PATTERNS & PHENOTYPES

A Migratory Role for EphrinB Ligands in AvianEpicardial Mesothelial CellsSonia M. Wengerhoff,1 Amy R. Weiss,1† Kathryn L. Dwyer,1 and Robert W. Dettman1,2*

Little is known about the molecules that mediate the attachment of proepicardial cells to the heart. Eph-rins are cell surface ligands for Eph tyrosine kinase receptors, molecules known to play a role in cell ad-hesion and migration. Here, we detected EphrinB ligands in proepicardial and epicardial mesothelialcells (EMCs) using reverse transcriptase-polymerase chain reaction, immunoblotting, immunolocaliza-tion, and EphB-Fc binding. Aggregated EphB-Fc fragments clustered ephrinB1 ligands on living EMCsindicating that they are cell surface expressed. In vitro assays demonstrated that ephrinB ligands partici-pate in EMC migration but not cell adhesion. Localization studies in hearts at Hamburger and Hamiltonstage 30 and older revealed that ephrinB1 is expressed in the epicardium and subepicardial mesenchymeof the atrioventricular sulcus. EMCs treated with platelet-derived growth factor-BB expressed smoothmuscle markers but not ephrinB1. Our study supports an early role for ephrinB ligands for migration ofepicardial cells and a later role in perivascular fibroblasts of coronary vessels in the atrioventricularsulcus. Developmental Dynamics 239:598–609, 2010. VC 2009 Wiley-Liss, Inc.

Key words: coronary artery; migration; epicardium; ephrin; Eph

Accepted 13 October 2009

INTRODUCTION

The coronary vessels are derived from

the mesoderm of the septum transver-sum. At about the time the early

heart loops, a group of cells posteriorto the sinoatrial region of the heart

coalesce into a villous protrusioncalled the proepicardial organ (PE;

Viragh and Challice, 1981; Schulte

et al., 2007). The PE grows craniallytoward and attaches to the inner cur-

vature of the heart (Manner, 1993;Viragh et al., 1993; Nahirney et al.,

2003). Outgrowth of the PE appearsto be triggered by localized liver-

derived factors, which may includefibroblast growth factors (FGFs) and

is simultaneously inhibited by coex-pression of bone morphogenetic pro-tein-2 (BMP2) and FGF2 at the baseof the PE (Kruithof et al., 2006; Ishiiet al., 2007). Once attached to theheart tube, PE-derived epicardial me-sothelial cells (EMCs) migrate bothsuperficially toward the outflow tractand invasively into the subepicar-dium and myocardium. The invasivestep is generally referred to as epicar-dial–mesenchymal transformation(EMT) and the cells are calledepicardially derived mesenchymalcells (EPDCs). EMT is triggered byseveral factors including transform-ing growth factor-beta (TGFb), FGF,and platelet-derived growth factor

(PDGF; Compton et al., 2006; Oliveyet al., 2006; Mellgren et al., 2008; Sri-durongrit et al., 2008; Tomanek et al.,2008) and inhibited by soluble VCAM-1 (Dokic and Dettman, 2006).After invading, EPDCs participate

in the formation of several differentcomponents of the adult heart, includ-ing coronary vessels, cardiac fibro-blasts of the myocardial interstitium,and mesenchymal tissues of the valvu-loseptal complex (Perez-Pomares et al.,1997, 1998, 2002; Dettman et al., 1998;Gittenberger-de Groot et al., 1998).During epicardial formation endothe-lial and blood cells begin to appear inthe subepicardial mesenchyme. Earlyvessels grow and remodel into first an

1Northwestern University, Feinberg School of Medicine, Department of Pediatrics, Chicago, Illinois2Children’s Memorial Research Center, Developmental Biology Core, Chicago, Illinois†Dr. Weiss’ current address is Newton-Wellesley Hospital, 2014 Washington Street, Newton, MA 02462Grant sponsor: American Heart Association; Grant numbers: 0030412Z, 0455612Z; Grant sponsor: the Children’s Memorial ResearchCenter, Chicago IL.*Correspondence to: Robert W. Dettman, 303 E. Chicago Avenue, Chicago, IL 60611. E-mail: r-dettman@northwestern.edu

DOI 10.1002/dvdy.22163Published online 13 November 2009 in Wiley InterScience (www.interscience.wiley.com).

DEVELOPMENTAL DYNAMICS 239:598–609, 2010

VC 2009 Wiley-Liss, Inc.

Dev

elop

men

tal D

ynam

ics

endothelial plexus through vasculogen-esis and subsequently into a maturevessel wall through a process that islikely to involve vascular endothelialgrowth factor-A (VEGF-A; Tomaneket al., 2006; Nesbitt et al., 2009). De-spite an ever growing understandingof the movements and fates of EMCs,precious little is understood about howthese events are regulated at the mo-lecular level.

The Eph tyrosine kinases are afamily of receptors that play animportant role in organogenesis andvascular development along withtheir cell-surface ligands the ephrins(Cowan and Henkemeyer, 2002). Inmice, ephrinB2 is primarily expressedin cells of arteries, including endothe-lial (Wang et al., 1998; Hayashi et al.,2005), smooth muscle, and adventitialcells (Gale et al., 2001; Shin et al.,2001). Genetic studies in mice havedemonstrated that ephrinB2 func-tions in endothelium to facilitateangiogenic remodeling (Wang et al.,1998; Adams et al., 1999; Geretyet al., 1999) and in smooth muscleand adventitial cells for recruitmentto the vessel wall (Foo et al., 2006).These studies implicated reciprocalrepulsive interactions with theEphB4 receptor, which is expressedpredominantly in veins. Other EphBreceptors and ephrinB ligands havebeen implicated in systemic vascularformation of the mouse (Adams et al.,1999). In vitro, ephrinB ligands pro-mote endothelial capillary-like assem-bly, cell attachment, and angiogenesisof endothelial cells (Daniel et al.,1996; Zhang et al., 2001). Given theimportance of Eph/ephrin signaling invascular development, we postulatedthat these molecules are likely toplay a role in coronary vasculardevelopment.

Here, we present evidence that, inavian embryos, ephrinB ligands partic-ipate in epicardial and coronary vascu-lar development. We found that the PEexpresses transcripts for both eph-rinB1 and ephrinB2. Proteins andtranscripts are present in the epicar-dium and then become limited to peri-vascular fibroblasts of the atrioventric-ular sulcus. Using in vitro migrationand cell adhesion assays, we presentevidence that ephrinB ligands arelikely to play a role in migrating PEcells but not adhesion. Thus, like other

developing vascular systems, the heartuses ephrinB ligands during blood ves-sel development.

RESULTS

Expression of ephrinb1 and

EphrinB2 Ligands in

Proepicardium and

Epicardium

While three mammalian ephrinBligands have been identified, thereare only two ephrinB orthologs in thechick genome database: ephrinB1 andephrinB2 (Hubbard et al., 2005). Todetermine if ephrinB transcriptsare expressed in the PE, we per-formed reverse transcriptase-poly-merase chain reaction (RT-PCR) fromtotal RNA isolated from Hamburgerand Hamilton stage (HH) 16 chickPEs (Fig. 1A). We observed ephrinB1and ephrinB2 amplification productsfrom HH16 PE and cultured HH24epicardial total RNA (not shown) indi-cating that these transcripts areexpressed in the PE and epicardium.To determine if superficial epicardiumexpressed ephrinB ligands, we iso-lated total protein from HH24 epicar-dial cultures and analyzed it usingimmunoblotting (Fig. 1B). Using anantiserum that recognizes a C-termi-nal epitope common to all ephrinBisoforms (pan anti-ephrinB), weobserved two bands of sizes consistentwith ephrinB1 (50 kDa) and ephrinB2(48 kDa). This antiserum recognizeda band of the same mobility in mouselung total protein, used as a positivecontrol for ephrinB1. Using an antise-rum that recognizes an internal epi-tope in the extracellular domain ofhuman ephrinB1, we observed a bandat 50 kDa, consistent with the pre-dicted molecular weight for chickenephrinB1 and consistent with the mo-bility of the band in the mouse lungextract. These observations supportedthe hypothesis that the developingchicken epicardium expresses eph-rinB ligands.

Localization of EphrinB

Ligands in Epicardium

We stained epicardial monolayersmigrating from explanted HH24 chickhearts with anti-human ephrinB1and observed that the antiserum

reacted with superficial epicardialcells. Here, we observed cytoplasmicstaining. Interestingly, the intensityof staining was greater in cells at theleading edge of the monolayer andless in cells nearer to the explantedheart (Fig. 1C). We stained similarmonolayers with pan anti-ephrinB(Fig. 1D). In this case, we observedcytoplasmic staining as well as stain-ing in intercellular junctions andnuclei (Fig. 1D, arrowheads). Junc-tional staining with pan anti-ephrinBwas more evident in areas of themonolayer behind the leading edge(Fig. 1E) where we have previouslyobserved that junctional complexessuch as adherens junctions and tightjunctions are better organized (Dokicand Dettman, 2006). Nuclear stainingwas present in this area of the mono-layer (Fig. 1E). We performed threeexperiments to validate nuclear reac-tion by the rabbit pan anti-ephrinBantiserum. Nuclei did not react withgoat anti-rabbit immunoglobulin G(IgG) in the absence of pan anti-ephrinB(Fig. 1F). Tight junctions but notnuclei were labeled when mono-layers were stained with an antise-rum to the tight junction proteinzona occludens-1 (ZO1; Fig. 1G).This also independently demon-strated that the secondary antibodywas not responsible for labeling thenuclei in our experiments with pananti-ephrin. Finally, using confocalmicroscopy, we optically sectionednuclei of monolayers stained withpan anti-ephrin and WT1, a meso-thelial marker found in the nucleus.Here within 0.32-mm slices, weobserved that nuclei were labeledwith DAPI (40,6-diamidine-2-phenyli-dole-dihydrochloride; Fig. 1H), andreacted with anti-WT1 (Fig. 1I) andpan anti-ephrin (Fig. 1J).To confirm the presence of ephrinB

ligands in vivo, we stained coronalsections of hearts with pan anti-eph-rinB (Fig. 2A) and anti-ephrinB1 (Fig.2B–E). Figure 2A shows a section of aHH30 heart stained with pan anti-ephrinB and anti-integrin a5 to labelthe vascular endothelium. Here, theepicardium and the perivascular mes-enchyme reacted with this antiserum.Unlike what we observed in culturedcells, there did not appear to be nu-clear staining in EPDCs at this stagewith pan anti-ephrinB (Fig. 2A).

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 599

Dev

elop

men

tal D

ynam

ics

Figure 2B shows a section of a HH26heart stained with anti-ephrinB1.Here, the epicardium and interstitialcells reacted with the antiserum. Fig-ure 2C shows a control experiment inwhich a section from the same heartwas stained with anti-cytokeratin tolabel the epicardium. In these sec-tions, labeled cells are not visible inthe myocardial interstitium. Athigher magnifications, cells labeledwith anti-ephrinB1 appear in sitesconsistent with the endocardium (Fig.2D) and within the myocardium (Fig.2E). In all cases, this antiserum labelsthe cytoplasm of cells.

To confirm ephrinB ligand expres-sion in these sites we incubated sec-tions with EphB3-FC fragments andthen visualized this interaction usinggoat anti-human IgG coupled to Alexa488. In this experiment, we observedthat the EphB3-FC protein interactedwith superficial epicardium andEPDCs (Fig. 2F,G). Sections incubatedwith the human IgG control did notreact with epicardium (Fig. 2H).Unlikethe anti-ephrinB1 antiserum, EphB3-Fc did not react strongly with cellswithinmyocardiumor endocardium.

Fig. 1.

Fig. 2. EphrinB ligands are expressed in epicardium in vivo. A: Confocal microscopy of a Ham-burger and Hamilton stage (HH) 30 chick heart section (coronal) stained with pan anti-ephrinBantiserum (green) and anti-a5 integrin to label vascular endothelium (red). Stars indicate lumens ofcoronary vessels. B: Confocal microscopy of a HH26 chick heart section (coronal) stained withpan anti-ephrinB1 (green), mAb MF20 (red) to delineate the myocardium, and DAPI (40,6-diami-dine-2-phenylidole-dihydrochloride; blue) to visualize nuclei. C: View of a similar section from thesame heart stained with pan anti-cytokeratin (green), mAb MF20 (red), and DAPI. D: Higher mag-nification of a HH26 heart section similar to (B) where the antiserum has labeled cells (green)directly facing the lumen of the heart within the trabeculae (lum). E: Confocal image of the myo-cardial interstitium of a HH28 chick heart section (coronal) stained with anti-ephrinB1. Here, otherchannels were removed to highlight the reaction of the antiserum with the cytoplasm of inter-spersed isolated cells. Arrowheads point to three such cells. F: Confocal microscopy of coronalsections through a HH28 chick heart incubated with mouse EphB3-FC fragments and visualizedwith goat anti-human Alexa 488. G: View of the atrioventricular (AV) sulcus (avs) showing bindingof EphB3-Fc to the epicardium (epi) and epicardially derived mesenchymal cells (EPDCs). Cellsare counterstained with propidium iodide (red). H: Control section incubated only with secondaryantibody. Scale bars ¼ 20 mm in A, 50 mm in B,C,F,G, 25 mm in D, 10 mm in E.

Fig. 1. Expression of ephrinB ligands inavian epicardium. A: Reverse transcriptase-polymerase chain reaction (RT-PCR; 35cycles) of ephrinB transcripts in total RNA iso-lated from dissected Hamburger and Hamiltonstage (HH) 16 PEs. B: Immunoblots of totalprotein isolated from chick epicardial meso-thelial cells (EMCs) cultured from HH24 heartsprobed with pan anti-ephrinB (left) and anti-human ephrinB1 (right). Total protein frommouse lung extract (MLE) was used as a posi-tive control for ephrinB1. C: Confocal micros-copy of cultured chick EMCs stained withanti-ephrinB1. Dotted line indicates the lead-ing edge of the migrating monolayer. Arrowsindicate general direction of migration. D,E:Confocal microscopy of cultured chick EMCsstained with pan anti-ephrinB at the leadingedge of the monolayer (D) and several celllengths behind (E). Arrowheads indicate areaswhere intercellular junctions are visible in (D).F: Confocal image of an EMC monolayer incu-bated with goat anti-rabbit Alexa 488 as acontrol. Inset shows DAPI (40,6-diamidine-2-phenylidole-dihydrochloride) staining of thesame cells. G: Confocal image of an EMCmonolayer stained with rabbit anti-humanZO1. H–J: Confocal images of 0.32-mm opti-cal sections through an EMC nucleus stainedwith DAPI (H), Wilm’s Tumor factor 1 (I) andpan anti-ephrinB (J). Scale bars ¼ 50 mm inC, 20 mm in D–G, 10 mm in H–J.

600 WENGERHOFF ET AL.

Dev

elop

men

tal D

ynam

ics

Cell Surface Expression

of EphrinB1

The antiserum to human ephrinB1reacted with cultured epicardial cells;however, its expression was diffuse inthe cytoplasm. Thus, we did not knowif the protein was surface expressed.To test if ephrinB proteins areexpressed on the surface of chickEMCs, we treated serum-starvedchick EMCs with aggregated EphB1-FC and EphB3-Fc fragments. Cellswere treated for 45 min, fixed, andprobed with anti-ephrinB1 (Fig. 3).Clustering was absent in cells thatwere treated with aggregated humanIgG (Fig. 3A,D). Clustering of pro-teins was observed when cells weretreated with aggregated EphB1-FCfragments (Fig. 3B,E). This confirmedthat reaction of anti-ephrinB1 withchick EMCs is specific to a proteinthat can be clustered by aggregatedEphB-Fc fusion proteins and indi-cated that at least some ephrinB1ligands are presented on the surfaceof cultured chick EMCs.

EphB Receptors Are

Expressed in the Developing

Myocardium

EphrinB ligands could mediate dis-tinct adhesive and migratory effectson EMCs, including attraction orrepulsion (Holland et al., 1996; San-tiago and Erickson, 2002). EMCsrequire integrins for migration on themyocardial surface, and in their ab-sence, migrations does not occur(Yang et al., 1995; Sengbusch et al.,2002). For this reason, it is not likelythat ephrinB ligands are sufficient tomediate EMC superficial migration.It is, however, likely that they couldmodify integrin-mediated migration(Huynh-Do et al., 1999, 2002; Der-oanne et al., 2003; Meyer et al., 2005).We, therefore, reasoned that beforeattachment of the PE, the myocar-dium would express an EphB receptorto interact with EMC expressed eph-rinB ligands.

To determine if EphB receptors areexpressed in the heart before PEattachment, we performed RT-PCR ontotal RNA isolated from HH16 heartsthat were dissected free from PEs. Weobserved that of the four chick EphBreceptors, three were amplified:

EphB1, EphB2, and EphB3 (Fig. 4A).The presence of two bands in theEphB3 reaction suggested the pres-ence of an alternatively spliced tran-script, and this was confirmed bysequencing the smaller amplificationproduct (data not shown). Transcriptsfor EphB5 were not amplified. Whilethis experiment does not define whichEphB receptors are expressed by themyocardium, it does demonstrate thatEphB transcripts are present in theHH16 heart tube. We next performedin situ hybridization analysis ofHH16 and HH17 embryos using anti-sense probes to chicken EphB1,EphB2, and EphB3 (Fig. 4B). Here,we observed that the antisense probeto EphB3 had the strongest reactionwith the heart tube. Thus, before theattachment of the PE, EphB1, EphB2,and EphB3 transcripts are present inthe heart tube, with EphB3 appearingto be the highest expressed.

To test if EphB3 proteins were pres-ent in the developing heart, we iso-lated protein from dissected HH16ventricles. We chose hearts with visi-bly unattached PEs and removed boththe presumptive outflow tract andatria (sinus venosus). We also isolatedtotal protein from HH19 and HH25ventricles. For positive controls, weisolated total protein from dissectedHH19 trunks and forelimbs. This wasdone by removing the head cranially,and the rest of the embryo caudally,leaving the heart and forelimbs. Theheart, trunk, and forelimbs were thensegregated for protein isolation. Thetrunk region includes portions of theneural tube, neural crest, and somitesthat have been shown by in situhybridization to express EphB1,EphB2, and EphB3 (Krull et al., 1997;Santiago and Erickson, 2002). Theforelimb was also demonstrated to bea site of EphB3 expression by in situhybridization (Santiago and Erickson,2002). Proteins were analyzed by im-munoblotting (Fig. 4C). Using a ratmonoclonal antibody raised againstthe N-terminus of mouse EphB3, wewere able to detect a prominent bandof approximately 100 kDa (Fig. 4C).This band was present in all the sam-ples tested. Together with the resultsfrom RT-PCR and in situ hybridiza-tion, we conclude that of the EphBreceptors tested, EphB3 is present inthe developing chick heart during the

time that the PE attaches and EMCsmigrate superficially to form theepicardium.

Eph Receptors Alter Integrin-

Based EMC Migration but

Not Adhesion

To test if EphB receptors alter epicar-dial cell migration in vitro, weexplanted HH24 chick hearts todishes coated with mammalian EphB-FC fragments. We predicted that re-pulsive effects would be manifested aseither inhibition or reduction of EMCmigration from explanted hearts.Alternately, attractive effects wouldbe manifested as an increase in EMCmigration. Cells were allowed tomigrate onto the plates from thehearts for 18 hours. Hearts wereremoved from dishes and the remain-ing epicardial monolayers were fixed.The area of each monolayer wasdetermined using light microscopy.EphB-Fc fragments are coupled to theFc portion of the human IgG heavychain. We, therefore, used dishescoated with bovine serum albumin(BSA) and human IgG as controls forthe Eph-Fc coated dishes. We alsoused dishes coated with human serumfibronectin (FN) as a positive control.Here, we observed that EMCsmigrated from explanted hearts toform monolayers that covered 3.69mm2 for FN and 1.82 mm2 for IgG(Fig. 5A). As compared with coatingwith BSA and IgG, EphB1-Fc andEphB2-Fc increased the average sizeof monolayers to 2.58 mm2 and 2.14mm2, respectively. EphB3-Fc (1.79mm2) did not increase or decreasemigration. Only the increased migra-tion on Eph-B1-FC was statisticallysignificant. This effect was not as ro-bust as FN, a known mediator ofEMC migration. From this experi-ment, we conclude that surfacescoated with mammalian EphB recep-tors can augment epicardial migra-tion relative to BSA and IgG. Becausewe did not observe a repulsive effectwith EphB-Fc coating, this experi-ment supports the hypothesis thatepicardial expressed ephrinB ligandsare involved in attractive migration ofchick EMCs on the heart surface.EphrinB ligands could also alter

integrin-based adhesion of EMCs

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 601

Dev

elop

men

tal D

ynam

ics

(Huynh-Do et al., 1999). To test this,we performed cell adhesion assayswith FN and rat EphB1-FC. We chose

EphB1-FC, because it had the great-est effect on migration. We observedthat EphB1-FC was not sufficient to

increase EMC adhesion to FN (Fig.5B). FN increased cell adhesion byapproximately 20%, but neither IgGnor EphB1-Fc significantly increasedthis adhesion to FN. Thus, ephrinBligands do not alter integrin-based ad-hesion in EMCs.We next tested if EphB1-Fc could

alter EMC migration on surfacescoated with FN. We coated chargedtissue culture plates with FN at twoconcentrations: 1 mg/ml and 5 mg/ml.We also coated plates with FN (at thesame concentrations above) mixedwith EphB1-Fc fragments at a con-centration of 5 mg/ml. Plates wereblocked in BSA (1% w/v), and HH24hearts were explanted onto thesesurfaces and migration was quanti-fied after 18 hr. Here, we found thatthe addition of EphB1-Fc to the coat-ing mixture increased EMC migrationby a modest but significant amount(Fig. 5C). At 1 mg/ml, FN was able toincrease migration as compared withBSA coating in our assay, but not sig-nificantly. The effect of FN was signif-icant at 5 mg/ml, increasing from 1.59mm2 to 3.46 mm2. When EphB1-Fcwas coated on surfaces along withFN, it increased migration at bothconcentrations of FN tested. Migra-tion increased from 1.88 mm2 on 1 mg/ml FN to 2.32 mm2 on 1 mg/mlFN with EphB1-Fc, an increase ofapproximately 23%. Migration in-creased from 3.46 mm2 on 5 mg/ml FNto 4.03 mm2 on 5 mg/ml FN withEphB1-Fc, an increase of approxi-mately 16%; however, this increasewas not statistically significant.We have shown that chick EMCs

express several integrin receptors,including those that bind the RGDcore of the cell-binding domain of FN(Pae et al., 2008). Others have demon-strated that a4b1 integrin, whichbinds to the V25 (CS-1) domain of FN,is expressed by EMCs and that thisreceptor is essential for PE cellattachment and migration on the sur-face of the myocardium (Stepp et al.,1994; Yang et al., 1995; Sengbuschet al., 2002). To determine whichclass of integrins is affected by FN,EphB1-Fc co-coating we used func-tion-blocking peptides. Two peptideswere used to test interactions withthe cell binding domain: GRGDSPand its control peptide GRADSP.Additionally, two peptides were used

Fig. 3. EphrinB1 is cell surface expressed. A–F: Confocal microscopy of cultured chick epicar-dial mesothelial cells (EMCs) stained with anti ephrinB1 (green), Texas-Red-X phalloidin, andDAPI (40,6-diamidine-2-phenylidole-dihydrochloride). A,D: Cells were incubated with aggregatedhuman immunoglobulin G (IgG). B,E: Cells were incubated with aggregated EphB1-Fc fusionproteins. C,F: Cells were incubated with nonaggregated goat anti-human IgG. A–F: Regionswithin white boxes in (A–C) are magnified in (D–F). B,E: Clustering of ephrinB1 is visible asspeckles in (B) and (E, arrowheads). Speckles are absent in the controls (A,C,D,F). Scale bars ¼10 mm in A–C, 5 mm in D–F.

Fig. 4. EphB3 expression in the developing chicken heart. A: Reverse transcriptase-polymer-ase chain reaction (RTPCR; 35 cycles) of EphB receptor transcripts from total RNA isolatedfrom E16 heart tubes. B: Whole-mount in situ hybridization of EphB antisense (top) and senseprobes (bottom) to Hamburger and Hamilton stage (HH) 16 and 17 chick embryos. C: Immuno-blotting of total protein isolated from (left to right) HH19 trunk, HH19 forelimb, HH16 ventricle,HH19 ventricle, and HH25 ventricle. The immunoblot was probed with rat anti-mouse EphB3 asindicated at the right. The mobility of the 100-kDa marker is indicated on the left.

602 WENGERHOFF ET AL.

Dev

elop

men

tal D

ynam

ics

to test interactions with the V25 (CS-1) domain of FN: EILDVPST and itscontrol peptide EILEVPST. Becauseincreased migration was statisticallysignificant only when plates were co-coated with 1 mg/ml FN and 5 mg/mlEphB1-Fc (Fig. 5C), we chose theseconcentrations for our peptide stud-ies. Thus, surfaces were coated with1 mg/ml FN and 5 mg/ml EphB1-Fc,and peptides were added to the me-dium at a concentration of 100 mMduring the time cells were migratingfrom hearts. Here, we observed thatGRGDSP significantly reduced migra-tion from 2.32 mm2 to 1.94 mm2,

a decrease of approximately 16%.EILDVPST did not diminish migra-tion but slightly increased it to 2.43mm2; however, this increase wasnot statistically significant. Of thecontrol peptides, GRADSP increasedmigration and EILEVPST reducedmigration, but these changes werenot statistically significant. Theseobservations are consistent with thehypothesis that the interaction ofEMCs with the cell-binding domain ofFN by means of the RGD bindingclass of integrins is altered by thepresence of EphB1-Fc on the sub-strate during migration.

Adventitial Fibroblasts

Express EphrinB Ligands

Based on our observations of ephrinBligand expression in situ, we pre-dicted that ephrinB ligands persist inEPDCs during coronary vascular de-velopment. To investigate this, weperformed in situ hybridization onchick hearts using antisense probes toephrinB1 and ephrinB2. For eph-rinB1, we observed that from HH24to HH36 staining with the antisenseprobe was in the superficial epicar-dium and subepicardial mesenchyme(data not shown). This confirmed ourprevious observations with pan anti-ephrin and anti-ephrinB1. For theephrinB2 antisense probe, we did notobserve appreciable staining in theepicardium after HH24 (data notshown). From this it appears that, af-ter HH24, ephrinB1 becomes the pre-dominant ephrinB ligand in chickenepicardium and its derivatives. Of in-terest, after HH30 reaction with theephrinB1 antisense probe appearedmost intense in the region of the atri-oventricular (AV) sulcus (Fig. 6A). Wecut transverse sections of HH36hearts previously stained by the eph-rinB1 antisense probe and observedthat the cells which reacted with theprobe were located around vessels butnot in the vascular media. We stainedthese sections with anti-smooth mus-cle a-actin and observed that the pur-ple stain from the in situ hybridiza-tion was outside of the red stainedregion containing smooth muscle (Fig.6B,C). Anti-ephrinB1 staining ofHH40 (4 days older) chick heart sec-tions indicated that some adventitialfibroblasts continued to express eph-rinB1 (Fig. 6D).These observations suggested that

as EPDCs differentiate into smoothmuscle they reduce their expressionof ephrinB1. To test this, we used pri-mary EMC cultures from HH24 chickhearts. These cells shift from a meso-thelial to a fibroblast-like phenotypeand begin to express smooth musclecytoskeletal genes when treated withplatelet-derived growth factor BB(PDGF BB) for 3 days (Landerholmet al., 1999; Lu et al., 2001). Weexplanted HH24 chick hearts onto col-lagen coated coverslips and allowedcells to migrate to the surface of theglass. Coverslips were treated with

Fig. 5. EphrinB ligands play a role in epicardial cell migration. A: Bar graph showing the aver-age size of areas of epicardial monolayers migrated from Hamburger and Hamilton stage (HH)24 chick hearts on surfaces coated with fibronectin (FN; 5 mg/ml) or EphB-Fc fragments (5 mg/ml). The height of each bar reflects the mean area of the monolayers in square millimeters. Thefive-point star indicates a P value of 0.004 for FN compared with bovine serum albumin (BSA;1% w/v). The dagger indicates a P value of 0.02 for EphB1-Fc compared with BSA coating. Theline above the other bars indicates that none of these values are significant for these variablescompared with BSA coating. B: Bar graph showing relative adhesion of chick EMCs to the indi-cated proteins coated at a concentration of 5 mg/ml. The values on the y-axis are optical densityunits read at 540 nm for crystal violet staining. Increased values reflect more adhered cells. Thefive-point star indicates a P value of 0.01 for the comparison between FN coating and BSAcoating. The line above the other bars indicates that none of these values are significant forthese variables compared with FN coating. C: Bar graph showing the average size of areas ofepicardial monolayers migrated from HH24 chick hearts on surfaces coated with FN or FN andEphB1-Fc fragments. The height of each bar reflects the mean area of the monolayers in squaremillimeters. The five-point star indicates a P value of 0.0008 for FN compared with BSA. Thedagger indicates a P value of 0.04 for FN (1 mg/ml) þ EphB1-Fc (5 mg/ml) compared withFN (1 mg/ml). The eight-point star indicates a P value of 0.05 for FN (1 mg/ml) þ EphB1-Fc(5 mg/ml) compared with FN (1 mg/ml) þ EphB1-Fc (5 mg/ml) þ GRGDSP (100 mM). In allgraphs, the error bars represent standard error of the mean. The statistical test was a Student’st-test. White numbers in each bar indicate the sample size for that experiment.

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 603

Dev

elop

men

tal D

ynam

ics

PDGF BB (10 ng/ml) for 3 days.EMCs on coverslips were probed forephrinB1, smooth muscle a-actin, orcaldesmon (Fig. 6E–J). We observedthat, before differentiation, EMCsexpressed ephrinB1 and smooth mus-cle a-actin (Fig. 6E,F). After stimula-tion with PDGF-BB, EMCs becamefibroblast-like in appearance and theyexpressed higher levels of smoothmuscle a-actin but not ephrinB1 (Fig.6G,H). We repeated this experimentusing antibodies to caldesmon andmade a similar observation (Fig. 6I,J).Thus, as EMCs differentiate intosmooth muscle in vitro, they down-regulate ephrinB1 expression. Thisexperiment was consistent with ourin vivo observations and suggeststhat the PDGF-BB stimulated EMCsdifferentiate into smooth muscle andnot into other lineages derived from

EMCs like cardiac fibroblasts andpericytes. Thus, down-regulation ofephrinB1 expression could be used asa marker to identify factors that stim-ulate cardiac fibroblast and pericytedifferentiation in vitro.

DISCUSSION

We have observed that, in the devel-oping chick heart, one site of ephrinBligand expression is in epicardium,EPDCs, and perivascular fibroblastsof the AV sulcus. This expression is atleast partially on the cell surface andis likely to play a role in integrinmediated epicardial superficial migra-tion but not adhesion. EphB receptorsare expressed in the HH16 hearttube, so it is possible that an interac-tion between a PE expressed ephrinBligand and a myocardial expressed

EphB receptor plays a role in the ini-tial interface between the two celltypes.EphrinB1 has been implicated in

the formation of skeletal structures,the retina, and in neural crest. A com-mon theme for ephrinB1 in these tis-sues is in the guidance or sorting ofcells along migratory pathways. Forexample, during early neural crestmigration, ephrinB1 expressed in thesomite can act repulsively on migrat-ing neural crest cells expressing Ephreceptors (Krull et al., 1997; Wangand Anderson, 1997). In the case ofmigrating EMCs, the ephrinB ligandsare expressed in the migrating cells.Our evidence would suggest that eph-rinB ligands play a supportive role inEMC migration. This may involvesensing the myocardium using a simi-lar mechanism through which retinal

Fig. 6. EphrinB1 ligand expression in perivascular mesenchyme in the atrioventricular (AV) sulcus. A: Whole-mount in situ hybridization of an eph-rinB1 antisense probe to a Hamburger and Hamilton stage (HH) 36 chick heart. The line indicates the transverse plane of section shown in panels(B) and (C). B,C: Transverse sections of a heart similar to the one in (A) that show purple staining in the perivascular mesenchyme. Red staining isanti-smooth muscle a-actin. Stars indicate lumens of vessels. D: Confocal image of a transverse section of a HH40 heart stained with anti-eph-rinB1 (green) and anti-smooth muscle a-actin (red). Arrows point to green cells in the vascular adventitia. E,F: Confocal image of an untreated epi-cardial mesothelial cell (EMC) monolayer stained with anti-ephrinB1 (green), anti-smooth muscle a-actin (red), and DAPI (40,6-diamidine-2-phenylidole-dihydrochloride; blue). G,H: Confocal image of a platelet-derived growth factor-BB (PDGF-BB) treated EMC monolayer stained withanti-ephrinB1 (green), anti-smooth muscle a-actin (red), and DAPI (blue). I,J: Confocal image of a PDGF-BB treated EMC monolayer stained withanti-ephrinB1 (green), anti-caldesmon (red), and DAPI (blue). The sensitivity of the photomultiplier tube was 40% less for the red channel in (G)and (I) than in (E). F, H, and J were imaged using identical photomultiplier tube settings and only show the ephrinB1 reaction.

604 WENGERHOFF ET AL.

Dev

elop

men

tal D

ynam

ics

progenitor cells sense their environ-ment as they migrate into the eye field(Moore et al., 2004; Lee et al., 2006).

Evidence is also accumulating thatephrinB ligands are likely to be im-portant in establishing or maintain-ing tight junctions. Xenopus, mouse,and chick ephrinB1 show absoluteconservation at their C-termini. Leeand colleagues have recently demon-strated that three tyrosine residues inthis domain of ephrinB1 play a criti-cal role in regulating the planar cellpolarity pathway by interacting withPar6 and Disheveled (Dsh) (Lee et al.,2006, 2008). Phosphorylation of theseresidues can be regulated by either li-gation of ephrinB ligands to Ephreceptors or by FGF signaling (Leeet al., 2008). FGF signaling can pro-mote phosphorylation of ephrinB1 atTyr 310. This reduces the interactionof ephrinB1 with par6 and promotesthe establishment of tight junctions.FGF signaling can also result in tyro-sine phosphorylation of ephrinB1 atresidues 324 and 325. This reducesthe interaction between ephrinB1 andDsh, and this alters the ability of eph-rinB1 to mediate cell migration (Leeet al., 2009). TGFb receptors play animportant role in regulating epicar-dial EMT (Olivey et al., 2006; Comp-ton et al., 2007; Sridurongrit et al.,2008) and interact with Par6 to modu-late epithelial cell polarity in mam-mary epithelial cells (Ozdamar et al.,2005). These studies, together withours, point to a potential role for eph-rinB1 in the complex regulation ofepicardial migration, cell polarity,and EMT as regulated by the FGFand TGFb signaling pathways.

Our observation of junctional eph-rinB ligand localization with pananti-ephrinB antiserum supports thishypothesis. There are two possibleinterpretations of our observation. Byvirtue of its C-terminal epitope, pananti-ephrinB recognizes both eph-rinB1 and ephrinB2. Therefore, be-cause junctional staining was notobserved with the anti-ephrinB1 anti-serum, which recognizes the extracel-lular portion of the molecule, it repre-sents the localization of ephrinB2 inEMCs. Alternatively, because the epi-tope for the pan anti-ephrin is the C-terminal cytoplasmic domain, junc-tional staining could represent stain-ing of either ephrinB ligand but that

this region of ephrinB1 is not accessi-ble to this antiserum when it is local-ized in junctional complexes. Basedon our experiments, it is not possibleto conclude which ligand is present inthe junctions. However, staining withthe pan anti-ephrinB antiserum doessuggest a role for ephrinB ligands inepicardial cell junctions.

In cultured HH24 EMCs, we alsoobserved nuclear staining with pananti-ephrinB. This localization wasnot observed in subepicardial mesen-chyme of HH30 hearts. A possible nu-clear localization for ephrinB ligandshas not yet been documented but isconsistent with other epithelial exam-ples. Class B ephrins have been dem-onstrated to be PDZ domain bindingproteins. Specifically, the conservedYYKV sequence in the cytoplasmic C-terminal domain has been implicatedas a PDZ domain binding site (Linet al., 1999). PDZ domain proteinscan mediate the interaction of pro-teins and their subcellular localiza-tion (Nourry et al., 2003). Of interest,similar to what we observed with pananti-ephrinB, the zona occludins-2protein (ZO2) is localized either intight junctions or the nucleus, andthe nucleus is thought to serve as areservoir for newly synthesized ZO2(Chamorro et al., 2009). Nuclearimport of ZO2 is increased by me-chanical injury or chemical stress andduring the G1 phase of the cell cycle.Thus, its localization is carefullyregulated and there is typically moreZO2 in the nucleus of proliferatingcells (Tapia et al., 2009). It is possiblethat, if ephrinB ligands bind to PDZdomain proteins such as ZO2, theirlocalization pattern could changedepending on several factors includ-ing cell proliferation (for example incultured cells), migration and epithe-lial versus mesenchymal phenotype.

Of the EphB transcripts detectedin the HH15–17 heart, EphB3 wasexpressed at the highest level in themyocardium by RT-PCR and in situhybridization. EphB3 transcriptshave been observed in the cardiogenicmesoderm with continued expressionin the primary myocardium duringfusion and looping of the heart tube(Baker et al., 2001; Baker and Antin,2003). Additionally, Santiago andErickson (2002) observed EphB3 tran-scripts in HH23 hearts by in situ

hybridization. In their study, none ofthe other Eph receptor probes (includ-ing EphB1 and EphB2) reacted signif-icantly with the heart at this stage.These observations, along with ours,support a continued expression ofEphB3 in the primary myocardial lin-eage. Thus, the presence of EphB3 inthe myocardium before the attach-ment of the PE suggests a possiblerole in mediating a molecular interac-tion between of ephrinB1/ephrinB2expressing PE cells and EphB3expressing myocardial cells.One curiosity made apparent by

our experiments was that, in ourmigration experiment, chick EMCsresponded the most to rat EphB1-Fcchimeras. This was not consistentwith our observation that EphB3transcripts were the most abundantof the four EphB receptors we testedby RT-PCR and in situ hybridization.We concluded that there must besubtle functional differences betweenthe mammalian Eph-Fc chimeras weused in our assay and avian EphBreceptors. So we compared the aminoacid sequences of chick EphB3 withrat and mouse EphB1, EphB2, andEphB3 using clustalW2 (Larkin et al.,2007). We found that chick EphB3was most closely related to ratEphB1. Thus, by phylogeny we pre-dict that, of the mammalian EphB-Fcproteins, rat EphB1-Fc would havethe greatest biologic effect on chickEMCs effectively mimicking avianEphB3. It also follows that our ex-periment demonstrates that, whencomparing orthologous gene products,there may be important functionaldifferences between avian andmammalian Eph family membersthat affect their use in avianexperiments.While several studies have demon-

strated in vitro differentiation ofEMCs into smooth muscle, nonehave reported differentiation intoperivascular fibroblasts. This is likelybecause little is known about this dif-ferentiation pathway or markers thatwould define it. Our findings supportthe idea that ephrinB1 could be usedas a marker for fibroblast differentia-tion, because it is expressed in peri-vascular fibroblasts in HH36 andolder hearts and because it is reducedin PDGF-BB differentiated EMCsin vitro.

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 605

Dev

elop

men

tal D

ynam

ics

EXPERIMENTAL

PROCEDURES

Eggs

Babcock B-300 Chicken (Gallus gal-lus) hatch eggs were obtained fromPhil’s Fresh Eggs (Forreston, IL) andincubated in a humidified incubatorat 38�C. Embryos were staged accord-ing to method of Hamburger andHamilton (1951).

Reagents

Recombinant rat EphB1-FC, mouseEphB2-FC, mouse EphB3-FC, mouseephrinB1-FC, and mouse ephrinB2-FC were obtained from R&D Systems.Texas Red-X phalloidin, 40, 6 diami-dino-2-phenylindole, dihydrochloride(DAPI), propidium iodide, and phal-loidin coupled to Texas Red-X werefrom Invitrogen, Molecular Probes.IgG from human serum was obtainedfrom Sigma. Peptides were purchasedfrom American Peptide and sus-pended in sterile water. To competi-tively inhibit binding of RGD bindingintegrins to the RGD core domain ofECM proteins, we used the GRGDSPpeptide. The peptide GRADSP wasused as the control. To competitivelyinhibit binding of a4b1 to the V25 (CS-1) domain of FN, we used EILDVPST.The peptide EILEVPST was used asthe control. All peptides were used ata final concentration of 100 mM.Mouse lung extract (Santa Cruz Bio-technology, SC-2300) was used as apositive control for ephrinB1 inimmunoblots.

Antibodies

The following antibodies were used inthis study. Rabbit anti-humanephrinB1 (sc-1011), and rabbit pananti-human ephrinB (sc-910) were ob-tained from Santa Cruz Biotechnol-ogy. Goat anti-human IgG, goat anti-mouse IgG and goat anti-rabbit IgGcoupled to the fluorophores indicatedin the text were obtained from Invi-trogen, Molecular Probes. Sheep anti-digoxigenin (DIG) coupled to alkalinephosphatase was obtained from RocheDiagnostics. Mouse anti-a5 integrin(U1a) was a gift from Dr. Ruth Chi-quet-Ehrismann. Mouse anti-caldes-mon (CALD-5) and anti-smooth mus-cle a-actin (1A4) were obtained from

Sigma. Mouse monoclonal anti-myo-sin heavy chain (mAb MF20), wasobtained from Developmental StudiesHybridoma Bank. Rat anti-mouseEphB3 was obtained from R&D sys-tems. Rabbit anti-cytokeratin (catalogno. Z0622) and mouse anti-humanWT1 (clone 6F-H2) were obtainedfrom Dako. Goat anti-human IgGFC fragment specific was obtainedfrom Jackson Immunochemicals. Vec-tor Red staining of paraffin sectionswas done using a goat anti-mouseVectastain ABC-AP kit (VectorLaboratories).

Tissue Culture

Primary cultures of chick epicardialcells (EMCs) were grown from HH24hearts as in Dokic and Dettman(2006) and maintained in M199 me-dium with varying amounts of (asindicated in the text) fetal bovineserum (Hyclone) in a humidified5% CO2 tissue culture incubator at37�C. In some cases, hearts wereexplanted onto 22-mm glass cover-slips coated with rat-tail Collagen 1(BD Biosciences).

Immunobloting

Cells or embryonic tissues were solubi-lized in ice-cold RIPA buffer (50 mmol/L Tris-HCl pH 8.0, 350 mmol/L NaCl,1% w/v NP-40, 0.5% w/v deoxycholate,0.1%w/v sodium dodecyl chloride) con-taining protease inhibitor cocktail(Sigma, catalog no. P8340) for 5 min,scraped or pulverized with a dispos-able pestle and spun at 4�C at 10,000rpm for 10 min. Protein in clearedsupernatants was quantified using theBradford method (Thermo Scientific)and 10 mg of total cellular proteinwas run on 10% acrylamide sodiumdodecyl sulfate-polyacrylamide gelelectrophoresis gels (Bio-Rad). Pro-teins were electroblotted onto Hybond-ECL nitrocellulose membranes (Amer-sham), which were blocked in 2.5% (w/v) nonfat dry milk in Tris buffered sa-line with 0.1% Tween-20 (Fisher).Membranes were probed with antibod-ies in blocking solution at 4�C, over-night. Horseradish peroxidase conju-gated secondary antibodies (CellSignaling Technologies) in blocking so-lution were incubated with washedmembranes for 1 hr at room tempera-

ture. Bands were detected usingSuperSignal West Femto substrate(Thermo Scientific) on X-ray film.

Aggregation of EphB-Fc

Fragments

EphB1-FC or EphB3-Fc proteins wereaggregated using a 10-fold excess ofgoat anti-human FC for 2 hr at roomtemperature. As a control, humanIgG was aggregated with goat anti-human FC for the same time. Aggre-gates (5 mg/ml, final concentration)were added for 45 min to serum-starved chick EMCs grown on colla-gen coated glass coverslips in a 5%CO2 tissue culture incubator at 37�C.A second control was to incubate cellsfor 45 min with goat anti-human FCto determine if this antibody adheredto cells in a punctate manner. Cover-slips were washed three times withphosphate buffered saline (PBS)before fixation in 4% formaldehydefor 10 min. Coverslips were thenwashed three times in PBS to removeformaldehyde and blocked in PBScontaining 0.1% (w/v) bovine serumalbumin (Sigma) and 0.1% (v/v) TritonX-100 (Fisher). Cells were probedwith anti-ephrinB1, washed, and thenprobed with goat anti-rabbit IgG.Cells were counterstained with DAPIand phalloidin. Cells were thenimaged using confocal microscopy.

Mesothelial Cell

Migration Assay

Cell migration assays were performedas was described in Pae et al. (2008)with the following changes. The 30-mlculture dishes were coated overnightwith human plasma fibronectin (BDBiosciences) at concentration of 1 or 5mg/ml (in PBS) and/or EphB-FCfusion proteins at 5 mg/ml (in PBS) at4�C, washed three times with PBSand blocked for 1 hr in bovine serumalbumin (Sigma, 1% v/v) at 37�C in a5% CO2 tissue culture incubator.Coated and blocked plates werewashed three times with serum freeM199 medium. A total of 500 ml of se-rum free M199 medium was added af-ter the third wash, and two to fourhearts from HH24 embryos wereplaced on the surface of each plateand left at room temperature for 30min to allow hearts to adhere to the

606 WENGERHOFF ET AL.

Dev

elop

men

tal D

ynam

ics

surface. Because hearts were approxi-mately the same size, the startingarea was approximately equal be-tween each assay. Dishes were placedin a 5% CO2 tissue culture incubatorat 37�C for 18 hr. Hearts wereremoved from the surface of theplates by gentle washing with theremaining medium and cells werewashed twice with sterile PBS andfixed in 4% formaldehyde. Plates werestained with hematoxylin as in Paeet al. (2008) and the total area of eachmonolayer was determined usingMetamorph 4.5 (Molecular Devices).In experiments with bioactive pep-tides, peptides were recently pur-chased, aliquoted, and stored at�80�C. They were thawed and dilutedin serum free medium immediatelybefore hearts were explanted ontodishes. Peptides or other proteinswere never reused after thawing.

Cell Adhesion Assay

Cell adhesion assays were performedas was described in Pae et al. (2008)with the following changes. Primarycultures of chick EMCs were gener-ated from 20 to 30 explanted HH24hearts in serum free M199 and antibi-otics. Hearts were removed after1 day and cells were cultured for2 days in M199 medium containing fe-tal bovine serum (FBS; 1% v/v).Ninety-six well tissue culture plateswere coated as above, blocked in heat-inactivated bovine serum albumin (10mg/ml) for 30 min, and then washedwith 300 mL of serum free M199. Cellswere digested briefly in trypsin(0.25% w/v, 2.21 mM ethylenediami-netetraacetic acid), mechanically dis-rupted by pipetting and complete dis-ruption of cells was monitored on aphase contrast microscope. Cells werepelleted by centrifugation (5,000rpm), resuspended in 320 ml of M199supplemented with FBS (10% v/v),and placed on ice. Cells were countedon a hemocytometer and diluted to aconcentration of 350 cells/ml. An equalnumber of cells (35,000) were addedto individual wells in 100 ml serumfree medium, the plate was brieflyswirled and placed in a 5% CO2 incu-bator for 45 min at 37�C. Wells werewashed three times with PBS fol-lowed by aspiration and then fixed informaldehyde (4% v/v) for 10 min at

room temperature. Bound cells werestained with crystal violet (0.1% w/vin absolute ethanol) for 10 min. Wellswere washed with water until no re-sidual dye remained and plates wereallowed to dry. Dye was solubilized in100 mL sodium dodecyl sulfate (2% w/v in water) and absorbance was readat 540 nm on a Lab Systems MCC/340multiscan plate reader. Data areexpressed as average optical densityof the solution at 540 nm. P valueswere calculated using a Student’st-test.

In Situ Hybridization

Hybridization with DIG labeled RNAprobes was performed following an insitu hybridization protocol adaptedfrom Nieto (Nieto et al., 1996). Analkaline phosphatase conjugatedanti-DIG antibody and an NBT/BCIP(nitroblue tetrazolium choride/5-bromo-4-chloro-3-indolyl phosphate)color reaction was used for detectionof probe. Photographs of the embryosand hearts were taken using a NikonCoolpix 5700 digital camera.

Riboprobe Synthesis

EphB1, EphB2, and EphB3 cDNAswere obtained from Dr. Parker Antin.EphrinB1 was amplified from PEmRNA cloned into pCRII (Invitrogen)and sequenced to confirm identity.The following cDNAs were used togenerate ribroprobes: EphB1, acces-sion number Z19110, nucleotide range934–2876; EphB2, accession numberM62325, nucleotide range 871–1439;EphB3, accession number Z19061,nucleotide range 1674–3582; eph-

rinB1, accession number U72394, nu-cleotide range 801–1145; ephrinB2,accession number AF180729, nucleo-tide range 1–1002.

RT-PCR

Total RNA from dissected PEs or cul-tured embryonic chick EMCs was iso-lated using the RNAqueous for RT-PCR kit (Ambion). RT-PCR was doneusing the Access for RT-PCR kit(Promega). The primers used for RT-PCR are listed in Table 1.

ACKNOWLEDGMENTSThe authors thank Dr. Parker Antinfor the gift of the cDNAs used in thisstudy. We thank Drs. Hans-GeorgSimon, Danijela Dokic, and Maria LuzV. Dizon for critical reading of themanuscript. The Pediatric Cardiopul-monary Disease Laboratory is gener-ously supported by funds raised by theWomen’s Board of Children’s Memo-rial Hospital, Chicago, IL.

REFERENCES

Adams RH, Wilkinson GA, Weiss C,Diella F, Gale NW, Deutsch U, Risau W,Klein R. 1999. Roles of ephrinB ligandsand EphB receptors in cardiovasculardevelopment: demarcation of arterial/venous domains, vascular morphogene-sis, and sprouting angiogenesis. GenesDev 13:295–306.

Baker RK, Antin PB. 2003. Ephs and eph-rins during early stages of chickembryogenesis. Dev Dyn 228:128–142.

Baker RK, Vanderboom AK, Bell GW,Antin PB. 2001. Expression of the re-ceptor tyrosine kinase gene EphB3 dur-ing early stages of chick embryodevelopment. Mech Dev 104:129–132.

Chamorro D, Alarcon L, Ponce A, TapiaR, Gonzalez-Aguilar H, Robles-Flores

TABLE 1. Primers Used in This Study

Chick ephrinB1 forward 50AGGAGGCAGACAACACCGTGA30

Chick ephrinB1 reverse 50TAGGGGATGATGATGTCGCT 30

Chick ephrinB2 forward 50TCTACTCAACTGTGCCAAGCCAGA30

Chick ephrinB2 reverse 50GGCTCAGAACCATTGTTGTTGCCA30

Chick GAPDH forward 50AGGCCATCACTATCTTCCAG30

Chick GAPDH reverse 50CAGCCTTCACTACCCTCTTG30

Chick Eph B1 forward 50CACACACACCCTACACCTTTGAGA30

Chick Eph B1 reverse 50CACCAGCGAAACAATGAAGACCAC30

Chick Eph B2 forward 50AGCCAAGGAGATGAAGGATGTGTC30

Chick Eph B2 reverse 50TAATCCAGGATGACTCCATTGGGC30

Chick Eph B3 forward 50ATCAAGTACTCCGAGAAGCAAGGC30

Chick Eph B3 reverse 50AAACTCTCCTGCTCCAATGACCTC30

Chick EphB5 forward 50AGTAGCATCACACTGTCTTGGCCT30

Chick EphB5 reverse 50TCCCACCAGCTGTAACACACTGAA30

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 607

Dev

elop

men

tal D

ynam

ics

M, Mejia-Castillo T, Segovia J, BandalaY, Juaristi E, Gonzalez-Mariscal L.2009. Phosphorylation of zona occlu-dens-2 by protein kinase C{varepsilon}regulates its nuclear exportation. MolBiol Cell 20:4120–4129.

Compton LA, Potash DA, Mundell NA,Barnett JV. 2006. Transforming growthfactor-beta induces loss of epithelialcharacter and smooth muscle cell differ-entiation in epicardial cells. Dev Dyn235:82–93.

Compton LA, Potash DA, Brown CB, Bar-nett JV. 2007. Coronary vessel develop-ment is dependent on the type IIItransforming growth factor beta recep-tor. Circ Res 101:784–791.

Cowan CA, Henkemeyer M. 2002. Eph-rins in reverse, park and drive. TrendsCell Biol 12:339–346.

Daniel TO, Stein E, Cerretti DP, St JohnPL, Robert B, Abrahamson DR. 1996.ELK and LERK-2 in developing kidneyand microvascular endothelial assem-bly. Kidney Int Suppl 57:S73–S81.

Deroanne C, Vouret-Craviari V, Wang B,Pouyssegur J. 2003. EphrinA1 inacti-vates integrin-mediated vascular smoothmuscle cell spreading via the Rac/PAKpathway. J Cell Sci 116:1367–1376.

Dettman RW, Denetclaw W Jr, OrdahlCP, Bristow J. 1998. Common epicardialorigin of coronary vascular smooth mus-cle, perivascular fibroblasts, and inter-myocardial fibroblasts in the avianheart. Dev Biol 193:169–181.

Dokic D, Dettman RW. 2006. VCAM-1inhibits TGFbeta stimulated epithelial-mesenchymal transformation bymodulating Rho activity and stabilizingintercellular adhesion in epicardial me-sothelial cells. Dev Biol 299:489–504.

Foo SS, Turner CJ, Adams S, CompagniA, Aubyn D, Kogata N, Lindblom P,Shani M, Zicha D, Adams RH. 2006.Ephrin-B2 controls cell motility and ad-hesion during blood-vessel-wall assem-bly. Cell 124:161–173.

Gale NW, Baluk P, Pan L, Kwan M, HolashJ, DeChiara TM, McDonald DM, Yanco-poulos GD. 2001. Ephrin-B2 selectivelymarks arterial vessels and neovasculari-zation sites in the adult, with expressionin both endothelial and smooth-musclecells. Dev Biol 230:151–160.

Gerety SS, Wang HU, Chen ZF, AndersonDJ. 1999. Symmetrical mutant pheno-types of the receptor EphB4 and its spe-cific transmembrane ligand ephrin-B2in cardiovascular development. Mol Cell4:403–414.

Gittenberger-de Groot AC, VranckenPeeters MP, Mentink MM, GourdieRG, Poelmann RE. 1998. Epicardium-derived cells contribute a novel popula-tion to the myocardial wall and theatrioventricular cushions. Circ Res 82:1043–1052.

Hamburger V, Hamilton HL. 1951. A se-ries of normal stages in the develop-ment of the chick embryo. J Morphol88:49–92.

Hayashi S, Asahara T, Masuda H, IsnerJM, Losordo DW. 2005. Functional eph-

rin-B2 expression for promotive interac-tion between arterial and venousvessels in postnatal neovascularization.Circulation 111:2210–2218.

Holland SJ, Gale NW, Mbamalu G, Yanco-poulos GD, Henkemeyer M, Pawson T.1996. Bidirectional signalling throughthe EPH-family receptor Nuk and itstransmembrane ligands. Nature 383:722–725.

Hubbard SJ, Grafham DV, Beattie KJ,Overton IM, McLaren SR, Croning MD,Boardman PE, Bonfield JK, BurnsideJ, Davies RM, Farrell ER, FrancisMD, Griffiths-Jones S, Humphray SJ,Hyland C, Scott CE, Tang H, TaylorRG, Tickle C, Brown WR, Birney E,Rogers J, Wilson SA. 2005. Transcrip-tome analysis for the chicken based on19,626 finished cDNA sequences and485,337 expressed sequence tags. Ge-nome Res 15:174–183.

Huynh-Do U, Stein E, Lane AA, Liu H,Cerretti DP, Daniel TO. 1999. Surfacedensities of ephrin-B1 determineEphB1-coupled activation of cell attach-ment through alphavbeta3 and alpha5-beta1 integrins. EMBO J 18:2165–2173.

Huynh-Do U, Vindis C, Liu H, CerrettiDP, McGrew JT, Enriquez M, Chen J,Daniel TO. 2002. Ephrin-B1 transducessignals to activate integrin-mediatedmigration, attachment and angiogene-sis. J Cell Sci 115:3073–3081.

Ishii Y, Langberg JD, Hurtado R, Lee S,Mikawa T. 2007. Induction of proepicar-dial marker gene expression by theliver bud. Development 134:3627–3637.

Kruithof BP, van Wijk B, Somi S, Krui-thof-de Julio M, Perez Pomares JM,Weesie F, Wessels A, Moorman AF, vanden Hoff MJ. 2006. BMP and FGF reg-ulate the differentiation of multipoten-tial pericardial mesoderm into themyocardial or epicardial lineage. DevBiol 295:507–522.

Krull CE, Lansford R, Gale NW, CollazoA, Marcelle C, Yancopoulos GD, FraserSE, Bronner-Fraser M. 1997. Interac-tions of Eph-related receptors andligands confer rostrocaudal pattern totrunk neural crest migration. Curr Biol7:571–580.

Landerholm TE, Dong XR, Lu J, BelaguliNS, Schwartz RJ, Majesky MW. 1999. Arole for serum response factor in coro-nary smooth muscle differentiationfrom proepicardial cells. Development126:2053–2062.

Larkin MA, Blackshields G, Brown NP,Chenna R, McGettigan PA, McWilliamH, Valentin F, Wallace IM, Wilm A,Lopez R, Thompson JD, Gibson TJ,Higgins DG. 2007. Clustal W and Clus-tal X version 2.0. Bioinformatics 23:2947–2948.

Lee HS, Bong YS, Moore KB, Soria K,Moody SA, Daar IO. 2006. Dishevelledmediates ephrinB1 signalling in the eyefield through the planar cell polaritypathway. Nat Cell Biol 8:55–63.

Lee HS, Nishanian TG, Mood K, BongYS, Daar IO. 2008. EphrinB1 controlscell-cell junctions through the Par

polarity complex. Nat Cell Biol 10:979–986.

Lee HS, Mood K, Battu G, Ji YJ, Singh A,Daar IO. 2009. Fibroblast growth factorreceptor-induced phosphorylation ofephrinB1 modulates its interaction withDishevelled. Mol Biol Cell 20:124–133.

Lin D, Gish GD, Songyang Z, Pawson T.1999. The carboxyl terminus of B classephrins constitutes a PDZ domain bind-ing motif. J Biol Chem 274:3726–3733.

Lu J, Landerholm TE, Wei JS, Dong XR,Wu SP, Liu X, Nagata K, Inagaki M,Majesky MW. 2001. Coronary smoothmuscle differentiation from proepicar-dial cells requires rhoA-mediated actinreorganization and p160 rho-kinase ac-tivity. Dev Biol 240:404–418.

Manner J. 1993. Experimental study onthe formation of the epicardium inchick embryos. Anat Embryol (Berl)187:281–289.

Mellgren AM, Smith CL, Olsen GS,Eskiocak B, Zhou B, Kazi MN, RuizFR, Pu WT, Tallquist MD. 2008. Plate-let-derived growth factor receptor betasignaling is required for efficient epicar-dial cell migration and development oftwo distinct coronary vascular smoothmuscle cell populations. Circ Res 103:1393–1401.

Meyer S, Hafner C, Guba M, Flegel S,Geissler EK, Becker B, Koehl GE, OrsoE, Landthaler M, Vogt T. 2005. Ephrin-B2 overexpression enhances integrin-mediated ECM-attachment and migra-tion of B16 melanoma cells. Int J Oncol27:1197–1206.

Moore KB, Mood K, Daar IO, Moody SA.2004. Morphogenetic movements under-lying eye field formation require inter-actions between the FGF and ephrinB1signaling pathways. Dev Cell 6:55–67.

Nahirney PC, Mikawa T, Fischman DA.2003. Evidence for an extracellular ma-trix bridge guiding proepicardial cellmigration to the myocardium of chickembryos. Dev Dyn 227:511–523.

Nesbitt TL, Roberts A, Tan H, Junor L,Yost MJ, Potts JD, Dettman RW, Good-win RL. 2009. Coronary endothelialproliferation and morphogenesis areregulated by a VEGF-mediated path-way. Dev Dyn 238:423–430.

Nieto MA, Patel K, Wilkinson DG. 1996.In situ hybridization analysis of chickembryos in whole mount and tissue sec-tions. Methods Cell Biol 51:219–235.

Nourry C, Grant SG, Borg JP. 2003. PDZdomain proteins: plug and play! SciSTKE 2003:RE7.

Olivey HE, Mundell NA, Austin AF, Bar-nett JV. 2006. Transforming growthfactor-beta stimulates epithelial-mesen-chymal transformation in the proepicar-dium. Dev Dyn 235:50–59.

Ozdamar B, Bose R, Barrios-Rodiles M,Wang HR, Zhang Y, Wrana JL. 2005.Regulation of the polarity protein Par6by TGFbeta receptors controls epithelialcell plasticity. Science 307:1603–1609.

Pae SH, Dokic D, Dettman RW. 2008.Communication between integrin recep-tors facilitates epicardial cell adhesion

608 WENGERHOFF ET AL.

Dev

elop

men

tal D

ynam

ics

and matrix organization. Dev Dyn 237:962–978.

Perez-Pomares JM, Macias D, Garcia-Garrido L, Munoz-Chapuli R. 1997.Contribution of the primitive epicar-dium to the subepicardial mesenchymein hamster and chick embryos. DevDyn 210:96–105.

Perez-Pomares JM, Macias D, Garcia-Garrido L, Munoz-Chapuli R. 1998. Theorigin of the subepicardial mesenchymein the avian embryo: an immunohisto-chemical and quail-chick chimera study.Dev Biol 200:57–68.

Perez-Pomares JM, Phelps A, SedmerovaM, Carmona R, Gonzalez-Iriarte M,Munoz-Chapuli R, Wessels A. 2002. Ex-perimental studies on the spatiotempo-ral expression of WT1 and RALDH2 inthe embryonic avian heart: a model forthe regulation of myocardial and valvu-loseptal development by epicardiallyderived cells (EPDCs). Dev Biol 247:307–326.

Santiago A, Erickson CA. 2002. Ephrin-Bligands play a dual role in the controlof neural crest cell migration. Develop-ment 129:3621–3632.

Schulte I, Schlueter J, Abu-Issa R, BrandT, Manner J. 2007. Morphological andmolecular left-right asymmetries in thedevelopment of the proepicardium: acomparative analysis on mouse andchick embryos. Dev Dyn 236:684–695.

Sengbusch JK, He W, Pinco KA, Yang JT.2002. Dual functions of a4b1 integrin

in epicardial development: initialmigration and long-term attachment. JCell Biol 157:873–882.

Shin D, Garcia-Cardena G, Hayashi S,Gerety S, Asahara T, Stavrakis G, IsnerJ, Folkman J, Gimbrone MA Jr, Ander-son DJ. 2001. Expression of ephrinB2identifies a stable genetic differencebetween arterial and venous vascularsmooth muscle as well as endothelialcells, and marks subsets of microvesselsat sites of adult neovascularization. DevBiol 230:139–150.

Sridurongrit S, Larsson J, Schwartz R,Ruiz-Lozano P, Kaartinen V. 2008. Sig-naling via the Tgf-beta type I receptorAlk5 in heart development. Dev Biol322:208–218.

Stepp MA, Urry LA, Hynes RO. 1994.Expression of alpha 4 integrin mRNAand protein and fibronectin in the earlychicken embryo. Cell Adhes Commun 2:359–375.

Tapia R, Huerta M, Islas S, Avila-FloresA, Lopez-Bayghen E, Weiske J, HuberO, Gonzalez-Mariscal L. 2009. Zonaoccludens-2 inhibits cyclin D1 expres-sion and cell proliferation and exhibitschanges in localization along the cellcycle. Mol Biol Cell 20:1102–1117.

Tomanek RJ, Ishii Y, Holifield JS, SjogrenCL, Hansen HK, Mikawa T. 2006.VEGF family members regulate myo-cardial tubulogenesis and coronary ar-tery formation in the embryo. Circ Res98:947–953.

Tomanek RJ, Hansen HK, ChristensenLP. 2008. Temporally expressed PDGFand FGF-2 regulate embryonic coronaryartery formation and growth. Arterios-cler Thromb Vasc Biol 28:1237–1243.

Viragh S, Challice CE. 1981. The origin ofthe epicardium and the embryonic myo-cardial circulation in the mouse. AnatRec 201:157–168.

Viragh S, Gittenberger-de Groot AC, Poel-mann RE, Kalman F. 1993. Early devel-opment of quail heart epicardium andassociated vascular and glandularstructures. Anat Embryol (Berl) 188:381–393.

Wang HU, Anderson DJ. 1997. Eph fam-ily transmembrane ligands can mediaterepulsive guidance of trunk neural crestmigration and motor axon outgrowth.Neuron 18:383–396.

Wang HU, Chen ZF, Anderson DJ. 1998.Molecular distinction and angiogenicinteraction between embryonic arteriesand veins revealed by ephrin-B2 and itsreceptor Eph-B4. Cell 93:741–753.

Yang JT, Rayburn H, Hynes RO. 1995.Cell adhesion events mediated by alpha4 integrins are essential in placentaland cardiac development. Development121:549–560.

Zhang XQ, Takakura N, Oike Y, Inada T,Gale NW, Yancopoulos GD, Suda T.2001. Stromal cells expressing ephrin-B2 promote the growth and sproutingof ephrin-B2(þ) endothelial cells. Blood98:1028–1037.

EPHRINB LIGANDS IN EPICARDIAL DEVELOPMENT 609

Dev

elop

men

tal D

ynam

ics