Actors of the tyrosine kinase receptor downstream signaling pathways

in amphioxus

Stephanie Bertrand,a,b Florent Campo-Paysaa,b,1 Alain Camasses,b Jordi Garcıa-Fernandez,a andHector Escrivab,�

aDepartament de Genetica, Facultat de Biologia, Universitat de Barcelona, Av. Diagonal 645, edifici annex, 1a planta,

08028 Barcelona, SpainbCNRS UMR 7628, UPMC Univ Paris 06, Observatoire oceanographique, F-66651 Banyuls-sur-Mer, France�Author for correspondence (email: hector.escriva@obs-banyuls.fr)

1Present address: Universite de Lyon, Institut de Genomique Fonctionnelle de Lyon, Molecular Zoology team, Ecole Normale Superieure de Lyon, Universite

Lyon 1, CNRS, INRA, Institut Federatif 128 Biosciences Gerland Lyon Sud, France.

SUMMARY One of the major goals of evo-developmentalistsis to understand how the genetic mechanisms controllingembryonic development have evolved to create the currentdiversity of bodyplans that we encounter in the animal kingdom.Tyrosine kinase receptors (RTKs) are transmembranereceptors present in all metazoans known to control severaldevelopmental processes. They act via the activation of variouscytoplasmic signaling cascades, including the mitogen-activated protein kinase (MAPK), the PI3K/Akt, and thephospholipase C-g (PLCg)/protein kinase C (PKC) pathways.In order to address the evolution of these three pathwaysand their involvement during embryogenesis in chordates,we took advantage of the complete genome sequencing of a

key evolutionarily positioned species, the cephalochordateamphioxus, and searched for the complete gene set of thethree signaling pathways. We found that the amphioxusgenome contains all of the most important modules of theRTK-activated cascades, and looked at the embryonicexpression of two genes selected from each cascade. Ourdata suggest that although the PI3K/Akt pathway may haveubiquitous functions, the MAPK and the PLCg/PKC cascadesmay play specific roles in amphioxus development. Togetherwith data known in vertebrates, the expression pattern ofPKC in amphioxus suggests that the PLCg/PKC cascadewas implicated in neural development in the ancestor ofall chordates.

INTRODUCTION

Only a few signaling pathways are known to be implicated in

cell–cell interactions during embryonic development in meta-

zoans (Barolo and Posakony 2002). Some of these pathways

involve tyrosine kinase receptors (RTKs). RTKs are plasma

membrane receptors found in all animals as well as choano-

flagellates, which are thought to have diverged just before the

appearance of the first metazoans (King and Carroll 2001).

They control several cellular processes, such as cell migration,

cell survival, and cell differentiation. Members of this super-

family have a modular structure with a conserved cytoplasmic

tyrosine kinase domain, and can be classified based on the

nature of their variable ligand-binding extracellular domain.

Following ligand binding, RTKs usually form homodimers

and phosphorylate each other, leading to the activation of

several downstream signaling cascades. Three major path-

ways are thus activated: the mitogen-activated protein kinase

(MAPK) pathway, the PI3K/Akt pathway, and the phospho-

lipase C-g (PLCg)/protein kinase C (PKC) pathway (Fig. 1).

The activation of MAPK and PI3K/Akt pathways both start

with the recruitment of the Grb2/Shp2/Gab1/Sos complex

to the cytoplasmic membrane (Kouhara et al. 1997). This

recruitment can be indirect for RTKs lacking the pYXN-

binding site for the Src homology 2 (SH2) domain of Grb2

(i.e., fibroblast growth factor [FGF] receptors). In this case,

docking proteins like FGF receptor substrate 2 (FRS2) or Shc

are needed (Kouhara et al. 1997). In the case of the MAPK

pathway, Sos catalyzes GDP release and GTP binding to the

Ras protein. Ras then binds to its effector Raf, thereby

allowing activation of one MAPKmodule, which finally leads

to the activation of several transcription factors (Jelinek et al.

1996). The recruitment of the Grb2/Shp2/Gab1/Sos complex

also activates PI3K, which can be further stimulated by bind-

ing to activated Ras protein. PI3K then converts the plasma

membrane lipid PIP2 to PIP3 (phosphatidylinositol diphos-

phate to triphosphate). Proteins possessing plekstrin homo-

logy (PH) domains bind directly to PIP3 at the membrane,

most notably Akt and PDK. These proteins being at prox-

imity, PDK can phosphorylate Akt, which then phosphory-

EVOLUTION & DEVELOPMENT 11:1, 13 –26 (2009)

DOI: 10.1111/j.1525-142X.2008.00299.x

& 2009 The Author(s)

Journal compilation & 2009 Wiley Periodicals, Inc.

13

lates many other proteins (see Cantley 2002 for a review).

Phosphorylation of RTKs on their tyrosines also allows in-

teraction with the SH2 domains of PLCg, the phosphorylat-

ion of which leads to its activation. PLCg then catalyzes the

hydrolysis of membrane PIP2 into IP3 and DAG. IP3 then

activates calcium signaling whereas DAG activates PKC (for

a review, see Rhee 2001 and Carpenter and Ji 1999).

One of the most intriguing questions faced by researchers

interested in the evolution of developmental mechanisms, or

‘‘evo-devo,’’ is how the modification of a few signaling

pathways has been an important factor in generating so many

different forms and functions in the animal kingdom. The

first step toward answering this question is the comparison

of the members of these pathways present in different

species, and particularly in species placed at key evolution-

ary positions. In our understanding of the appearance of

vertebrates from an invertebrate animal, amphioxus (genus

Branchiostoma) has long been a reliable model. Indeed,

for a century amphioxus was thought to be the closest living

invertebrate relative of vertebrates. New phylogenetic

analysis, taking advantage of the sequencing of the whole

or partial genomes of several deuterostome species, recently

left little doubt that cephalochordates, and therefore amp-

hioxus, have diverged before urochordates and that they are

more likely basal chordates (Oda et al. 2002; Blair et al. 2005;

Bourlat et al. 2006; Delsuc et al. 2006; Wada et al. 2006).

In addition, morphological and genetic data suggest that

amphioxus is much less derived than model urochordates like

Ciona intestinalis, and it may therefore be a key animal model

for the study of the appearance and evolution of both

chordates and vertebrates (Schubert et al. 2006). In addition

to the availability of classical developmental biology techni-

ques, the sequencing of the complete genome of the Florida

species of amphioxus (Branchiostoma floridae) strengthens

this position, offering new possibilities. In particular, it is

now straightforward to look for the complete set of genes

implicated in major developmental pathways, allowing

comparisons with vertebrates.

Taking advantage of the accessibility to the amphioxus

genome sequence, we have searched for all the genes coding

for the proteins implicated in the three main downstream

cascades activated by RTKs. Our genomic survey shows

that the amphioxus genome contains representatives of all the

essential constituents of the RTK-activated pathways. To

deepen our analysis, we decided to look at the expression

patterns, throughout the course of amphioxus embryonic

development, of three pairs of genes that can be considered

a signature of the three main downstream cascades activated

by RTKs. Our results suggest that the PI3K/Akt pathways

have ubiquitous functions during embryogenesis, whereas

the MAPK and the PLCg pathways might have specific

functions during notochord and central nervous system

development, respectively. This result, in combination with

known data from vertebrates, suggests that the neural func-

tion of the PLCg/PKC cascade was already present in the

ancestor of all chordates.

Fig. 1. Schematic diagram of the tyrosinekinase receptor (RTK)-activated cyto-plasmic signaling pathways. The proteinsof the mitogen-activated protein kinase(MAPK), PI3K/Akt, and phospholipaseC-g (PLCg)/PKC pathways are in darkgray, light gray, and white, respectively.Gray arrows indicate protein activation.

14 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

MATERIALS AND METHODS

Searching for orthologsA complete set of protein sequences for each of the studied gene

families was established to query the predicted peptides from the

B. floridae genome on the JGI website (http://genome.jgi-psf.org/

euk_cur1.html) first by BlastP (Altschul et al. 1990). The cutoff value

of sequence similarity was individually determined for each gene

group. Because the sequence of the B. floridae genome was made

from a single animal, and because of the high polymorphism of this

organism, we often found two gene models corresponding to a single

gene. For each gene, we chose the best model to do the phylogenetic

analysis. In Tables 1–3, the accession number for the entries that

were not used in our phylogenetic analysis are presented in brackets.

The orthology relationships of the sequences obtained from the

amphioxus genome were tested by phylogenetic analysis. All pro-

tein sequences were aligned using ClustalX (Thompson et al. 1997)

and alignments were manually corrected using the SEAVIEW

program (Galtier et al. 1996). Only complete sites (without gaps or

Xs) were used for phylogenetic reconstruction, and for several

protein families, only conserved domains were considered. Phylo-

genetic trees were first built using neighbor-joining with Poisson’s

correction and 1000 bootstrap repetitions with the PHYLO_WIN

software (Galtier et al. 1996). When resolution was poor, trees

were rebuilt using PHYML (Guindon and Gascuel 2003;

Guindonet al. 2005), a fast and accurate maximum likelihood

heuristic, under the JTT substitution model (Jones et al. 1992),

with a gamma distribution of rates between sites (four categories,

parameter a estimated by PHYML). For some superfamilies, we

had to consider the phylogeny of each vertebrate paralogy group

separately because the whole family topology was not resolved by

any of these methods. When we did not find orthologs of known

C. intestinalis sequences or of known vertebrate paralogy groups,

we looked at the genomic sequences using TBlastN. The genomic

sequences collected were therefore used for gene prediction using

GENSCAN (Burge and Karlin 1997) and the protein sequences

obtained were analyzed as described above.

Cloning of Branchiostoma lanceolatum cDNAsOne microgram of total RNA extracted from adult B. lanceolatum

was retro-transcribed using MMLV reverse transcriptase (Promega,

Charbonnieres, France) and was used for polymerase chain reaction

(PCR) using specific primers designed according to the B. floridae

sequences of AmphiAKT, AmphiPDK, AmphiPKCalpha/beta/gam-

ma, AmphiPLCgamma, AmphiRAF, and AmphiH/K/NRASa. PCR

products were cloned into pGEMs-T Easy vector (Promega) and

individual clones were sequenced. The primer sequences are as fol-

lows:

AKT-50 CTCTCCTACCAACATCTCAAAGATGA

AKT-30 TAACATTGAAAATTACCTGCACCCAG

PDK-50 GGTATACCTTCGAATCCGGACCCTCT

PDK-30 TGAATGATACCCAGACCATGTAGATG

PKC-50 GCCTGACTTAAGTTAGGATACAAAGC

PKC-30 CTCTCCTACCAACATCTCAAAGATGA

PLC-50 CGAGAGAACTCCATCTTCAATGAAGC

PLC-30 TGCCATGGTTCTCTGCTGGGCTATAT

RAF-50 TACCTACATGCAAAGCACATCATCCA

RAF-30 AAAGGCTGCAAACTGGCCCTGGATGG

RAS-50 ATGACGGAGTACAAGTTGGTGGTGGT

RAS-30 CAACAGAACACAGCAGGTCCCGCTAG

The accession numbers for the sequences of the isolated cDNAs

are:

AmphiAKT: EF540865, AmphiPDK: EF540860, AmphiPK

Calpha/beta/gamma: EF540864, AmphiPLCgamma: EF540861,

AmphiRAF: EF540862, AmphiH/K/NRASa: EF540863.

Embryonic expression analysisRipe animals of the Mediterranean amphioxus (B. lanceolatum)

were collected in Argeles-sur-Mer (France), and gametes were

obtained by heat stimulation (Fuentes et al. 2004, 2007). Partial

fragments of AmphiAKT, AmphiPDK, AmphiPKCalpha/beta/gam-

ma, AmphiPLCgamma, AmphiRAF, and AmphiH/K/NRASa

subcloned into pBSKS (Stratagene, Amsterdam, Netherlands)

were used for the synthesis of sense and anti-sense riboprobes.

Fixation and whole-mount in situ hybridizations were performed

as described (Holland et al. 1996), but using BM Purple (Roche,

Neuilly-sur-Seine, France) for the chromogenic reaction step. Sense

and anti-sense analysis were realized in parallel, and no labeling

was observed for any sense probe.

Table 1. Amphioxus genes for the mitogen-activated protein kinase (MAPK) and PI3K/Akt pathways common proteins1

Group Gene name Branchiostoma floridae genome accession no. Best reciprocal BLAST hit in human

FRS/DOK/IRS AmphiFRS jgi|Brafl1|95597 (jgi|Brafl1|96659) FRS3/CAI13184

AmphiDOK1/2/3 jgi|Brafl1|75227 DOK2/NP_003965

AmphiDOK4/5/6 jgi|Brafl1|214258 (jgi|Brafl1|218820) DOK6/Q6PKX4

AmphiIRS jgi|Brafl1|124878 (jgi|Brafl1|124878132514) IRS1/NP_005535

Grb2 AmphiGRB2 scaffold_575 (scaffold_4) GRB2/NP_002077

Shp AmphiSHP scaffold_149 (sacffold_150) SHP2/Q06124

Sos AmphiSOS jgi|Brafl1|275769 (jgi|Brafl1|113623) SOS2/BAD92514

1For each amphioxus gene, the name, the accession number corresponding to the protein sequence at the jgi webpage, or the scaffold we used forgene prediction, and the best reciprocal BLAST hits in the human proteome are given. The accession numbers in brackets correspond to the secondprediction found for each gene when it exists (see ‘‘Materials and methods’’).

RTK downstream signaling pathways in amphioxus 15Bertrand et al.

RESULTS AND DISCUSSION

Our first aim was to isolate the complete set of genes coding

for the proteins acting downstream of RTKs in the genome of

amphioxus. Figure 1 schematizes the three signaling cascades

activated by RTKs, including all the proteins analyzed in the

present study.

MAPK and PI3K pathway common actors

Docking proteins

Docking proteins are implicated in the transmission of the

signal from several RTKs to the MAPK and PI3K signaling

pathways (Fig. 1). One group of docking proteins is charac-

terized by the presence of a well-conserved phosphotyrosine-

binding site (PTB) domain, which allows interaction with

the phosphotyrosines of the RTK. This group includes

FGF receptor substrate (FRS) proteins, downstream of

tyrosine kinase (DOK) proteins, and insulin receptor sub-

strate (IRS) proteins. We have found four orthologous genes

to the vertebrate docking proteins in the genome of B. floridae

(see Table 1 and Fig. 2). Phylogenetic analysis using the PTB

domain showed that amphioxus possesses: (i) a single

AmphiFRS placed at the base of FRS2 and FRS3

(as for C. intestinalis or Drosophila), (ii) two DOK protein-

coding genes named AmphiDOK1/2/3 and AmphiDOK4/5/6,

placed at the base of vertebrate DOK1,2,3 and DOK4,5,6,

respectively, and (iii) a single IRS gene, AmphiIRS, or-

thologous to the four vertebrate IRS genes. Another docking

protein is Shc, also possessing a PTB domain as well as an

SH2 domain. In vertebrates, there are four Shc genes, but only

one is known in Drosophila. In amphioxus we have found a

Table 2. Amphioxus genes for the mitogen-activated protein kinase (MAPK) pathway1

Group Gene name Branchiostoma floridae genome accession no. Best reciprocal BLAST hit in human

RAS AmphiM-RAS jgi|Brafl1|114321 (jgi|Brafl1|61835) M-RAS/AAV38860

AmphiR-RAS jgi|Brafl1|199337 (jgi|Brafl1|57645) R-RAS/NP_036382

AmphiH/K/N-RASa jgi|Brafl1|62308 (jgi|Brafl1|271363) N-RAS/NP_002515

AmphiH/K/N-RASb jgi|Brafl1|61057 (jgi|Brafl1|59113) N-RAS/NP_002515

AmphiRALA/B jgi|Brafl1|58968 (jgi|Brafl1|273483) RALA/NP_005393

AmphiRAP1A/B jgi|Brafl1|209131(jgi|Brafl1|271393) RAP1B/AAH95467

AmphiRAP2A/B/C jgi|Brafl1|63015 (jgi|Brafl1|79041) RAP2C/NP_067006

AmphiRHEB jgi|Brafl1|131929 (jgi|Brafl1|120734) RHEB/NP_005605

AmphiRERG jgi|Brafl1|92366 (jgi|Brafl1|236041) RERG/NP_116307

AmphiRASL12 jgi|Brafl1|258317 RASL12/NP_057647

AmphiNKIRAS jgi|Brafl1|80117(jgi|Brafl1|222092) NKIRAS2/NP_060065

MAPKKK AmphiMAPKKK1 jgi|Brafl1|70444 (jgi|Brafl1|70437) MAPKKK1/AAC97073

AmphiMAPKKK2/3 jgi|Brafl1|221293 MAPKKK2/XP_001128799

AmphiMAPKKK5/6 jgi|Brafl1|252900 (jgi|Brafl1|219597) MAPKKK15/CAI40279

AmphiMAPKKK7 jgi|Brafl1|125878 MAPKKK7/NP_663304

AmphiMAPKKK9/10/11 jgi|Brafl1|65791 (jgi|Brafl1|202719) MAPKKK9/NP_149132

AmphiMAPKKK12/13 jgi|Brafl1|66872 (jgi|Brafl1|230864) MAPKKK12/AAH50050

AmphiMAPKKK14 jgi|Brafl1|84620 (jgi|Brafl1|88067) MAPKKK14/AAH35576

AmphiMLTK jgi|Brafl1|76434 (jgi|Brafl1|235147) MLTK/BAD92211

AmphiMOS jgi|Brafl1|126429 (jgi|Brafl1|257678) MOS/NP_005363

AmphiKSR jgi|Brafl1I230463 KSR2/NP_775869

AmphiRaf scaffold_27 BRAF/AAA96495

MAPKK AmphiMAPKK1/2 jgi|BraflI124326 (jgi|BraflI113013) MAPKK1/NP_002746

AmphiMAPKK4 jgi|BraflI129331 (jgi|BraflI125171) MAPKK4/AAH36032

AmphiMAPKK5 scaffold_71 MAPKK5/NP_002748

AmphiMAPKK3/6 jgi|Brafl266623 (jgi|Brafl200264) MAPKK6/NP_002749

AmphiMAPKK7 jgi|Brafl99242 (jgi|Brafl99237) MAPKK7/NP_660186

MAPK AmphiERK1/2 jgi|Brafl60037 (jgi|Brafl218574) ERK1/AAK52330

AmphiERK5 jgi|Brafl59938 (jgi|Brafl84433) MAPK7/ERK5/NP_002740

AmphiP38 jgi|Brafl93656 (jgi|Brafl85282) MAPK14/P38ALPHA/NP_620581

AmphiJNK jgi|Brafl251426 (jgi|Brafl86371) MAPK8/JNK1/NP_620635

AmphiNLK jgi|Brafl256229 (jgi|Brafl219176) NLK/AAF04857

AmphiMAPK15 jgi|Brafl88155 (jgi|Brafl123996) MAPK15/NP_620590

1For each amphioxus gene, the name, the accession number corresponding to the protein sequence at the jgi webpage, or the scaffold we used forgene prediction, and the best reciprocal BLAST hits in the human proteome are given. The accession numbers in brackets correspond to the secondprediction found for each gene when it exists (see ‘‘Materials and methods’’).

16 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

single AmphiSHC gene that is the ortholog of all vertebrate

Shc genes (see Table 1).

Other docking proteins include Grb2, Shp, and Sos.

Growth factor receptor-bound protein 2 (Grb2) possesses two

Src homology 3 (SH3) domains with one SH2 domain

in between. Alignment of these conserved domains was used

to make the phylogenetic analysis, showing the presence

of one AmphiGRB2 orthologous to the vertebrates Grb2, to

Ciona Grb2, and to Drosophila Drk (downstream of receptor

kinase) (see Table 1).

Vertebrate Shp-1 and Shp-2 are nonreceptor protein tyro-

sine phosphatases with two SH2 domains and one protein

tyrosine phosphatase catalytic (PTPc) domain. The phyloge-

netic analysis made using the PTPc domain showed that

there is only one member in amphioxus (AmphiSHP), like

in Drosophila (named corkscrew). Unexpectedly, neither cork-

screw nor AmphiSHP are placed at the base of vertebrate

Shp-1 and Shp-2, but rather occur at the base of vertebrate

Shp-2, using both neighbor-joining and maximum likelihood

methods (even if this position is supported by a low bootstrap

value). Vertebrate Shp-2 has been described as the functional

ortholog of Drosophila corkscrew (Perkins et al. 1996) and

several data suggest that Shp-1 is a negative regulator of

tyrosine kinase receptor pathways whereas Shp-2 is an acti-

vator (see Zhang et al. 2000; Neel et al. 2003 for a review).The

phylogenetic position of the Drosophila and amphioxus Shp

orthologs may reflect a high divergence of Shp-1 sequences

that may be associated with the acquisition of a new function

specifically for the vertebrate Shp-1.

Finally, two members of the Sos group of genes are known

in vertebrates, Sos1 and Sos2. One member was found in

amphioxus, as in Drosophila, and the phylogenetic analysis

using the whole sequence shows that it is placed at the base of

the vertebrate duplication.

MAPK pathway

RAS GTPases

RAS GTPases form a superfamily of Ser/Thr kinases, which

contain a RAS domain, and 36 members are known in

human. Because the phylogeny for the whole family is difficult

to resolve, we undertook separate analyses for the different

subfamilies. In the amphioxus genome we found orthologs

for several vertebrate genes, always placed at the base of the

vertebrate paralogy groups, which suggests a high level of

gene retention in this family after the two genome duplication

events that took place between the divergence of amphioxus

and vertebrates. The amphioxus RAS GTPases include a

single ortholog of M-Ras, R-Ras; two different H/N/K-Ras

proteins (at the base of H, N, and K-Ras), probably the

result of an amphioxus-specific gene duplication; as well as

RalA/B, Rap1A/B, Rap2A/B/C, Rheb, Rerg, RasL12, and

NKI (see Table 2).

MAPKKK/MEKK

MAPKKKs form a big family of proteins (more than 20

members are known in mammals), all containing a Ser/Thr

kinase domain (STK domain). In the amphioxus genome we

found 11 members of this family, which can be placed with

high confidence in the phylogenetic tree using the alignment of

STK domains, whereas only eight were previously described

in the genome of C. intestinalis (see Fig. 3) (Satou et al. 2003).

We found one AmphiMAPKKK1, one AmphiMAPKKK2/3

placed at the base of vertebrate MAPKKK2 and MAPKKK3,

Table 3. Amphioxus genes for the PI3K and phospholipase C-g (PLCg)/PKC pathways1

Group Gene name Branchiostoma floridae genome accession no. Best reciprocal BLAST hit in human

Gab AmphiGAB jgi|Brafl63588 (jgi|Brafl255068) GAB1/NP_997006

PI3K AmphiP110alpha jgi|Brafl228095 (jgi|Brafl287925) P110ALPHA/BAE06102

AmphiP110beta/delta jgi|Brafl94886 (jgi|Brafl112912) P110DELTA/CAI15703

AmphiCII jgi|Brafl281636 (jgi|Brafl233446) CIIALPHA/AAI13659

AmphiVPS34 jgi|Brafl280369 (jgi|Brafl164434) VPS34/NP_002638

AmphiP85 jgi|Brafl91712 P85ALPHA/NP_852664

AmphiP150 jgi|Brafl132368 (jgi|Brafl115340) P150/NP_055417

Akt AmphiAKT scaffold_191 AKT1/NP_005154

PDK AmphiPDK jgi|Brafl125110 (jgi|Brafl126526) PDK1/NP_002604

PLCg AmphiPLCgamma jgi|Brafl276621 PLCGAMMA/BAE06110

PKC AmphiPKCalpha/beta/gamma jgi|Brafl251880 (jgi|Brafl59849) PKCALPHA/NP_002728

AmphiPKCdelta/theta jgi|Brafl57451 PKCTHETA/AAU29340

AmphiPKCepsilon jgi|Brafl275928 (jgi|Brafl113650) PKCEPSILON/NP_005391

AmphiPKCiota/zeta jgi|Brafl173713 PKCIOTA/AAH22016

1For each amphioxus gene, the name, the accession number corresponding to the protein sequence at the jgi webpage, or the scaffold we used forgene prediction, and the best reciprocal BLAST hits in the human proteome are given. The accession numbers in brackets correspond to the secondprediction found for each gene when it exists (see ‘‘Materials and methods’’).

RTK downstream signaling pathways in amphioxus 17Bertrand et al.

one AmphiMAPKKK5/6, one AmphiMAPKKK7 (or TAK1),

one AmphiMAPKKK9/10/11, one AmphiMAPKKK12/13, one

AmphiMLTK, one AmphiMOS, one AmphiKSR, and one

AmphiRAF placed at the root of vertebrate Raf1, ARaf, and

BRaf genes (see Table 2). We were not able to find in the

genome any ortholog of MAPKKK4, whereas one is known

in Ciona and in Drosophila, or of MAPKKK8 (also known as

TPL-2), which has no known ortholog outside vertebrates.

MAPKK/MEK

As for the MAPKKK, all the proteins of this family share a

conserved STK domain that we used for our phylogenetic

Fig. 2. Phylogenetic tree of docking pro-teins. The tree was generated by theneighbor-joining method based on thealignment of the phosphotyrosine-bind-ing site (PTB) domain. Amphioxus pro-teins are highlighted in gray. The numbermatching each branch indicates the per-centage of times that a node was sup-ported in 1000 bootstrap pseudo-replications. The scale bar indicates anevolutionary distance of 0.1 amino acidsubstitutions per position. Species abbre-viations are as follows: CAEE, Ca-enorhabditis elegans; CIOI, Cionaintestinalis; DANR, Danio rerio; DROM,Drosophila melanogaster; GALG, Gallusgallus; HOMS, Homo sapiens; MUSM,Mus musculus; STRP, Strongylocentrotuspurpuratus; TAKR, Takifugu rubripes;TETN, Tetraodon nigroviridis; XENL,Xenopus laevis.

18 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

analysis. In vertebrates seven genes are known, forming five

paralogy groups. As previously described for C. intestinalis

(Satou et al. 2003), five genes named AmphiMAPKK1/2,

AmphiMAPKK4, AmphiMAPKK5, AmphiMAPKK3/6, and

AmphiMAPKK7, corresponding to these paralogy groups, are

present in the amphioxus genome (see Table 2).

MAPK

All the MAPKs have an STK domain, the alignment of

which was used for the phylogenetic reconstruction. As for

C. intestinalis (Satou et al. 2003), we found orthologs for

ERK1/2 (AmphiERK1/2), ERK5 (AmphiERK5), JNK (Amp-

hiJNK), P38 (AmphiP38), and NLK (AmphiNLK). We were

Fig. 3. Phylogenetic tree of MAPKKKproteins. The tree was generated by theneighbor-joining method based on thealignment of the Ser/Thr kinase (STK)domain. Amphioxus proteins are overlainin gray. The number matching eachbranch indicates the percentage of timesthat a node was supported in 1000 boot-strap pseudo-replications. The scale barindicates an evolutionary distance of 0.1amino acid substitutions per position.Species abbreviations are as in Fig. 2.

RTK downstream signaling pathways in amphioxus 19Bertrand et al.

unable to find any ortholog of ERK3/4, but we found an

ortholog for MAPK15 or ERK8, a recently discovered

MAPK (AmphiMAPK15) not found in the Ciona genome.

PI3K pathway

Gab

Gab proteins (for Grb2-associated binder), contain a con-

served N-terminal PH domain whereas the C-terminus

sequence is not well conserved. In amphioxus, one Gab gene

was found (AmphiGAB) and is placed at the base of vertebrate

Gab1, Gab2, and Gab3 using the alignment of the PH domain

for the phylogenetic analysis.

PI3K

In vertebrates several classes of PI3K protein complexes are

known (Class I, II, and III). The Class I protein complexes

possess one catalytic and one regulatory subunit. The Class

IA complexes are formed by one of the catalytic subunits

(p110a, b, or d) associated with any of the three regulatory

subunits (p85a, b, and g). Only one Class IB complex exists,

which is formed by the association between the p110g cata-

lytic subunit and the p101 regulatory subunit. There are also

three Class II PI3Ks (CIIa, CIIb, and CIIg) and one Class III

PI3K (see Fig. 4). All the orthologous genes found in amp-

hioxus coding for Class I, II, and III PI3K proteins are

described in Table 3.

Class I catalytic subunits: the p110 peptides show several

conserved domains, like the catalytic and accessory domains

that are placed at the C-terminus, and possess in their

N-terminal part a domain that interacts with the regulatory

subunits. The catalytic domain, conserved among the different

classes of PI3K, was used to construct the phylogeny for all

the catalytic subunit coding genes. In amphioxus, we have

found two p110 genes, one of them being the ortholog of

the vertebrates’ p110a. The other gene is placed at the base

of the vertebrates’ p110b and d. However, we failed to find in

the genome any ortholog of the catalytic subunit of Class IB

PI3K, p110g, even if at least one p110g exists in C. intestinalis.

Nevertheless, we have isolated an EST sequence (accession

number BW833578) corresponding to the amphioxus p110g.Class I regulatory subunits: p85 subunits contain several

Src homology domains and an activator domain of Rho-like

GTPases. In amphioxus one gene (AmphiP85), placed at the

base of all three p85 from vertebrates, is present in the

genome. However, we were unable to find an ortholog of

p101, the regulatory subunit of the Class IB PI3K, even if it

has been described in C. intestinalis (Satou et al. 2003).

Class II: Only one gene, AmphiCII was found in the

genome, as in Drosophila, whereas three are known in ver-

tebrates (CIIa, b, and g).Class III catalytic subunit: As in vertebrates, Drosophila

and C. intestinalis, one ortholog of VPS34 (AmphiVPS34) is

present in the amphioxus genome.

Class III regulatory subunit: the regulatory subunit of this

class is called p150 and contains an STK domain that is well

conserved, and which was therefore used to perform phyloge-

netic analysis. As in vertebrates and Drosophila, we have iden-

tified one p150 gene in amphioxus, AmphiP150 (see Table 3).

Akt and PDK

In vertebrates there are three Akt genes named Akt1, Akt2,

and Akt3. All share a conserved PH domain and an STK

domain that was used for the phylogenetic analysis. In amp-

hioxus, we found a single ortholog, AmphiAKT, placed at

the base of all the vertebrate Akt genes. We also found Amp-

hiPDK, the ortholog of the unique vertebrate Pdk gene.

PLCc pathway

PLCcPLCg proteins contain a conserved catalytic domain that in-

cludes two regions connected by a linker possessing SH2 and

SH3 domains. In vertebrates, two genes coding for PLCg1and PLCg2 are known, whereas in amphioxus, we found only

one ortholog, called AmphiPLCgamma, which is placed at the

base of the vertebrate-specific duplication (see Table 3).

Fig. 4. Schematic diagram of the different subunits of the threeclasses of PI3K protein complexes in vertebrates and in amphioxus.In vertebrates, there are three catalytic and three regulatory sub-units that can form Class Ia PI3K, whereas in amphioxus we onlyfound two catalytic and one regulatory subunit. For the Class Ib,only one catalytic and one regulatory subunit are known in ver-tebrates whereas we only found an EST sequence corresponding tothe catalytic subunit in amphioxus. In the case of Class II, threesubunits are described in vertebrates, and one was found in theamphioxus genome. As in vertebrates, we found one catalytic andone regulatory subunit of the Class III PI3K in amphioxus.

20 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

PKC

In vertebrates, there are at least nine different genes coding

for PKC proteins. All the proteins of this family share a

conserved STK domain that was used for the pylogenetic

study. In amphioxus (as in Drosophila), we found four genes,

placed respectively: at the base of the PKCa, b and g para-

logy group (AmphiPKCalpha/beta/gamma), at the base of the

vertebrate PKCe genes (AmphiPKCepsilon), at the base of

PKCd and y genes (AmphiPKCdelta/theta), and at the base of

the PKCi and z paralogy group (AmphiPKCiota/zeta), re-

spectively. No amphioxus gene orthologous to PKCZ was

found (see Table 3). The AmphiPKCalpha/beta/gamma pro-

tein sequence from B. lanceolatum was already published

with the accession number AAM92833.

Developmental gene expression

To understand the specific implication of the three RTK

downstream cascades during embryonic development in

amphioxus, we decided to analyze the expression pattern of

two signature genes of each signaling pathway. For the

MAPK pathway, we chose AmphiH/K/NRASa and Amph-

iRAF, for the PI3K/Akt pathway we analyzed AmphiAKT

and AmphiPDK, and for the PLCg/PKC pathway, we

chose AmphiPLCgamma and AmphiPKCalpha/beta/gamma.

Expression patterns analysis was carried out using whole-

mount in situ hybridization on B. lanceolatum embryos, from

blastula to early larval stages. For this purpose partial

B. lanceolatum cDNAs corresponding to the different genes

we chose to study were cloned (see ‘‘Materials and methods’’

for the accession numbers).

MAPK pathway: gene expression of AmphiH/K/NRASa and AmphiRAF

From blastula to gastrula stages, AmphiH/K/NRASa is ubiq-

uitously expressed (Fig. 5A). In early amphioxus neurulae

expression of AmphiH/K/NRASa is detected in the whole

embryo, except in the epidermis (Fig. 5B). At the mid-neurula

stage the expression becomes restricted to the notochord

(Fig. 5, C and D). In the late neurula, before the mouth opens,

AmphiH/K/NRASa expression in the notochord is still

observed with a higher level in the anterior and posterior

parts, and a new domain of expression appears in the club-

shaped gland anlagen (Fig. 5, E and F). By the larval stage,

the expression is restricted to the posterior part of the noto-

chord and to the club-shaped gland (Fig. 5, G and H).

AmphiRAF shows an expression pattern similar to that of

AmphiH/K/NRASa until the early neurula stage (not shown).

In mid-neurulae, AmphiRAF expression is ubiquitous, except

in the epidermis. Then at the late neurula stage, AmphiRAF

shows expression in the mesoderm, in the endoderm, and in

the ventral part of the cerebral vesicle (Fig. 5, I and J). In the

amphioxus larva, the expression is ubiquitously detected and

we noticed a very high level of expression in the club-shaped

gland (data not shown).

In Drosophila, a single gene, orthologous to the three

H-, K-, and N-Ras genes, is present in the genome and shows

an ubiquitous expression during early embryonic develop-

ment (Segal and Shilo 1986). Later on, expression is restricted

to the dividing cells of the larva. In the mouse embryo,

expression of the three Ras genes is also ubiquitous (Leon

et al. 1987), and the function of the three genes overlaps,

as showed by the various knockout mutants reported

(Nakamura et al. 2007). In the case of the RAF genes, ubiq-

uitous expression during embryogenesis has been described

for theDrosophila ortholog pole hole (Casanova et al. 1994) as

well as for the three mouse orthologs Raf1, ARaf, and BRaf

(Wojnowski et al. 2000). Our results in amphioxus suggest

that the MAPK signaling pathway may accomplish general

ubiquitous functions during amphioxus embryogenesis. How-

ever, there may be a specific high MAPK pathway activation

signal in several developing organs, specially the notochord

(i.e., restricted gene expression of AmphiH/K/NRASa) and the

club-shaped gland.

PI3K pathway: gene expression of AmphiAKT andAmphiPDK

During early amphioxus embryonic development, both Amp-

hiAKT and AmphiPDK are ubiquitously expressed. In gas-

trula as well as in early neurula, AmphiAKT expression is

detected in the whole embryo except in the epidermis (Fig.

5K). Then at the mid-neurula stage, expression is restricted to

the endoderm and mesoderm (Fig. 5L). After this stage, no

specific expression can be detected by whole-mount in situ

hybridization, which may imply that AmphiAKT is not

expressed, or expressed at a very low level. From gastrula

to late larval stage, AmphiPDK expression is detected in the

whole embryo, except in the epidermis (Fig. 5, M and N). In

the early larva, AmphiPDK expression is still ubiquitous

showing a postero-anterior gradient, and is at particularly

high levels in the club-shaped gland and the endostyle (Fig.

5O). In the mouse embryo, Pdk1 expression is ubiquitous and

mouse deficient for this gene die at E9,5 showing many defects

such as the lack of somites or neural crest-derived organs.

This reflects an important role of this protein during early

development in vertebrates, and it has been proposed that

PDK1 is involved in the control of cell size (Lawlor et al.

2002). In Drosophila, null-function mutations are also em-

bryonic lethal, and dPDK1 has been shown to be implicated

in the control of cell growth (Rintelen et al. 2001). The same

holds true for Akt, one of the PDK substrates. Indeed, in

Drosophila as in vertebrates the orthologs are ubiquitously

expressed and have a major function in cell growth (Andj-

elkovic et al. 1995; Perrimon et al. 1996; Altomare et al. 1998;

Cho et al. 2001; Yang et al. 2005; Dummler et al. 2006). We

assume that the basic function of both genes is most probably

RTK downstream signaling pathways in amphioxus 21Bertrand et al.

conserved in amphioxus, which would be in accordance with

the ubiquitous gene expression patterns observed for Amp-

hiPDK and AmphiAKT.

PLCc pathway: gene expression ofAmphiPLCgamma and AmphiPKCalpha/beta/gamma

AmphiPLCgamma is ubiquitously expressed during amp-

hioxus embryogenesis (Fig. 6), although in the larva gene ex-

pression levels are particularly high in both the club-shaped

gland and the central part of the gut, except the ilio-colonic

region (Fig. 6, M and N). In Drosophila, the ortholog of

PLCgamma, small wing, is also ubiquitously expressed and

shows a higher expression level in the midgut (Emori et al.

1994). However, loss of function mutants are viable and show

wing and eye defects (Thackeray et al. 1998). In vertebrates,

two paralogues, Plcg1 and Plcg2, exist. Plcg1 is ubiquitously

expressed in the mouse embryo and knockout mutants show

growth retardation, abnormal hematopoiesis and blood

vessel development and die early during organogenesis at

E9.0 (Ji et al. 1997; Shirane et al. 2001; Liao et al. 2002). In

zebrafish, mutant and morphant animals also show vascular

defects (Lawson et al. 2003) suggesting that the role of Plcg1in vessel formation during embryogenesis is conserved in

vertebrates. In mouse, Plcg2 shows a ubiquitous expression

at late embryonic stages and knockout mutants are viable,

although they have defects in the immune system (Wang et al.

2000; Visel et al. 2004). All these data suggest that the

embryonic function of Plcg is not conserved between verte-

brates and ecdysozoans. However, because our gene expres-

Fig. 5. Gene expression patterns of AmphiH/K/NRASa (A–H), AmphiRAF (I,J), AmphiAKT (K, L), and AmphiPDK (M–O) duringembryogenesis. Anterior toward the left, and scale bars550mm. (A) gastrula showing ubiquitous expression. (B) Dorsal view of a neurulashowing ubiquitous expression except in the epidermis (arrowhead). (C) Lateral view of a mid-neurula with expression restricted to thenotochord. (D) Dorsal view of the specimen shown in (C). (E) Side view of a late neurula stage embryo showing expression in the notochordand the club-shaped gland anlagen. (F) Enlargement of (D) showing the expression in the club-shaped gland anlagen (arrowhead).(G) Expression in the club-shaped gland (arrowhead) in larva (first gill slit). (H) Posterior part of the first gill slit larval stage showingexpression in the posterior notochord (arrowhead). (I) Late neurula showing expression of AmphiRAF in the mesoderm and the endoderm.(J) Enlargement of (G) showing expression in the anterior notochord and the ventral part of the cerebral vesicle (bracket). (K) Gastrulashowing ubiquitous expression of AmphiAKT except in the ectoderm (arrowhead). (L) Mid-neurula showing expression of AmphiAKT inpart of the endoderm and mesoderm. (M) Expression of AmphiPDK in the whole embryo except the epidermis at the early neurula stage.(N) Late neurula showing a broad expression domain of AmphiPDK. (O) First gill slit larval stage showing expression of AmphiPDK in theclub-shaped gland (arrowhead) and in the endostyle (arrow).

22 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

Fig. 6. Gene expression patterns of AmphiPKCalpha/beta/gamma (A–L) and AmphiPLCgamma (M, N) during embryogenesis. Anteriortoward the left, and scale bars550mm. (A) Gastrula showing ubiquitous expression ofAmphiPKCalpha/beta/gamma except in the ectoderm(arrowhead). (B) Mid-neurula with ubiquitous expression of AmphiPKCalpha/beta/gamma and particularly high expression in part of theneural tube. (C) Enlargement of the specimen shown in (B). The most anterior labeled neurons correspond to the posterior part of thecerebral vesicle (arrowhead). (D) Enlargement of the specimen shown in (B). The neurons posterior to the cerebral vesicle are positionedventrally (arrows). (E) Dorsal view of the anterior part of the specimen shown in (B). The neurons labeled in the neural tube aresymmetrically placed on either side of the midline (arrowheads). (F) Side view of a late neurula showing AmphiPKCalpha/beta/gammaexpression in the endoderm and in the ventral part of the cerebral vesicle (bracket), as well as in the anterior ventral neural tube. (G)Enlargement of the specimen shown in (F). Only the ventral part of the cerebral vesicle (bracket) and of the neural tube (arrowhead)are labeled. (H) Dorsal view of the anterior part of the specimen shown in (F). The labeling in the cerebral vesicle is homogenous (bracket),and in the neural tube we can observe that the labeled neurons are laterally placed (arrowhead). (I) First gill slit larva showing expressionof AmphiPKCalpha/beta/gamma in the cerebral vesicle, the anterior neural tube, the club-shaped gland, and the preoral pit. (J) Enlargementof the anterior trunk of the specimen shown in (I). Labeling in the neural tube is ventral and the posterior limit is placed after the pigmentedspot (arrowhead). (K) Enlargement of the posterior trunk of the specimen shown in (I). There is low labeling in the gut, but no labeling isobserved in the ilio-colonic region (bracket). (L) Enlargement of the head of the specimen shown in (I) showing expression in the cerebralvesicle, posterior to the frontal eye (arrowhead), in the preoral pit (arrow), and in the club-shaped gland (double arrowhead). (M)Expression of AmphiPLCgamma in the club-shaped gland (arrowhead) of a first gill slit larva. (N) Expression of AmphiPLCgamma in thegut, except the ilio-colonic region (bracket), in a first gill slit larva.

RTK downstream signaling pathways in amphioxus 23Bertrand et al.

sion data for AmphiPLCgamma in amphioxus do not give

indications about the functional conservation in chordates,

additional studies will be necessary to address PLCg func-

tional evolution.

We also studied the gene expression pattern of Amp-

hiPKCalpha/beta/gamma during amphioxus embryogenesis.

The expression is ubiquitous until the blastula stage, and, as

for the other genes described here, in gastrula and early

neurula stages, expression is detected in the whole embryo

except in the epidermis (Fig. 6A). Then in mid-neurulae, even

though we still observe ubiquitous expression, specific expres-

sion is detected in the posterior part of the cerebral vesicle,

and in some ventrolateral neurons with a segmented pattern

(Fig. 6, B–E). This segmented pattern is lost in older neurulae,

where expression is specifically detected in the ventral part of

the cerebral vesicle and in the ventrolateral part of the

anterior neural tube, which corresponds to motor neurons at

this stage (Wicht and Lacalli 2005) (Fig. 6, F–H). In addition,

low levels of expression are also detected in the anterior

endoderm (Fig. 6F). In the amphioxus larva the expression in

the cerebral vesicle is limited to the region just posterior to

the frontal eye, and the expression in the neural tube is still

restricted to its ventral and anterior part, the posterior limit of

expression being posterior to the pigmented spot (Fig. 6, I–L).

AmphiPKCalpha/beta/gamma is also expressed at this stage in

the preoral pit and in the club-shaped gland (Fig. 6L). The

early segmental expression we observed in the mid neurulae

was also described for several other genes in amphioxus, such

as AmphiERR (Bardet et al. 2005), AmphiIslet (Jackman et al.

2000), AmphiKrox and AmphiShox (Jackman and Kimmel

2002), and AmphiVAChT and AmphiChAT (Candiani et al.

2008), which again suggests that the amphioxus neural tube

possesses a segmental character parallel to the vertebrate

hindbrain. In Drosophila, mRNA expression was not detected

by Northern blot in 0–3-day-old embryos, but gene expression

was observed in the adult brain and eye (Rosenthal et al.

1987; Schaeffer et al. 1989). Immunostaining in Caenorhabdi-

tis elegans of the corresponding ortholog called Pkc2 shows

the presence of the protein in neurons and intestinal and

muscle cells (Islas-Trejo et al. 1997). In vertebrates, three

paralogues, Pkca, Pkcb, and Pkcg are known but gene

expression during embryogenesis is not well documented. In

mouse embryos at E9.5 and E10.5, the protein is detected by

immunostaining for the three paralogous proteins in the

notochord, the presomitic mesoderm, the hindgut, and the

neural tube (Cogram et al. 2004). The knockout mutants for

the three genes show, respectively, no obvious abnormalities,

immunodeficiency, or behavioral problems (Abeliovich et al.

1993a, b; Leitges et al. 1996, 2002; Braz et al. 2004). Alto-

gether these data suggest that one of the ancestral functions of

Pkc in bilaterian animals is related to neural development

and/or function. This would be in accordance with the gene

expression pattern observed in amphioxus. In vertebrates,

Pkc genes would have evolved at least partially by ne-

ofunctionalization, Pkcg keeping the ancestral function, whilePkca and Pkcb acquiring new developmental functions.

CONCLUSION

Our genomic survey for actors of the RTK downstream

signaling pathways in amphioxus clearly shows that

cephalochordates possesses all the major effectors acting

downstream of the RTKs. As for other gene families, we

found that following the genome duplication events that

occurred during vertebrate’s evolution, vertebrates retained

many duplicates of the genes implicated in the RTKs down-

stream cascades. Those gene duplications, associated with

functional redundancy, introduce in vertebrates an additional

level of complexity and experimental difficulties for the anal-

ysis of gene function in vertebrate development. Amphioxus,

as we have shown, has a chordate ‘‘prototypical’’ genome in

the sense that it has a single gene for each vertebrate paralogy

group (except for the amphioxus-specific duplication of H/K/

NRAS). Our results on the developmental expression of some

signature genes of the three main cascades downstream of the

RTKs show that most of the genes studied are ubiquitously

expressed, which is also the case inDrosophila and mouse. This

may reflect the involvement of these signaling pathways in

major cellular processes that are conserved between ecdyzoso-

ans and chordates. However, the fact that AmphiPKCalpha/

beta/gamma gene shows a very restricted expression pattern in

the amphioxus neural tube at the late neurula stage and there-

after, together with data known in vertebrates, suggests that

PKC was probably implicated in neural development in the

ancestor of all chordates. The restricted expression of Am-

phiH/K/NRASa also suggests a specific implication of the

MAPK pathway in development of the notochord in amp-

hioxus. Future studies in amphioxus, particularly on the pres-

ence/absence of the activated proteins of these three signaling

pathways, will give us new insight into the specific function of

each gene cascade in vertebrates, and, more generally, will help

us to understand the role of the different RTK downstream

cascades in the ancestor of chordates.

AcknowledgmentsThis work was funded by ANR and CNRS grants to H. E. andBMC2005-00252 (Ministerio de Educacion y Ciencia) to J. G. F.Stephanie Bertrand’s postdoctoral position was supported by anEMBO Long-Term fellowship. We thank Ildiko Somorjai for carefulreading of the manuscript and two anonymous reviewers for theirinteresting comments.

REFERENCES

Abeliovich, A., et al. 1993a. Modified hippocampal long-term potentiationin PKC gamma-mutant mice. Cell 75: 1253–1262.

Abeliovich, A., et al. 1993b. PKC gamma mutant mice exhibit mild deficitsin spatial and contextual learning. Cell 75: 1263–1271.

24 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009

Altomare, D. A., et al. 1998. Akt2 mRNA is highly expressed in embryonicbrown fat and the AKT2 kinase is activated by insulin. Oncogene 16:2407–2411.

Altschul, S. F., et al. 1990. Basic local alignment search tool. J. Mol. Biol.215: 403–410.

Andjelkovic, M., et al. 1995. Developmental regulation of expression andactivity of multiple forms of the Drosophila RAC protein kinase. J. Biol.Chem. 270: 4066–4075.

Bardet, P. L., et al. 2005. Expression of estrogen-receptor related receptorsin amphioxus and zebrafish: implications for the evolution of posteriorbrain segmentation at the invertebrate-to-vertebrate transition. Evol.Dev. 7: 223–233.

Barolo, S., and Posakony, J. W. 2002. Three habits of highly effectivesignaling pathways: principles of transcriptional control by developmen-tal cell signaling. Genes Dev. 16: 1167–1181.

Blair, J. E., et al. 2005. Evolutionary sequence analysis of completeeukaryote genomes. BMC Bioinform. 6: 53–62.

Bourlat, S. J., et al. 2006. Deuterostome phylogeny reveals monophyleticchordates and the new phylum Xenoturbellida. Nature 444: 85–88.

Braz, J. C., et al. 2004. PKC-alpha regulates cardiac contractility andpropensity toward heart failure. Nat. Med. 10: 248–254.

Burge, C., and Karlin, S. 1997. Prediction of complete gene structures inhuman genomic DNA. J. Mol. Biol. 268: 78–94.

Candiani, S., et al. 2008. The cholinergic gene locus in amphioxus: molec-ular characterization and developmental expression patterns. Dev. Dyn.237: 1399–1411.

Cantley, L. C. 2002. The phosphoinositide 3-kinase pathway. Science 296:1655–1657.

Carpenter, G., and Ji, Q. 1999. Phospholipase C-gamma as a signal-transducing element. Exp. Cell. Res. 253: 15–24.

Casanova, J., et al. 1994. An oncogenic form of human raf can specifyterminal body pattern in Drosophila. Mech. Dev. 48: 59–64.

Cho, H., et al. 2001. Akt1/PKBalpha is required for normal growthbut dispensable for maintenance of glucose homeostasis in mice. J. Biol.Chem. 276: 38349–38352.

Cogram, P., et al. 2004. Specific isoforms of protein kinase C are essentialfor prevention of folate-resistant neural tube defects by inositol. Hum.Mol. Genet. 13: 7–14.

Delsuc, F., et al. 2006. Tunicates and not cephalochordates are the closestliving relatives of vertebrates. Nature 439: 965–968.

Dummler, B., et al. 2006. Life with a single isoform of Akt: mice lackingAkt2 and Akt3 are viable but display impaired glucose homeostasis andgrowth deficiencies. Mol. Cell. Biol. 26: 8042–8051.

Emori, Y., et al. 1994. Drosophila phospholipase C-gamma expressed pre-dominantly in blastoderm cells at cellularization and in endodermal cellsduring later embryonic stages. J. Biol. Chem. 269: 19474–19479.

Fuentes, M., et al. 2004. Preliminary observations on the spawningconditions of the European amphioxus (Branchiostoma lanceolatum) incaptivity. J. Exp. Zool. B Mol. Dev. Evol. 302: 384–391.

Fuentes, M., et al. 2007. Insights into spawning behavior and developmentof the European amphioxus (Branchiostoma lanceolatum). J. Exp. Zool.B Mol. Dev. Evol. 308: 484–493.

Galtier, N., et al. 1996. SEAVIEW and PHYLO_WIN: two graphic toolsfor sequence alignment and molecular phylogeny. Comput. Appl. Biosci.12: 543–548.

Guindon, S., and Gascuel, O. 2003. A simple, fast, and accurate algorithmto estimate large phylogenies by maximum likelihood. Syst. Biol. 52:696–704.

Guindon, S., et al. 2005. PHYML onlineFa web server for fast maximumlikelihood-based phylogenetic inference. Nucleic Acids Res. 33 (WebServer issue): W557–W559.

Holland, L. Z., et al. 1996. Revealing homologies between body parts ofdistantly related animals by in situ hybridization to developmental genes:amphioxus vs. vertebrates. In J. D. Ferraris and S. Palumbi (eds.).Molecular Zoology: Advances, Strategies, and Protocols. Wiley-Liss,New York; pp. 267–282, 473–483.

Islas-Trejo, A., et al. 1997. Structure and expression of the Caenorhabditiselegans protein kinase C2 gene. Origins and regulated expression of afamily of Ca21-activated protein kinase C isoforms. J. Biol. Chem. 272:6629–6640.

Jackman, W. R., and Kimmel, C. B. 2002. Coincident iterated geneexpression in the amphioxus neural tube. Evol. Dev. 4: 366–374.

Jackman, W. R., et al. 2000. Islet reveals segmentation in the Amphioxushindbrain homolog. Dev. Biol. 220: 16–26.

Jelinek, T., et al. 1996. Ras-induced activation of Raf-1 is dependent ontyrosine phosphorylation. Mol. Cell. Biol. 16: 1027–1034.

Ji, Q. S., et al. 1997. Essential role of the tyrosine kinase substratephospholipase C-gamma1 in mammalian growth and development.Proc. Natl. Acad. Sci. USA 94: 2999–3003.

Jones, D. T., et al. 1992. The rapid generation of mutation data matricesfrom protein sequences. Comput. Appl. Biosci. 8: 275–282.

King, N., and Carroll, S. B. 2001. A receptor tyrosine kinase from choano-flagellates: molecular insights into early animal evolution. Proc. Natl.Acad. Sci. USA 98: 15032–15037.

Kouhara, H., et al. 1997. A lipid-anchored Grb2-binding protein that linksFGF-receptor activation to the Ras/MAPK signaling pathway. Cell 89:693–702.

Lawlor, M. A., et al. 2002. Essential role of PDK1 in regulating cell size anddevelopment in mice. EMBO J 21: 3728–3738.

Lawson, N. D., et al. 2003. Phospholipase C gamma-1 is required down-stream of vascular endothelial growth factor during arterial develop-ment. Genes Dev. 17: 1346–1351.

Leitges, M., et al. 1996. Immunodeficiency in protein kinase cbeta-deficientmice. Science 273: 788–791.

Leitges, M., et al. 2002. Knockout of PKC alpha enhances insulin signalingthrough PI3K. Mol. Endocrinol. 16: 847–858.

Leon, J., et al. 1987. Differential expression of the ras gene family in mice.Mol. Cell. Biol. 7: 1535–1540.

Liao, H. J., et al. 2002. Absence of erythrogenesis and vasculogenesis inPlcg1-deficient mice. J. Biol. Chem. 277: 9335–9341.

Nakamura, K., et al. 2007. Partial functional overlap of the three ras genesin mouse embryonic development. Oncogene 27(21): 2961–2968.

Neel, B. G., et al. 2003. The ‘Shp’ing news: SH2 domain-containing tyrosinephosphatases in cell signaling. Trends Biochem. Sci. 28: 284–293.

Oda, H., et al. 2002. A novel amphioxus cadherin that localizes to epithelialadherens junctions has an unusual domain organization with implica-tions for chordate phylogeny. Evol. Dev. 4: 426–434.

Perkins, L. A., et al. 1996. The nonreceptor protein tyrosine phosphatasecorkscrew functions in multiple receptor tyrosine kinase pathways inDrosophila. Dev. Biol. 180: 63–81.

Perrimon, N., et al. 1996. Zygotic lethal mutations with maternal effectphenotypes in Drosophila melanogaster. II. Loci on the second and thirdchromosomes identified by P-element-induced mutations. Genetics 144:1681–1692.

Rhee, S. G. 2001. Regulation of phosphoinositide-specific phospholipaseC. Annu. Rev. Biochem. 70: 281–312.

Rintelen, F., et al. 2001. PDK1 regulates growth through Akt and S6Kin Drosophila. Proc. Natl. Acad. Sci. USA 98: 15020–15025.

Rosenthal, A., et al. 1987. Structure and nucleotide sequenceof a Drosophila melanogaster protein kinase C gene. EMBO J 6:433–441.

Satou, Y., et al. 2003. A genomewide survey of developmentally relevantgenes in Ciona intestinalis. V. Genes for receptor tyrosine kinase pathwayand Notch signaling pathway. Dev. Genes Evol. 213: 254–263.

Schaeffer, E., et al. 1989. Isolation and characterization of two new droso-phila protein kinase C genes, including one specifically expressed inphotoreceptor cells. Cell 57: 403–412.

Schubert, M., et al. 2006. Amphioxus and tunicates as evolutionary modelsystems. Trends Ecol. Evol. 21: 269–277.

Segal, D., and Shilo, B. Z. 1986. Tissue localization of Drosophilamelanogaster ras transcripts during development. Mol. Cell. Biol. 6:2241–2248.

Shirane, M., et al. 2001. Deficiency of phospholipase C-gamma1 impairsrenal development and hematopoiesis. Development 128: 5173–5180.

Thackeray, J. R., et al. 1998. small wing encodes a phospholipaseC-(gamma) that acts as a negative regulator of R7 development inDrosophila. Development 125: 5033–5042.

Thompson, J. D., et al. 1997. The CLUSTAL_X windows interface: flexiblestrategies for multiple sequence alignment aided by quality analysis tools.Nucleic Acids Res. 25: 4876–4882.

RTK downstream signaling pathways in amphioxus 25Bertrand et al.

Visel, A., et al. 2004. GenePaint.org: an atlas of gene expression patterns inthe mouse embryo. Nucleic Acids Res. 32 (Database issue): D552–D556.

Wada, H., et al. 2006. Molecular evolution of fibrillar collagen in chordates,with implications for the evolution of vertebrate skeletons and chordatephylogeny. Evol. Dev. 8: 370–377.

Wang, D., et al. 2000. Phospholipase Cgamma2 is essential in the functionsof B cell and several Fc receptors. Immunity 13: 25–35.

Wicht, H., and Lacalli, T. 2005. The nervous system of amphioxus: structure,development, and evolutionary significance. Can. J. Zool. 83: 122–150.

Wojnowski, L., et al. 2000. Overlapping and specific functions of Braf andCraf-1 proto-oncogenes during mouse embryogenesis. Mech. Dev. 91:97–104.

Yang, Z. Z., et al. 2005. Dosage-dependent effects of Akt1/protein kinaseBalpha (PKBalpha) and Akt3/PKBgamma on thymus, skin, and car-diovascular and nervous system development in mice.Mol. Cell. Biol. 25:10407–10418.

Zhang, J., et al. 2000. Roles of the SHP-1 tyrosine phosphatase in thenegative regulation of cell signalling. Semin. Immunol. 12: 361–378.

26 EVOLUTION & DEVELOPMENT Vol. 11, No. 1, January^February 2009