979) Sulphur and

phosphorus content in relation to fibre composition and atrophy

of skeletal muscle in patients with Parkinson’s disease. J Neurol

Sci 41:311–323. doi:10.1016/0022-510X(79)90092-3

Fink RH, Stephenson DG, Williams DA (1986) Calcium and

strontium activation of single skinned muscle fibres of normal

and dystrophic mice. J Physiol 373:513–525

Fink RH, Stephenson DG, Williams DA (1990) Physiological proper-

ties of skinned fibres from normal and dystrophic (Duchenne)

human muscle activated by Ca2? and Sr2?. J Physiol 420:337–353

Geiger PC, Cody MJ, Sieck GC (1999) Force-calcium relationship

depends on myosin heavy chain and troponin isoforms in rat

diaphragm muscle fibers. J Appl Physiol 87:1894–1900

Grabarek Z, Tao T, Gergely J (1992) Molecular mechanism of

troponin-C function. J Muscle Res Cell Motil 13:383–393. doi:

10.1007/BF01738034

Gundersen K, Leberer E, Lomo T, Pette D, Staron RS (1988) Fibre

types, calcium-sequestering proteins and metabolic enzymes in

denervated and chronically stimulated muscles of the rat. J Physiol

398:177–189

Hayashi R, Hashimoto T, Tada T, Ikeda S (2001) Relation between

changes in long-latency stretch reflexes and muscle stiffness in

Parkinson’s disease—comparison before and after unilateral palli-

dotomy. Clin Neurophysiol 112:1814–1821. doi:10.1016/S1388-

2457(01)00642-3

Hennig R, Lomo T (1985) Firing patterns of motor units in normal

rats. Nature 314:164–166. doi:10.1038/314164a0

Hill AV (1910) A new mathematical treatment of changes of ionic

concentration in muscle and nerve under the action of electric

currents, with a theory as to their mode of excitation. J Physiol

40:190–224

Hogg RC, Raggenbass M, Bertrand D (2003) Nicotinic acetylcholine

receptors: from structure to brain function. Rev Physiol Biochem

Pharmacol 147:1–46. doi:10.1007/s10254-003-0005-1

Hoh JF (1975) Selective and non-selective reinnervation of fast-twitch

and slow-twitch rat skeletal muscle. J Physiol 251:791–801

Kischel P, Bastide B, Muller M, Dubail F, Offredi F, Jin JP, Mounier

Y, Martial J (2005) Expression and functional properties of four

slow skeletal troponin T isoforms in rat muscles. Am J Physiol

Cell Physiol 289(2):C437–C443

Lynch GS, Stephenson DG, Williams DA (1995) Analysis of Ca2?

and Sr2? activation characteristics in skinned muscle fibre

preparations with different proportions of myofibrillar isoforms.

J Muscle Res Cell Motil 16:65–78. doi:10.1007/BF00125311

Mishina M, Takai T, Imoto K, Noda M, Takahashi T, Numa S,

Methfessel C, Sakmann B (1986) Molecular distinction between

fetal and adult forms of muscle acetylcholine receptor. Nature 321:

406–411. doi:10.1038/321406a0

Moisescu DG (1976) Kinetics of reaction in calcium-activated skinned

muscle fibres. Nature 262:610–613. doi:10.1038/262610a0

O’Connell B, Nguyen LT, Stephenson GM (2004a) A single-fibre

study of the relationship between MHC and TnC isoform

composition in rat skeletal muscle. Biochem J 378:269–274. doi:

10.1042/BJ20031170

O’Connell B, Stephenson DG, Blazev R, Stephenson GM (2004b)

Troponin C isoform composition determines differences in

Sr(2?)-activation characteristics between rat diaphragm fibers.

Am J Physiol Cell Physiol 287:C79–C87. doi:10.1152/ajpcell.

00555.2003

Pette D, Schnez U (1977) Coexistence of fast and slow type myosin

light chains in single muscle fibres during transformation as

induced by long term stimulation. FEBS Lett 83:128–130. doi:

10.1016/0014-5793(77)80656-X

Pette D, Staron RS (1990) Cellular and molecular diversities of

mammalian skeletal muscle fibers. Rev Physiol Biochem

Pharmacol 116:1–76

Phillips HA, Scheffer IE, Berkovic SF, Hollway GE, Sutherland GR,

Mulley JC (1995) Localization of a gene for autosomal dominant

nocturnal frontal lobe epilepsy to chromosome 20q 13.2. Nat

Genet 10:117–118. doi:10.1038/ng0595-117

Piquet F, Stevens L, Butler-Browne GS, Mounier Y (1997) Contrac-

tile properties and myosin heavy chain composition of newborn

rat soleus muscles at different stages of postnatal development.

J Muscle Res Cell Motil 18:71–79. doi:10.1023/A:1018633017

143

Rees BB, Stephenson DG (1987) Thermal dependence of maximum

Ca2?-activated force in skinned muscle fibres of the toad Bufomarinus acclimated at different temperatures. J Exp Biol 129:

309–327

Rossi B, Siciliano G, Carboncini MC, Manca ML, Massetani R,

Viacava P, Muratorio A (1996) Muscle modifications in

Parkinson’s disease: myoelectric manifestations. Electroencep-

halogr Clin Neurophysiol 101:211–218. doi:10.1016/0924-980X

(96)94672-X

Rubinstein N, Mabuchi K, Pepe F, Salmons S, Gergely J, Sreter F

(1978) Use of type-specific antimyosins to demonstrate the

transformation of individual fibers in chronically stimulated

rabbit fast muscles. J Cell Biol 79:252–261. doi:10.1083/jcb.

79.1.252

Sala C, Kimura I, Santoro G, Kimura M, Fumagalli G (1996)

Expression of two neuronal nicotinic receptor subunits in

innervated and denervated adult rat muscle. Neurosci Lett 215:

71–74. doi:10.1016/0304-3940(96)12923-2

Salmons S (1980) Functional adaptation in skeletal muscle. Trends

Neurosci 3:134–137. doi:10.1016/0166-2236(80)90050-8

Salmons S, Henriksson J (1981) The adaptive response of skeletal muscle

to increased use. Muscle Nerve 4:94–105. doi:10.1002/mus.8800

40204

Salmons S, Sreter FA (1976) Significance of impulse activity in the

transformation of skeletal muscle type. Nature 263:30–34. doi:

10.1038/263030a0

Salmons S, Vrbova G (1969) The influence of activity on some

contractile characteristics of mammalian fast and slow muscles.

J Physiol 201:535–549

Schachat FH, Diamond MS, Brandt PW (1987) Effect of different

troponin T-tropomyosin combinations on thin filament activa-

tion. J Mol Biol 198:551–554. doi:10.1016/0022-2836(87)

90300-7

Scheffer IE, Bhatia KP, Lopes-Cendes I, Fish, Marsden CD, Ander-

mann E, Andermann F, Desbiens R, Keene D, Cendes F et al

(1995) Autosomal dominant nocturnal frontal lobe epilepsy. A

distinctive clinical disorder. Brain 118(Pt 1):61–73. doi:10.1093/

brain/118.1.61

Sharott A, Grosse P, Kuhn AA, Salih F, Engel AK, Kupsch A,

Schneider GH, Krauss JK, Brown P (2008) Is the synchroniza-

tion between pallidal and muscle activity in primary dystonia

due to peripheral afferance or a motor drive? Brain 131:473–484.

doi:10.1093/brain/awm324

Sliwinski A, Stanic D, Finkelstein DI, Ilic M, West JM, Dooley PC

(2005) Alterations in the proportions of skeletal muscle proteins

following a unilateral lesion to the substantia nigra pars compacta

of rats. J Muscle Res Cell Motil 26:149–155. doi:10.1007/

s10974-005-6833-7

Sreter FA, Gergely J, Salmons S, Romanul F (1973) Synthesis by fast

muscle of myosin light chains characteristic of slow muscle in

response to long-term stimulation. Nat New Biol 241:17–19

82 J Muscle Res Cell Motil (2009) 30:73–83

123

Steinlein OK, Mulley JC, Propping P, Wallace RH, Phillips HA,

Sutherland GR, Scheffer IE, Berkovic SF (1995) A missense

mutation in the neuronal nicotinic acetylcholine receptor alpha 4

subunit is associated with autosomal dominant nocturnal frontal

lobe epilepsy. Nat Genet 11:201–203. doi:10.1038/ng1095-201

Stephenson DG (2006) Tubular system excitability: an essential

component of excitation-contraction coupling in fast-twitch

fibres of vertebrate skeletal muscle. J Muscle Res Cell Motil

27:259–274. doi:10.1007/s10974-006-9073-6

Stephenson DG, Williams DA (1982) Effects of sarcomere length on

the force–pCa relation in fast- and slow-twitch skinned muscle

fibres from the rat. J Physiol 333:637–653

Syrovy I (1987) Isoforms of contractile proteins. Prog Biophys Mol

Biol 49:1–27. doi:10.1016/0079-6107(87)90007-1

Takakusaki K, Habaguchi T, Ohtinata-Sugimoto J, Saitoh K,

Sakamoto T (2003) Basal ganglia efferents to the brainstem

centers controlling postural muscle tone and locomotion: a new

concept for understanding motor disorders in basal ganglia

dysfunction. Neuroscience 119:293–308. doi:10.1016/S0306-

4522(03)00095-2

Takakusaki K, Habaguchi T, Saitoh K, Kohyama J (2004a) Changes in

the excitability of hindlimb motoneurons during muscular atonia

induced by stimulating the pedunculopontine tegmental nucleus

in cats. Neuroscience 124:467–480. doi:10.1016/j.neuroscience.

2003.12.016

Takakusaki K, Oohinata-Sugimoto J, Saitoh K, Habaguchi T (2004b)

Role of basal ganglia-brainstem systems in the control of postural

muscle tone and locomotion. Prog Brain Res 143:231–237. doi:

10.1016/S0079-6123(03)43023-9

Takakusaki K, Saitoh K, Harada H, Kashiwayanagi M (2004c) Role

of basal ganglia-brainstem pathways in the control of motor

behaviors. Neurosci Res 50:137–151. doi:10.1016/j.neures.

2004.06.015

Talmadge RJ, Roy RR (1993) Electrophoretic separation of rat

skeletal muscle myosin heavy-chain isoforms. J Appl Physiol

75:2337–2340

Teper Y, Whyte D, Cahir E, Lester HA, Grady SR, Marks MJ, Cohen

BN, Fonck C, McClure-Begley T, McIntosh JM, Labarca C,

Lawrence A, Chen F, Gantois I, Davies PJ, Petrou S, Murphy M,

Waddington J, Horne MK, Berkovic SF, Drago J (2007)

Nicotine-induced dystonic arousal complex in a mouse line

harboring a human autosomal-dominant nocturnal frontal lobe

epilepsy mutation. J Neurosci 27:10128–10142. doi:10.1523/

JNEUROSCI.3042-07.2007

West JM, Stephenson DG (1993) Ca2? and Sr2? activation properties

of skinned muscle fibres with different regulatory systems from

crustacea and rat. J Physiol 462:579–596

West JM, Barclay CJ, Luff AR, Walker DW (1999) Developmental

changes in the activation properties and ultrastructure of fast-

and slow-twitch muscles from fetal sheep. J Muscle Res Cell

Motil 20:249–264. doi:10.1023/A:1005433809414

Wong JY, Ross SA, McColl C, Massalas JS, Powney E, Finkelstein

DI, Clark M, Horne MK, Berkovic SF, Drago J (2002)

Proconvulsant-induced seizures in alpha(4) nicotinic acetylcho-

line receptor subunit knockout mice. Neuropharmacology 43:

55–64. doi:10.1016/S0028-3908(02)00067-9

J Muscle Res Cell Motil (2009) 30:73–83 83

123

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.