Upload
khangminh22
View
0
Download
0
Embed Size (px)
Citation preview
UNDERSTANDING NATURAL PLASTIC BIODEGRADATION:
A CASE STUDY OF TENEBRIO MOLITOR
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF CIVIL AND ENVIRONMENTAL
ENGINEERING
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
Anja Malawi Brandon
July 2020
http://creativecommons.org/licenses/by-nc/3.0/us/
This dissertation is online at: http://purl.stanford.edu/cs239bh3255
© 2020 by Anja Malawi Drevitch Brandon. All Rights Reserved.
Re-distributed by Stanford University under license with the author.
This work is licensed under a Creative Commons Attribution-Noncommercial 3.0 United States License.
ii
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Craig Criddle, Primary Adviser
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Richard Luthy
I certify that I have read this dissertation and that, in my opinion, it is fully adequatein scope and quality as a dissertation for the degree of Doctor of Philosophy.
Weimin Wu
Approved for the Stanford University Committee on Graduate Studies.
Stacey F. Bent, Vice Provost for Graduate Education
This signature page was generated electronically upon submission of this dissertation in electronic format. An original signed hard copy of the signature page is on file inUniversity Archives.
iii
Abstract
We live in the “Age of Plastics,” an era in which plastic’s versatility, strength, and low
production costs have led to its ubiquity. Plastics are often designed for single use, leading
to the rapid accumulation of plastic waste. Much of this waste escapes formal collection
and accumulates in natural environments, especially the ocean. Increasing restrictions on
recycling and landfill space are rendering current waste management systems unable to
address current and future plastic waste. Finding a way to degrade plastic waste into valu-
able, sustainable resources and permanently eliminate it from the pollution cycle is critical
for the e↵ective remediation of the natural environment and development of a sustainable
future.
A promising solution to achieve this goal is microbial biodegradation of plastics. How-
ever, the rate of plastic degradation by most mixed microbial cultures and isolated microor-
ganisms is low. E↵orts to improve plastic biodegradation have identified an environment in
which a number of plastics can degrade at relatively rapid rates: the gut of mealworms (the
larvae of Tenebrio molitorLinnaeus). Understanding the mechanisms and conditions re-
quired for degradation within the mealworm could enable the scaling-up of this process as a
sustainable waste management strategy. The research described in this dissertation expands
our understanding of naturally occurring plastic biodegradation mechanisms, drawing on
insights from the study of the mealworm and its gut microorganisms to identify strategies
whereby that understanding can be harnessed in engineered systems. These contributions
advance the field of plastic biodegradation beyond a focus on isolated pure cultures to a
deeper understanding about environments and necessary conditions for plastic degrada-
tion. With this more holistic approach, it is possible to move past the existing paradigm of
single-use plastics to a future of sustainable, environmentally benign materials.
Chapter 2 examines the ability of mealworms to degrade multiple types of plastics,
specifically polyethylene (PE) and a mixture of two of the most common plastic wastes
v
(PE and PS). This study found that polyethylene, polystyrene, and mixtures of the plastics
degraded at comparable rates. Microbial analysis of the mealworm gut found several mi-
croorganisms strongly associated with the plastic-fed diets. These results provide the first
evidence of a non-specific degradation mechanism within the mealworm gut and highlight
the need for additional research to elucidate this mechanism.
Chapter 3 investigates the ex situ polystyrene degradation achieved by the gut micro-
biome of plastic-degrading mealworms. The gut microbiome was cultured with PS as the
only carbon source to enrich for e�cient plastic-degradation and to enable the isolation of
the bacteria involved. The mealworm gut environment was studied with and without the
gut microbiome to explore the role the insect host during plastic degradation. This research
revealed the important role of the mealworm host in secreting emulsifying factors that me-
diate plastic bioavailability. In addition, plastic-degrading microorganisms were identified
as well as microbial secreted factors that enhance degradation. Chapter 3 demonstrated
the ability to culture plastic-degrading bacteria, which may enable future investigations and
bioaugmentation for enhanced plastic degradation.
Chapter 4 explores the fate of chemical additives in plastics during degradation by
mealworms to assess whether there is evidence of bioaccumulation. Specifically, this study
examines the fate of hexabromocyclododecane (HBCD), a common flame retardant in PS
products. The results reveal that HBCD is rapidly excreted and does not bioaccumulate
within the mealworm biomass. PS-fed mealworm biomass was also used as a feed supplement
for shrimp without evidence of HBCD bioaccumulation. Chapter 4 presents the first
investigation into the fate of chemical additives during plastic degradation. This work
demonstrates the need for further investigations into the environmental impact of secreted
micro- and nano-plastic particles after plastic degradation and the continued need for green
chemistry in designing additives.
Chapter 5 presents a critical review on the state of plastic pollution and remediation
strategies that contextualizes the research conducted in this thesis. The review analyzes
the state of plastic pollution, bioplastic materials, and plastic biodegradation and presents
a framework for transitioning from recalcitrant plastics to biodegradable and non-toxic
replacement materials. This review provides a summary of the state of a rapidly expanding
field and proposes directions for future research to achieve a sustainable future.
The research summarized in this dissertation provides a comprehensive understanding
vi
the rapid biodegradation of plastics in an unexpected natural system: the gut of meal-
worms. Results from these studies contribute to the growing field of plastic degradation
by illustrating how plastics are rapidly biodegraded within the mealworm gut and pro-
vides guidance on how this process might be replicated and scaled-up to enable a viable,
sustainable alternative for plastic waste.
vii
Acknowledgments
I first need to thank my advisor Craig. Thank you for taking a chance on a passionate,
young undergraduate with limited research experience. Thank you for helping me turn an
idea into a PhD. Thank you for challenging me and for supporting me and, ultimately, for
helping me through this journey.
I also need to thank Dr. Wei-Min Wu. You were integral in helping bring this project
to Stanford and for creating its lasting impacts. Thank you for always looking out for me
and my best interests while balancing an increasingly complex, global project.
To the rest of my committee – thank you for taking the time to help me. Bob – thank
you for sharing your expertise and for your patience while I began my journey in polymer
science. Dick – thank you for your kindness and your support throughout this process.
Steve – thank you for making me think in di↵erent ways about the challenges facing the
world and for sharing your time with me.
To Royal – thank you for being the heart and soul of our program! Thank you for
always being willing to help in lab, to chat about nearly anything, and to take our o�ce
puppy out on walks. I cannot imagine making it through this journey without our daily
mezzanine chats, Friday beer laughs, and kitchen discussions. To the administrators who
keep our department and program running (especially Jack Chiueh and Jill Filice) – thank
you, thank you, thank you! From your kindness and patience in the face of frantic emails
to always having the right answer, I truly don’t know how I could have done this without
you!
Throughout this journey I have been incredibly lucky to work with amazing collabora-
tors. I need to than Dr. James Flanagan for helping me develop methods and think through
any number of challenges early on in this project. Thank you to Dr. Shanshan Yang for
your help and your kindness. An incredibly big thank you to Dr. Yeo-Myoung Cho – your
expertise and support was invaluable! I absolutely could not have completed this project
ix
with you. To Mfon – not only were you incredibly helpful with experiments, you brought
a joy and laughter to the lab that was always appreciated! Thank you for your patience,
kindness, and all your help.
To Alexa – you came into this project when I needed you most. You were a breath
of fresh air bringing new ideas, energy, and passion for the project and for science overall.
Thank you for always being open to bouncing around ideas, troubleshooting challenges,
and chatting about life amidst tedious lab work. I’m so glad to have worked with you as a
colleague and even more glad I get to keep you as a friend.
To Sahar – I could not have made it through this PhD without you. Thank you for
being a constant source of joy in the o�ce and for always being there to support me. I’m
so glad I moved up to the mezzanine level to be with you – I will miss swiveling around and
chatting about work (sometimes), life (frequently), and all things puppy-related (always).
I am forever grateful for your friendship these last five years – through the good times and
the bad, I knew you always had my back and that made all the di↵erence.
Andrew – thank you for always reminding me of basic environmental engineering pro-
tocols, being willing to teach me, and for always being there for a good chat.
To the rest of the Criddle group – thank you for making these last five years so great.
Thank you for always o↵ering help around the lab — form teaching me new protocols to
opening freezer doors for me when my back went out, you have all been so amazingly helpful.
I also appreciate all your great feedback over the years. Most importantly, thank you for
helping me keep my spirits up, from our BBQs to holiday parties to chats in the lab – you
are always kept me laughing!
I also need to thank everyone in the EES program for making my time here so great! An
extra big thank-you to the fun committee (and its original founders!) for helping cultivate a
welcoming and inclusive student environment. To Jill and Eily – thank you for role modeling
how to make it through grad school and for taking me under your wings for everything from
PCR assay development to finding a work-life balance, you ladies are amazing and I am
so glad I got to spend time with you! To Stephen – thank you for being an amazingly
thoughtful o�cemate! I will miss our political rants and morning check-ins. To Katy, Alex,
Kirin, and Nicole – thank you for your endless support, fun rants, and for all the laughs!
To my favorite group of hooligans – Wiley, James, and Christine, thank you all for being
such wonderful friends and people! Thank you for reading and editing my work and for
answering my frantic Zoom calls as I stressed about how to set up for a virtual defense.
x
More importantly, thank you for keeping me laughing, particularly during the very stressful
last few months of this process!
I have been incredibly lucky to have developed an amazingly supportive group of friends
during my time at Stanford. To John and Cassie – thanks for being our best couple and
for being there for me from the beginning of this journey! Thank you for being the best
cheerleaders and celebrating with me during moments of success, cheering me up in moments
of failure, and for hanging out with me during all the moments in between. Jesse - thank
you for your constant positivity and for being curious enough about my work to read the
papers I sent you! Thanks to the virtual reality gang for sanity-saving Zoom calls over these
crazy last few months filled with games, laughter, and cute kitties!
Kira - thank you for sticking with me over my entire Stanford career, we both grew
and evolved and I’m so glad I had you along with me for that process! Thank you for
reminding me to get out of the basement lab, supplying me with ca↵eine and Chinese take-
out, and for being the most supportive friend I could’ve ever asked for. Corey – thank you
for always being there for always being open to talk about science, STEM advocacy, fun
cooking ideas, and all things dogs. Thank you (and Andrei!) for being the most amazing
puppy-godparents to Kona and for all your help early on in our journey of training. I don’t
think I could’ve made it through this last year (especially shelter-in-place!) without you –
thanks for being there when I needed it and for keeping me smiling throughout (shout-out
to Bear for helping with this part too!).
This process has not been easy, beyond academic and research challenges, I, like many
of my peers, su↵ered from anxiety and imposter syndrome. I am thankful I was able to get
help and only after doing so did I realize how common it was. I want to use this space to
encourage anyone in the same position to seek out the help you need – there is no prize
for making it through this journey alone. Beyond mental health, I also struggled with a
major back injury that took me out of the lab (repeatedly) for several weeks and involved
a lengthy recovery. That recovery would not have been possible without the help of Zaldy
De La Cuesta from MORE Physical Therapy. Thank you for teaching me that, like grad
school, recovery is not a linear process and that setbacks are just part of the journey.
I also need to thank the people that helped inspire me to take this journey in the first
place. To Seattle Girls’ School - thank you for teaching me to think creatively and how
to stand and deliver, knowing I belong in any room. To the Seattle Aquarium, especially
the Youth Ocean Advocates program, Dave Glenn, and Katrina Bettis – thank you for
xi
introducing me to the amazing world beneath the surface of our oceans and for teaching
me to lead with my passion.
To Mike, Mary, and Katie – thank you for welcoming me into your family, for supporting
me throughout this journey, and for taking me on much needed breaks! I couldn’t have
made it through this process without your love, kindness, and support. I am so excited for
more adventures together and for exploring even more wine regions!
To my family – I could not have done this without your unconditional support and love.
To Peace and DJ - thank you for putting up with all my lab-talk, for being my biggest
supporters, and for reminding me what’s really important in the world. To my parents
– thank you for always leading by example in encouraging me to follow my passion. To
Rob – thank you for being the absolutely best dad. Thank you for encouraging me to try
new things, even when it’s challenging, and for always being a calming presence when I
am anxious. To mom – you never got to finish your PhD (in no small part to me and the
other kids) so this degree is for you. Thank you for encouraging me to finish while I had
momentum, even when I thought I couldn’t keep going. You have always been my hero and
I love you.
I wouldn’t have made it through this journey without two more amazing helpers. To our
kitty Boba, thank you for keeping my lap warm during the long hours of working from home
and for always keeping me on my toes. To our puppy Kona, thank you for making me get
outside, making me smile always, for introducing me to the amazing world of dog-owners
on campus, and of course, for being the best girl.
Finally, to Kevin – thank you for being the best partner on this journey. Thank you for
editing my work, listening to hours of practice talks, and for talking through experiment
ideas with me – you have made me a better writer, presenter, and scientist. Thank you
for always being there to remind me that the only way to fail is to not try. Thank you for
keeping me sane, making me laugh, and always helping me see the bigger picture.
xii
Contents
Abstract v
Acknowledgments ix
1 Introduction 1
1.1 Problem statement and motivation . . . . . . . . . . . . . . . . . . . . . . . 1
1.2 Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2
1.2.1 Overview of synthetic plastics . . . . . . . . . . . . . . . . . . . . . . 2
1.2.2 Recalcitrance of synthetic plastics . . . . . . . . . . . . . . . . . . . 3
1.2.3 Current plastic waste management systems . . . . . . . . . . . . . . 3
1.2.4 Emerging concerns related to plastic pollution . . . . . . . . . . . . 5
1.2.5 Alternative plastic materials . . . . . . . . . . . . . . . . . . . . . . . 5
1.2.6 Plastic biodegradation by microorganisms . . . . . . . . . . . . . . . 7
1.2.7 Plastic biodegradation by insects . . . . . . . . . . . . . . . . . . . . 7
1.3 Dissertation Organization . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
1.4 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
1.5 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2 Biodegradation of polyethylene and plastic mixtures in mealworms (larvae
of Tenebrio molitor) and e↵ects on the gut microbiome 15
2.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.3 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.3.1 Mealworm survival and plastic consumption . . . . . . . . . . . . . . 19
2.3.2 Plastic test materials . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
xiii
2.3.3 Characterization of plastic degradation within egested frass . . . . . 20
2.3.4 Microbial community analysis . . . . . . . . . . . . . . . . . . . . . . 21
2.3.5 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.4 Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.4.1 PE consumption and e↵ects on survival . . . . . . . . . . . . . . . . 22
2.4.2 Evidence for depolymerization and biodegradation of PE . . . . . . 23
2.4.3 Evidence for mineralization via a mass balance . . . . . . . . . . . . 25
2.4.4 Biodegradation of mixed plastics . . . . . . . . . . . . . . . . . . . . 25
2.4.5 E↵ects of plastic consumption on gut microbiome . . . . . . . . . . . 26
2.5 Implications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
2.6 Supporting Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
2.7 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
2.8 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
3 Enhanced polystyrene biodegradation in an ex situ gut microbiome en-
richment from Tenebrio molitor (mealworm larvae) 35
3.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
3.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.3 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.3.1 Plastic materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.3.2 Mealworm maintenance . . . . . . . . . . . . . . . . . . . . . . . . . 39
3.3.3 Collection of gut microbiome and supernatant . . . . . . . . . . . . . 39
3.3.4 Enrichment and isolation of PS-degrading bacteria . . . . . . . . . . 40
3.3.5 Microbial activity analysis . . . . . . . . . . . . . . . . . . . . . . . . 41
3.3.6 Characterization methods . . . . . . . . . . . . . . . . . . . . . . . . 42
3.3.7 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.4 Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.4.1 E↵ects of supernatant on ex situ microbial growth . . . . . . . . . . 43
3.4.2 Identification of endogenous emulsification activity . . . . . . . . . . 45
3.4.3 Enhanced ex situ microbial growth . . . . . . . . . . . . . . . . . . . 46
3.4.4 Identification of plastic degradation microbial community . . . . . . 48
3.5 Implications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
3.6 Supporting Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
xiv
3.7 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
4 The fate of hexabromocyclododecane (HBCD), a common flame retar-
dant, in polystyrene-degrading mealworms: elevated HBCD levels in
egested polymer but no bioaccumulation 57
4.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
4.2 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
4.3 Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
4.3.1 Plastic test materials . . . . . . . . . . . . . . . . . . . . . . . . . . . 61
4.3.2 Mealworm growth conditions . . . . . . . . . . . . . . . . . . . . . . 61
4.3.3 HBCD quantification . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
4.3.4 Aquaculture experimental conditions . . . . . . . . . . . . . . . . . . 63
4.3.5 Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63
4.4 Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
4.4.1 E↵ects of HBCD on mealworm survival and plastic consumption . . 64
4.4.2 Exponential removal of HBCD from mealworm biomass . . . . . . . 65
4.4.3 Fate of HBCD in mealworm biomass over time . . . . . . . . . . . . 66
4.4.4 Lack of HBCD bioaccumulation in secondary trophic level . . . . . . 68
4.5 Implications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
4.6 Supporting Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
4.7 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72
5 The role of biotechnology for control and remediation of plastic pollution 77
5.1 Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
5.2 Highlights . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
5.3 Current plastic production rates are not sustainable . . . . . . . . . . . . . 79
5.4 From tiny bioreactors to new mitigation strategies . . . . . . . . . . . . . . 80
5.5 From linear to fully circular economies . . . . . . . . . . . . . . . . . . . . . 80
5.6 Low-cost, tailored to the application, and Ecocyclable . . . . . . . . . . . . 81
5.7 Design for disassembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
5.8 Outlook . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
5.9 Supporting Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
5.10 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
xv
6 Conclusions and Future Work 91
6.1 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
6.2 Recommendations for future research . . . . . . . . . . . . . . . . . . . . . . 93
A Supporting Information for Chapter 2 97
A.1 Material and Methods Supplement . . . . . . . . . . . . . . . . . . . . . . . 98
A.1.1 Extraction method e�ciency assay . . . . . . . . . . . . . . . . . . . 98
A.1.2 Phasing amplicon sequencing library preparation . . . . . . . . . . . 98
A.1.3 E. coli K12 plastic characterization controls . . . . . . . . . . . . . . 99
A.2 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
A.3 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 108
B Supporting Information for Chapter 3 115
B.1 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
B.2 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117
C Supporting Information for Chapter 4 121
C.1 Material and Methods Supplement . . . . . . . . . . . . . . . . . . . . . . . 122
C.1.1 Chemicals and reagents . . . . . . . . . . . . . . . . . . . . . . . . . 122
C.1.2 HBCD analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122
C.1.3 Litopenaus vannamei experimental conditions . . . . . . . . . . . . . 124
C.1.4 Mealworm depuration experimental conditions . . . . . . . . . . . . 125
C.2 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127
C.3 Figures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128
D Supporting Information for Chapter 5 135
D.1 Tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 136
Bibliography 137
xvi
List of Tables
1.1 Five most common thermoplastics . . . . . . . . . . . . . . . . . . . . . . . 11
2.1 Characterization of PE and PS foams . . . . . . . . . . . . . . . . . . . . . 29
A.1 Overview of Illumina MiSeq data . . . . . . . . . . . . . . . . . . . . . . . . 101
A.2 1H-NMR peak information (PE samples) . . . . . . . . . . . . . . . . . . . . 102
A.3 1H-NMR peak information (PS samples) . . . . . . . . . . . . . . . . . . . . 103
A.4 FTIR peak information, PE samples . . . . . . . . . . . . . . . . . . . . . . 104
A.5 FTIR peak information, PS samples . . . . . . . . . . . . . . . . . . . . . . 105
A.6 FTIR peak information, plastic mixture samples . . . . . . . . . . . . . . . 106
A.7 Relative abundance of PE and PS associated OTUs . . . . . . . . . . . . . 107
B.1 Sequenced bacterial strains from microbial enrichment and isolates . . . . . 116
C.1 Characterization of the PS foams . . . . . . . . . . . . . . . . . . . . . . . . 127
D.1 Cost, material properties, and suitability for various manufacturing processes
for common plastics and plastic replacement materials . . . . . . . . . . . . 136
xvii
List of Figures
1.1 Characteristics within insect larvae that may accelerate biodegradation . . . 13
1.2 Characteristics within mealworms that may accelerate biodegradation . . . 14
2.1 Chapter 2 summary figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.2 Survival rate and plastic consumption by T. molitor by diet . . . . . . . . . 31
2.3 Characterization of polyethylene degradation within the mealworm gut . . . 32
2.4 Microbial community analysis of gut microbiome in di↵erent diets . . . . . 33
2.5 Di↵erential abundance analysis of gut microorganisms between experimental
diets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
3.1 Chapter 3 summary figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36
3.2 E↵ects of mealworm gut supernatant on ex situ gut microbiome growth on PS 52
3.3 Hydrophobicity of mealworm gut supernatant . . . . . . . . . . . . . . . . . 53
3.4 E↵ect of PS supernatant on microbial respiration . . . . . . . . . . . . . . . 54
3.5 Bacterial strain identifies from microbial enrichment and isolates . . . . . . 55
3.6 Bacterial strain identifies from microbial enrichment and isolates . . . . . . 56
4.1 Chapter 4 summary figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
4.2 Survival rate and HBCD consumption by T. molitor . . . . . . . . . . . . . 73
4.3 Reduction in T. molitor whole-body burden of HBCD with starvation . . . 74
4.4 Fate tracking of HBCD in T. molitor . . . . . . . . . . . . . . . . . . . . . . 75
4.5 Bioaccumulation e↵ects from plastic-fed mealworm biomass on L. vannamei 76
5.1 Chapter 5 summary figure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78
5.2 Projected increase in plastic production based on historic production data . 87
xix
5.3 Current linear pathways for recalcitrant plastics and circular pathways of
future plastic materials . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
5.4 A transition sequence for plastic materials . . . . . . . . . . . . . . . . . . . 89
A.1 Characterization of PS degradation within the mealworm gut . . . . . . . . 109
A.2 Characterization of plastic treated with E. coli K12 . . . . . . . . . . . . . 110
A.3 Mass balance on mealworms during the 32-day experiment . . . . . . . . . . 111
A.4 Characterization of mixed plastic (PE + PS) degradation . . . . . . . . . . 112
A.5 Principal Coordinate Analysis of microbial communities with outliers . . . . 112
A.6 E�ciency of extraction method used to recover residual polymer in the frass 113
B.1 Dose-response curves for supernatant and glucose equivalent . . . . . . . . . 118
B.2 Supernatant emulsification activity . . . . . . . . . . . . . . . . . . . . . . . 119
B.3 Enrichment biofilm formation . . . . . . . . . . . . . . . . . . . . . . . . . . 120
C.1 Schematic diagram of the mealworm experimental conditions . . . . . . . . 129
C.2 Schematic diagram of the L. vannamei experimental conditions . . . . . . . 129
C.3 Schematic diagram of sample preparation for HBCD analysis . . . . . . . . 130
C.4 Multiple regression analysis of predicted versus actual number of pupae . . 131
C.5 Fate tracking of HBCD in T. molitor in co-fed diets . . . . . . . . . . . . . 132
C.6 Recovery e�ciency of surrogate standard across sample types . . . . . . . . 132
C.7 Mass balance on HBCD in the mealworm experiments . . . . . . . . . . . . 133
C.8 Standard curves for the main stereoisomers of HBCD . . . . . . . . . . . . . 133
C.9 Log removal of HBCD from T. molitor over time . . . . . . . . . . . . . . . 134
xx
Chapter 1
Introduction
1.1 Problem statement and motivation
Plastics are a growing concern for both the environment and waste management systems.
Plastic production has grown exponentially since the invention of synthetic polymers and
is now approximately 400 million metric tons per year (Fig. 5.2). As understanding of
polymer science has improved, polymers have been designed and modified to better suit
the needs of di↵erent industries.[139, 53] While some of these products have highly valuable
functions (such as sterile disposable tools in hospitals), much of the increase in plastic pro-
duction involves packaging and other products that lend themselves to wasteful, single-use
applications.[139, 3, 184] The properties that have led to the rampant increase in production
of plastics – versatility, durability, and low cost – also render these materials di�cult to
dispose of sustainably. These same features that make plastics desirable commercially (i.e.,
strength, durability, and inert nature) can contribute to their recalcitrance and ultimately
their accumulation within natural environments.
The incredible increase in plastic production has led to massive waste management
challenges. Globally, much of the waste that results from use of these products is misman-
aged, resulting in plastic waste accumulating in diverse natural environments, especially
the ocean. The most robust analysis of plastic inputs into the environment reported that
⇠ 32% of plastic waste is mismanaged and available to escape into the environment, with
an estimated 4.8 – 12.7 million metric tons of plastic entering the ocean annually.[79] Even
properly managed waste is subject to increasing challenges as landfills, the most common
1
2 CHAPTER 1. INTRODUCTION
end-of-life fate for plastics, are space-constrained and approaching capacity is some ur-
ban environments.[42] Thus, developing strategies for remediation and removal of discarded
plastic is increasingly critical. Biodegradation is one possible solution as it would break
down plastic waste and potentially enable the recovery of useful resources. However, cur-
rent rates of biodegradation are slow and often plastic-specific, limiting the use of microbial
biodegradation as a scalable solution for plastic waste. Identification of natural systems that
can accelerate plastic biodegradation is a critical first step to understanding of degradation
mechanisms and scale up of biodegradation as a sustainable end-of-life fate for plastic waste.
1.2 Background
1.2.1 Overview of synthetic plastics
Plastics are polymers – large macromolecules made up of smaller repeating units of smaller
molecules known as monomers. Conventional plastics are novel in that they are entirely syn-
thetic, enabling their physical and chemical properties to be tailored for di↵erent purposes.
Synthesis of these plastics (polymerization) typically yields a mixture of large polymers
with di↵erent molecular weights.[163] Controlling polymer chain length (molecular weight,
MW) and the distribution of sizes (polydispersity) can dramatically change the physical
and mechanical properties of the produced material.[163]
Plastics can be broadly classified as either thermoplastics or thermoset plastics. Ther-
moplastics soften upon heating and can therefore be formed into di↵erent shapes through
the application of heat and pressure. This property enables reuse (or recycling) of ther-
moplastics collected at end-of-life by melting and reprocessing.[3, 163] Thermoset plastics
are soft or even liquid polymers that upon heating become cross-linked, which solidifies the
polymer and prevents softening upon further exposure to heat.[3, 163] The most common
thermosets are foams like polyurethane or polyisocyanurate. Plastics can also be classi-
fied as either hydrolyzable, polymers that contain more readily degradable ester bonds, or
non-hydrolyzable plastics that are more resistant to enzymatic degradation.[78] The work
in this dissertation focuses on two of the most common thermoplastics: polyethylene (PE)
and polystyrene (PS), both of which are non-hydrolyzable.
1.2. BACKGROUND 3
1.2.2 Recalcitrance of synthetic plastics
The physical and molecular characteristics of plastics confer recalcitrance to abiotic and
biotic degradation.[149, 158] Abiotic processes include weathering, photooxidation by UV
light, and fragmentation due to mechanical stress.[158, 65] Biotic processes (i.e., biodegra-
dation) entail polymer degradation mediated by microorganisms – typically bacteria, fungi,
or algae.[149, 158] Microbial biodegradation can result in complete mineralization to CO2
and H2O and/or biomass production and partial degradation (partial depolymerized and
modified polymers).[158] Abiotic and biotic processes can operate in parallel in the envi-
ronment. The plastics listed in Table 1.1, along with most other synthetic plastics, are
all considered recalcitrant because they resist degradation in natural environments over
meaningful timescales.
Polymerization and manufacturing of many plastic products has been optimized to yield
stronger and more durable polymers. The addition of co-polymers, plasticizers, and other
additives have resulted in plastics that are more resistant to shattering, fragmentation, and
photo-oxidation, and thus less susceptible to abiotic degradation processes.[3]
Biotic degradation is likewise limited because plastic polymers are often large, bulky
high molecular weight molecules that cannot pass through cell membranes.[149] They must
first be depolymerized into lower molecular weight molecules before further biodegradation
and mineralization is possible. The inert chemical structure of plastics also limits biotic
degradation.[149] The most common bonds are C-C and C-H bonds, and the functional
moieties that enable biodegradation (e.g., alcohols, aldehydes, acids) are often lacking.[163]
The absence of such groups, contributes to the hydrophobic nature of most polymers, which
can also impedes microbial colonization.[163, 149, 65]
Synthetic polymers are relatively new in the environment, having only been discovered
a little over a century ago.[3, 1] By contrast, the mineralization of naturally-occurring
biopolymers (e.g., polyhydroxyalkanoates) has evolved over billions of years and thus occurs
rapidly in many environments.[143, 117] The work in this dissertation focuses on biotic
degradation (or biodegradation).
1.2.3 Current plastic waste management systems
A recent e↵ort to catalog the fate of all synthetic plastics ever made identified three major
end-of-life fates for plastics: discarded (landfilled or in the environment, 60%), incinerated
4 CHAPTER 1. INTRODUCTION
(12%), and recycled (9%).[66] The remaining fraction of plastics remain in use.
1. Landfilling. The vast majority of plastics (75.8% of properly collected waste in the
US[53]) end up in a landfill. If managed well, this can be a desirable end point as the
carbon is sequestered; however, space is finite, especially in urban areas where most
waste is generated.[42]
2. Incineration. The recovery of energy from waste plastic is typically achieved by com-
bustion, sometimes referred to as “quaternary or energy-recovery recycling.” This
process can be ine�cient, contribute to greenhouse gas emissions, and potentially
volatilize chemical additives; however, such emissions of additives or their derivatives
may be contained with proper engineering controls.[59]
3. Recycling. Plastics can be collected and recycled, but rates of plastic recycling are
the lowest of any material.[184] Recycling can take the following forms:[59]
(a) Primary/mechanical recycling: Production of new products with similar (pri-
mary) or di↵erent properties (secondary) to the original waste product. The
heating and re-melting of polymers can result in ‘downcycling,’ where the recy-
cled polymer has inferior qualities (MW, strength, durability) compared to virgin
material.
(b) Monomer or feedstock recycling (tertiary recycling): Production of chemical fuels
and feedstocks from waste plastic. This process works well for specific polymers
(e.g., polyethylene terephthalate and polypropylene) but remain limited in their
use.
While recycling has been touted as a potential solution, in practice, recycling plastics
remains challenging. Proper collection, without contamination, remains a constant chal-
lenge. Once collected, plastics are di�cult to recycle given the variety of forms, additives,
and blends used in an increasing number of products.[59, 20] Further, the low cost of virgin
materials has led to economic disincentives that have prevented the revitalization of the re-
cycling system. China became the chief market for plastic recycling in the 1990s, importing
nearly 45% of all plastic waste generated since 1992.[20] Thus the 2017 decision by China
to ban the import of nonindustrial plastic waste further endangers global plastic recycling
systems.[20]
1.2. BACKGROUND 5
Current waste management systems are based on a linear economy in which fossil carbon
is transformed into recalcitrant plastics that accumulate in landfills or the environment after
use. In such a scheme, failure to capture plastic waste at the end-of-life inevitably leads to
rampant environmental problems. To address this issue a circular economy is needed, with
larger recycling loops that can sustainably break down plastic waste and recover value.
1.2.4 Emerging concerns related to plastic pollution
Recent research has highlighted the complex relationship between plastic debris and poten-
tially toxic chemicals, both from the plastic production process and from other sources.[52]
The hydrophobic nature of synthetic plastics allows plastic debris to sorb hydrophobic chem-
icals such as polychlorinated biphenyls (PCBs) from the environment.[9] Additionally, many
synthetic plastics are embedded with chemical additives such as plasticizers, stabilizers, and
flame retardants, many of which are hydrophobic and are of growing concern for human
health.[3, 7] For example, expanded and extruded polystyrene are embedded with the flame
retardants hexabromocyclododecane (HBCD),[11, 157] a known endocrine disruptor and
potential neurotoxin.[36, 80, 215, 129, 156]
New research has claimed that plastics can act as a vector for transporting these chemi-
cals into the food chain when ingested.[52, 9, 50, 114] This gives rise to many concerns about
the potential for bioaccumulation within the food web and within commercially important
species.[52, 9, 35]
Current systems for plastic production and recycling have yet to fully address the fate of
chemical additives, such as fire retardants and plasticizers. Strategies are needed to ensure
their removal from recycled materials and to develop green chemistry replacements.[7, 12]
Further, research is needed to understand the fate of contaminants within plastics when
they enter di↵erent environments, especially when ingested by diverse animals, including
humans, and enter the gut environment.[75, 172]
1.2.5 Alternative plastic materials
Sustainable replacement materials for petroleum-based plastics are needed to end the ram-
pant production and accumulation of plastic waste.[45, 170] Renewable plastic replacements
will need to match the in-use functionality of current plastics without leading to accumu-
lation, thus safeguarding the environment. To meet current plastic demands, a roughly
6 CHAPTER 1. INTRODUCTION
500-fold increase in renewable plastics production is required.[56] Production costs need to
be decreased by a factor of 2 – 4 to achieve cost parity with recalcitrant petroleum-based
plastics to enable the widespread use of renewable plastics (Table D.1).
Polylactic acid (PLA) is the most common renewable plastic currently in use, account-
ing for 10.3% of global polymer production in 2017.[56, 49] Most PLA is made from lactic
acid obtained through the fermentation of cultivated crops.[85] PLA readily degrades in
warm, aerobic environments (e.g., thermophilic composts) but in cool, anaerobic environ-
ments (e.g., soils and the marine environment) it is as recalcitrant as traditional petroleum-
based plastics.[86, 117] Thus, while PLA is an improvement over conventional plastics, it
is not an ideal replacement material given the lack of sustainability of using cultivated
crops and its failure to biodegrade in critical environments. These challenges can be ad-
dressed through advancements in polymer chemistry and biotechnology. Copolymerization
of PLA and the development of PLA composites have been demonstrated to improve ma-
terial properties and degradability.[49] Researchers are also investigating the use of micro-
bial carboxylesterases to rapidly depolymerize PLA, potentially enabling enzymatic control
strategies in the future.[70]
Another class of renewable polymers are naturally occurring biopolymers, polyhydrox-
yalkanoate (PHAs). PHAs are a vast family of moldable biopolymers that could serve as
“drop-in” replacements for traditional plastics in production and their in-use functionality.[217]
However, critical bioprocess challenges for PHA production such as feedstock and produc-
tion costs, the need to tailor polymer structure for specific applications, and polymer ex-
traction and purification remain, limiting the wide-spread use of these polymers. The use
of waste-derived feedstocks can reduce the cost of PHAs while creating a closed-loop cycle,
increasing the sustainability of these materials.[154] Research has demonstrated the ability
to tailor the polymer structure through the choice of co-substrates, application of selection
pressures, and genetic manipulation of biochemical pathways.[154, 123, 29] Biotechnology
has also been applied to overcome the challenges of conventional polymer extraction meth-
ods which are time, energy, and chemical-intensive.[154, 110] Recent advances such as the
development genetic modifications that enable direct secretion of PHA molecules and the
use of osmolysis to release PHA granules will further enable the scaling of PHA production
without the challenges of conventional extraction.[146, 54, 142]
Biotechnology has opened the door for improves in bioplastic design in terms of its
production, in-use properties, and end-of-life fate. Together these advances will be necessary
1.2. BACKGROUND 7
to transition away from the linear lifecycle of petroleum-based plastics to a sustainable,
circular lifecycle of renewable plastics.
1.2.6 Plastic biodegradation by microorganisms
Microbial enrichment and isolation studies have demonstrated that several bacterial isolates
are capable of degrading plastic wastes, as reviewed elsewhere.[65, 158, 93, 200, 124] Rates
of degradation vary but are typically slow, ranging from ⇠ 8% in two weeks to ⇠ 5% over six
months; however, the concentration of microorganisms, a critical variable in these systems,
is often not reported.[65, 158] Most of the identified microorganisms have been isolated
from environments contaminated with plastic waste such as landfills, waste water sludge,
or soils from disposal or recycling sites.[158, 65, 93, 214] To date, there has been little to
no research into endogenous environmental degradation of plastic, even in environments
heavily contaminated with waste.
Most studies of plastic biodegradation do not clearly identify the mechanism of de-
polymerization. Secreted enzymes such as oxygenases (monooxygenase and dioxygenase),
hydrolases, esterases, laccases, and peroxidases are hypothesized candidates for microbial-
mediated degradation of synthetic polymers.[93, 198, 78] However, without a firm un-
derstanding of the mechanism of depolymerization or environments that enable enhanced
degradation, it is di�cult to replicate and stimulate biodegradation at high rates and at
large scales. Given that individual bacterial strains have typically exhibited low plastic
biodegradation rates, future studies should evaluate whether microbial consortia can accel-
erate biodegradation and mineralization.
1.2.7 Plastic biodegradation by insects
Recent studies have demonstrated one environment in which plastics undergo rapid biodegra-
dation: the gut of insect larvae, specifically Tenebrio molitor (yellow mealworms),[212,
213, 210, 207] Tenebrio obscurus (dark mealworms),[134] Plodia interpunctella (Indianmeal
moth),[206] and Galleria mellonella (wax moths).[91, 147, 135, 105, 25] Of these, the most
well studied is mealworms, where researchers have established that within the 15 – 20 hour
gut retention time nearly 50% of ingested plastic is mineralized to CO2.[212, 210, 207]
There are several features common to these insect larvae that could contribute to their
unique ability to rapidly degrade plastic (Fig. 1.1). All these insects are omnivorous
8 CHAPTER 1. INTRODUCTION
and have evolved to utilize a variety of substrates, a trait that is thought to contribute
to their ability to opportunistically degrade plastic.[91, 51, 204] Further, the chewing and
fragmentation of plastic into smaller pieces via ingestion increases the surface area to volume
ratio, increasing the area exposed for enzymatic attack (Fig. 1.1). These insects are also
su�ciently small such that oxygen can passively di↵use throughout (or through most) of
the gut, allowing for oxidative attacks on the plastics (Fig. 1.1). A deeper understanding
of the degradation environment and mechanism, including the relative contributions of the
insect itself and the gut microbiome, could enable development of scalable enzyme-based
strategies for plastic waste management.
Overview of mealworms
Yellow mealworms (larvae of Tenebrio molitor) are the larval stage of a darkling beetle. T.
molitor has four life cycle stages: egg (4-18 days), larva (6-9 months), pupa (6-18 days),
and beetle (2-3 months).[212] Mealworms are omnivorous, and researchers hypothesize that
their gut bacteria play an important role in their ability to adapt to di↵erent foods.[194]
Originally from North America, the species is now found and reared by farmers throughout
the world as a protein source for agriculture and aquaculture.[10, 64, 165, 136] Recent
life cycle assessment studies have shown that mealworm protein has low greenhouse gas
emissions, energy requirements, and land requirements per gram of edible protein, which
has prompted researchers to consider mealworms as a potential protein source for humans
in the near future.[128]
The mealworm gut structure, pH, and microbiome have previously been studied by
entomologists.[194, 190, 169, 187] The gut structure is traditionally broken down into four
sections, which have been found to harbor di↵erent quantities of microorganisms in the
range of 105 to 106 colony forming units (CFU) per gut.[213, 194] Under normal conditions,
the anterior gut is dominated by facultative anaerobes of the genus Lactococcus, genus
Pantoea, and the family Bacillaceae while the posterior gut is more diverse and features
more anaerobic bacteria from the genera Spiroplasma, Clostridium, and Enterobacter (Fig.
1.2).[194] Another defining characteristic of the mealworm gut is a sharp pH gradient that
ranges from ⇠ 5.6 to ⇠ 7.9 moving from the anterior to the posterior, partially driven by
the loss of CO2 in the posterior spiracles (respiratory pores) of the animal as part of their
respiratory circuit (Fig. 1.2).[190, 169] Di↵erences in secreted enzyme activity within the
gut vary along this pH gradient.[190, 169]
1.3. DISSERTATION ORGANIZATION 9
While the mechanisms of plastic degradation within these insects are unknown, re-
searchers hypothesize that their diet of naturally occurring polymers (e.g., ligand, chitin,
etc.) play a role in the evolution of their unique degradation ability. At present, we lack a
comprehensive understanding of the mechanisms and specific conditions that lead to the ob-
served high rates of biodegradation within the mealworm gut, limiting our ability to utilize
this capacity to develop large-scale solutions for plastic waste. Understanding the environ-
ment in which plastic already degrades is important when considering how biotechnology
might be used to create more e�cient plastic degrading systems.
1.3 Dissertation Organization
This dissertation is comprised of six chapters. Chapter 1 (this chapter) provides an intro-
duction, including background and motivation for the work and the current understanding of
plastic biodegradation. Chapters 2 through 4 present three di↵erent experimental studies
conducted as a part of this dissertation. Each chapter contains an abstract, introduction,
methods, results, and discussion. Chapter 5 presents a critical review on the state of
biotechnology for the remediation and prevention of plastic waste. Tables and figures from
the manuscripts are embedded within the chapters and supplementary information is pre-
sented as appendices. Chapter 2 was published in May 2018, Chapter 4 was published
in January 2020, and Chapter 5 was published in June 2019. Chapter 3 is in preparation
for publication.
Chapter 2 presents an experimental study that assessed the ability of mealworms to
degrade polyethylene and a mixture of plastic wastes (PE and PS). The motivation of this
study was to expand our understanding of the biodegradation ability of the mealworm by
assessing its ability to degrade chemically dissimilar plastics. Results of this study suggest
a non-specific degradation mechanism within the mealworm gut.
Chapter 3 demonstrates ex situ polystyrene degradation by the gut microbiome of
mealworms. This study investigated the role of the mealworm host and the gut microbiome
in plastic biodegradation and utilized these insights to cultivate microorganisms capable of
enhanced polystyrene degradation. The system developed in this chapter will enable fu-
ture studies and bioengineering on the isolated microorganisms and will ultimately support
e↵orts to scale-up plastic degradation.
10 CHAPTER 1. INTRODUCTION
Chapter 4 investigated the fate of one common PS additive, HBCD, within plastic-
degrading mealworms using a mass-balance study coupled with body burden analysis using
analytical chemistry. HBCD was tracked as a representative plastic additive to assess poten-
tial bioaccumulation e↵ects within the mealworm. Bioaccumulation was further assessed
when plastic-degrading mealworm biomass was incorporated as an aquaculture feed for
shrimp (L. vannamei). We find that HBCD is rapidly excreted from the mealworm in its
frass and does not bioaccumulate withinin mealworm biomass.
Chapter 5 presents a brief critical review on the state of plastic pollution and biotech-
nology remediation strategies. This review includes the state of bioplastic degradation
and presents recommendations for future work. In addition, this review presents a frame-
work for transitioning from recalcitrant petroleum-based plastics to biodegradable, non-
bioaccumulative, and non-toxic plastic replacement materials.
Chapter 6 summarize the overall conclusions and contributions of this dissertation
research and provides suggestions for future research.
1.4. TABLES 11
1.4 Tables
Table 1.1: Five most common thermoplastics ranked by annual U.S. production (highest tolowest): showing chemical structure, applications, and methods of polymerization.[3, 184]
1.5. FIGURES 13
Gut wall
Ingestedplastic
Microbial activity
FrassDegradedresiduals
small size - concentrates
important reactants
oxygen permeabilitypH range
diverse & adaptablegut microbiome
pre-fragmentation -increased
surface area-to-volume ratio
recalcitrant plasticdegraded residuals
CO2
incorporation into biomass
observed degradation:
system characteristics influencing degradation rates:
15 - 20 hours
Figure 1.1: Characteristics within the insect larvae (drawn here as a mealworm) that mayenable the accelerated biodegradation of recalcitrant plastics.
14 CHAPTER 1. INTRODUCTION
Figure 1.2: T. molitor gut pH and microbial community structure (based on 16S rRNAsequencing) in the di↵erent regions of the gut constructed using data and images fromprevious studies on mealworms fed their natural diet (bran & vegetables). Image andrelative abundance data from Wang et al. 2015, annotated with additional data fromvarious sources.[194, 169, 190, 144]
Chapter 2
Biodegradation of polyethylene
and plastic mixtures in mealworms
(larvae of Tenebrio molitor) and
e↵ects on the gut microbiome
The results of this chapter were originally published in Environmental Science & Technology
in 2018, doi: 10.1021/acs.est.8b02301, reprinted here with permission, copywrite American
Chemical Society 2018. Drs. Shu-hong Gao, Renmao Tian, and Daliang Ning preformed
sequencing analysis and contributed to analysis of results under the supervision of Dr.
Jizhong Zhou. Dr. Shan-Shan Yang contributed to the design of the study. Dr. Wei-
Min Wu contributed to the design of the study and provided comments to improve the
manuscript.
15
16 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
2.1 Abstract
Recent studies have demonstrated the ability for polystyrene (PS) degradation within the
gut of mealworms (Tenebrio molitor). To determine whether plastics may be broadly sus-
ceptible to biodegradation within mealworms, we evaluated the fate of polyethylene (PE)
and mixtures (PE+PS). We find that PE biodegrades at comparable rates to PS. Mass
balances indicate conversion of up 49.0 ± 1.4% of the ingested PE into a putative gas frac-
tion (CO2). The molecular weights (Mn) of egested polymer residues decreased by 40.1 ±8.5% in PE-fed mealworms and by 12.8 ± 3.1% in PS-fed mealworms. NMR and FTIR
analyses revealed chemical modifications consistent with degradation and partial oxidation
of the polymer. Mixtures likewise degraded. Our results are consistent with a non-specific
degradation mechanism. Analysis of the gut microbiome by next-generation sequencing
revealed two OTUs (Citrobacter sp. and Kosakonia sp.) strongly associated with both PE
and PS as well as OTUs unique to each plastic. Our results suggest that adaptability of
the mealworm gut microbiome enables degradation of chemically dissimilar plastics.
Figure 2.1: Summary Figure.
2.2. INTRODUCTION 17
2.2 Introduction
Plastics are a growing concern for both the environment and waste management systems.
Global plastic production has tripled in the last 25 years to over 322 million tons in
2015.[139] This nearly exponential growth in production has contributed to waste man-
agement challenges including space limitations in landfills, which coupled with low re-
cycling rates has led to mismanagement of plastic waste and increased environmental
pollution.[139, 42, 184] Plastic is of especially great concern in marine environments where
its recalcitrance has led to accumulation and harmful e↵ects on wildlife and potentially
humans.[79, 172] To combat this growing problem, there has been a steady increase in
research on plastic biodegradation by bacteria and fungi.[158, 173, 93] Microbial enrich-
ment and isolation studies have demonstrated that several bacterial isolates are capable of
degrading plastics, but rates of degradation vary and are typically low.[158, 173, 93]
Recent work has demonstrated that mealworms (larvae of Tenebrio molitor), obtained
from various sources across the globe, readily ingest and biodegrade polystyrene (PS) to
CO2 and lower molecular weight compounds within their gut.[212, 213, 207] Antibiotic
studies implicated gut bacteria as agents of PS degradation, and Exugiobacterium sp. YT2,
a bacterium capable of PS degradation was isolated from the gut.[213] Mealworms were
shown to degrade nearly half of the ingested PS within the 12 – 15 hour retention time in
the gut, which is higher than the mass loss reported by the isolated Exugiobacterium sp.
YT2 and other plastic-degrading bacterial isolates.[212, 213, 69] A recent report found that
co-feeding PS with bran almost doubled the rate of PS degradation.[207]
Mealworms are omnivorous and researchers hypothesize that their gut bacteria play
an important role in their ability to adapt to di↵erent foods.[194] Bacterial concentrations
range from 105 to 106 colony forming units per gut.[213, 194] On a standard diet (e.g.,
bran), the anterior gut is dominated by facultative anaerobes of the genera Lactococcus and
Pantoea and by genera within the family Bacillaceae, while the posterior gut is more diverse,
featuring anaerobes from the genera Spiroplasma, Clostridium, and Enterobacter.[194]
To determine whether plastics may be broadly susceptible to biodegradation within
mealworms, we evaluated the fate of polyethylene (PE) within the gut. Assessing the
degradation of PE is of interest because PE has a markedly di↵erent chemical structure
than PS; PE lacks a benzene ring in the repeating monomer unit, which could impact
the resulting degradation. The chemical structure of polyethylene represents the simplest
18 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
homogenous carbon-to-carbon backbone.[3] Thus, the ability to degrade PE would suggest
that the mealworm gut microbiome is capable of degrading other plastics with a similar
chemical motif (e.g., polyvinyl chloride or polypropylene). In addition, the global production
of polyethylene (PE) is approximately four times that of PS, and PE plastics are among
the most common plastic pollutants.[3, 171]
There have been recent reports of PE degradation within the gut of other omnivorous
insect larvae (Indian meal moths, wax moths), which could suggest that the insect gut
broadly enables the degradation of recalcitrant plastics; however, evidence for degradation
is preliminary and warrants further study and confirmation.[206, 14] None these studies
reported the ability to degrade more than one type of plastic or plastic mixtures. Addition-
ally, few previously identified plastic-degrading systems, including isolated microorganisms,
are capable of degrading multiple types of plastic, suggesting that the plastic degradation
is typically plastic-specific.[158, 173, 93]
In this study, we investigate the biodegradation of polyethylene (PE) and mixed plastics
(PE and PS) in a previously untested strain of T. molitor. We find that PE degrades at
rates comparable to those of PS-fed larvae.[212, 207] Moreover, mixed plastics (PE and PS)
are consumed and degraded, suggesting that degradation is non-specific. Next-generation
sequencing indicates that this degradation is associated with changes in the gut microbiome.
2.3. MATERIALS AND METHODS 19
2.3 Materials and Methods
2.3.1 Mealworm survival and plastic consumption
Mealworms, larvae of T. molitor Linnaeus, (average weight 75-85 mg/worm) were purchased
online from Rainbow Mealworms (Compton, CA) and shipped overnight to the laboratories
at Stanford University. Prior to arrival, the mealworms were fed bran; after arrival, they
were subject to a 48-hour starvation period before initiating experimental diets. Natural
wheat bran was purchased from Exotic Nutrition (Newport News, VA).
Six experimental diets were compared: PE, PE + bran (1:1 [w/w]), PS, PS + bran
(1:1 [w/w]), PE + PS (1:1 [w/w]), and bran (control diet). To assess mealworm survival
rate and plastic mass loss, 120 randomly selected mealworms were placed in a food grade
polypropylene container (volume 475 mL) along with 1.80 g of plastic cut into 2 – 3 cm
cubes (PE, PS, or 0.90 g PE and 0.90 g PS). Bran-fed containers (PE + bran, PS + bran)
initially received 1.80 g bran plus plastic spread throughout the container. Additional bran
was added every 3 days to maintain a 1:1 ratio [w/w] of plastic to bran within each container.
Bran-fed controls initially received 1.80 g of bran and 1.80 g of additional bran every 3 days.
All tests were carried out in duplicate. Containers were stored in incubators maintained at
25 �C and 70% humidity.[212, 207]
Mealworm survival was evaluated approximately every 3 days for 32-days by counting
dead mealworms, which were then removed. Once a week, the mealworms were cleaned
with a stream of air to remove any residual plastic fragments and transferred to a clean
container to collect frass (excrement) for analysis. After 24 hours, the mealworms were
returned to their original container, and frass samples were weighed and stored at -20 �C.
To obtain su�cient frass for characterization, 1000 mealworms (from the same order)
were raised in larger “bulk-fed” food grade polypropylene containers (volume 780 mL) on
the six diets described above. These containers followed the same bran-supplementation
and frass-collection schedule as described above. Bulk-fed containers were also stored in
incubators maintained at 25 �C and 70% humidity. Frass samples from the end of the
32-day experiment are used in the analysis below.
20 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
2.3.2 Plastic test materials
To assess the degradation of commercially available plastic products, low-density polyethy-
lene foam, 1.3 cm thickness, was purchased online from the Foam Factory (Macomb, MI).
The polystyrene foam, 5.1 cm thickness, used was an expanded polystyrene insulation ma-
terial from Carlisle Construction Materials (Puyallup, WA). Plastic foam blocks were cut
into irregular 2 – 3 cm cubes and cleaned with a stream of air to remove any residues prior
to being placed in the appropriate container. The molecular weight and density of the con-
trol materials are shown in Table 2.1. The PE foam contained no chemical additives. The
PS foam contained less than 1% 1,2,5,6,9,10-hexabromocyclododecane (a common flame
retardant in PS materials).
2.3.3 Characterization of plastic degradation within egested frass
To characterize depolymerized polymer in the frass, the molecular weight (number-averaged
[Mn] and weight-averaged [Mw] molecular weight) of the polymer was quantified by high-
temperature gel permeation chromatography (HT-GPC) using previously established
methods.[207] Frass samples (50 mg) were gently crushed in a mortar and pestle prior
to a 2-hour extraction in 2 mL solvent aliquots with gentle heating (placed on a hot plate
on the lowest setting). For PE samples, the solvent was dichloromethane (� 99.9%, Thermo
Fisher Scientific Inc., Pittsburg, PA); for PS samples, the solvent was tetrahydrofuran (�99.9%, Thermo Fisher Scientific Inc., Pittsburg, PA) (SI Method A.1.1, Fig. A.6). After
2 hours, the solution was filtered using a 0.22 µm PVDF filter (Thermo Fisher Scientific
Inc., Pittsburg, PA) and transferred into a clean glass vial. The residual polymer in the fil-
tered solution was concentrated by rotary evaporation, and the residue (“residual polymer”)
was weighed to determine the extractable fraction (i.e., the fraction of the frass weight re-
covered). Residual polymer was dissolved in 1,2,4-trichlorobenzene (� 99%, Alfa Aesar,
Haverhill, MA) to obtain a final concentration of approximately 5 mg/mL. Triplicate anal-
yses for each sample were run at 180 �C with a 100 µL injection volume with an eluent
(1,2,4-trichlorobenzene) flow rate of 1.0 mL/min (EcoSEC High Temperature GPC System,
Tosoh Biosciences).
Proton nuclear magnetic resonance (1H-NMR) analysis was conducted to characterize
degradation in the egested frass. The control plastics and residual polymers from mealworms
fed each diet were analyzed. Trace residue extracted from the frass of bran-fed mealworms
2.3. MATERIALS AND METHODS 21
was used as a control. Before conducting the liquid-state 1H-NMR analysis, frass samples
(50 mg) were extracted as described above. The residual polymer was re-suspended in
chloroform-D (� 99.8%, Cambridge Isotope Laboratories, Inc., Tewksbury, MA). Proton-
NMR spectra were obtained at 55 �C on a Varian Inova 500-MHz NMR spectrometer
(Agilent Technologies, Inc., Santa Clara, CA). The 1H-spectra [32 scans, delay time (d1)
= 0.0 s] were referenced to the residual deuterated-chloroform peak [7.26 ppm]. Spectra
were analyzed using MestReNova software (version 10.0.2), values are reported in parts per
million (ppm).
Additional characterization of the residual polymer was obtained using Fourier Trans-
form Infrared Spectroscopy (FTIR) on a Nicolet iS50 FTIR Spectrometer (Thermo Fisher
Scientific, Inc., Pittsburg, PA). Spectra were recorded from the residual polymers extracted
from the frass ground to a homogenous powder in absorbance mode and transformed into
transmittance for graphing. Spectra were recorded in the range of 4000-500 cm-1 with a
minimum of 16 scans with a spectral resolution of 0.482 cm-1. Peaks were identified using
OMNIC software (Thermo Fisher Scientific Inc., Pittsburg, PA). Proton-NMR and FTIR
analysis were run in duplicate for each diet on residual polymer collected from the bulk-fed
containers.
2.3.4 Microbial community analysis
At the end of the 32-day experiment, the gut content of each sample (four mealworms from
the same container pooled to eliminate individual variability) was harvested and washed
four times by vortexing the guts with 100 µL of DNA extraction bu↵er (0.1 M NaH2PO4, 0.1
M Na2HPO4, 0.1 M EDTA, 0.1 M Tris-HCl, 1.5 M NaCl, 1% CTAB).[219] Gut walls were
removed, and DNA was extracted using the MoBio PowerLyzer PowerSoil protocol with
a 25:24:1 phenol/chloroform/isoamyl alcohol modification to improve yield.[71] Phasing
amplicon sequencing was used to sequence the V4 region of 16S rRNA gene (SI Method
A.1.1).[203] Library of the 16S rRNA gene amplicon sequencing were constructed using
MiSeq reagent kit (Illumina, San Diego, CA) and DNA was sequenced using an Illumina
MiSeq platform.
Sequencing data were processed to combine pair-end reads and filter out poorly over-
lapped and unqualified sequences using the Amplicon Sequencing Analysis Pipeline (ASAP
version 1.3). The sequences (2 x 251 bp) were subjected to quality check with FastQC
22 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
(version 0.11.5). Pair-end sequences were merged based on the 3‘ overlap using PEAR (ver-
sion 0.9.10) with a quality score cuto↵ of 20 and minimum overlap length of 40 bp.[216]
Samples were demultiplexed using split libraries fastq.py from the QIIME package (ver-
sion 1.9.1) based on the barcodes (maximum barcode error of 0 and a trimming quality
score cuto↵ of 20).[24] Primer sequences were trimmed. Dereplication was performed using
USEARCH (version 9.2.64) with the command fastx uniques (with -sizeout for sequence
abundance output). Operational Taxonomic Units (OTUs) were clustered using UPARSE
(command -cluster otus of USEARCH) with OTU identity threshold of 97% and singletons
and chimeric sequences were removed.[47] Representative sequences of the OTUs were clas-
sified using RDP Classifier (training set 16, June 2016) with confidence cuto↵ of 0.8.[193]
Diversity was evaluated using the R package “vegan.”[126] Di↵erential abundance analysis
was conducted using the Bioconductor package DESeq2 in QIIME with the Benjamini-
Hochberg (BH) correction for multiple testing.[106, 8] Due to sample limitations there was
an uneven number of replicates for each diet, with more replicates available for the PE-fed
diets (Table A.1).
2.3.5 Statistical analysis
Statistical analyses were performed in Prism (GraphPad Software, version 7.0a). To assess
di↵erences in survival, plastic consumption, changes in molecular weight, and microbial
diversity ANOVAs were performed, followed by pairwise comparisons using Student’s t-
test with Tukey’s correction to assess di↵erences between diets. All p-values are adjusted
p-values and all error values are average ± standard deviation.
2.4 Results and Discussion
2.4.1 PE consumption and e↵ects on survival
At the end of the 32-day experiment, the survival ratio (SR) of the mealworms fed PE was
98.3% ± 0.0%, a value that was not significantly di↵erent (p = 0.92) from that of the bran
fed controls (96.3% ± 4.1%) (Fig. 2.2a). There was also no significant di↵erence (p = 0.65)
in SR of mealworms fed PE alone and mealworms fed PE + bran (95.0% ± 1.2%) (Fig.
1a). The SR of PS-fed mealworms (90.8% ± 2.4%) and PS + bran fed mealworms (91.3%
± 1.8%) were similar to values previously reported and were also not significantly di↵erent
2.4. RESULTS AND DISCUSSION 23
from those of mealworms fed PE (PS: p = 0.06, PS + bran: p = 0.08) PE + bran (PS: p =
0.44, PS + bran: p = 0.54), or the bran-fed controls (PS: p = 0.21, PS + bran: p = 0.27)
(Fig. 2.2a).[212, 207]
Consumption of PE and PS increased throughout the experiment (Fig. 2.2b). From
the initial 1.80 g PE, the total mass loss at the end of the experiment was 0.87 ± 0.0 g by
mealworms fed PE (Fig. 2.2c,d). For mealworms fed PS, the total PS mass loss was 0.57 ±0.12 g (Fig. 2.2c,d). For both PE- and PS-fed mealworms, the mass loss was significantly
greater when the mealworms received bran as a co-feed. For PE + bran, the mass loss was
1.10 ± 0.12 g and for PS + bran, the mass loss was 0.98 ± 0.11 g (Fig. 2.2c,d). Specific
rates of plastic consumption (mg plastic consumed per 100 worms per day) followed the
same pattern (Fig. 2.2d). The increase in specific consumption when co-fed with bran
supports previous findings.[207]
2.4.2 Evidence for depolymerization and biodegradation of PE
Residual polymer extracted from the frass of the bulk-fed containers was used to as-
sess biodegradation and depolymerization within the mealworm gut. The egested frass
contains an extractable fraction, consisting of non-degraded and partially degraded poly-
mer, and a non-extractable fraction (other biological waste not recovered in the extraction
process).[207] A decrease in the extractable fraction (“residual polymer”) suggests that more
of the ingested plastic is being completely degraded (mineralized) and/or is being incorpo-
rated into mealworm biomass.[207] The extractable portion of the frass from mealworms
fed PE or PS decreased over the course of the 32-day experiment (Fig. 2.3b).
Depolymerization of PE and PS was characterized using HT-GPC on the residual poly-
mers. HT-GPC analysis of the residual polymers from mealworms fed PE and PE + bran
showed a significant decrease in weight-averaged (Mw) and number-averaged (Mn) molec-
ular weight compared to the control PE (Fig. 2.3a). The residual polymer from PE-fed
mealworms showed an average reduction in Mw of 61.3 ± 5.0% and reduction in Mn of 40.1
± 8.5% (Fig. 2.3a; Table 2.1). The residual polymer from mealworms fed PE + bran showed
an average reduction in Mw of 51.8 ± 9.3% and reduction in Mn of 47.6 ± 8.5% (Fig. 2.3a;
Table 2.1), indicating significant depolymerization of PE occurred within the gut of the
mealworms fed PE and PE + bran. HT-GPC analysis of the residual polymer from meal-
worms fed PS and PS + bran also revealed significant decreases in Mw and Mn compared
to the control PS (Fig. A.1a; Table 2.1). The observed depolymerization in mealworms fed
24 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
PS and PS + bran is consistent with previous observations (Table 2.1).[212, 207]
Chemical modifications of the residual polymer were examined using 1H-NMR analysis.
Comparison of the control PE spectra to the spectra of the residual polymer from meal-
worms fed PE and PE + bran revealed a new peak around 5.3 ppm in a region associated
with alkene bonds (C=C-H) (Fig. 2.3c; Tables A.2, A.3). This peak was not observed in
spectra of control extractions from the frass of bran-fed mealworms, suggesting this peak
is not a result of contamination from the frass or the extraction method. Comparison of
the control PS spectra to the spectra of the residual polymers from PS and PS + bran
fed mealworms revealed new peaks associated with the incorporation of oxygen, previously
associated with plastic degradation (Fig. 2.3c; Tables A.2, A.3).[212, 207] To further assess
the possibility that the newly observed peaks were attributable to contamination by bac-
terial biomass or secreted proteins, samples of plastic (PE and PS) were separately treated
in a suspension of E. coli K12 for 48-hours then subject to the same extraction methods
(SI Method A.1.3).[196] The NMR spectra for PE and PS control samples incubated with
E. coli K12 did not reveal new peaks relative to the control spectra, supporting the con-
clusion that newly observed peaks in the residual polymers spectra (from PE- and PS-fed
mealworms) are evidence of chemical modifications resulting from plastic degradation and
are likely not due to contamination (Fig. A.2a,b).[196]
Additional evidence of chemical modifications in the residual polymer was obtained by
FTIR analysis. FTIR spectra from the residual polymers from mealworms fed PE and PE
+ bran revealed incorporation of oxygen as indicated by the appearance of peaks associated
with C-O stretching (1000–1200 cm-1) and alcohol groups (R-OH bend, 1300–1450 cm-1;
R-OH stretching, 3000–3500 cm-1) (Fig. 2.3d; Tables A.4, A.5, A.6). These peaks were not
observed in the control PE spectra. FTIR spectra for the residual polymers from mealworms
fed PS and PS + bran also revealed chemical modifications and the incorporation of oxygen
(Fig. A.1d; Tables A.4, A.5, A.6). Again, to assess whether the new peaks were byproducts
of microbial contamination, control plastic (PE and PS) incubated with E. coli K12 were
also subject to FTIR analysis (SI Method A.1.3). FTIR spectra of these controls did not
reveal any new peaks, supporting the conclusion that the newly observed peaks resulted
from plastic degradation within the mealworm gut and are likely not due to contamination
(Fig. A.2c,d; Tables A.4, A.5, A.6).[196]
2.4. RESULTS AND DISCUSSION 25
2.4.3 Evidence for mineralization via a mass balance
A mass balance on the plastic-fed mealworms was conducted by measuring the weights of
system inputs (plastic and/or bran), outputs (the weight of the frass before extraction and
the weight of the extractable fraction), and the weight of accumulated biomass (changes in
the weight of surviving mealworms).[212] The mealworm containers were kept at a constant
humidity and all weights were measured as wet-weights to avoid errors due to losses or gains
in water vapor. Deviations from a perfect mass balance (e.g., if the outputs 6= the inputs +
changes within the container, “putative gas fraction”) would be due to losses into the gas
phase (e.g., mineralization), which were not directly measured.
The putative gas fraction (PGF) increases over the course of the experiment for PE-fed
mealworms while the extractable fraction from the frass decreased, both of which suggest
more degradation (and mineralization) occurred towards the end of the 32-day experiment
(Fig. 2.3b; Fig. A.3a). Mealworms fed plastic alone (PE or PS) gained less biomass
weight over the course of the experiment than mealworms co-fed with bran, an observation
consistent with previous studies of PS-fed mealworms (Fig. A.3).[207] By mass balance,
the PGF was 49.0 ± 1.4% at the end of the experiment for PE-fed mealworms (Fig. A.3a).
For mealworms fed PE + bran, the PGF was 24.3 ± 2.2% with a higher percent of the
ingested mass being incorporated into the mealworm biomass (Fig. S3b). The PGF in
PS-fed mealworms was 45.5 ± 2.9%, a value similar to that previously reported for PS
mineralization by mealworms (measured via mass balance and 13C-carbon tracing) (Fig.
A.3c).[212] The PGF of PE- and PS-fed mealworms were not significantly di↵erent.
2.4.4 Biodegradation of mixed plastics
When fed a diet of one plastic (PE or PS, with or without bran) there was no significant
di↵erence between plastic mass loss by the mealworms based on the plastic (Fig. 2.2b, c,
d). However, when mealworms were co-fed PE and PS (1:1 [w/w]), there was a significantly
higher mass loss of PE than PS (Fig. 2.2c, d). A previous report suggested that di↵erences
in plastic consumption rates among di↵erent types of PS foams may be due to density, with
a higher consumption rate associated with less dense plastics.[207] In this study, however,
the PE plastic had a higher density than the PS plastic, suggesting that other factors may
a↵ected the relative rates of mixed plastic consumption. Further work is needed to assess
what factors influence di↵erential plastic consumption rates.
26 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
The molecular weight distributions of the mixed polymers could not be di↵erentiated via
HT-GPC, therefore characterization of depolymerization was not included in this analysis.
However, FTIR analysis of the residual polymers revealed chemical modifications and the
incorporation of oxygen relative to the control PE and PS spectra, similar to those observed
in the residual polymers from mealworms fed PE or PS, which suggests degradation of the
mixed polymers occurred within the mealworm gut (Fig. A.4; Tables A.4, A.5, A.6). This
finding o↵ers further evidence that plastic degradation within the mealworm gut is non-
specific.
2.4.5 E↵ects of plastic consumption on gut microbiome
Next-generation sequencing was used to investigate the e↵ect of plastic diets on microbial
community structure (Table A.1). Relative abundance analysis revealed the same three
majority community members (OTUs) in all diets: Spiroplasma sp., Cronobacter sp., and
Enterococcus sp. (Fig. 2.4a). These three OTUs are common insect gut-associated bacteria
and are known members of the T. molitor gut microbiome.[194, 65]
We analyzed microbial diversities across all six experimental diets. The alpha diversity
of the microbial community, measured via the inverse Simpson index, was not significantly
di↵erent between the di↵erent diets (Fig. 2.4b). A principal coordinate analysis (PCoA)
based on Bray-Curtis dissimilarity index revealed clusters associated with di↵erent diets,
with clear clusters for PE-fed and bran-fed mealworms (Fig. 2.4c). A multi-response per-
mutation procedure test revealed a significant di↵erence in the microbial communities based
on diet (p = 0.001). This suggests that while the majority members of the microbial com-
munity do not di↵er dramatically in PE diets, the composition of the microbial community
is distinct from either bran-fed or PS-fed communities.
Di↵erential abundance analysis was used to assess whether particular OTUs were asso-
ciated with di↵erent diets (Fig. 2.5, Table A.7). This analysis revealed two OTUs that were
strongly associated (p < 0.05) with both the plastic diets (PE and PS): Citrobacter sp. and
Kosakonia sp. Both OTUs are members of the Enterobacteriaceae, a family known to con-
tain PE-degrading member Enterobacter absuriae YT1 isolated from the gut of the larvae of
Indian mealmoth.[206] Both OTUs can utilize oxygen (Citrobacter sp. are aerobic, Kosako-
nia sp. are facultative anaerobic), which could be further evidence for their involvement in
plastic degradation, as incorporation of oxygen is key in the accelerated biodegradation of
both PE and PS, as evident in the analysis of residual polymers and previous work (Fig.
2.4. RESULTS AND DISCUSSION 27
2.3c, d; Fig. A.1c, d).[158, 173, 93, 65] Both Citrobacter sp. and Kosakonia sp. were more
abundant (based on relative abundance) in both of the plastic-only diets than the plastic +
bran fed diets and were also more abundant than the other OTUs identified via di↵erential
abundance analysis (Table A.7).
Two OTUs, both minority members of the microbial community, were significantly as-
sociated (p < 0.05) with PE-fed microbiomes: Sebaldella termitidis and Brevibacterium sp.
(Fig. 2.5b, c, d; Table A.7). Sebaldella termitidis is phylogenetically isolated within the
phylum Fusobacteria, is anaerobic, and is a known inhabitant of the posterior end of the
termite gut track.[72] Brevibacterium sp. are aerobic bacteria known to be associated with
hydrocarbon degradation, including n-alkanes.[27] Further work should assess the involve-
ment of Brevibacterium sp. in the degradation of polyethylene.
Seven OTUs, all minority members of the microbial community, were significantly asso-
ciated (p < 0.05) with the PS-fed gut microbiome: Listeria sp., Nitrospira defluvii, Pedomi-
crobium sp., Aquihabitans sp., unclassified Xanthomonadaceae, unclassified Saprospiraceae,
and unclassified Burkholeriales (Fig. 2.5c,d; Table A.7). Most of these PS-associated OTUs
are aerobic, which is important when considering their possible role in the degradation of
polystyrene. The increase in OTUs associated with the PS microbial community could be
indicative of a more diverse suite of daughter products created in PS degradation, likely due
to the more complex chemical composition of PS and the presence of benzene rings that
could degrade into a variety of daughter products. Changes in the PS-microbial community
could also be a↵ected by the presence of trace amounts (< 1%) of a chemical flame retardant
(present in most commercially available PS products). Further research is needed to assess
whether and how trace chemicals (especially flame retardants in PS materials) a↵ect the
microbial community.
Overall, di↵erential abundance analysis of the gut microbiome revealed several minority
OTUs strongly associated with the plastic diets. The gut microbiome, which previous
work has shown is necessary for PS degradation, shows changes in response to di↵erent
plastic diets, further suggesting the importance of the microbial community in the plastic
degradation process. While further work is needed to assess the role of individual OTUs
in the plastic degradation pathway, this analysis o↵ers an initial insight into what species
might be of interest in future studies.
28 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
2.5 Implications
This work is the first report to demonstrate that PE is depolymerized and undergoes chem-
ical modifications within the mealworm gut. Additionally, we demonstrated for the first
time that mixed plastics (PE and PS) undergo biodegradation within the gut. Application
of next-generation sequencing to the gut microbiome revealed two OTUs (Citrobacter sp.
and Kosakonia sp.) strongly associated with both PE and PS as well as OTUs unique to
each plastic. Our findings suggest that plastic degradation within the mealworm gut is not
plastic-specific. This could have implications for future waste management applications.
As the mealworms in this study were previously untested for plastic degradation, their
ability to degrade both PE and PS further suggests the ubiquity of plastic degradation
among mealworms. Further work is needed to assess whether other recalcitrant plastics that
resemble polyethylene (e.g., polyvinyl chloride and polypropylene) degrade in the mealworm
gut. Future work should focus on elucidating the mechanisms of degradation within the
mealworm to enable future applications.
2.6 Supporting Information
Appendix A contains more detailed information about the methods and results from this
study, including Tables A.1 through A.7 and Figures A.1 through A.6.
2.7. TABLES 29
2.7 Tables
Table 2.1: Characterization of PE and PS foams tested before and after degradation bymealworms (mean ± standard deviation, n = 4 for control samples, n = 3 for frass samples).
2.8. FIGURES 31
0 10 20 300
50
70
80
90
100
Days
Surv
ival
Rat
e (%
)
Bran OnlyPE OnlyPE + Bran (1:1)PS OnlyPS + Bran (1:1)PE + PS (1:1)
ns
PE Only
PE + Bran (1:1)
PS Only
PS + Bran (1:1)
PE + PS (PE)
PE + PS (PS)0
20
40
60
80
100
Fina
l Pla
stic
Mas
s Lo
ss (
%)
**
**ns
0 10 20 300
15
30
45
60
7580
100
Days
Plas
tic M
ass
Loss
(%) PE Only
PE + Bran (1:1)PS OnlyPS + Bran (1:1)PE + PS (PE)PE + PS (PS)
PE Only
PE + Bran (1:1)
PS Only
PS + Bran (1:1)
PE + PS (PE)
PE + PS (PS)0
10
20
30
40
Spec
ific
Plas
tic C
onsu
mpt
ion
(mg
plas
tic /
100
wor
ms
- day
)
**
*
ns
(a) (b)
(c) (d)
Figure 2.2: Survival rate and plastic consumption by T. molitor by diet. (a) Survival rateof mealworms over 32-day experiment. (b) Mass loss in plastic (PE or PS) in the plastic-feddiets over 32-days. (c) The percent mass loss in the plastic by diet at the end of the 32-dayexperiment. (d) Average specific plastic consumption (mg plastic per 100 mealworms perday) over the 32-day experiment. All values represent mean ± SD, n = 2. Significance(Student’s t-tests, Tukey’s multiple test correction) p < 0.05 indicated by ⇤, p < 0.005indicated by ⇤ ⇤, no statistical significance indicated by ns. For mealworms fed PE + PS,the mass loss is displayed separately for each plastic.
32 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
0
1×104
2×104
3×104
4×104
0.0
5.0×104
1.0×105
1.5×105
2.0×105
2.5×105
Mol
ecul
ar W
eigh
t (M
n) M
olecular Weight (M
w )
Mn Mw
* ***
nsns
50010001500200025003000350040000
50
100
Wavenumber (cm-1)
% T
rans
mitt
ance PE Frass
PE + Bran FrassOHR
C H
C O
C C
C H
OHRstretch
stretch
bend
bend
stretch
bend
PE ControlC Ostretch
(c)
likely C=C-H
Bran Frass
PE + Bran Frass
PE Frass
PE Control
(a)
(d)Week 1
Week 2Week 3
Week 40
20
40
60
80
Ext
ract
able
Fra
ctio
n (%
)
PE Frass
PE + Bran Frass
PE Control
(b)
Figure 2.3: Characterization of polyethylene degradation within the mealworm gut. (a)Changes in molecular weight (Mn and Mw) within residual polymer from the frass versusthe control PE as measured by HT-GPC. Significance (Student’s t-tests, Tukey’s multipletest correction) p < 0.05 indicated by ⇤, p < 0.0005 indicated by ⇤ ⇤ ⇤, no statisticalsignificance indicated by ns. (b) Changes in the extractable fraction of the frass (% recoveredby extraction), a measure of residual non-degraded and partially degraded polymer in thefrass, over the 32-day experiment. (c) 1H-NMR spectra of residual polymer from the frass ofPE and PE + bran fed mealworms versus residuals extracted from bran-fed mealworms andthe control PE foam. The appearance of alkene derivatives is highlighted in grey. Detailedpeak information in Table S2. (d) FTIR spectra of residual polymer from the frass of PEand PE + bran fed mealworms versus the control PE, annotations show functional groupsassociated with key peaks based on wavenumber. Detailed peak information in Tables A.4,A.5, A.6.
2.8. FIGURES 33
●
●
●
●
●●
●
●
●
●
●
●●
●
●
●
●
●
●
●
●
●
● ●
●
●
●
●
●
●●
●
●
●
●
●
●●
●
●
●
●
●
●
●
●
●
● ●
●
PS_Bran1PE_PS2
PE1PE2
PE_Bran1PE_Bran3
PE_Bran4
PS2PE_Bran2
PE_PS1
Bran6
PE7PE9PE6
Bran4
PE_Bran5
PE_Bran4
PE8PE3
Bran1
Bran3
PE5Bran2 PE_Bran3
PE4
−0.2
−0.1
0.0
0.1
0.2
−0.2 0.0 0.2Axis.1 [28.5%]
Axis.
2 [
19.5
%]
Diet●●
●●
●●
●●
●●
●●
Bran
PE
PE_Bran
PE_PS
PS
PS_Bran
Bran PE
PE + BranPE + PS PS
PS + Bran0
50
100
Rel
ativ
e A
bund
ance
(%)
Clostrium senso stricto sp. Lactobacillus sp.Lactococcus sp.un. BacteriaEnterococcus sp. Cronobacter sp. Spiroplasma sp.
Listeria sp.Bacillus sp. Sebaldella termitidis
Most Abundant OTUs:
Bran PE
PE + Bran
PE + PS PS
PS + Bran0
1
2
3
4
5
Inve
rse
Sim
pson
Inde
x
ns
(a) (b)
(c)
Figure 2.4: Microbial community analysis of gut microbiome in di↵erent diets. (a) Changesin community composition by family by diet (average from all replicates, Table A.1), legendshows ten most abundant OTUs across all diets, un. indicates unclassified. (b) InverseSimpson Index of the gut microbiome by diet. No statistical significance (ANOVA, Tukey’smultiple test correction) indicated by ns. (c) Principal Coordinate Analysis (PCoA) ofmicrobial communities by diet based on Bray-Curtis distance, colored by diet and labeledwith the sample ID (two outliers removed: PS1, PS Bran2; PCoA with outliers Fig. A.5).
34 CHAPTER 2. BIODEGRADATION OF POLYETHYLENE
-10 -5 0 5 10
Clostrium sensu stricto sp.Clostrium sensu stricto sp.
Bacillus sp.Un. LachnospiraceaeBrachybacterium sp.
Un. EnterobacteriaceaeStaphylococcus sp.
Un. LachnospiraceaeBrevibacterium sp.
Sebaldella termitidisCorynebacterium sp.
Kosakonia sp.Citrobacter sp.
log2 Fold Change
PE vs. Bran
PE AssociatedBran Associated
-10 -5 0 5 10
Listeria sp. Nitrospira defluviiAquihabitans sp.
Un. XanthomonadaceaePedomicrobium sp. Un. BurkholderialesUn. SaprospiraceaeChondromyces sp.
Un. BurkholderialesSphingorhabdus sp.
Ferruginibacter sp. Brevibacterium sp.
Sebaldella termitidis
log2 Fold Change
PE vs. PS
PE AssociatedPS Associated-10 -5 0 5 10
Clostrium sensu stricto sp. Clostrium sensu stricto sp.
Bacillus sp. Un. Myxococcales
Un. SaprospiraceaeUn. Xanthomonadaceae
Pedomicrobium sp. Aquihabitans sp.
Un. BurkholderialesNitrospira defluvii
Citrobacter sp. Listeria sp.
Kosakonia sp.
log2 Fold ChangeBran Associated
PS vs. Bran
PS Associated
-10 -5 0 5 10
Clostrium sensu stricto sp.Bacillus sp.
Citrobacter sp.Un. Clostridiales
Clostrium sense stricto sp.Cronobacter sp.
Brachybacterium sp.Un. Enterobacteriaceae
Un. LachnospiraceaeKosakonia sp.
Brevibacterium sp.Sebaldella termitidis
Citrobacter sp.
log2 Fold ChangePE AssociatedPE + Bran Associated
PE vs. PE + Bran(a) (b)
(c) (d)
Figure 2.5: Di↵erential abundance analysis of gut microorganisms between experimentaldiets. OTUs shown significantly (BH adjusted p < 0.05) di↵ered between diets. Directionof fold change (log2) indicates which diet each OTU is more strongly associated (labeledbelow x-axis). (a) PE-fed microbiome versus bran-fed microbiome. (b) PE-fed microbiomeversus PE + bran-fed microbiome. (c) PE-fed microbiome versus PS-fed microbiome. (d)PS-fed microbiome versus bran-fed microbiome.
Chapter 3
Enhanced polystyrene
biodegradation in an ex situ gut
microbiome enrichment from
Tenebrio molitor (mealworm
larvae)
The results of this chapter are in preparation for publication. Alexa M. Gracia helped
design and perform laboratory experiments. Dr. Wei-Min Wu contributed to the design of
the study and provided comments to improve the manuscript.
35
36 CHAPTER 3. ENHANCED EX SITU DEGRADATION
3.1 Abstract
As the global threat of plastic pollution has grown in scale and urgency, so have e↵orts
to find sustainable and e�cient solutions. Research conducted over the past few years has
identified gut environments within insect larvae, including Tenebrio molitor (mealworms),
as microenvironments uniquely suited to rapid plastic biodegradation. However, there is
currently limited understanding of how the insect host and its gut microbiome collaborate
to create an environment conducive to plastic biodegradation. In this work, we provide
evidence that T. molitor secretes one or more emulsifying factor(s) (30 – 100 kDa) that
mediate plastic bioavailability. We also demonstrate that the insect gut microbiome se-
cretes factor(s) (<30 kDa) that enhance respiration on polystyrene. We appy these insights
to culture polystyrene-fed gut microbiome enrichments, with elevated rates of respiration
and degradation compared to the unenriched gut microbiome. Within the enrichment, we
identified eight unique microorganisms that are associated with polystyrene biodegradation
including Citrobacter freundii, Serratia marcescens, and Klebsiella aerogenes. Our results
demonstrate that the mealworm itself and its gut microbiome both contribute to the accel-
erated plastic biodegradation. This work provides new insights into insect-mediated mech-
anisms of plastic degradation and potential strategies for cultivation of plastic-degrading
microorganisms in future investigations and scale-up.
Mealworm host
CO2
Gut microbiome
T. molitorC C
H
H
H
Emulsifing agent
Respiration enhancing factor
C C
H
H
H
Gut supernatant+ gut microbiome
Polystyrene
CO2 , H2O & degradedresiduals
Figure 3.1: Summary Figure.
3.2. INTRODUCTION 37
3.2 Introduction
Plastic pollution is a well-known threat to human and environmental health. Strategies are
needed for e↵ective management of recalcitrant plastic wastes because current cradle-to-
grave lifecycles result in plastic accumulation in landfills and in the environment.[66] Thus,
there is an urgent need to permanently and completely eliminate plastic waste from this
linear lifecycle. Recent work to achieve this goal has focused on natural plastic biodegra-
dation, mainly identifying and isolating bacterial strains capable of biodegrading plastic
polymers.[158, 65, 93, 200, 124] Rates of plastic degradation vary among these microbes,
but are typically low, ranging from ⇠ 5% plastic degradation (by mass) within six months
(⇠ 0.03% per day) to ⇠ 8% within two weeks (⇠ 0.6% per day).[158, 65]
A fundamental limitations to microbial biodegradation of plastics is the limited bioavail-
ability of plastics to microbial attack.[158, 93, 197] Petroleum-derived plastics have high
molecular weights and are highly hydrophobic, both of which limit the ability of microor-
ganisms to interact with these materials, especially in aqueous environments.[158, 93, 197]
E↵orts to improve plastic biodegradation rates have revealed that the gut environment of
insect larvae can support comparatively rapid plastic degradation. To date, plastic degra-
dation has been demonstrated in several holometabolic insect species: Tenebrio molitor
(yellow mealworms),[213, 213, 210, 207, 18] Tenebrio obscurus (dark mealworms),[134] Zo-
phobas attratus (superworms),[133, 89, 140] Plodia interpunctella (Indianmeal moth),[206]
Achroia Grisella (lesser wax moth),[95] and Galleria mellonella (greater wax moths).[91,
147, 135, 105, 25] Of these, the best characterized is the yellow mealworm.[210] Prior re-
search has established that ingested plastic is retained within the gut of yellow mealworms
for 15 – 20 hours, during which time nearly 50% of the plastic is mineralized to CO2 (⇠60% per day).[212, 207, 207] Researchers have also demonstrated that the gut microbiome of
yellow mealworms can degrade several chemically-dissimilar plastics (including polystyrene
and polyethylene), suggesting an initial, non-specific attack.[18]
Plastic-degrading microorganisms demonstrate expedited degradation within the insect
gut environment, implying that the insect host may play a role in the plastic biodegrada-
tion process. When gut microbiome activity is suppressed, Galleria mellonella retains
the capacity to metabolize polyethylene.[91] In addition, marked changes are observed
in the proteins secreted by the insect’s salivary glands, underscoring its role in plastic
38 CHAPTER 3. ENHANCED EX SITU DEGRADATION
degradation.[91] When the gut microbiome is left intact, the microbial community compo-
sition shifts during degradation and one plastic-degrading bacterium was isolated: Enter-
obacter sp. D1.[147, 105] This suggests a complex system in which the insect host and its
gut microbiome collaborate to degrade plastic.
Mealworms are a useful model organism for plastic biodegradation studies because they
are readily cultivated and are the subject of a rapidly growing body of research.[210, 18,
177, 141] As with G. mellonella, prior research has demonstrated that the mealworm gut
microbiome undergoes notable changes during plastic degradation.[210, 18] Suppression of
gut microbiome by supplementing their diet with antibiotics indicates that the microbiome
is necessary for polystyrene (PS) biodegradation.[213] PS-degrading Exiguobacterium sp.
YT2 has been isolated from the mealworm gut microbiome[213] and researchers have inves-
tigated enzyme activity in both the mealworm and the gut microbiome, though the specific
mechanisms and the role of the mealworm itself have yet to be identified.[141]
In this work, we describe e↵orts to increase plastic biodegradation rates by enhancing
gut microbiome-derived enrichments outside the gut microenvironment. To do this, we first
investigated the roles of the mealworm and its gut microbiome in plastic degradation. We
then applied these insights to enhance plastic degradation in microbial enrichments outside
the mealworm.
3.3 Materials and Methods
3.3.1 Plastic materials
Commercially available expanded polystyrene (PS) foam (thickness: 5.2 cm, weight-averaged
molecular weight (Mw): 170700 ± 9800 Da, number-averaged molecular weight (Mn):
88500 ± 5900 Da) was used as a feed for the mealworms (Carlisle Construction Materi-
als, Puyallup, WA). Prior to use, the PS foam blocks were cut into 2 – 3 cm cubes and
cleaned with a stream of air to remove any residues. PS microplastics (size: ⇠ 150 µm, Mw:
76400 ± 4700 Da, Mn: 41500 ± 3300 Da) were used in microbial cultures (Jinshuowang
Plastic Materials Co., Ltd, Dongguan, Guangdong, China). PS microplastics were either
used directly in microbial cultures or heat-pressed at 260 �C using PHI Manual Compression
Press (PW-22 Series, Industry, CA) into uniform thin films (thickness: 17.6 ± 1.1 mm) for
use in microbial cultures.
3.3. MATERIALS AND METHODS 39
3.3.2 Mealworm maintenance
Mealworms, larvae of Tenebrio molitor Linnaeus, (average weight: 75-85 mg/worm) were
purchased online from Rainbow Mealworms (Compton, CA) and shipped overnight to the
Environmental Engineering and Science laboratories at Stanford University (mealworms
from this source have previously been shown to degrade PS).[16, 17, 210, 207] Prior to
arrival, the mealworms were fed bran; after arrival, they were subject to a 48-hour starvation
period before initiating tests with the experimental diet of either natural wheat bran (Exotic
Nutrition, Newport News, VA) or PS foam. Mealworms (⇠ 1200 per experimental condition)
were reared in food grade polypropylene containers (volume: 780 mL) and kept in incubators
maintained at 25 �C and 70% humidity.[212, 207]
To understand the role of the mealworm and its gut microbiome as well as the en-
dogenous response of the mealworm to its natural diet versus an experimental plastic diet,
mealworms were reared under four conditions: (1) bran (control diet), (2) polystyrene (PS),
(3) bran + antibiotic,and (4) PS + antibiotic. Gentamicin sulfate (Acros Organics, Fisher
Scientific, Pittsburg, PA) was the antibiotic used to suppress the gut microbiome as de-
scribed in previous studies.[210, 213] Gentamicin was added at 30 mg/g bran to the bran
+ antibiotic group and an equivalent mass was added to the PS + antibiotic group. PS-fed
mealworms were initially given 2.6 g of PS foam. Bran-fed mealworms were initially given
12 g bran. Bran and gentamicin were supplemented every three days, and dead mealworms
were removed. Mealworms were maintained on the experimental diets for ⇠ 3 weeks before
use in any experiments. Prior to testing, mealworms were subjected to a 24-hour starvation
period to ensure removal of antibiotic residuals.
3.3.3 Collection of gut microbiome and supernatant
To collect the mealworm gut microbiome and produce a supernatant containing secreted
factors from the mealworm and its gut bacteria (henceforth, “supernatant”), the following
procedure was used. Fifty mealworms from each diet were scarified following established
methods.[213] Briefly, mealworms were immersed in 75% ethanol for one minute, then rinsed
with DI water. Mealworm guts were harvested via dissection into 0.6 mL sterile saline
(0.75% NaCl) in a sterile microcentrifuge tube. Samples were vigorously vortexed (Vortex-
Genie 2, MO BIO, Carlsbad, CA), and the liquid phase was collected and replaced with
sterile saline water. This was repeated ⇠ 3 – 4 times until the liquid phase was clear.
40 CHAPTER 3. ENHANCED EX SITU DEGRADATION
The collected liquid was then passed through a 40 µm nylon cell strainer (Falcon, Fisher
Scientific, Pittsburg, PA) and then centrifuged at 4000 rpm for 10 min to collect gut bacteria.
Following centrifugation, the supernatant was filtered through a 0.2 µm syringe filter
(25mm, nylon, Fisher Scientific, Pittsburg, PA) to remove remaining particulates. To better
understand the role(s) of secreted factors, supernatant was fractionated by molecular weight
using molecular weight spin columns (Amicon Ultra Centrifugal Filters, MilliporeSigma, St.
Louis, MO) into three fractions: <30 kDa, 30 – 100 kDa, and >100 kDa. All supernatant
samples were stored at 4 �C until used in experiments. Additional supernatant was collected
as needed to ensure samples were not stored for longer than three weeks.
3.3.4 Enrichment and isolation of PS-degrading bacteria
Amicrobial enrichment was used to study the potential for cultivation of key gut microbiome
members outside the mealworm gut. The gut microbiome was collected from 50 PS-fed
mealworms as described above. The collected gut bacteria were then inoculated into 30
mL of carbon-free Bushnell Haas (BH) media containing the following chemicals (g/L): 0.2
MgSO4, 0.02 CaCl2, 1.0 KH2PO4, 1.0 K2HPO4, 1.0 NH4NO3, 0.05 FeCl3.[23] PS film (0.5
g) was added to the culture along with the supernatant from PS-fed mealworms (0.18 mL,
0.6% v/v). The enrichment was grown in a round-bottomed glass culture tube (25mm outer
diameter, Fisher Scientific, Pittsburg, PA), sealed with a Kim-Kap (25mm outer diameter,
Fisher Scientific, Pittsburg, PA), and incubated at 30 � C on an orbital shaker table (150
rpm). The enrichment was cultured for three months weekly with 10 mL media changes
and supplemented with PS supernatant until a stable biofilm developed on the PS film (Fig.
B.3).
Serum bottle assays were conducted to assess the volume of CO2 produced by PS-
degrading enrichments. Cultures were incubated in 25 mL serum bottles (Wheaton, Mealville,
NJ) capped with butyl-rubber stoppers (MilliporeSigma, St. Louis, MO) and crimp-sealed
(MilliporeSigma, St. Louis, MO) under an air headspace of one atmosphere. Liquid volume
was 15 mL and the headspace volume was 10 mL. Cultures were incubated at 30 � C on an
orbital shaker table (150 rpm). All serum bottle assays were conducted in triplicate. Serum
bottles were inoculated with either bacteria from the mealworm gut or bacteria from the
enrichment. To obtain su�cient inoculum, bacteria from either sample were first grown
in 15 mL tryptic soy media for 24 hours at 30 � C. The bacteria were then collected by
centrifugation, washed with BH media, and spun again prior to use.
3.3. MATERIALS AND METHODS 41
To isolate bacterial strains involved in plastic degradation from the PS-degrading en-
richment, 30 µL liquid culture from the enrichment was plated on non-selective agar plates
(tryptic soy agar, Difco, Fisher Scientific, Pittsburg, PA). Colonies were picked with sterile
inoculum loops and streak-plated to isolate individual pure colonies, which were then were
grown in 3 mL tryptic soy media (MilliporeSigma, St. Louis, MO) for 24 hours at 30 � C.
A bacterial pellet was then collected by centrifugation, rinsed with BH media, and spun
again prior to use. The rinsed bacteria were then inoculated in 5 mL BH media with PS
film, supplemented with PS supernatant (30 µL, 0.6% v/v) and cultivated at 30 � C on an
orbital shaker (150 rpm).
To identify bacteria associated with plastic-degradation, colonies were isolated from
the enrichment and sequenced. Liquid media from the enrichment and isolates described
above was first plated on tryptic soy agar plates. For each isolate (16 total), an individ-
ual colony was randomly selected for sequencing. For the enrichment, individual repre-
sentative colonies were selected for sequencing (16 total). DNA was extracted from the
selected colonies using FastDNA SPIN Kit for Soil (MP Biomedicals, Santa Ana, CA,
USA) following manufacturer’s protocols. The 16s rRNA V4 region was then PCR ampli-
fied using 8F (5’AGAGTTTGATCCTGGCTCAG3’) and1492R (5’GGTTACCTTGTTAC-
GACTT3’). Amplification was confirmed by denaturing gel electrophoresis and clean PCR
products (QIAquick PCR Purification Kit, Qiagen, Hilden, Germany) were sent to MCLAB
(San Francisco, CA) for sequencing on ABI 3730xl automated sequencers. Pair-end reads
were aligned in Geneious Prime (2020.1.1) and strains were identified by BLAST sequence
similarity search through the NCBI 16s rRNA database.
3.3.5 Microbial activity analysis
Biolog MT2 Microplates were used (Biolog Cat. # 1013, Hayward, CA) were used to
screen the ability of cultivated bacteria and the mealworm gut microbiome to metabolize
PS as their sole carbon source. Each MT2 microplate is pre-loaded with bu↵ered nutrient
medium and a redox dye (tetrazolium violet), a well-established colorimetric indicator of
bacterial carbon oxidation (respiration) by bacteria.[63, 62] Bacterial cells from the gut
microbiome were collected via centrifugation as described above and resuspended in sterile
saline (0.75% NaCl). The cell suspension was inoculated into the MT2 microplate at 130
µL per well, followed by the addition of experimental supernatant and/or PS microplastics
(⇠ 3 mg) to the appropriate wells. All experimental conditions were tested in triplicate
42 CHAPTER 3. ENHANCED EX SITU DEGRADATION
with a negative control (loaded with inoculum and supernatant without PS) in duplicate.
The microplate was then incubated at 30 � C with gentle shaking in the Synergy HTX
Multi-Mode Plate Reader (BioTek Instruments, Winooski, VT) with hourly colorimetric
measurements (absorbance: 595 nm).[104, 111]
To assay the CO2 produced in the headspace of the serum bottles, 0.25 mL of gas from
each serum bottle was injected onto GOW-MAC gas chromatograph with an Altech CTR 1
column and a thermal conductivity detector. The following method parameters were used:
injector, 120 � C; column, 60 � C; detector, 120 � C; and current, 150 mV. The peak area of
CO2 was compared to standards and quantified using the software ChromPerfect (Justice
Laboratory Software, Denville, NJ, USA) to determine the concentration (measured as
percent of the headspace volume) CO2 in the headspace of each vial.
3.3.6 Characterization methods
Contact angle analyses was performed to quantitatively explore di↵erences in the super-
natant hydrophobicity for each experimental condition. A Contact Angle Goniometer
(Rame-Hart model-290, Succasunna, NJ) was used to measure supernatant hydrophobicity
(i.e., the ability of the tested supernatant to wet a hydrophobic surface, PS film), with
deionized (DI) water tested as a control. Increased surface wetting indicates increased hy-
drophobicity of the liquid. For each sample, PS film was placed on a level platform and 5
µL of liquid supernatant was dropped onto the film, in quadruplicate. Contact angle anal-
ysis was also utilized to characterize changes in PS films after incubation with microbial
cultures. Control and treated films were places on a level platform and 5 µL of DI water was
dropped onto the film, in quadruplicate, to assess changes in the hydrophobicity of the film
surface. Contact angles were quantified using the DROPimage Pro Software (Rame-Hart,
Succasunna, NJ).
To characterize chemical changes in the PS film after incubation with microbial cultures,
films were visualized using Fourier Transform Infrared Spectroscopy (FTIR) on a Nicolet
iS50 FTIR Spectrometer (Thermo Fisher Scientific, Inc., Pittsburg, PA), as previously
described.[18] Absorbance spectra were recorded and transformed into transmittance for
graphing. Spectra were recorded between 4000 – 500 cm-1 with at least 16 scans at a
spectral resolution of 0.482 cm-1. Peaks were identified using OMNIC software (Thermo
Fisher Scientific Inc., Pittsburg, PA).
3.4. RESULTS AND DISCUSSION 43
3.3.7 Statistical analysis
Statistical analyses were performed in Prism (version 7.0a). To compare respiration activity
and supernatant contact angles between experimental conditions, ANOVA tests were per-
formed, followed by pairwise comparisons using Student’s t-test with Tukey’s correction.
All p-values are adjusted p-values and all error values are reported as average ± standard
deviation of experimental replicates.
3.4 Results and Discussion
3.4.1 E↵ects of supernatant on ex situ microbial growth
A Biolog MT2 plate assay was used to assess respiration by the gut microbiome immediately
after extraction from mealworms. This assay demonstrated that the gut microbiome was
able to respire on PS as the sole carbon source and respiration increased significantly in
cultures supplemented with the gut supernatant from the mealworms fed either PS or bran
(p 0.05 for both, Fig. 3.2a). No increase in respiration activity occurred after the
addition of gut supernatant from mealworms fed antibiotic-treated diets; rather inhibition
was observed (Fig. 3.2a). Inhibition could be due to carry-over of antibiotics in the gut
supernatant or secretion of other factors (e.g., immune responses proteins[51]) that are
inhibitory or toxic to the gut microbiome. To test whether inhibition was due to carry-
over of antibiotic residues, positive controls (glucose-fed wells) were supplemented with
supernatant from antibiotic-treated mealworms. No loss in activity was observed (p =
0.16). This is evidence that the gut microbiome produces and secretes factors into the
supernatant that enhance degradation.
To better understand the beneficial e↵ect of the supernatant on respiration, the su-
pernatant was fractionated by molecular weight into three fractions: <30 kDa, 30 – 100
kDa, and > 100 kDa. The two smallest of these fractions (<30, 30 – 100 kDa) from each
condition were then subject to the same respiration assay described above. This assay
revealed a two-fild increase in respiration activity in the lowest molecular weight fraction
(<30 kDa), from both PS and bran diets (Fig. 3.2a). Taken together, our results suggest
that the smallest supernatant fraction contains a respiration enhancing factor secreted by
the gut microbiome of mealworms fed PS or bran. This factor increases the ability of the
gut microbiome to respire on, and thus degrade, PS outside the mealworm gut.
44 CHAPTER 3. ENHANCED EX SITU DEGRADATION
After identifying the fraction of the supernatant that contributed to increased PS-
degradation, the amount of supernatant needed to achieve this enhanced e↵ect was assayed.
To do this, five dosages of supernatant were tested: 0.0, 0.05, 0.1, 0.5, 1 mL (0.0, 0.3, 0.6,
3.0, 5.6% v/v). Supernatant dosages were used to supplement the gut microbiome from
PS-fed mealworms cultured in carbon-free media with PS microplastics in serum bottles.
CO2 production was measured over two weeks. The ideal dose was determined as the con-
centration of supernatant that led to the largest net volume of CO2 produced over 14 days,
measured as the final minus initial concentration of CO2 in the headspace. The initial con-
centration of CO2 was measured 24 hours after initializing experiments to ensure gas-liquid
equilibrium. To assess whether the increase in respiration was due to addition of an exter-
nal carbon source (rather than the presence of degradation-enhancing secreted factors), the
CO2 production of cultures supplemented with an equivalent amount of glucose (based on
chemical oxygen demand) was tested for each supernatant dose (Fig. B.1). Plots of each
dose along with the negative controls (gut microbiome supplemented with supernatant but
no PS) and glucose equivalent are provided in the Supporting Information (Fig. B.1).
At the lowest doses (0.0, 0.05, 0.1 mL), the addition of the supernatant increases the
amount of CO2 produced compared to the negative control, again highlighting the benefit
of supernatant addition for PS biodegradation (Fig. B.1a-c). Supplementation with the two
highest doses (0.5, 1.0 mL), did not increase the respiration of PS overtime; instead, high
doses led to a rapid increase in increased CO2 production in the first 24 hours, after which
the CO2 concentration stabilized (Fig. B.1d,e). This suggests that supplementation at
high doses with supernatant or glucose likely selects for bacterial strains that grow quickly
on the available carbon but do not necessarily biodegrade PS. The final change in CO2
produced over the course of the experiment was plotted by dose to determine the ideal dose
of supernatant to support PS degradation (Fig. 3.2b). The lower doses of supernatant led
to greater increases than the highest two doses, with 0.1 mL (0.6% v/v) being the clear
ideal dose. These results reveal that supplementing ex situ gut microbiome cultures with
supernatant improves PS respiration beyond the leves achieved by addition of bioavailable
carbon, supporting the hypothesis that the supernatant contains factor(s) that enhance the
capacity of the gut microbiome to respire and biodegrade PS.
3.4. RESULTS AND DISCUSSION 45
3.4.2 Identification of endogenous emulsification activity
In conducting the experiments described above, addition of gut supernatant resulted in
rapid emulsification of hydrophobic PS microplastics into the aqueous media (Fig. B.2a).
Further, this emulsification was stable over time, enabling the microplastics to settle in the
aqueous phase as they do when treated with Tween-80, a known surfactant (Fig. B.2b).
Emulsification was observed in all diets tested (PS, bran, ± antibiotic treatment), suggesting
that the production and secretion of an emulsifying agent is independent of both diet and
the gut microbiome, implying it must be endogenous to the mealworm itself. Emulsifying
surfactants are known to increase degradation rates of hydrophobic pollutants, including
plastics, where bioavailability of hydrophobic substrates is rating limiting.[6, 191, 112, 197]
It is possible that the supernatant acts similarly in the mealworm gut environment, coating
hydrophobic materials, such as plastic particles, with an emulsifying agent that increases
bioavailability and accelerates biodegradation.
To further quantify this emulsification activity, contact angle analysis was used to mea-
sure the ability of the supernatant to wet a hydrophobic surface (PS film) relative to DI
water as a control (Fig. 3.3). Increased surface wetting is analogous to increased hydropho-
bicity of the supernatant, which would implicate the supernatant as an emulsifying agent for
plastics. Whole supernatant from both PS- and bran-fed mealworms was more hydrophobic
than DI water (increased surface wetting on a hydrophobic surface, p < 0.001 for PS and
bran supernatant, Fig. 2a). When fractionated, the intermediate supernatant fraction (30 –
100 kDa) was significantly more hydrophobic than the other two fractions (<30 kDa, >100
kDa) for all four experimental diets: PS, PS + ab, bran, bran + ab (Fig. 3.3, PS: p < 0.0001
relative to both >100 kDa and <30 kDa; Bran: p = 0.002, p < 0.001 relative to >100 kDa,
<30 kDa respectively). In each case, the intermediate fraction was significantly better at
wetting the hydrophobic surface, as indicated by a distinctly larger smaller contact angle
(theta, �). This further confirms the emulsification activity is endogenous to the mealworm
itself and indicates that the emulsifying agent lies within the molecular weight range of 30
– 100 kDa, which will facilitate the identification of the factor.
This analysis reveals a significant role of the mealworm itself in the plastic biodegra-
dation process. The absence of emulsifying agents in ex situ microbial cultures could help
explain the low rate of PS biodegradation relative to in situ conditions. In addition to
enhancing plastic biodegradation by the gut microbiome, emulsifying agents could be a
46 CHAPTER 3. ENHANCED EX SITU DEGRADATION
valuable tool for remediation of other hydrocarbons. Further research into identify and
characterize this emulsifying agent is needed to maximize and exploit its potential utility.
3.4.3 Enhanced ex situ microbial growth
The insights from the previous sections were then applied to enhance the ex situ PS-
degradation using the extracted mealworm gut microbiome. Serum bottles were inoculated
with PS-fed mealworm gut microbiome in carbon-free media with PS microplastics added
as the sole carbon source. Cultures were supplemented with di↵erent fractions, tested sep-
arately and in combination as follows: <30 kDa, 30 – 100 kDa, <30 + 30 – 100 kDa, and
>100 kDa. Supernatant was supplemented at the previously determined ideal dose (0.6%
v/v) and CO2 production was measured over 10 days. When the supernatant fractions
were added separately, both the <30 kDa and 30 – 100 kDa fractions stimulated similar
increases in CO2 production (p � 0.99), both of which caused a significantly higher increase
than the >100 kDa fraction (p < 0.01 relative to both <30 kDa and 30 – 100 kDa, Fig.
3a). These results suggest that supplementation with either microbial secreted factors in
the <30 kDa fraction (Fig. 3.2) or mealworm-produced emulsifying agent in the 30 – 100
kDa fraction (Fig. 3.3) increases ex situ microbial respiration on plastic. When combined,
the <30 kDa + 30 – 100 kDa fractions promoted the highest increase in CO2 production
(p < 0.01 relative to both <30, 30 – 100 kDa, Fig. 3.4a). The only fraction from antibiotic
treated supernatant that increased activity was 30 – 100 kDa, further confirming that the
smallest molecular weight fraction provides no added benefit in the absence of the gut mi-
crobiome. These results demonstrate that the contributions of both the mealworm and its
gut microbiome are necessary to achieve enhanced plastic biodegradation.
To explore the long-term e↵ect of these respiration-enhancing factors on plastic biodegra-
dation, a microbial enrichment was inoculated with PS-fed mealworm gut microbiome in
carbon-free media supplemented with PS film (as the carbon source) and PS gut super-
natant. This mixed community enrichment was cultured for several months until a stable
biofilm formed (Fig. B.3). The PS respiration activity of the enrichment was then compared
to freshly extracted PS-fed mealworm gut microbiome to determine whether the enrichment
conditions selected for more e�cient plastic biodegrading microbes. This was done using
serum bottles seeded with inoculum (either the microbial community from the enrichment
or the freshly extracted gut microbiome) in carbon-free media, supplemented with 0.6%
v/v PS-fed mealworm gut supernatant and either PS film or PS microplastics as a carbon
3.4. RESULTS AND DISCUSSION 47
source. Cultures were grown for 14 days. The microbial enrichment exhibited significantly
higher PS respiration activity (CO2 production) on both PS microplastics and PS film,
suggesting that the enrichment was selecting for more e�cient plastic degrading bacteria
than those found in the gut microbiome (Fig. 3.4b). This enhanced plastic biodegradation
activity was especially prominent when comparing the CO2 produced from respiration on
PS films; while the microbial enrichment produced slightly more CO2 on PS film than PS
microplastics, the gut microbiome produced significantly less CO2 on PS film (Fig. 3.4b).
This suggests that in addition to selecting for better PS-biodegrading bacteria, the con-
ditions of the microbial enrichment also selected for bacteria that thrive in biofilms, an
unsurprising result given that the microbial enrichment was cultivated with PS film and
formed a stable biofilm on its surface (Fig. B.3). These promising results highlight the
ability to extrapolate insights drawn from the mealworm gut environment (e.g., the addi-
tion of a gut supernatant supplement) to select for bacteria capable of enhanced plastic
biodegradation outside the mealworm.
To further understand the mealworm’s role(s) in PS biodegradation, supernatant from
the mixed community enrichment was subject to the same supernatant fractionation process
used for the mealworm gut supernatant. The enrichment supernatant fractions were then
assayed using the same serum bottle experiment described above (Fig. 3.4a). Unlike the
supernatant fractions from the PS-fed mealworm, only the smallest fraction (<30 kDa) from
the enrichment increased CO2 production. This provides additional confirmation that the
PS-degradation enhancing e↵ect of the 30 – 100 kDa supernatant fraction is due to factor(s)
secreted by the mealworm itself.
The e↵ects of PS degradation by the microbial enrichment were further assayed by mon-
itoring changes in functional groups indicative of oxidative attack and hydrophobicity of
PS films (via FTIR visualization and contact angle analysis), and mass loss. FTIR spectra
of the PS films incubated with the microbial enrichment revealed oxygen incorporation as
indicated by the appearance of peaks associated with R-OH stretch (3000–3500 cm-1) and
C-O stretching (1000–1300 cm-1), as well as C-H bending (700-750 cm-1) often associated
with monosubstituted benzene derivatives (Fig. 3.5a). Changes in the surface chemistry of
incubated PS films were further explored by measuring changes in contact angle of DI water
on control versus incubated PS films (Fig. 3.5b). These analyses revealed a significant dif-
ference between the surface hydrophobicity of the films (p < 0.001), with a marked increase
in surface wetting on the treated PS film. This is further evidence of changes in surface
48 CHAPTER 3. ENHANCED EX SITU DEGRADATION
chemistry of the PS film, including oxygen incorporation, which would facilitate increased
surface wetting by water. While the rate of plastic degradation observed (measured as the
percent of the initial PS mineralized to CO2) was still significantly slower than within the
mealworm gut (Fig. 3.5b), these results are an important first step towards higher rates
of plastic degradation outside the mealworm and suggest that further enhancements are
possible.
3.4.4 Identification of plastic degradation microbial community
Once the microbial enrichment formed a stable biofilm on the surface of the PS film, a
sample of the biofilm was collected, and streak-plated in order to isolate and identify strains
involved in plastic biodegradation. Sixteen individual representative colonies were randomly
selected for sequencing (”enrichment strains”). The same process was then repeated, and 24
individual representative colonies were randomly selected and grown overnight in carbon-
rich media. The cultures were then centrifuged, and the cultured bacteria transplanted
to carbon-free media with PS films, supplemented with PS gut supernatant at 0.6% v/v.
Cultures were monitored for biofilm development and changes in optical density as an
indication of growth and respiration on the PS film. After 14 days, media from each
isolate culture that showed signs of respiration on PS (16 total). To obtain isolated strains,
these cultures were plated, and representative colonies were picked for sequencing (“isolate
strains”).
Overall, eight unique bacterial species were isolated and identified (Fig. 3.6, Table
B.1). The identified species are predominantly aerobes or facultative anaerobes, supporting
previous findings that oxygen incorporation is critical for rapid plastic biodegradation.[18]
While the mixed enrichment and identified isolates included many of the same species,
they were not the same, suggesting that a di↵erent subset of species thrive in the mixed
enrichment than can survive alone on PS (Fig. 3.6). However, to fully understand this
shift, further information, such as that from next generation sequencing of the microbial
enrichment, is required.
Of the identified plastic-biodegrading strains, many are associated with the degradation
and bioremediation of hydrocarbons and polymeric substrates. In the mixed enrichment
(Fig. 3.6a), the most prevalent species was Citrobacter freundii, a bacterium known to
degrade long-chain polymers (e.g., tannic acid[94]), linear hydrocarbons (e.g., oil[77]), and
cyclic hydrocarbons (e.g., phenylenediamine,[131] 4-nitroaniline,[88] and pentachlorophenol[199]).
3.5. IMPLICATIONS 49
Further, Citrobacter sp. are significantly associated with gut microbiome in PS- and PE-fed
mealworms,[18] and several Citrobacter enzymes have been extracted and used for degrada-
tion of phenylenediamine including: 1,2-dioxygenase, dehydrogenase, alkaline phosphatase,
phenol hydroxylase, and acetate kinase.[131] These previously identified enzymes may also
be involved in PS biodegradation, suggesting possible directions for future research on the
enzymatic degradation of PS.
Of the identified isolates, the most prevalent strains are Serratia marcescens [120, 40, 2]
and Klebsiella aerogenes,[67, 153] both of which are associated with hydrocarbon degra-
dation and bioremediation. S. marscens, Klebsiella sp. (closely related to K. aerogenes),
and Pseudomonas aeruginosa (another identified isolate) were found in the gut micro-
biome of PS-degrading mealworms, but were incapable of PS degradation when cultured
in isolation.[177] This suggests that these strains rely upon mealworm-secreted factors to
enable PS biodegradation. P. aeruginosa is also known to degrade crude oil[41, 132] and
produce a rhamnolipid,[189] a biosurfactant that accelerates hydrocarbon degradation. In
addition, P. aeroginosa was recently isolated from the gut of PS-degrading superworms
(Zophobas atratus) and found capable of growth on PS alone.[89] Another identified iso-
late, Enterobacter asburiae, was able to degrade polyethylene after its isolation from the
gut microbiome of plastic-eating waxworms (Plodia interpunctella).[206] Stenotrophomonas
maltophilia, another identified species, is capable of cyclic hydrocarbon degradation,[31, 99]
and the rate of bioodegradation can be enhanced in the presence of surfactants, similar to
the results of this study.[15]
The results of this work suggest that bacterial strains already known for their ability
to degrade hydrocarbon xenobiotics are likely responsible for PS biodegradation. Further
investigation is required to optimize the conditions for biodegradation of PS and other
xenobiotics, and to elucidate the metabolic pathway(s) involved.
3.5 Implications
This work is the first to achieve ex situ cultivation of a mixed enrichment derived from
the mealworm gut microbiome for enhanced PS biodegradation. This was accomplished by
elucidating the respective roles of Tenebrio molitor and its gut microbiome. We demonstrate
a significant role for the insect in secreting an endogenous emulsifying agent, increasing the
bioavailability of PS, and enabling more rapid microbial attack. The gut microbiome was
50 CHAPTER 3. ENHANCED EX SITU DEGRADATION
also found to secrete factor(s) that enhance microbial respiration when PS is the sole carbon
source. Additionally, we identify eight unique bacterial species involved in PS-degradation,
many of which have previously been associated with the biodegradation of hydrocarbons and
other xenobiotics. Our results imply that naturally occurring components of the mealworm
gut – including those secreted by both the mealworm host and its gut microbiome – must
be present and work in concert with the microbiota themselves in order to achieve enhanced
plastic respiration and biodegradation. This work develops techniques for the ex situ growth,
investigations, and exploitations of plastic-degrading microorganism from the mealworm gut
microbiome, thereby providing guidance for future research and scale-up e↵orts.
3.6 Supporting Information
Appendix B contains figures including supernatant dose response curves, images from emul-
sification assays, and images of stable biofilm formed in the microbial enrichment (Figs. B.1
- B.3). In addition, a table with details on the sequences isolates and most similar strains
from BLAST is available (Table B.1).
52 CHAPTER 3. ENHANCED EX SITU DEGRADATION
Figure 3.2: E↵ects of mealworm gut supernatant on ex situ gut microbiome growth on PS.(a) Respiration activity of the gut microbiome in Biolog MT2 plates was measured usingtetrazolium violet redox dye as a colorimetric indicator at absorbance: 595 nm. Bacteriawere cultured in carbon-free media supplemented with PS microplastics (carbon source)and supernatant fractions (<30 kDa, 30 – 100 kDa) from each experimental condition.Supernatant condition is indicated by color with antibiotic treated supernatant indicatedby ab. (b) Final concentration of CO2 respired (final – initial percent CO2 in the headspaceof serum bottles) by bacterial cultured supplemented with di↵erent doses of PS supernatant.Statistical significance is calculated relative to the gut microbiome not supplemented withsupernatant is indicated by: ⇤ for p 0.05, ⇤ ⇤ for p 0.01, ⇤ ⇤ ⇤ for p 0.001; nostatistical significance indicated by ns.
3.7. FIGURES 53
60
70
80
90
100
Thet
a ($
)
PS Supernatant Bran Supernatant
hydr
ophi
lic
DI WaterPS Supernatant (PS Sup.)PS Sup. > 100 kDaPS Sup. 30 - 100 kDaPS Sup. < 30 kDaBran Supernatant (B Sup.)B Sup. > 100 kDaB Sup. 30 - 100 kDaB Sup. < 30 kDa
DI Water PS Supernatant PS Sup. 30 - 100 kDaPS Sup. >100kDa PS Sup. <30 kDa
60
70
80
90
100
Thet
a ($
)
PS + antibiotic Supernatant
Bran + antibioticSupernatant
Molecular Weight
(a) (b)
(c)
*** *** ****** *** *** *** ***
ns ns ns ns
Figure 3.3: Hydrophobicity of mealworm gut supernatant. Contact angle analysis on thesupernatant fractions from each of the mealworm diets, colored by mealworm diet for eachsupernatant and ordered by molecular weight fraction (<30 kDa, 30 – 100 kDa, >100 kDa,size gradient indicate below), legend on the right. DI water was used as a negative control.(a) Contact angle (� C) of the supernatant fractions from the PS and bran fed diets. (b)Contact angle (� C) of the supernatant fractions from PS and bran + antibiotic fed diets.(c) Representative photos of DI water, whole PS supernatant, and PS supernatant fractionson PS film. Statistical significance relative to the intermediate molecular weight fraction(30 – 100 kDa) fraction indicated by: ⇤ for p 0.05, ⇤ ⇤ for p 0.01, ⇤ ⇤ ⇤ for p 0.001;no statistical significance indicated by ns.
54 CHAPTER 3. ENHANCED EX SITU DEGRADATION
PS Sup. < 30PS Sup. 30 - 100
PS Sup. <30 + 30 - 100
PS Sup. > 100
PS + ab Sup. < 30PS + ab Sup. 30 - 100
PS + ab Sup. <30 + 30 - 100
PS + ab Sup. > 100
Enrich. Sup. < 30Enrich. Sup. 30 - 100
Enrich. Sup. <30 + 30 - 100
Enrich. Sup. > 100
Molecular Weight
0.0
0.5
1.0
1.5
2.0
2.5
Fina
l Cha
nge
in C
O2 (
%) **
**ns
**
ns ns
* *
5 10 15
-2
-1
0
1
2
3
4
5
6
Days
Perc
ent C
O2 Gut Microbiome Control (no PS)
Gut Microbiome + PS MicroplasticGut Microbiome + PS Film
Enrichment Control (no PS)
Enrichment + PS MicroplasticEnrichment + PS Film
(a)
(b)
Figure 3.4: E↵ect of PS supernatant on microbial respiration. Microbial respiration onPS supplemented with supernatant. (a) Final percent change in CO2 produced (measuredin the headspace of serum bottles) by the gut microbiome supplemented with di↵erentsupernatant fractions. Supernatant fractions were tested separately and in combinationto assess the impact on respiration (final – initial percent CO2 in the headspace of serumbottles), colored by supernatant condition (PS in green, PS + ab in blue, enrichment inpurple) and ordered by molecular weight fraction (size gradient indicated below) legendon the right. (b) PS-degradation (represented by percent CO2 produced) of extracted gutmicrobiome (green) and cultured enrichment (purple) fed with PS microplastics (squares)or film (triangles), relative to control (no PS, circles). (c) Percent of initial PS mineralizedto CO2 over 14 days by experimental conditions described in b. Statistical significanceindicated by: ⇤ for p 0.05, ⇤ ⇤ for p 0.01; no statistical significance indicated by ns.
3.7. FIGURES 55
0
1
2
3
4
5
6
7
Perc
ent P
S M
iner
aliz
ed
Gut Microbiome + PS MicroplasticGut Microbiome + PS Film
Enrichment + PS MicroplasticEnrichment + PS Film
500100015002000250030003500400050
60
70
80
90
100
Wavenumber (cm-1)
% T
rans
mitt
ance
Enrichment PS FilmEnrichment PS FilmControl PS Film
OHRstretch
C Ostretch
out-of-planebending
C H
Control PSFilm
Treated PSFilm
60
70
80
90
100
Thet
a (°
)
***
(a)
(b) (c)
Figure 3.5: Characterization of PS degradation by gut microbiome and cultured microbialenrichment through changes in polymer surface chemistry and mass loss. (a) FTIR spectra(in percent transmittance) of PS films after incubation with microbial enrichment (purple)and a microbial isolate (green) relative to control PS film, annotations show functionalgroups associated with key peaks based on wavenumber. (b) Contact angle analysis ofDI water on control PS film and PS film after incubation with the microbial enrichment.(c) Percent of initial PS mineralized to CO2 over 14 days in serum bottle experiments,colored by condition: extracted gut microbiome (green) and cultured enrichment (purple).Statistical significance calculated relative to control PS film indicated by: ⇤ ⇤ ⇤ for p 0.001.
56 CHAPTER 3. ENHANCED EX SITU DEGRADATION
n = 16 n = 16
Citrobacter freundiiKlebsiella aerogenesSerratia marcescensStenotrophomonas maltophilia
Pseudomonas aeruginosaEnterococcus faecalisEnterobacter asburiae
Bacillus thuringiensis
(a) (b)
Figure 3.6: Relative abundance of PS-degrading bacterial species identified by 16S rRNAsequencing of individually isolated colonies from (a) the mixed microbial enrichment (16representative colonies) and (b) pure cultured isolates capable of PS-degradation (16 total).Additional data on species and sequence information is available in Table B.1.
Chapter 4
The fate of
hexabromocyclododecane (HBCD),
a common flame retardant, in
polystyrene-degrading mealworms:
elevated HBCD levels in egested
polymer but no bioaccumulation
The results of this chapter were originally published in Environmental Science & Technology
in 2020, doi: 10.1021/acs.est.9b06501, reprinted here with permission, copywrite American
Chemical Society, 2020. Sahar H. El Abbadi and Uwakmfon A. Ibekwe helped design and
perform laboratory work with L. vannamei. Dr. Yeo-Myoung Cho assisted with develop-
ment of analytic methods. Dr. Wei-Min Wu contributed to the design of the study and
provided comments to improve the manuscript.
57
58 CHAPTER 4. FATE OF HBCD
4.1 Abstract
As awareness of the ubiquity and magnitude of plastic pollution has increased, so has interest
in the long-term fate of plastics. To date, however, the fate of potentially toxic plastic
additives has received comparatively little attention. In this study, we investigated the fate
of the flame retardant hexabromocyclododecane (HBCD) in polystyrene (PS)-degrading
mealworms and in mealworm-fed shrimp. Most of the commercial HBCD consumed by the
mealworms was egested in frass within 24 hours (1-log removal) with nearly a 3-log removal
after 48 hours. In mealworms fed PS containing high HBCD levels, only 0.27 ± 0.10%, of the
ingested HBCD remained in the mealworm body tissue. This value did not increase over the
course of the experiment, indicating little or no bioaccumulation. Additionally, no evidence
of higher trophic level bioaccumulation or toxicity was observed when L. vannamei (Pacific
whiteleg shrimp) were fed mealworm biomass grown with PS containing HBCD. Di↵erences
in shrimp survival were attributable to the fraction of mealworm biomass incorporated into
the diet, not HBCD. We conclude that the environmental e↵ects of PS ingestion need further
evaluation as the generation of smaller, more contaminated particles is possible, and may
contribute to toxicity at nanoscale.
Figure 4.1: Summary Figure.
4.2. INTRODUCTION 59
4.2 Introduction
Plastic waste is a widespread environmental pollutant and a growing waste management
challenge. Polystyrene (PS), one of the five most common thermoplastics, is typically used
for packaging and insulation, and is among the least sustainable plastics.[3, 66] PS foams are
low density and bulky, making them di�cult and costly to transport and recycle.[66] Because
recycling centers typically do not accept PS wastes, they are generally landfilled or escape
into the environment where they persist and can accumulate due to their recalcitrance.[66]
Chemicals added to improve manufacturing properties (e.g., plasticizers or stabilizers)
or decrease flammability, for example in insulation in the case of PS, pose an additional
sustainability concern.[3, 7] Because these additives are not covalently bonded to the poly-
mer, they could potentially partition into fatty tissues and bioaccumulate in food chains or
the environment.[7, 11] For PS, the most common flame retardant is commercial hexabro-
mocyclododecane (HBCD).[11, 157] HBCD is hydrophobic, lipophilic, persistent in the en-
vironment, and has been known to bioaccumulate in marine organisms.[11, 36, 80, 215] It
is also an endocrine disruptor and potentially neurotoxic.[11, 157, 36, 129, 156] Due to its
toxic nature, HBCD has been the subject of regulatory action in the European Union (to
be phased-out and eventually banned)[174] and in the United States, HBCD is currently
the subject of a risk evaluation by the EPA.[176] Solutions are needed to address HBCD,
and other chemical additives, in PS waste.[16]
Biodegradation is of increasing interest for management of PS and other plastic wastes.
While researchers have isolated many plastic-degrading microorganisms (e.g., fungi and bac-
teria), rates of biodegradation are typically low.[158, 198, 161, 65] For plastic materials, one
rate-limiting factor is access to surface area.[93] Insects that chew natural polymers, such as
lignin and wax, convert macro-scale fragments into micron-scale particles, increasing spe-
cific surface area accessible to attack by secreted enzymes.[127] Within the insect gut (e.g.,
Tenebrio molitor,[18, 210, 212, 207] Plodia interpunctella,[206] and Galleria mellonella[91])
secreted enzymes and ingested particles are concentrated and co-located, enhancing rates
of biodegradation. Of the insects tested to date, mealworms (T. molitor) are the most
well-studied and can rapidly eat and degrade PS and polyethylene waste, with half-lives for
plastic conversion to CO2 on the order of 15 – 20 hr.[18, 210, 212, 207] For chemical fate and
e↵ect studies, mealworms are an attractive insect model: they are readily cultivated; have a
rapid life cycle; and are prey for other animals, enabling assessment of food chain impacts.
60 CHAPTER 4. FATE OF HBCD
In addition to their plastic-degrading ability, mealworms are farmed as a valuable protein-
rich[84] feed supplement for birds and reptiles as well aquaculture (e.g., shrimp, prawns,
sea bass).[76, 10, 130, 64, 32, 58] Further, mealworms are being considered as a more sus-
tainable, lower greenhouse gas emitting source of edible protein for humans.[128, 159, 119]
Conversion of plastic wastes into a valuable feed-supplement is appealing, but the fate
of plastic additives, such as HBCD, must first be understood. If HBCD accumulates in the
tissues of mealworms, there is a risk of food chain contamination and bioaccumulation. On
the other hand, if HBCD passes through the mealworm, there is risk of concentration within
the remaining undegraded PS particles in the frass, creating a need for further remediation
of these particles, such as frass pyrolysis.[208, 209]
In this study, we investigated the fate of HBCD within PS-degrading mealworms using
a mass balance and body burden analysis to assess toxicity and bioaccumulation. We also
evaluated HBCD bioaccumulation at a secondary trophic level by feeding PS-fed mealworm
biomass to a model aquaculture organism, L. vannamei (Pacific whiteleg shrimp).
4.3. MATERIALS AND METHODS 61
4.3 Materials and Methods
4.3.1 Plastic test materials
To determine the fate of HBCD in PS-degrading mealworms, two commercially available
expanded polystyrene foam packaging materials were acquired from local vendors. The
first PS foam was a commercial insulation material with a high concentration of HBCD,
⇠0.25 % [w/w] (2385.5 ± 353.0 µg HBCD/g PS) and was utilized as the PS material
high in HBCD (“PS-H”).[145] The second expanded PS foam was a commercial packing
material that contained only trace amounts of HBCD, ⇠ 8.0 x 10-5 % [w/w] (0.83 ± 0.20
µg HBCD/g PS) and was utilized as the PS material low in HBCD (“PS-L”). Table C.1
includes additional descriptive characteristics (e.g., molecular weights, density) of the two
PS foams used in this study, demonstrating that the concentration of HBCD is the main
di↵erence between them. The PS foam blocks were cut into irregular 2 – 3 cm cubes and
cleaned with a stream of air to remove any fine residues prior to being weighed and utilized
in experiments following established methods.[18, 210, 212, 207]
4.3.2 Mealworm growth conditions
Mealworms, larvae of T. molitor Linnaeus, (average weight 75-85 mg/worm) were purchased
online from Rainbow Mealworms (Compton, CA) and shipped overnight to the laboratories
at Stanford University. Prior to arrival, the mealworms were fed bran; after arrival, they
were subject to a 48-hour depuration (starvation) period before initiating experimental
diets.[18] Natural wheat bran used as a control diet[18, 210, 212, 207] was purchased from
Exotic Nutrition (Newport News, VA).
Five experimental diets were compared, in duplicate: PS-H, PS-H + bran (1:1 [w/w]),
PS-L, PS-L + bran (1:1 [w/w]), as well as a bran only control.[18, 210, 212, 207] Each repli-
cate (in 475 mL food grade polypropylene containers) started with 200 randomly selected
mealworms along with their respective feeds (Fig. C.1a). Plastic-fed containers began with
1.80 g of polystyrene cut into 2 – 3 cm cubes following established methods.[18] Containers
that received bran started with 1.80 g of bran, with bran added every 3 days to main-
tain a 1:1 ratio [w/w] of plastic to bran, including the bran-fed control.[18, 210, 212, 207]
Containers were stored in incubators maintained at 25 �C and 70% humidity.[18, 212]
Every 3 days, mealworm frass (excrement) in the containers was collected and weighed
62 CHAPTER 4. FATE OF HBCD
and mealworm survival was evaluated for the duration of the 32-day experiment. Once
a week, the mealworms were cleaned with a stream of air to remove any residual plastic
fragments and transferred to a clean container to collect frass for HBCD analysis. After
24 hours, the mealworms were returned to their original container, and the frass samples
were weighed and stored at -20 �C. In addition, 10 mealworms from each container were
sacrificed and dissected (gut track and non-gut tissues) as representative weekly biomass
samples, which were then freeze-dried for > 72 hr prior to being stored for future analysis
(Fig. C.1a, SI Method C.1.2).
To prepare su�cient mealworm biomass for aquaculture feeding experiments, 500 meal-
worms (from the same order) were raised in larger “bulk-fed” food grade polypropylene
containers (volume 780 mL) on either PS-H, PS-L, or bran diets for 32 days following the
conditions described above (Fig. C.1b). At the end of 32 days, the mealworms were sac-
rificed and the biomass (all the mealworm tissues) were freeze-dried for > 72 hr prior to
being incorporated in aquaculture feed (SI Method C.1.3).
Depuration tests were conducted to investigate accumulation of HBCD in mealworm
tissues; full details are described in the Supporting Information (SI Method C.1.4). Briefly,
mealworms were fed either PS-H or PS-L for 72 hr and were then subject to depuration for 48
hr. Ten mealworms were collected at 0, 24, and 48 hr of depuration, in triplicate, for HBCD
analysis. The expected intake for each PS diet was calculated (SI Method C.1.4). Bran was
spiked with HBCD to achieve comparable expected intake as PS-H and PS-L, referred to
as Bran-H and Bran-L, respectively, to assess the e↵ects of PS on the bioaccumulation or
egestion of HBCD.
4.3.3 HBCD quantification
Full details of the HBCD analysis are described in the Supporting Information (SI Method
C.1.2, Fig. C.3). Briefly, analytical methods to quantify total HBCD were developed
following modified EPA methods using extraction via ultrasonication (sample extraction:
3350B[180]; sample cleanup: 3630C[178]) on lyophilized biomass or PS samples. Quan-
tification of total HBCD was performed using an Agilent gas chromatograph[188, 73, 102]
(model 6890) equipped with a micro electron capture detector (GC-µECD) following modi-
fied EPA methods 8082[182] and 8081.[181] Surrogate standards (a mixture of PCBs, BZ#
14, 65, 166; 20 µL of 400 µg/L) were used to assess recovery e�ciencies (Fig. C.6, accepted
range: 40 – 100%) and internal standards (a mixture of PCBs, BZ# 30, 204; 10 µL of
4.3. MATERIALS AND METHODS 63
400 µg/L) were utilized for quantification.[215, 102] Standards of the three main stereoiso-
mers were tested independently and as a mixture. Retention times and response factors
of the three stereoisomers were statistically indistinguishable (Fig. C.8), justifying the use
of one HBCD signal to quantify total HBCD.[73, 102] Method detection limit (MDL) for
mealworm biomass samples was 0.20 ng HBCD/g dry weight and for shrimp biomass the
MDL was 1.00 ng HBCD/g dry weight. Our limit of detection (LOD) and limit of quanti-
tation (LOQ) were determined to be 40 pg and 1000 pg, respectively, based on established
definitions.[5, 116] To increase the robustness of our analysis, we do not utilize any values
below the MDL for statistical quantification, but we plot all values above our LOD.
4.3.4 Aquaculture experimental conditions
Postlarvae of L. vannamei were used as a model aquaculture organism. L. vannamei were
reared for two experimental tests. In the first, postlarvae were placed in individual contain-
ers to assess toxicity of experimental feeds through daily survival monitoring. The second
test evaluated total HBCB bioaccumulation. Postlarvae were grown in larger containers
with the same experimental diets to enable collection of su�cient biomass for HBCD analy-
sis (Fig. C.2). The experimental diets included bran-fed mealworm biomass (MWB), PS-L
fed MWB, PS-H fed MWB; each type of MWB was integrated into the shrimp diets at 3 dif-
ferent rates: 10%, 50%, and 100% w/w (for a total of 9 experimental diets). Control shrimp
were fed commercially available feed (FRiPPAK RW+500, INVE Aquaculture, Deception
Bay, Queensland, AUS). Detailed experimental conditions used to assess bioaccumulation
studies in aquaculture are available in the Supporting Information (SI Method C.1.3, Fig.
C.2).
4.3.5 Statistical analysis
Statistical analyses were performed in Prism (GraphPad Software, version 8.1.1). To as-
sess di↵erences in plastic consumption and pupation rates, one-way ANOVAs were per-
formed, followed by pairwise comparisons using Student’s t-test with Bonferroni multiple
test correction to assess di↵erences between diets. Di↵erences in survival was assayed using
Kaplan-Meier survival analysis. All p-values are adjusted p-values and all error values are
average ± standard deviation.
64 CHAPTER 4. FATE OF HBCD
4.4 Results and Discussion
4.4.1 E↵ects of HBCD on mealworm survival and plastic consumption
Mealworm survival rate was una↵ected by amount of total HBCD consumed in PS over the
course of the experiment (Fig. 4.2a,b). There was no significant di↵erence in final survival
curves among the experimental diets nor the control diet based on Kaplan-Meier survival
analysis (Fig. 4.2a). However, a pair-wise analysis of the final survival by diet found that
mealworms fed PS-L + bran had a significantly higher survival than mealworms fed PS-L
alone (p = 0.02). No other significant di↵erences in survival based on the inclusion of bran
in the diet were found (PS-H vs. PS-H + bran, PS-H vs. bran, PS-L vs. bran). Previous
studies have reported di↵erences in survival based on inclusion of bran.[210] Further research
is needed to determine why di↵erent types of PS may result in di↵erential survival outcomes
among mealworms when co-fed with bran. Importantly, a linear regression analysis shows
that total HBCD exposure from each diet was not a significant determinant of final survival
(Figure 1b, R2 = 0.13).
Mealworms consumed a similar amount of either type of PS, showing that higher con-
centration of HBCD in the PS did not a↵ect mealworm consumption patterns (Fig. 4.2c).
Mealworms fed plastic plus bran consumed significantly more plastic than those fed PS
alone, a trend established in previous studies[18, 210] (Fig. 4.2c). The increase in PS con-
sumption in bran-fed mealworms was not as large as previously reported,[18, 207] perhaps
due to feedstock di↵erences. Overall, mealworm plastic consumption rates in all experimen-
tal diets are comparable to those of previous studies.[18, 210, 207]
Mealworm pupation is a hormonally controlled process[150, 151] that is known to be
impacted by endocrine disrupting chemicals.[44, 162] Therefore, if HBCD (an endocrine
disrupting compound[157, 43]) were bioaccumulating in mealworm tissues, we would hy-
pothesize observable di↵erences in the rates of pupation across experimental diets on the
basis of HCBD exposure. However, our results indicate that the pupation rate was not
a↵ected by HBCD exposure (Fig. 4.2d). The major di↵erence in the rate of pupation
appeared to be driven by the inclusion of bran in the diet, rather than HBCD. Both PS
diets that included bran (PS-H + bran, PS-L + bran), had a comparable pupation rate as
the control group (Fig. 4.2d). This finding was further explored with a multiple regres-
sion model to assess the e↵ects of bran, plastic, and HBCD consumption on pupation rates
4.4. RESULTS AND DISCUSSION 65
(Fig. C.4, model R2 = 0.95). Bran consumption was found to be a significant predictor of
pupation rate (p < 0.0001) while HBCD consumption was not (p > 0.05). This suggests
that di↵ering rates of pupation are driven by the added nutritional benefits from bran in
the diet rather than any e↵ect from HBCD.
In summary, these results demonstrate that HBCD in commercial PS was not toxic to
mealworms and did not a↵ect mealworm survival and pupation behavior. Taken together,
these results suggest that total HBCD does not bioaccumulate within mealworm tissue.
This finding was further explored through analysis of mealworm tissue.
4.4.2 Exponential removal of HBCD from mealworm biomass
Depuration tests post feeding of PS were conducted to investigate accumulation of HBCD
in mealworm tissues over time periods that were comparable to the retention time of PS in
the mealworm gut (15 – 20 hr).[18] This analysis revealed that HBCD was rapidly excreted
from the mealworm body (whole body tissues, including the gut track) when subject to
depuration (i.e., starvation) (Fig. 4.3). The HBCD concentration from both types of PS
(PS-H and PS-L) decreased significantly over 48 hr, in good agreement with a one-phase
exponential decay model (Fig. 4.3, R2 = 0.96 for PS-H, 0.93 for PS-L). From the fitted
decay models, the half-lives for HBCD in the mealworm gut was 5.3 and 7.6 hr for S-H and
PS-L, respectively. The decay rate constant (k) for PS-H is 0.13 hr-1 and for PS-L is 0.09
hr-1. This suggests that HBCD from both types of plastic are subject to similar processes
within the gut and are removed at comparable rates. After 24-hours of starvation, there was
a 1-log reduction in the HBCD body burden (ng HBCD/g dry weight of mealworm tissue)
from both types of plastic (Fig. 4.3). After 48-hours of starvation, tissue from mealworms
fed either type of PS experienced a nearly 3-log reduction in HBCD body burden (Fig. 4.3).
There was not a significant di↵erence in the log-reduction of HBCD between the PS-H and
PS-L diets at either time point (Fig. C.9).
To assess the impact of the presence of polystyrene on the egestion of HBCD, mealworms
were fed bran directly spiked with HBCD at a comparable expected intake of HBCD as
PS-H and PS-L referred to as Bran-H and Bran-L, respectively (SI Method C.1.4). The
concentration of HBCD in mealworm tissues were measured over the same depuration period
as mealworms fed PS (at 0, 24, and 48 hr) and were then fit to a one-phase decay model
(Fig. 4.3, R2 = 0.88 for Bran-H, 0.94 for Bran-L). The decay rate constants (k = 0.05
hr-1 for Bran-H and 0.04 hr-1 for Bran-L) and half-lives (13.7 hr for Bran-H and 16.0 hr
66 CHAPTER 4. FATE OF HBCD
for Bran-L), indicate a significantly slower egestion of HBCD than mealworms fed PS. The
log-reduction of HBCD from both Bran-H and Bran-L diets was significantly lower than
the reduction of HBCD from either PS diet (Fig. C.9). These findings suggest that the
presence of PS within the gut may play a significant role in concentrating the HBCD in the
frass, leading to its egestion.
These findings suggest that the majority of the HBCD is transient and that when meal-
worms are subject to depuration periods longer than the gut retention time, HBCD passes
through the gut and is egested when PS is present. The rates of HBCD egestion are not
significantly di↵erent between PS-H and PS-L, suggesting that HBCD behaves similarly in
either PS diet. Previous studies of mealworm PS-degradation have demonstrated that a
fraction of the PS is egested in the frass as partially degraded polymer.[18, 212, 207] Given
the lipophilic nature of HBCD[157] and the rapid egestion of HBCD in mealworm tissues,
this could suggest that the HBCD is predominantly partitioning to and thus concentrating
within the egested PS polymer residues. The increased half-life of HBCD delivered without
PS (spiked into bran) further supports this hypothesis. Taken together, our findings suggest
that the presence of depolymerizing PS plays an important role in concentrating HBCD and
removing it from the mealworm; however, further work is needed to confirm the role of PS
in the egestion of HBCD.
4.4.3 Fate of HBCD in mealworm biomass over time
To further assess whether any of the ingested HBCD bioaccumulates in the mealworm
tissues, a mass balance was conducted to monitor the fate of HBCD in various mealworm
tissues over time. The amount of HBCD that entered the mealworm (based on consumption
of PS), the amount of HBCD that left the mealworm system (measured in the frass), and
the amount of HBCD remaining in mealworm (gut and non-gut tissues) was determined
on a weekly basis. This approach enabled the tracking of HBCD within the mealworms
over the course of the 32-day experiment to assess bioaccumulation (Fig. C.7). The results
indicate that the majority of the HBCD consumed by mealworms, fed either type of PS, is
egested in their frass (Fig. 4.4a,b). On average, of the amount of HBCD consumed from PS
on a weekly basis, 93.20 ± 1.45% was egested in PS-H fed-mealworms and 92.56 ± 4.17%
was egested from PS-L fed mealworms. This trend was also observed in PS diets co-fed
with bran, where the total HBCD consumption was higher than those fed PS alone (Fig.
C.5a,b). This further supports evidence that HBCD is rapidly excreted from mealworms
4.4. RESULTS AND DISCUSSION 67
(Fig. 4.3). Moreover, while total consumption of HBCD varied over the course of the
experiment (as PS consumption by the mealworms varied), the HBCD recovered in frass
remained consistently high.
The weekly HBCD body burden analysis, based on 10 randomly selected representative
mealworms pooled together from each container, showed that little HBCD remained in the
mealworm tissues (Fig. 4.4c,d). Based on total PS weekly consumption and number of
mealworms per container, the expected weekly intake of HBCD (EWI, normalized to 10
mealworms) was calculated and compared to the amount of HBCD in mealworm tissues.
For mealworms fed PS-H, on average only 0.29 ± 0.11% of the EWI was found in the
mealworm gut (Fig. 4.4c). The representative mealworms were first subjected to a 24-hour
depuration, which from analysis in Fig. 4.3 suggests enables ⇠ 90% removal of transient
HBCD, explaining why trace amounts of HBCD may still have been detected within the
gut track. For the same mealworms fed PS-H, on average only 0.27 ± 0.10% of the EWI, or
25.6 ± 8.7 ng HBCD g-1 dry weight, was found in the non-gut tissues of the mealworms; this
amount remained consistently low throughout the experiment (Fig. 4.4c). For mealworms
fed PS-L, the HBCD concentration of the majority of body tissue samples were below
the method detection limit (MDL, 0.2 ng HBCD/g dry weight) and thus were not used
for quantification (plotted in Fig. 4.4d). The HBCD detected in the gut tissues is elevated
compared to the HBCD in the non-gut tissues, which again, was likely due to the limited (⇠90%) removal of transient HBCD during the 24-hour depuration period. For mealworms fed
either type of PS, the levels of HBCD in the non-gut tissue remained stable over the course
of the experiment, suggesting that HBCD was not bioaccumulating, as bioaccumulation
would likely have resulted in an increase in HBCD concentration in non-gut tissues over
time.
Similar trends were observed in the PS plus bran co-fed diets (Fig. C.5). Previous
studies have established that mealworms co-fed bran gain more weight over the course of
the experiment than those fed PS alone.[18, 207] Despite the increased growth and metabolic
activity of mealworms fed these diets, mealworm tissues still only contained trace levels of
HBCD (0.24 ± 0.04% and 0.15 ± 0.12% of EWI for PH-H + bran remains in the gut and
non-gut tissues, respectively). As observed in the PS-L group, the HBCD concentration in
the tissues of mealworms fed PS-L plus bran were below the MDL, suggesting little or no
bioaccumulation. This also suggests that bioaccumulation of HBCD was not a↵ected by an
increase in metabolic activities.
68 CHAPTER 4. FATE OF HBCD
Overall, the rapid excretion of HBCD from the gut and the consistently low body burden
analysis in all diets over the duration of the experiment suggest that HBCD is not bioaccu-
mulating in mealworm tissues. The mass balance instead demonstrates that total HBCD is
concentrating in the frass egested by the mealworms. Further research is needed to better
understand the mechanism driving rapid egestion of HBCD and to assess the environmental
impacts of HBCD within the smaller, more concentrated particles in the frass.
4.4.4 Lack of HBCD bioaccumulation in secondary trophic level
Mealworm biomass represents a valuable supplemental protein source in many agricultural
and aquaculture feeds.[76, 10, 130, 64, 32, 58] Therefore, we investigated the toxicity of
HBCD-exposed mealworm biomass (MWB) on the growth and survival of a model aqua-
culture organism, Pacific whiteleg shrimp (L. vannamei). Further, we investigated whether
HBCD from MWB was bioaccumulating through a body burden analysis of the shrimp
biomass. Mealworm biomass was incorporated into experimental shrimp diets both at a
realistic levels (10%)[76, 64, 136] and at higher level to assess the upper bound for HBCD
bioaccumulation and toxicity.
Our results from the toxicity experiments showed an increase in mortality with increasing
incorporation of MWB (Fig. 4.5a). The increase in mortality was observed for MWB from
mealworms fed PS-H as well as mealworms fed PS-L and bran-fed mealworms (Fig. 4.5a).
This suggests that changes in shrimp survival are driven by total amount of mealworm
biomass included in the diet, not by HBCD. The amount of MWB included in the shrimp-
feed, regardless of the diet of the mealworms, explained > 70% of the di↵erence in survival
(Fig. 4.5c, R2 = 0.73), with a greater inclusion of MWB leading to an increase in mortality.
This suggests that MWB of any type (bran, PS-H, or PS-L) a↵ects mortality at higher
inclusion rates, likely due to lack of nutrition, rather than presence of HBCD. Shrimp
mortality in this study was higher than has been previously observed when supplementing
L. vannamei diet with MWB.[130] Unlike previous work, we studied postlarvae, which are
more sensitive than adult shrimp,[218] likely explaining the higher mortality rate. Increases
in weight in the L. vannamei over the course of the experiment also appear to be driven by
percent of MWB incorporated in the diet rather than HBCD exposure (Fig. 4.5b).
To further confirm that total HBCD was not bioaccumulating in the shrimp, body
burden analysis was conducted on shrimp fed the same experimental diets, excluding the
high mortality 100% MWB diets, for two weeks (Fig. C.2b). The HBCD concentration
4.4. RESULTS AND DISCUSSION 69
in all shrimp biomass including those fed PS-L and PS-H MWB were below the MDL and
not significantly di↵erent than zero. Moreover, the concentration of HBCD in the shrimp
biomass was una↵ected by the experimental diet (bran-fed, PS-H fed, or PS-L fed MWB).
Taken together, these results suggest no significant bioaccumulation of HBCD in the shrimp
fed mealworm biomass. While the starting concentration of HBCD in the shrimp feed was
likely relatively low (given the 24 hr depuration before collection of MWB), this case-study
demonstrates that that inclusion of PS-fed mealworm biomass under realistic aquaculture
growth conditions does not lead to the bioaccumulation of total HBCD.
70 CHAPTER 4. FATE OF HBCD
4.5 Implications
This is the first study to assess the fate of chemical additives in a plastic biodegradation
system. This is important because chemical additives, such as HBCD, can have significant
environmental and health impacts. We demonstrated that total HBCD does not bioac-
cumulate in PS-degrading mealworms, but is instead egested in the frass where it likely
concentrated in the partially degraded PS. This study did not investigate the fate of in-
dividual stereoisomers of HBCD, such an analysis would not change the conclusions of
this study. Nevertheless, future research should assess whether the distribution of isomers
egested in the frass are di↵erent than those in the initial PS.[168]
This study serves as a proof-of-concept for deriving valuable biomass from plastic waste.
Through the egestion of HBCD, the proteinaceous mealworm biomass is preserved as a
potential resource, which in this study we demonstrated could be used as an aquaculture
feed supplement without leading to bioaccumulation at a higher trophic level. However,
only one chemical additive for one type of plastic was investigated. Other common chemical
additives (e.g., plasticizers, stabilizers, pigments, other types of flame retardants)[3, 7] have
variable chemical properties (e.g., hydrophobicity), which will result in a di↵erent fate within
plastic-degrading mealworms. This study lays the foundation for additional investigations
into the fate of plastic additives within plastic degrading systems. Future work should focus
on whether these findings are generalizable to other plastic additives and in other systems
that degrade plastic.
This research shows that in working to address the issue of plastic pollution, it is im-
portant to avoid creating a new concern as residual plastic particles become smaller and
smaller, increasingly concentrating hydrophobic contaminants in the particles. Future re-
search should focus on the environmental impacts of such particles. Further, this research
demonstrates the need for biodegradable plastic replacement materials and green chemistry
to ensure that future materials and additives are non-bioaccumulative and non-toxic.
4.6. SUPPORTING INFORMATION 71
4.6 Supporting Information
Appendix C contains detailed methods on HBCD chemical analysis and quality assurance
measures, mealworm and aquaculture growth conditions, and sample preparation informa-
tion as well as Table C.1 and supporting Figs. C.1 – C.9.
4.7. FIGURES 73
0 10 20 300
50
80
90
100
Days
Mea
lwor
m S
urvi
val (
%)
ns
0 10 20 300
50
100
150
Days
Num
ber o
f Pup
ae
BranPS-HPS-H + BranPS-LPS-L + Bran
ns
ns
✱✱
03×102
6×1029×102
1.2×106
1.5×106
1.8×10680
85
90
95
HBCD Exposure (ng)
Mea
lwor
m S
urvi
val (
%)
Bran OnlyPS-H OnlyPS-H + Bran (1:1)PS-L OnlyPS-L + Bran (1:1)Linear Regression,R2 = 0.13
PS-H
PS-H + Bran PS-L
PS-L + Bran0.0
0.2
0.4
0.6
0.8
1.0
Mas
s Pl
astic
Los
s (g
)
✱✱
✱
(a) (b)
(c) (d)
Figure 4.2: Survival rate and HBCD consumption by T. molitor. (a) Survival rate of meal-worms over 32-day experiment, significance analyzed using Kaplan-Meier survival analysis.(b) Scatter plot and linear regression (black line) with 95% confidence interval (grey lines),of final mealworm survival versus HBCD exposure, by diet. HBCD exposure was calculatedfor each experimental container as total plastic consumed over the course of the experiment[g] ⇥ the concentration of HBCD in the plastic [ng/g]. (c) Plastic mass loss [g] at the end ofthe experiment, used in the HBCD exposure calculation above, by diet. (d) Total numberof larvae that pupated over the course of the experiment by diet. All values represent meanSD, n = 2. Significance (one-way ANOVA, Bonferroni multiple test correction, for all testsnot already described) p 0.05 indicated by ⇤, p 0.005 indicated by ⇤ ⇤, no statisticalsignificance indicated by ns.
74 CHAPTER 4. FATE OF HBCD
0 10 20 30 40-2000
0
2000
4000
6000
Bod
y B
urde
n, H
igh
(ng
HB
CD
/ g dw
)
Hours
PS-H
Bran-H
PS-H decay model R2 = 0.96
Bran-Hdecay modelR2 = 0.88
expected intake
MDL
0 10 20 30 40-5
0
5
10B
ody
Bur
den,
Low
(n
g H
BC
D /
g dw)
Hours
MDL
PS-L
Bran-L
PS-L decay modelR2 = 0.93
Bran-Ldecay modelR2 = 0.94
expected intake
(a) (b)
Figure 4.3: Reduction in T. molitor whole-body burden of HBCD with starvation. Bodyburden [ng HBCD/g dry weight] over time (points) plotted with one-phase exponentialdecay model (solid lines) and 95% confidence interval (dashed lines) (a) for PS-H and forcontrol bran spiked with HBCD at a comparable concentration (b) for PS-L and for controlbran spiked with HBCD at a comparable concentration. From the models, the half-lives forHBCD in the mealworm gut are 5.3 and 7.6 hr for PS-H and PS-L. The half-lives for HBCDspiked directly into control bran are 14 hr and 16 hr for Bran-H and Bran-L, respectively.The rate constant (k) is 0.13 hr-1 for PS-H, 0.09 hr-1 for PS-L, 0.05 hr-1 for Bran-H and0.04 hr-1 for Bran-L. All values represent mean SD, n = 3.
4.7. FIGURES 75
Week 1 Week 2 Week 3 Week 40.0
1.5×105
3.0×105
4.5×105
6.0×105
7.5×105
HB
CD
, Hig
h (n
g)
Week 1 Week 2 Week 3 Week 40
50
100
80009000
10000
Bod
y B
urde
n PS
- H
(n
g H
BC
D /
g dw)
EWI
Week 1 Week 2 Week 3 Week 40
50
100
150
200
250
300
350
HB
CD
, Low
(ng)
Consumed in PSEgested in Frass
Week 1 Week 2 Week 3 Week 40.00.10.20.30.40.50.63.0
3.5
4.0
Bod
y B
urde
n PS
- L
(ng
HB
CD
/ g dw
)
Gut trackBody tissuesMDL
EWI
(a) (b)
(c) (d)
Figure 4.4: Fate tracking of HBCD in T. molitor fed PS-H (left) or PS-L (right). (a, b)Amount of HBCD consumed in PS (grey bars) coupled with the amount of HBCD egestedin frass (purple bars) from each container weekly (a: PS-H, b: PS-L). Amount of HBCDconsumed was calculated as total plastic consumed per week [g] ⇥ the concentration ofHBCD in the plastic [ng/g]). Amount of HBCD egested was calculated as the concentrationof HBCD in the weekly representative clean frass sample [ng/g] ⇥ the total frass collectedfor the week [g]. (c, d) Body burden of HBCD [ng/g dry weight] in mealworm tissues (gutor non-gut tissues) weekly, plotted with the method detection limit (MDL) (c: PS-H, d:PS-L). Expected weekly intake (EWI) of HBCD was calculated as the average amount ofHBCD consumed for each diet [ng/week], normalized to 10 mealworms, and is plotted forcomparison. All values represent mean SD, n = 2.
76 CHAPTER 4. FATE OF HBCD
0
20
40
60
80
100
Nor
mal
ized
Sur
viva
l (%
)
10% 50% 100%Percent MWB in Diet
ns
✱
✱✱
0
2
4
6
8
Bod
y w
eigh
t (d
w, m
g / s
hrim
p)
Initial WeightControl Diet
PS-L MWBPS-H MWB
Bran MWB
10% 50%Percent MWB in Diet
ns
✱
0 20 40 60 80 1000
20
40
60
80
100
MWB in Diet (%)
Fina
l Sur
viva
l (%
)
Linear Regression,R2 = 0.73
0.00
0.05
0.10
0.15
0.200.80
1.00
Bod
y B
urde
n (n
g H
BC
D /
g dw)
10% 50%
Percent MWB in Diet
Control DietBran MWBPS-L MWBPS-H MWB
MDL
0%
(a) (b)
(c) (d)
Figure 4.5: Bioaccumulation e↵ects from plastic-fed mealworm biomass on L. vannamei. (a,c) Survival of L. vannamei from toxicity experimental set-up. (a) Final survival proportionsfrom Kaplan-Meier survival analysis by diet normalized to control diet and (c) scatter plotand linear regression of final survival versus percent of mealworm biomass (MWB) includedin the diet. (b, d) Analysis of L. vannamei from bulk experimental set up. (b) Final bodyweight (dry weight, dw) based on diet. (d) Body burden of HBCD [ng/g dry weight] inshrimp biomass at the end of the bulk experiment. All samples are below the methoddetection limit (MDL, plotted in dashed line), thus raw data are shown but not used forquantification. All values represent mean SD, n = 3-5 depending on diet. Significanceversus control (one-way ANOVA, Bonferroni multiple test correction) p 0.05 indicated by⇤, p 0.005 indicated by ⇤ ⇤, no statistical significance indicated by ns.
Chapter 5
The role of biotechnology for
control and remediation of plastic
pollution
This chapter was originally published in Current Opinion of Biotechnology as Can biotech-
nology turn the tides on plastic?, doi: 10.1016/j.copbio.2019.03.020, reprinted here with
permission, copywrite Elsevier B.V. 2019.
77
78 CHAPTER 5. TURNING THE TIDE ON PLASTICS
5.1 Abstract
Accumulation of plastic pollution in aquatic ecosystems is the predictable result of high
demand for plastic functionalities, optimized production with economies of scale, and recal-
citrance. Strategies are needed for end-of-life conversion of recalcitrant plastics into useful
feedstocks and for transition to materials that are biodegradable, non-bioaccumulative,
and non-toxic. Promising alternatives are the polyhydroxyalkanoates (PHAs), a vast fam-
ily of polymers amenable to decentralized production from renewable feedstocks. Estab-
lishment of a global-scale PHA-based industry will require identification of PHAs with
tailored properties for use as ‘drop-in’ replacements for existing plastics; use of low-cost
renewable/waste-derived feedstocks; high productivity cultures that may be genetically-
modified microorganisms or non-axenic mixed cultures maintained by selection pressures
that favor high PHA-producing strains; and low-cost extraction/purification schemes.
5.2 Highlights
• Current fossil carbon-based plastics are accumulating at an unsustainable rate.
• Insight into enzymatic depolymerization could enable new mitigation incentives.
• The ‘Ecocyclable’ framework provides a path for sustainable plastic design.
• Replacement plastics will require waste as feedstock, design for disassembly.
• Replacement plastics will need tailored functionality, e�cient bioprocesses.
Figure 5.1: Summary Figure.
5.3. CURRENT PLASTIC PRODUCTION RATES ARE NOT SUSTAINABLE 79
5.3 Current plastic production rates are not sustainable
Plastic production has grown exponentially with a 14-year doubling time since the 1950’s.[66]
A conservative linear increase in plastic production going forward is 10.8 million metric tons
per year (Fig. 5.2). This increase far outpaces the expected increase in recycling of ⇠ 0.8
million metric tons per year for 2018.[66] The inevitable result is cradle-to-grave accumula-
tion in landfills and ecosystems (Fig. 5.3, 5.4).[66] While landfilling sequesters carbon, space
for landfills is limited, especially in dense urban environments[74], increasing the probability
that plastic wastes will enter sensitive ecosystems. This situation will be exacerbated by
China’s recent decision to halt plastic waste imports as the country has managed ⇠ 45%
of all plastic waste generated since 1992.[20] Accumulation of plastic in aquatic ecosystems
already threatens wildlife health.[100] Human health may also be harmed by exposure to
plastic additives, especially via microplastics in food, such as table salt.[202, 205]
Plastic-contaminated urban waters warrant special attention because these water bodies
are both hubs of recreational and economic activity and delivery points for plastic and
microplastics from rivers and storm water outfalls.[46, 113, 167] One of the few economic
assessments of marine debris estimated that communities on the west coast of the United
States spend $13 per resident annually to clean up trash.[164] If extrapolated to the current
global coastal population (40% of 7.6 billion people), such an e↵ort would incur an annual
price tag of $40 billion. These prohibitive costs and the well-documented harm to ecosystem
health [100] are compelling incentives to develop sustainable alternatives.
Current strategies for controlling plastic pollution in urban waters rely on wastewater
treatment. In these systems, large plastic debris is removed by screening then landfilled; mi-
croplastics are mostly removed by attachment to biosolids that are then transferred to solids
handling facilities [195]; a small fraction remains in the treated e✏uent.[113, 167]. When
these biosolids are applied to land, the plastics can potentially re-enter aquatic ecosystems
via runo↵.[195]. Release of plastic to such environments could be avoided if microplas-
tics were designed to biodegrade in aquatic systems, such as wastewater treatment plants.
Researchers have isolated plastic-degrading microorganisms from landfills and petroleum-
production sites [214, 68, 201, 200], but, to date, the rates achieved by isolated pure cultures
have been low and almost all isolates are restricted to growth on a single type of plastic.[200]
Microorganisms and enzymes are needed that can more rapidly and e�ciently degrade com-
plex plastic mixtures.[200]
80 CHAPTER 5. TURNING THE TIDE ON PLASTICS
5.4 From tiny bioreactors to new mitigation strategies
Recent research has identified one environment in which structurally diverse plastics do
undergo rapid degradation: the gut of arthropods, specifically insect larvae of Tenebrio
molitor (mealworms) [212, 207, 18], Plodia interpunctella (Indianmeal moth) [206], and
Galleria mellonella (wax moths) [91]. The most well studied are the mealworms, with half-
lives for the conversion of ingested plastic to CO2 on the order of 15 � 20 hours, much
faster than rates observed for microbial isolates.[213]. The mealworm gut microbiome can
also degrade multiple types of plastics and mixtures (e.g., polyethylene plus polystyrene),
suggesting an initial non-specific oxidative attack.[18] A deeper understanding of the under-
lying molecular mechanisms, including the relative contributions of the insect itself [91] and
the gut microbiome [206, 213], could enable development of scalable enzyme-based strate-
gies for plastic waste management.[200]. Given that the products of mealworm degradation
contain oxidized functional groups [207, 18], it is possible that such metabolites could serve
as substrates for future production of polyhydroxyalkanoates (PHAs), converting an other-
wise recalcitrant plastic into one that is biodegradable and sustainable.[124] This possibility
has been demonstrated for polyethylene terephthalate (PET): enzymatic-mediated PET hy-
drolysis yields terephthalic acid and ethylene glycol [214, 198], both of which can serve as
feedstocks for PHAs.[87, 60]
Systems for plastic production and recycling have yet to fully address the fate of chem-
ical additives, such as fire retardants and plasticizers.[137] Strategies are needed to ensure
their removal from recycled materials and to develop green chemistry replacements.[12]
Within the proposed ‘Ecocyclable’ framework (discussed later), chemical additives within
new materials would be evaluated through tests of toxicology and bioaccumulation. Such
assessments could be informed by non-profit organizations that provide screening tools and
services to assist in selection of safe replacement chemicals (e.g., Clean Production Action,
[33]).
5.5 From linear to fully circular economies
Figure 5.3 illustrates the potential transition from recalcitrant plastics in the current linear
economy to a circular economy, in which renewable plastics displace conventional recal-
citrant plastics. The inputs for the linear path of recalcitrant plastics are fossil carbon
5.6. LOW-COST, TAILORED TO THE APPLICATION, AND ECOCYCLABLE 81
feedstocks that required millions of years to accumulate, and recycle loops are small; the
outputs either accumulate in landfills or the environment [66]. By contrast, renewable plas-
tics fit within a circular economy with large recycle loops and feedstocks that are renewable
over a short time (< 10 years).[48] In order to meet current plastic demands, a roughly
500-fold increase in renewable plastics production is required.[56] In addition, production
costs need to be decreased by a factor of 2 � 4 to achieve cost parity with recalcitrant fossil
carbon-derived plastics (Table D.1).
Renewable plastic will need to match the in-use functionality of current plastics while
also safeguarding the environment and enabling disassembly at end-of-life (Table D.1). To
that end, an ‘Ecocyclable’ framework has been proposed in which new materials are com-
pared to reference polymers in terms of degradability, susceptibility to bioaccumulation,
and toxicity (https://ecocyclable.wm.edu, [117]). The reference polymers are cellulose, the
most abundant organic polymer on Earth, and polyhydroxybutyrate (PHB), an ancient
and ubiquitous biopolymer that is synthesized and degraded within numerous Bacteria and
Archaea.[143] Within the Ecocyclable framework, biodegradability is assessed by compari-
son of test materials to either cellulose or PHB in aerobic soils, anaerobic (methanogenic)
conditions, and aquatic environments.[117] Materials deemed ‘Generally Ecocyclable’ biode-
grade in all three environments; materials deemed ‘Conditionally Ecocyclable’ biodegrade
in one or more environment, but not all three.
5.6 Low-cost, tailored to the application, and Ecocyclable
Figure 5.4 presents a transition sequence from polyethylene terephthalate (PET) to poly-
lactic acid (PLA) to polyhydroxyalkanoates (PHAs). The order of this sequence reflects
increasingly renewable, biodegradable, and ‘Ecocyclable’ materials. Unlike other fossil
carbon-derived plastics (e.g., polystyrene), PET is recyclable without downcycling and typ-
ically does not contain toxic additives. It is recalcitrant under all environmental condi-
tions and therefore not ‘Ecocyclable.’ As noted previously, PET is susceptible to enzyme-
mediated degradation [214, 198]; thus, future innovation could conceivably lead to a form
that is ‘Ecocyclable.’
PLA is currently the most common renewable plastic.[56, 49] It is made from lactic acid
typically obtained from cultivated crops and would be classified as ‘Conditionally Ecocy-
clable’ because it degrades in some environments (e.g., thermophilic composts), but not
82 CHAPTER 5. TURNING THE TIDE ON PLASTICS
others (e.g., marine environment).[117, 86] Copolymerizing PLA or creating PLA com-
posites with other sustainable materials can result in better material properties and in-
creased degradability,[49] A recent study demonstrated PLA depolymerization by microbial
carboxylesterases [70], paving the way for future enzymatic control strategies like those
suggested above for PET or other fossil carbon-derived plastics, potentially leading to a
‘Generally Ecocyclable’ PLA.
PHAs are a vast family of moldable biopolymers that could serve as ‘drop-in’ replace-
ments for persistent plastics.[217] Most PHAs are likely to be ‘Generally Ecocyclable’ as
they are close relatives of the PHB reference polymer, first described in Bacillus megaterium
as a homopolyester of 3-hydroxybutyric acid.[101] Interest in PHB surged following a 1958
report showing that B. megaterium and B. cereus use PHB as a carbon and energy storage
polymer.[109] Studies thereafter focused on PHA synthesis in Cupriavidus necator (for-
merly known as Hydrogenomonas eutropha, Alcaligenes eutropha, and Ralstonia autropha)
[97] and on the development of a genetic toolkit for recombinant Escherichia coli.[160, 30]
More recently, whole genome sequencing and phylogenetic tools have greatly expanded un-
derstanding the biodiversity of Bacteria and Archaea that produce PHA granules and its
synthesis pathways. These data can be mined to identify PHA-producing organisms with
special capabilities of interest. Examples include extremophiles, such as Haloferax mediter-
ranei, a model strain for PHA metabolism in Archaea [39], and Halomonas, a halophilic
gammaproteobacterium, both of which can be grown at high salinities, a feature that could
decrease costs for media and PHA recovery.[148]
Critical bioprocess challenges for PHA production are feedstock and production costs,
the need to tailor polymer structure for specific applications, maximizing productivity (g
PHA/L-h), and optimizing downstream polymer extraction and purification. Costs can be
decreased through economies of scale and use of waste-derived feedstocks.[154] Economies
of scale could be achieved in large biorefineries where gas pipelines deliver renewable feed-
stocks, such as compressed biomethane, CO2, H2, and syngas.[154, 123] Alternatively,
economies of scale might be achieved through a decentralized approach in which production
facilities are co-located near wastewater treatment plants, landfills, or food waste man-
agement facilities.[217, 154] Waste-derived feedstocks (e.g., H2, CO2, CH4, glycerol, fatty
acids, lignocellulose, and potentially future degradation products of recalcitrant plastic
waste) avoid competition with cultivated crops for land and the associated water, energy,
and fertilizer requirements.[154]
5.6. LOW-COST, TAILORED TO THE APPLICATION, AND ECOCYCLABLE 83
Tailored PHAs are needed because PHB is brittle and has a narrow thermal processing
window, limiting its utility as a replacement material for fossil carbon-derived plastics.[123]
Fortunately, blends and copolymers, such as poly(3-hydroxybutyrate-co-3-hydroxyvalerate)
(PHBV) and more than 150 PHA variants, have material properties that can rival recalci-
trant plastics (Table D.1).[143, 103] The structure and in-use properties of PHA co-polymers
can be adjusted by the choice of co-substrates [154, 123], application of selection pressures
on mixed cultures [123], and genetic manipulation of biochemical pathways and enzyme
optimization.[29] Four classes of PHA synthase are known [30], and crystal structures are
now available for two Class I synthases.[28, 90] Knowledge of PHA synthase structure can
provide deep insights into its mechanisms [28, 90, 118] and facilitate enzyme re-engineering
for production of a diverse suite of PHA co-polymers with di↵ering monomer lengths and
sidechains and even PLA.[211]
Both synthetic biology and application of feast-famine selection pressures to non-axenic
mixed cultures can be used to achieve high PHA productivity.[123, 29, 82] High rates of PHB
production have been achieved with recombinant E. coli strain grown on agricultural wastes
(productivity > 2.13 g PHB/L-hr) [125] and by Cupriavidus necator DSM 545 grown on
waste glycerol (1.36 g PHB/L-hr).[121] Typically, PHA is produced in two steps: in the first,
growth rates are maximized during a period of balanced growth, and cells grow under replete
conditions, that is, with su�cient carbon source/electron donor, electron acceptor (typically
oxygen), and nutrients; in the second, PHA accumulation is induced under conditions of
unbalanced growth where carbon/electron donor is present in excess and growth of the
culture becomes limited by a nutrient (e.g., N, P, K) or an electron acceptor (e.g., oxygen,
nitrate).[143, 123] Ultimately, cells are harvested at high density, which can exceed 100
g/L.[110] Further increases in productivity are possible through both pure culture synthetic
biology and mixed culture selection strategies: mutants that generate PHA constitutively
could eliminate the need for two-stage processing [85] and imposition of feast-famine regimes
in non-axenic sequencing batch reactors can select for competitive dominance by high PHA-
producing strains, such as Plasticicumulans acidovorans, a gammaproteobacterium that can
accumulate > 85% PHB in a second-stage fed-batch bioreactor.[92, 83]
E�cient processing is also needed for recovery of PHA from the cells and its purifica-
tion. Current techniques involve heat treatment or freeze-thaw to disrupt the cell membrane
followed by one of several treatments: (1) solvents plus centrifugation, (2) chemical disrup-
tion plus centrifugation, or (3) use of enzymes, surfactants, and other agents to break the
84 CHAPTER 5. TURNING THE TIDE ON PLASTICS
cells plus dissolved-air flotation.[154, 110] These methods are time, energy, and chemical-
intensive.[154, 110] Biotechnology has the potential to improve this step through genetic
modifications that enable secretion of PHA molecules into the extracellular media [142];
feeding PHA-enriched microbial biomass to animals such as mealworms that digest the bac-
terial cell-wall, releasing relatively pure PHA granules in the excreted fecal pellets [122]; and
use of halophilic Archaea to produce PHA followed by transfer of PHA-rich cells to deionized
water where osmotic pressure causes cell lysis and the release of the polymer.[146, 55]
5.7 Design for disassembly
Insights from phylogenetics and metagenome screening can potentially be harnessed to
expand end-of-life options. The principle of ‘design for disassembly’ [107] has been cham-
pioned for years at the macro scale; advances in bioengineering now o↵er similar potential
at nanoscale. The natural architecture of PHA granules o↵ers inspiration with PHB de-
polymerases in the granule surface allowing access to amorphous regions susceptible to
depolymerization.[81] It remains to be seen whether such features (e.g., plastic degrading
enzymes) could be added to improve the ‘Ecocyclability’ of new materials (e.g., Carbiolice,
which hopes to commercialize plastic resins pre-seeded with biodegradation enzymes [13]).
Further knowledge of underlying biochemical degradation mechanisms might enable the de-
sign of plastics that are susceptible to disassembly upon exposure to specific environmental
conditions, such as high salinity, yielding harmless, or even useful products.
5.8 Outlook
Biotechnology opens the door for improved plastic design in terms of its production, in-use
properties, and end-of-life fate. E�cient strains and mixed cultures, low cost feedstocks,
optimized fermentations, and improved extraction schemes can usher in a new generation
of materials that can function as drop-in replacements for existing plastics. Deeper under-
standing of the mechanisms of recalcitrant plastic degradation can inform design of new
materials, perhaps enabling development of new materials that are readily converted into
useful feedstocks.
Widespread adoption of Ecocyclable standards or their equivalent can enable nuanced
regulation of plastics use, reuse, and disposal while encouraging innovation. With increased
5.9. SUPPORTING INFORMATION 85
public awareness of the capabilities of biotechnology and enabling legislation, biotechnology
is poised to play an important role in the remediation of plastic pollution and development
of new plastics and improved systems for plastics management.
5.9 Supporting Information
Appendix D contains a supporting Table D.1 with details on the cost, material properties,
and suitability for various thermal manufacturing processes for common petroleum-derived
plastics and bioplastics.
5.10. FIGURES 87
19401960
19802000
20202040
20600
200
400
600
800
1000
1200
Year
Ann
ual P
last
ic P
rodu
ctio
n (m
illio
n of
met
ric
tons
)
Historic Plastic ProductionProjected exponential growthProjected linear growthbased on 1988 - 2015
Figure 5.2: Projected increase in plastic production based on historic production data.Historic data are shown in blue circles. Dashed lines show projected growth. The reddashed line shows projected plastic production based on an exponential growth model (R2
= 0.98). The purple dashed line shows projected production based on a linear regression(R2 = 0.99) from the last three decades. Historic plastic production data from Geyer et al.2017 [66].
88 CHAPTER 5. TURNING THE TIDE ON PLASTICS
CO2 BIOMASS
PHOTOSYNTHESIS
1 - 10 YEARS
>106 YEARS
craddle-to-grave
FOSSILCARBON
FEEDSTOCKS
407 MILLION TONNES
(global annual production,2015)
79% ACCUMULATE IN LANDFILLS OR
THE ENVIRONMENT
12% INCINERATED
9% RECYCLED
2 - 3%PROCESS
LOSSES
5% DOWNCYCLINGLOSSES
1 - 2%CLOSED-LOOP
RECYCLING
ENVIRONMENTALDEGRADATION
leakage
leakage
circular lifecycles
MICROBIAL DEGRADATION(bioreactors)
880 THOUSAND TONNES
(global annual production,2017)
PLAPHBV
~44%
~35%
PHYSICAL / CHEMICAL RECYCLING(recovery of resin materials)
RENEWABLECARBON
FEEDSTOCKS
CO2
RENEWABLEH2
COMPOST
Figure 5.3: Current linear cradle-to-grave pathways for recalcitrant plastics and circularpathways of future plastic materials. Data for recalcitrant plastics from Geyer et al. 2017[66] and Ellen MacArthur Foundation 2016 [48]. Data for biodegradable plastics fromEuropean Bioplastics 2017 [56].
5.10. FIGURES 89
CRADLE-TO-GRAVE CIRCULAR LIFECYCLE
Polylactic acid (PLA) Polyhydroxyalkanoates (PHAs)
Feedstock:Lactic acid
Precursor(lactide)
Plastic resins
Plastic products
CO2cultivated feedstocks(e.g., corn)
photo-synthesis
abioticpolymerization
Feedstocks:CH4, CO2, H2, Sugars, Fatty acids, Glycerol
Precursors(e.g., alkenoates,
hydroxyalkanoates)
Plastic products
Feedstock:Crude oil, coal,
natural gas
Precursors(e.g., ethylene glycol,
terephthalic acid)
Plastic resins
Plastic products
accumulation in landfills
CO2
recycling
Fossil Carbon-Based Plastics (e.g., PET)
inci
nera
tion
down-
cycling
agricultural byproducts
bio-basedabioticpolymerization
manufacturing
accumulation in environment
litter + mismanaged
wastedisposal
Plastic resins
PHA granules
accumulation in landfills
accumulation in environment
bioticpolymerization
PHA recovery
(futu
re) e
nzym
atic
deg
rada
tion
(futu
re) e
nzym
atic
deg
rada
tion
(futu
re) m
icro
bial
deg
rada
tion
aero
bic
and
anae
robi
c m
icrob
ial d
egra
datio
n
degradation in bioreactors and/or environment
aero
bic
degr
adat
ion
mic
robi
al (e
.g.,c
ompo
stin
g) PHA producingmicroorganisms
manufacturing
litter + mismanaged
wastedisposal
agricultural byproducts
hydrolysis & therm
al processing
sustainabledisposal
fermentation (future) plastic deg.
products
meltrecoverymanufacturingmelt
recovery
hydrolysis & therm
al processing
Figure 5.4: A transition sequence for plastic materials. Black arrows show conventionalpathways. Purple arrows show existing biotechnology-based pathways. Orange arrowsshow future biotechnology pathways. Timeline at the bottom shows the transition in thedominant type of plastic used toward an increasingly renewable and degradable materials.
Chapter 6
Conclusions and Future Work
6.1 Conclusions
The goal of this dissertation was to investigate plastic biodegradation in the mealworm
gut as a model system for plastic degradation. To date, the guts of mealworms and of
other insect larvae, such as waxworms, are the only environments in which diverse plastics
biodegrade on a timescale of hours. As such, they are of great interest for identifying mech-
anisms and rate-limiting steps of plastic degradation, potentially enabling development of
new strategies for disassembly of plastics at end-of-life. Faster plastic degradation would
decrease plastic pollution and mitigate many of its negative impacts, a global priority high-
lighted by the United Nation Sustainable Development Goals, NOAA, and by the US EPA,
as a global priority.[166, 185, 175] If scaled-up, more rapid plastic biodegradation would
revolutionize plastic management by enabling resource recovery from materials that would
otherwise accumulate in increasingly limited landfill spaces or the environment. Current
limitations include the ability to broadly degrade multiple types of plastic, to e�ciently cul-
ture plastic-degrading organisms, and to understand and manage chemical additives within
plastics.
The work fromChapter 2 demonstrates that the mealworm gut is capable of nonspecific
plastic degradation. Experiments were designed to assess the specificity of degradation
within the mealworm by testing multiple types of plastic and mixed plastics. The results
demonstrated that mealworms are capable of degrading polystyrene and polyethylene, as
well as mixtures of the two wastes. This finding is especially important given the need to
scale-up degradation as a viable alternative for all plastic wastes. This research highlights
91
92 CHAPTER 6. CONCLUSIONS AND FUTURE RESEARCH
the need for additional mechanistic studies to identify how and why plastics readily break
down in this environment.
To better understand plastic degradation mechanisms in the mealworm gut, Chapter
3 investigates the role of the mealworm host and the gut microbiome. This work reveals
the importance of the mealworm host in secreting emulsifying factors that mediate plastic
bioavailability, thus enabling microbial attacks. Additionally, microbial secreted factors and
key microorganisms are identified. The synergistic interactions identified were applied to
develop a system whereby the plastic-degrading ability of cultured microorganisms from the
gut microbiome can be further investigated for scale-up e↵orts.
Chapter 4 investigates the fate of chemical additives within plastic waste by tracking
hexacyclobromododecane, the most common polystyrene flame retardant during biodegra-
dation by mealworms. Surprisingly, these results demonstrate that HBCD does not bioaccu-
mulate. Instead, it is rapidly excreted and concentrated within polymer residuals within the
frass, preserving the valuable, proteinaceous mealworm biomass for use as an animal feed-
supplement. This work serves as a proof-of-concept for the transformation of plastic wastes
into mealworm biomass or other products of value. It also highlights the need for thought-
ful green chemistry to ensure that plastic additives are non-toxic and non-bioaccumulative.
Such considerations are required to facilitate the adoption of circular practices that account
for the fate and removal of additives in plastic waste management systems.
The critical review presented in Chapter 5 contextualizes the research conducted in
this thesis in the broader field of biotechnology. It investigates the current state of plastic
waste and the need for biotechnology advances to reduce current and future pollution.
This review highlights the significance of the nonspecific and rapid plastic degradation that
occurs naturally within the mealworm. Further, this work proposes a vision for transitioning
from traditional recalcitrant plastics to biodegradable replacement materials and identifies
specific criteria needed for replacement materials to ensure their sustainability. Finally, this
review demonstrates the significance of biotechnology in tackling plastic waste challenges
and directs the prioritization of research to reach a more sustainable future.
6.2. RECOMMENDATIONS FOR FUTURE RESEARCH 93
6.2 Recommendations for future research
The work presented in this dissertation significantly expands our understanding of naturally
occurring plastic biodegradation mechanisms and identifies strategies whereby that under-
standing can be harnessed in engineered systems. It also highlights areas requiring further
research, such as features within insect guts that enable rapid plastic degradation, and en-
zymes and biochemical pathways that enable large-scale rapid biodegradation to recover
value from otherwise recalcitrant plastics. Increasing our understanding of how biotech-
nology can develop and tailor drop-in replacements for petroleum-based plastics and green
chemistry in support of a sustainable, circular economy.
Gut microbiome as a tool
This research contributes to growing evidence that the insect gut environment is a valuable
resource for the discovery of novel degradation patterns and unique microorganisms. Until
recently, only one insect gut was widely studied and modeled for its degradation abilities:
termites and the symbionts within their hindgut that degrade plant lignose.[22, 21, 19] This
work, along with a growing number of other studies, demonstrate how the gut of insects
such as mealworms and waxworms are uniquely suited for enhanced plastic degradation,
likely because of their prior adaptation to the consumption of natural polymeric substances.
Further research is needed to assess the commonality of these gut environments that enable
degradation of complex, persistent polymers. These insect guts may also serve as a previ-
ously untapped resource for other biotechnology tools of interest, such as the endogenous
emulsifying agent identified in Chapter 3. Future studies should focus on identifying other
gut environments suitable for plastic biodegradation, especially those of other ecosystems,
such as the marine environment. These e↵orts would help characterize endogenous plastic
degradation in di↵erent ecosystems and identity microorganisms and environmental controls
that could enable rapid biodegradation.
Plastic biodegradation mechanisms
To date, there has been limited research into the mechanisms of plastic biodegradation in
either isolated microorganisms or in the gut of insects. While the research in this thesis
contributes to our understanding of degradation specificity and factors that enhance degra-
dation activity, it also highlights the need for enhanced understanding of biodegradation
94 CHAPTER 6. CONCLUSIONS AND FUTURE RESEARCH
pathways and the need for tools that can provide insight into these pathways in novel sys-
tems. Increased understanding of the degradation pathways and enzymes will enable future
e↵orts to scale-up biodegradation either through bioprocess engineering and/or synthetic
biology. This increased understanding may enable tailored biodegradation processes, such
as re-routing the degradation pathway to a di↵erent endpoint. Such tailoring could enable
the reclamation of valuable molecules or monomers, rather than letting the degradation pro-
ceed to complete mineralization. This possibility has been demonstrated for polyethylene
terephthalate (PET) where enzymatic PET hydrolysis yields terephthalic acid and ethylene
glycol,[198, 214, 87] both of which can serve as feedstocks for the production of bioplastics
such as polyhydroxyalkanoates.[87, 61] This process thus enables the use of by-products
from petroleum-based plastic degradation as substrates for production of biodegradable
bioplastics. This underscores the importance of identifying plastic degradation mechanisms
that can convert recalcitrant plastics into biodegradable and sustainable materials.
Scaling-up of plastic biodegradation
While a better understanding of the mechanisms of plastic degradation will support e↵orts
to scale-up these systems, more research is needed. There is a need to understand how to
increase the scale of plastic biodegradation can be accomplished without compromising on
the e�ciency or extent of degradation. Research is also needed to determine the optimal size
of future systems and to minimize losses that occur during collection and transportation
while maintaining economic feasibility. Further work is also needed to investigate how
mechanisms from biodegradation can be used at scale in the design and production of
new materials. As one example, further knowledge of enzyme structure and mechanism
might enable the production of plastics that are susceptible to enhanced degradation under
specific environmental conditions. This idea is already being explored commercially to
pre-seed materials with the necessary biodegradation enzymes to transform conditionally
biodegradable plastics, like polylactic acid, to fully biodegradable materials.[13] Utilizing
insights from biodegradation upstream in the design and production process could further
reduce waste management challenges and ultimately yield products that are less harmful to
the environment.
6.2. RECOMMENDATIONS FOR FUTURE RESEARCH 95
The need for sustainable replacement materials and green chemistry
To fully address the challenges of plastic pollution, there is a need to move from the linear
cradle-to-grave lifecycle of conventional plastics to renewable materials that fit into a circular
lifecycle. To make this transition economically feasible, research is needed to enhance the
material properties of proposed replacement materials to enable their ready use as drop-in
replacements for conventional plastics. Further biotechnology advances can help drive down
costs and overcome processing issues that currently limit widespread use of these plastics.
In addition, there is a need to overcome previous definitional issues surrounding replacement
materials. The Ecocyclable standard highlighted in Chapter 5 is a proposed option that
would enable a more nuanced definitions, and could be incorporated into legislation on
plastic pollution.[117, 195]
Current systems for plastic production and recycling fail to address and treat chemical
additives in plastic, such as fire retardants and plasticizers.[137] These additives are poten-
tially harmful to environmental and human health and require careful mitigation to ensure
they do not escape into the environment. They would pose similar threats if used in replace-
ment materials to achieve enhanced chemical properties. Strategies are therefore needed to
ensure their removal from recycled materials and to enable non-toxic and sustainable green
chemistry replacements.[12]
In combination with legislative actions (e.g., United States Microbead-Free Waters Act
of 2015), improved public awareness, and personal behavior changes, biotechnology is poised
to play an increasingly important role in the remediation of existing plastic pollution and
their replacement by materials that are environmentally benign.
Emerging challenges
As our understanding of plastic pollution in the environment grows, it becomes increasingly
evident that there is no ecosystem that remains undisrupted and unharmed. Macroplastic
pollution (e.g., plastic bags, water bottles, straws) are well documented to cause harm
through ingestion, entanglement, and exposure to chemical additives. Areas of emerging
concern that will necessitate further research include impacts from micro- and nano-plastics.
Research demonstrates that microplastic particles are ingested by a variety of zooplankton
species at the base of the marine food web, giving rise to concerns of bioaccumulation.[34, 35]
Health risks from the ingestion of these microplastics may result from their bioaccumulation
96 CHAPTER 6. CONCLUSIONS AND FUTURE RESEARCH
up the food chain or through other means of concentration, such as sea salt.[37, 202, 205]
Researchers have just begun examining the risks posed by nano-plastics.[152, 115] Clearly,
there is an imminent need to address plastic pollution in the environment without delay
and to develop remediation strategies across multiple scales.
98 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
A.1 Material and Methods Supplement
A.1.1 Extraction method e�ciency assay
The extraction method used to recover residual polymer from the frass in this study was
based on previously established methods.[207] To assess the e�ciency of the method, frass
samples from the bulk-fed containers (from the plastic only diets, PE and PS) along with
frass samples from the bran-fed controls were gently crushed in a mortar and pestle and
then divided into ⇠ 50 mg aliquots (4 for PE samples, 2 for PS samples, 4 for bran sam-
ples) and placed in clean glass vials with 2 mL of the extraction solvent and extracted
with gentle heating (placed on a hot plate on the lowest setting). The PS samples were
extracted in tetrahydrofuran (THF) (� 99.9%, Thermo Fisher Scientific Inc., Pittsburg,
PA) in duplicate. The PE and bran samples were extracted in THF in duplicate as well
as in dichloromethane (DCM) (� 99.9%, Thermo Fisher Scientific Inc., Pittsburg, PA) in
duplicate. Every 30 minutes for 3 hours the samples were allowed to settle, then the solvent
was recovered (leaving the frass particles in the vial) and filtered using a 0.22 µm PVDF
filter (Thermo Fisher Scientific Inc., Pittsburg, PA) into a clean pre-weighed glass vial.
Two mL of solvent was then re-added to the initial vials containing the frass to allow the
extraction to continue until the next time point. For the last time point, the vials were left
extracting for upwards of 12 hours before the solvent was recovered and filtered. The ex-
tracted residual polymer in the filtered solution was the concentrated by rotary evaporation
and the residual polymer was weighed to determine the extractable fraction (the percent of
the initial frass weight recovered in the extraction).
A.1.2 Phasing amplicon sequencing library preparation
The phasing amplicon sequencing (PAS) approach was used to sequence the V4 region
of 16S rRNA genes.[203] For the first-step PCR, 5 µL of 10⇥ PCR bu↵er II (Life Tech-
nologies, Carlsbad, CA), 2 µL of 10 µM forward and reverse target-only primers 515F
(5‘GTGCCAGCMGCCGCGGTAA3’) and 806R (5‘GGACTACHVGGGTWTCTAAT3’),
and ⇠10 ng template DNA were mixed in a 50 µL reaction. The DNA was denatured
at 94 �C for 1 min, and 10 cycles of 94 �C for 20 s, 53 �C for 25 s, and 68 �C for 45 s were
conducted before a final extension at 68 �C for 10 min. The PCR products were purified
with an Agencourt AMPure XP kit (Beckman Coulter, Beverly, MA) and were used in the
A.1. MATERIAL AND METHODS SUPPLEMENT 99
second-step PCR in which 2.5 µL 10⇥ PCR butter II, 2 µL forward and reverse phasing
primers (10 µM), and 15 µL of the first-step PCR products were mixed in a 25 µL reaction.
Twenty cycles of the above program were used and PCR products were detected with elec-
trophoresis and quantified with PicoGreen dsDNA assay Kit (Thermo Fisher Scientific Inc.,
Pittsburg, PA). Equal amount of product of the samples were pooled and purified with a
QIAquick gel extraction kit (Qiagen, Venlo, NL). Library of the 16S rRNA gene amplicon
sequencing were constructed using MiSeq reagent kit (Illumina, San Diego, CA) following
the manufacturer’s instruction, and DNA was sequenced using an Illumina MiSeq platform.
A.1.3 E. coli K12 plastic characterization controls
To test the possibility that the newly observed peaks in NMR and FTIR analysis were
attributable to contamination by bacterial biomass or secreted proteins, samples of plastic
(PE and PS) were separately treated in a suspension of E. coli K12, a common laboratory
bacterial culture not known to degrade plastics.[196] The E. coli K12 was grown in Luria-
Bertani (LB) broth (Thermo Fisher Scientific Inc., Pittsburg, PA) in 15 mL glass culture
tubes (Thermo Fisher Scientific Inc., Pittsburg, PA) at 30 �C with three approximately
0.1 g plastic pieces (either PE or PS) for 48-hours. After 24-hours, 5 mL of the broth was
removed from each tube and replaced with 5 mL of LB broth. After 48-hours, the plastic
samples were lightly rinsed with deionized water and allowed to dry completely prior to
being extracted and used for NMR or FTIR analysis.
A.2. TABLES 101
Table A.1: Overview of Illumina MiSeq data
Sequencing Data Feature:Minimum number of sequences (per sample): 9889Maximum number of sequences (per sample): 808059Mean number of sequences (per sample): 52532Resampling depth: 17460Resampled number of OTUs: 515Number of replicates per diet:
Bran 5PE 9
PE + Bran 7PS 2
PS + Bran 2PE + PS 2
102 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
Table A.2: 1H-NMR peak information (PE samples) based on analysis using MestReNovasoftware (version 10.0.2).
104 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
Table A.4: FTIR peak information for PE samples based on analysis using OMNIC software(Thermo Fisher Scientific Inc., Pittsburg, PA). Thermo Scientific Hummel Polymer andAdditives FTIR Spectral Library was used to obtain reference spectra of PE.
A.2. TABLES 105
Table A.5: FTIR peak information for PS samples, based on analysis using OMNIC software(Thermo Fisher Scientific Inc., Pittsburg, PA). Thermo Scientific Hummel Polymer andAdditives FTIR Spectral Library was used to obtain reference spectra of PS.
106 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
Table A.6: FTIR peak information for plastic mixture samples, based on analysis usingOMNIC software (Thermo Fisher Scientific Inc., Pittsburg, PA). Thermo Scientific HummelPolymer and Additives FTIR Spectral Library was used to obtain reference spectra of PEand PS.
A.2. TABLES 107
Table A.7: Relative abundance of PE and PS associated OTUs identified via di↵erentialabundance analysis. Average ± standard deviation reported by diet.
PE Associated Species Relative Abundance (% within sample) by DietOperational Taxonomic Units (OTU): PE Fed PE + Bran Fed PE + PS FedCitrobacter sp. 21.95 ± 9.45% 0.14 ± 0.08% 0.01 ± 0.02%Kosakonia sp. 17.94 ± 5.66% 1.17 ± 1.12% 5.40 ± 3.40%Sebaldella termitidis 1.78 ± 1.23% 0.04 ± 0.03% 0.11 ± 0.11%Brevibacterium sp. 0.12 ± 0.04% 0.01 ± 0.01% 0.03 ± 0.04%PS Associated Species Relative Abundance (% within sample) by DietOperational Taxonomic Units (OTU): PS Fed PS + Bran Fed PE + PS FedCitrobacter sp. 9.10 ± 9.08% 0.01 ± 0.01% 0.01 ± 0.02%Kosakonia sp. 13.14 ± 6.10% 0.01 ± 0.00% 5.40 ± 3.40%Listeria sp. 0.99 ± 1.40% 0.00 ± 0.00% 0.00 ± 0.00%Nistrospira defluvii 0.56 ± 0.40% 0.34 ± 0.24% 0.00 ± 0.00%Pedomicrobium sp. 0.19 ± 0.13% 0.11 ± 0.07% 0.01 ± 0.01%Aquihabitans sp. 0.20 ± 0.14% 0.18 ± 0.13% 0.00 ± 0.00%Un. Xanthomonodaceae 0.17 ± 0.12% 0.07 ± 0.05% 0.07 ± 0.05%Un. Saprospiraceae 0.15 ± 0.10% 0.03 ± 0.05% 0.01 ± 0.01%Un. Burkholderiales 0.23 ± 0.16% 0.09 ± 0.06% 0.02 ± 0.01%
A.3. FIGURES 109
6×104
8×104
1×105
1.0×105
1.5×105
2.0×105
Mol
ecul
ar W
eigh
t (M
n) M
olecular Weight (M
w )
Mn Mw
* *
ns ns
50010001500200025003000350040000
50
100
Wavenumber (cm-1)
% T
rans
mitt
ance PS Frass
OHRstretch
C Ostretch
C Ostretch
aromaticstretch
out-of-planebending
PS + Bran Frass
PS Control
C H
Bran Frass
PS + Bran Frass
PS Frass
PS Control
(c)
(a)
reduced aromatic region
PhOH
R-OH
Week 1Week 2
Week 3Week 4
0
20
40
60
80
Ext
ract
able
Fra
ctio
n (%
)
PS Frass
PS + Bran Frass
PS Control
(d)
(b)
Figure A.1: Characterization of PS degradation within the mealworm gut. a) Changes inmolecular weight (Mn and Mw) within residual polymer from the frass versus the control PSas measured by HT-GPC. Significance (Student’s t-tests, Tukey’s multiple test correction)p < 0.05 indicated by ⇤, no statistical significance indicated by ns. (b) Changes in theextractable fraction, a measure of residual polymer in the frass, over the 32-day experiment.(c) 1H-NMR spectra of residual polymer extracted from the frass of PS and PS + branfed mealworms versus residuals extracted from bran fed mealworms, and the control PSfoam. The reduction in the aromatic region, appearance of phenol derivatives, and alcoholderivatives are highlighted in grey. Detailed peak information in Tables A.2, A.3. (d) FTIRspectra of residual polymer extracted from the frass of PS and PS + bran fed mealwormsversus the control PS, annotations show functional groups associated with key peaks basedon wavenumber. Detailed peak information in Tables A.4, A.5, A.6.
110 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
50010001500200025003000350040000
50
100
Wavenumber (cm-1)
% T
rans
mitt
ance
PE E. Coli TreatedPE Control
50010001500200025003000350040000
50
100
Wavenumber (cm-1)
% T
rans
mitt
ance PS Control
PS E. Coli Treated
PE Control
PE E. Coli treated
PS Control
PS E. Coli treated
(a) (b)
(c) (d)
Figure A.2: Characterization of plastic treated with E. coli K12 as a control against micro-bial contamination (SI MethodA.1.2). (a & b) 1H-NMR spectra of control plastics comparedto E. coli K12 treated plastics (a: PE, b: PS). Detailed peak information in Tables A.2,A.3. (c & d) FTIR spectra of control plastics compared to E. coli K12 treated plastics (c:PE, d: PS). Detailed peak information in Tables A.4, A.5, A.6.
A.3. FIGURES 111
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100
Per
cent
of I
nges
ted
Mas
s
PE Fed
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100
Per
cent
of I
nges
ted
Mas
s
PE + Bran Fed
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100P
erce
nt o
f Ing
este
d M
ass
PS Fed
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100
Per
cent
of I
nges
ted
Mas
s
PS + Bran Fed
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100
Per
cent
of I
nges
ted
Mas
s
Frass - non-extractable fractionFrass - extractable fraction
Mealworm Biomass
PE + PS Fed
Week 1Week 2
Week 3Week 4
0
20
40
60
80
100
Per
cent
of I
nges
ted
Mas
sFrass - non-extractable fractionFrass - extractable fraction
Mealworm Biomass
Bran Fed Control
(a) (b) (c)
(d) (e) (f)
Figure A.3: Mass balance on mealworms during the 32-day experiment. The percent ofingested mass (plastic & bran, depending on the diet) recovered in the frass, the extractableportion of the frass (e.g., residual polymer), and the mealworm biomass throughout the 4-week experiment (days 6, 15, 21, 27). The plastic only diets (a � c) show a steady decreasein the amount of plastic being recovered in the frass and an increase in the PGF (likely CO2)(a: PE, b: PS, c: PE + PS). The plastic diets co-fed with bran (d � e) also show a decreasein the amount of plastic being recovered in the extractable portion of the frass (d: PE +Bran, e: PS + Bran). The bran-fed control (f) shows little to no material was recovered inthe extractable fraction over the course of the experiment and that the amount of ingestedmaterial (bran) converted to gases increases overtime while the amount of ingested materialconverted into mealworm biomass decreased with time.
112 APPENDIX A. SUPPORTING INFORMATION FOR CHAPTER 2
50010001500200025003000350040000
50
100
Wavenumber (cm-1)
% T
rans
mitt
ance
OHR
C H
stretch
stretch
C O
C HOHRbend
bend
stretch
C Ostretch
aromaticstretch
+
PE + PS Frass
out-of-planebending
C H
PE ControlPS Control
Figure A.4: Characterization of mixed plastic (PE + PS) degradation. FTIR spectra ofresidual polymer from the frass of PE + PS fed mealworms versus the control polymers (PEand PS), annotations show functional groups associated with key peaks based on wavenum-ber. Detailed peak information in Tables A.4, A.5, A.6.
●
●●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
PS_Bran1
PE_PS2PE1PE2
PS1
PE_Bran1
PE_Bran3
PS_Bran2
PE_Bran4
PS2
PE_Bran2
PE_PS1
Bran6
PE7
PE9PE6
Bran4
PE_Bran5
PE_Bran4
PE8
PE3
Bran1Bran3
PE5
Bran2
PE_Bran3
PE4
●
●●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
●
−0.2
0.0
0.2
−0.50 −0.25 0.00Axis.1 [27.7%]
Axis.
2 [
20.6
%]
Diet●a●
●a●
●a●
●a●
●a●
●a●
Bran
PE
PE_Bran
PE_PS
PS
PS_Bran
Figure A.5: Principal Coordinate Analysis of microbial communities by diet based onBray-Curtis distance, colored by diet and labeled with the sample ID with outliers (PS1,PS Bran2) included.
A.3. FIGURES 113
30 min60 min
90 min120 min
150 min180 min
>12 hour0
5
10
15
20
25
Ext
ract
able
Fra
ctio
n (%
) PE in DCM - total extractable fraction 41.02 ± 0.64% PE in THF - total extractable fraction 5.89 ± 0.23%PS in THF - total extractable fraction 42.60 ± 0.78%
Time Extracted
Bran in THF - total extractable fraction 0.95 ± 0.22%Bran in DCM - total extractable fraction 1.11 ± 0.21%
Figure A.6: E�ciency of extraction method used to recover residual polymer in the frass.Extractable fraction (the percent of the initial frass weight recovered in the extraction, the“residual polymer”) recovered over time for frass from PE- and PS-fed mealworms as well asbran-fed controls. The residue recovered from the PE- and PS-fed samples was visible whiteand polymer-like while the residue recovered from the bran-fed controls was not, which isconsistent with previous applications of this method (not shown).[207]
116 APPENDIX B. SUPPORTING INFORMATION FOR CHAPTER 3
B.1 Tables
Table B.1: Sequenced bacterial strains from microbial enrichment and isolates. Sequencesbacterial strains isolated from the cultivated enrichment (mixed community, “Enrichment”)and the bacterial isolates grown on PS film (“Isolates”) are shown with the most similarstrain (by sequence identity), the similarity grade (%), query coverage (%). All values arederived from BLAST comparison.
118 APPENDIX B. SUPPORTING INFORMATION FOR CHAPTER 3
5 10 15
-1
0
1
2
3
Days
Perc
ent C
O2
Control (Bacteria alone)Bacteria + PS
5 10 15-0.5
0.0
0.5
1.0
1.5
2.0
Days
Perc
ent C
O2
Control (Bacteria + 0.05 mL)0.05 mL Super. + PS0.05 mL glucose equivalent
5 10 15
-2
-1
0
1
2
3
Days
Perc
ent C
O2
Control (Bacteria + 0.5 mL)0.5 mL Super. + PS0.5 mL glucose equivalent
5 10 15-1
0
1
2
3
4
Days
Perc
ent C
O2
Control (Bacteria + 0.1 mL)0.1 mL Super. + PS0.1 mL glucose equivalent
5 10 15
-5-4-3-2-10123
Days
Perc
ent C
O2
Control (Bacteria + 1.0 mL)1.0 mL Super. + PS1.0 mL glucose equivalent
(a)
(b) (c)
(d) (e)
Figure B.1: Dose-response curves for supernatant and glucose equivalent. Gut microbiomewas cultured in carbon-free media with PS microplastics and supplemented with varyingdoses of PS-fed supernatant (blue) or glucose equivalent based on chemical oxygen demand(red), controls (grey) were seeded with gut microbiome and supernatant but no PS. Respi-ration activity (CO2 production) was measured over 14 days. Five supernatant doses weretested: (a) 0 mL, (b) 0.05 mL, (c) 0.1 mL, (d) 0.5 mL), and (e) 1.0 mL.
B.2. FIGURES 119
(a) (b)
+20 min
Bran supernatant PS-fed supernatant+ - + -
Bran supernatant PS-fed supernatant+ - + -
Neg. Pos.Controls
Neg. Pos.Controlsantibiotic
treatment
Figure B.2: Supernatant emulsification activity. To assess the capacity for gut supernatantfrom the four experimental diets (PS and bran, with and without antibiotic treatment) toemulsify PS microplastics into aqueous solution. (a) Emulsifications formed immediatelyafter 2 minutes of vortexing, labeled by diet (top row) and antibiotic treatment (bottomrow). Negative control (DI water + PS microplastics) and positive control (DI water +PS microplastics + Tween 80, a common surfactant) are shown on the right. (b) Emulsi-fications remained 20 minutes after vortexing, demonstrating PS microplastics are stablyincorporated into aqueous phase.
120 APPENDIX B. SUPPORTING INFORMATION FOR CHAPTER 3
Figure B.3: Enrichment biofilm formation. The microbial enrichment was cultured in car-bon free media with PS film and supplemented with PS supernatant. A stable biofilmformed on the PS film after 3 months of growth (shown).
122 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
C.1 Material and Methods Supplement
C.1.1 Chemicals and reagents
Hexane (>99.9%, HPLC grade) and methylene chloride (DCM, >99.9%, HPLC grade) were
purchases from Fischer Scientific Inc. (Pittsburg, PA). a-, b-, and g-HBCD (1,2,5,6,9,10-
hexabromocyclododecane, >98.0%, analytical standard grade) standards were purchased
from Sigma-Aldrich (now MilliporeSigma, St. Louis, MO). Sodium sulfate anhydrous
(99.0%) was purchased from EMD Millipore (now MilliporeSigman, St. Louis, MO) for
use sample preparation for HBCD analysis. GE Healthcare Whatman Binder-Free Glass
Microfiber Filters (Grade 934-AH, 70 mm) were purchased from Fischer Scientific Inc.
(Pittsburg, PA) for use sample preparation for HBCD analysis. Restek Normal Phase Re-
sprep SPE cartridges (packing material: Silica, 6mL, 1000mg) for the final clean-up step of
HBCD analysis was purchased from Fischer Scientific Inc. (Pittsburg, PA). Stock solutions
containing a mixture of polychlorinated biphenyls (PCBs) for use as a surrogate standards
and internal standards for HBCD chemical analysis (Surrogate standard: BZ#s 14, 65, 166;
Internal standard: BZ#s 30, 204) were purchased from Agilent ULTRA (Santa Clara, CA).
C.1.2 HBCD analysis
Analytical methods to quantify HBCD in mealworm and shrimp biomass as well as polystyrene
(PS) samples were developed following modified EPA methods[182, 181] for polychlorinated
biphenyls (PCBs) and organochloride pesticides because there is currently no accepted EPA
method for HBCDs and these methods have been used previously for the quantification of
other chlorinated and brominated compounds.[192, 96] Figure C.3 shows a schematic rep-
resentation of sample preparation, which is further explained below. To quantify HBCD in
mealworm biomass, mealworms were first sacrificed and then the gut track was dissected
out, separating the gut tissues from the non-gut tissues, these samples were pooled (10
mealworm gut tracks or non-gut tissues per sample). Samples were then freeze-dried for
>72 hr. Shrimp biomass was first sacrificed and pooled (5 – 6 shrimp/sample) prior to
freeze drying (>72 hr). These freeze-dried samples, as well as collected mealworm frass
samples, were then homogenized (via mortar and pestle). Sample extraction method was
based on EPA method 3350B.[180] The homogenized samples were then dried with sodium
C.1. MATERIAL AND METHODS SUPPLEMENT 123
sulfate, spiked with the surrogate standard (a mixture of PCBs, BZ# 14, 65, 166; 20 µLof 400 µg/L)[102, 215] prior to being extracted with methylene chloride (DCM, 20 mL)
using ultrasonic extraction (20 min in a Branson 2510 Ultrasonic bath). Polystyrene sam-
ples (0.05 g) were dissolved in 20mL DCM, spiked with the surrogate standard, and then
subject to the same ultrasonic extraction. Post sonication, samples were allowed to set-
tle, and the overlying DCM was decanted over a filter (containing approximately 1.0 g of
sodium sulfate) into a clean glass vial using a clean glass funnel. Twenty mL of DCM
was then re-added to the solid sample and re-extracted following the same methods. After
the solvent from the second extraction was filtered, samples were evaporated (using an N2
evaporator, N-EVAP 111) until the remaining volume was less than 2 mL, after which 4
mL of hexane was added to the vial and swirled to mix (repeated a second time after the
volume returns to 2 mL). The remaining volume (less than 2 mL) was then passed through
a silica SPE clean-up column (pre-conditioned with 4 mL hexane) following EPA method
3630C.[178] The column was then eluted with 4 mL of DCM and the flow-through collected
and concentrated to 1 mL using the N2-evaporator. The samples were then spiked with
internal standard (a mixture of PCBs, BZ# 30, 204; 10 µL of 400 µg/L) prior to instrumen-
tal analysis.[102, 215] PCBs were selected as surrogate and internal standards as they are
stable, chemically similar compounds to HBCD that do not interfere with quantifying the
peak of interest using our analytical methods and have been used previously as standards
for HBCD analysis.[215]
Quantification of total HBCD was performed using an Agilent gas chromatograph[102,
188, 73] (model 6890) with a fused silica capillary column (HP-5, 60 m ⇥ 0.25 mm ID)
and a micro electron capture detector (GC- µECD) based on EPA methods 8082[182] and
8081.[181] The main stereoisomers of HBCD present in PS are a-, b-, and g-HBCD; g-HBCD
is the predominant stereoisomer used in commercial products.[215, 183, 11] Standards of the
three main stereoisomers were tested independently and as a mixture. Retention times and
response factors of the three stereoisomers were statistically indistinguishable (Fig. C.8),
justifying the use of a single HBCD peak to quantify total HBCD.6,9,10 All quantifications
in this paper refer to total HBCD. A six-point calibration curve was prepared with g-
HBCD standard with the internal standard. HBCD concentration measured in unexposed
mealworms (under the control, bran-fed diet) and the bran used as feed were treated as
background (n = 3, all samples were below detection). Method detection limit (MDL) for
mealworm biomass samples was 0.20 ng HBCD/g dry weight and for shrimp biomass the
124 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
MDL was 1.00 ng HBCD/g dry weight. Our limit of detection (LOD) and limit of quanti-
tation (LOQ) were determined to be 40 pg and 1000 pg, respectively, based on established
definitions.[5, 116] To increase the robustness of our analysis, we do not utilize any values
below the MDL for statistical quantification, but we plot all values above our LOD. In ad-
dition, laboratory blanks were run with every batch (10 -– 20 samples/batch) of samples to
assess contamination from solvents, glassware, etc. To check for contamination in the GC,
a hexane blank is run at the beginning and end of a sample batch (10 – 20 samples/batch)
based on recommended frequency by the EPA[179] and best practices established by our
laboratory,[179, 108] no carry-over was observed. A preliminary assay was conducted to
assess average recovery e�ciency of surrogate standard across di↵erent sample types (Fig.
C.6a), we then used these results to establish an accepted range of recovery (40 – 100%) in
accordance with our laboratory established standard methods[108] (following EPA methods
that each laboratory should establish their own accepted range of recovery[182]). Recoveries
from this preliminary assay as well as from all the samples in this study are shown in Fig.
C.6.
C.1.3 Litopenaus vannamei experimental conditions
L. vannamei postlarvae were purchased from Shrimp Improvement Systems LCC (Islam-
orada, FL). Following overnight shipment, the postlarvae were acclimated over 12 hrs fol-
lowing guidelines from the company to ensure changes in pH, salinity, and temperature were
less than 0.1 pH unit/15 min, 1ppt/15 min and 1�C/15 minutes, respectively. The postlar-
vae were kept in 30 L tanks (stocking rate ⇠ 80 postlarvae/L) with constant aeration, which
were maintained at 28 �C and 33 ppt salinity (with 50% water changes every 3 days) until
they were used in experiments. Artificial seawater (35 g/L) was made with Instant Ocean
(Blacksburg, VA). For the first 48 hr after arrival, the postlarvae were fed recently hatched
brine shrimp (premium grade Artemia franciscana cysts, Brine Shrimp Direct, Ogden, UT).
After 48 hr, their diet was switched to standard postlarvae feed for post larval stages 15 –
20 (FRiPPAK RW+500, INVE Aquaculture, Deception Bay, Queensland, AUS), which was
used in all the experiments as the control diet. The postlarvae were fed ⇠ 3% of biomass
per tank daily.
Two experimental set-ups were utilized to assess the impact of PS-fed mealworms on
survival and fate of HBCD within the aquaculture biomass (Fig. C.2). In the first experi-
mental setup (“toxicity & survival setup,” Fig. C.2a), individual postlarvae were transferred
C.1. MATERIAL AND METHODS SUPPLEMENT 125
to a cup (145mL sterile food-grade polypropylene) that enabled the survival tracking of in-
dividual shrimp and prevented cannibalism, following methods as described by Crab et
al.[38] Each cup contained 50 mL initially composed of 50% fresh aquarium water and 50%
water from their previous tank to ease acclimation. The individual cups were suspended
in a temperature-controlled water bath maintained at 28 �C using an aquarium heater (50
W submersible glass heater, Aqueon Products, Franklin, WI). Postlarvae were allowed to
acclimate for at least 48 hr in the cups prior to the start of the experiment, during which
time they were fed with the control diet. A 50% water change was performed daily to
maintain high quality water within the individual cups. Each group included 13 shrimp.
The experiment was run for 10 days and survival was monitored daily for Kaplan-Meier
survival analysis. After the acclimation period, shrimp were switched to the experimental
diets (fed at ⇠ 3% shrimp weight daily, ⇠ 0.003 g per day). The experimental diets in-
cluded: bran-fed mealworm biomass (MWB), PS-L fed MWB, PS-H fed MWB, each type
of MWB was integrated into the shrimp diets at 3 di↵erent rates: 10%, 50%, and 100%
(for a total of 9 experimental diets). Control shrimp were fed commercially available feed
(FRiPPAK RW+500, INVE Aquaculture, Deception Bay, Queensland, AUS).
Experimental feeds were prepared utilizing MWB from bulk experimental setup (Fig.
C.1). The mealworms were subject to a 24-hr depuration, sacrificed, and the biomass (whole
mealworm) freeze-dried for >72 hr. The dried biomass was then homogenized with a blade
grinder and mixed with the requisite amount of control feed for each diet. The experimental
feeds were prepared in bulk and the same batch of the feeds were utilized for all tests.
The second experimental setup (“bulk setup,” Fig. C.2b) enabled the collection of
su�cient shrimp biomass to conduct HBCD chemical analysis. Fifty postlarvae were placed
in a 20 L tank filled with 14 L of aquarium water with constant aeration. A 50% water
change was conducted every 3 days. The same experimental diets were tested as in the
toxicity setup, excluding the diets composed of 100% MWB due to the high mortality
caused by that diet (total of 6 experimental diets in addition to a control group, fed daily).
After 14 days, the surviving shrimp were sacrificed (transferred to ice-water bath for >10
mins) for HBCD analysis (SI Method C.1.2 and Fig. C.3 for further details).
C.1.4 Mealworm depuration experimental conditions
Depuration tests post feeding of PS were conducted to investigate accumulation of HBCD
in mealworm tissues over time periods that were comparable to the retention time of PS in
126 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
the mealworm gut (15 -– 20 hr).[18]
The expected intake of HBCD was determined for the mealworms fed PS-H and PS-L
(calculated as the average amount of HBCD consumed for each diet [ng/72 hr], normalized to
10 mealworms. To assess the impact of the presence polystyrene on HBCD bioaccumulation
and egestion, bran was spiked with HBCD at levels comparable to PS-H and PS-L and fed
directly to mealworms, referred to as Bran-H and Bran-L, respectively. HBCD was added at
a concentration of 30 µg/g or 0.05 µg/g for Bran-H and Bran-L comparisons, respectively,
to bran by spiking HBCD into 1 mL of DI water, which was then mixed and uniformly
applied to 4.5 g of bran and allowed to dry in a sealed container prior to being fed to
mealworms. Bran-H and Bran-L were analyzed for HBCD concentration (in triplicate,
following SI Method C.1.2) after drying and no loss of HBCD was detected through the
bran preparation process. After 72 hr of feeding, ten mealworms from all diets were collected
at 0, 24, and 48 hr of depuration (starvation conditions), in triplicate, for analysis of the
egestion of HBCD.
C.2. TABLES 127
C.2 Tables
Table C.1: Characterization of the two PS foams tested in this study (mean ± SD, n = 4)including concentration of HBCD, density, molecular weight (both number-averaged, Mn,and weight-averaged, Mw), and source. ESP — expanded polystyrene foam.
C.3. FIGURES 129
Figure C.1: Schematic diagram showing the two mealworm experimental setups utilized.(a) The mass balance experimental setup to track HBCD (see methods “mealworm growthconditions”) with 200 mealworms in individual containers in duplicate for each experimentaldiet. Maintenance (weighing of plastic and frass, addition of bran, survival) and sacrificeschedule described on the bottom. Data from this experimental setup utilized in Fig. 4.2 andFig. 4.4. (b) The bulk experimental setup to collect su�cient mealworm biomass to produceaquaculture feed for the higher trophic level bioaccumulation studies. Larger containers weremaintained under the same condition as the mass balance experience. Images not to scale.
Figure C.2: Schematic diagram illustrating the two experimental setups utilized to assesssecondary trophic level e↵ects of HBCD utilizing L. vannamei. (a) The toxicity and survivalexperimental setup. Postlarvae (PL 28) were placed in individual cups and then survivalwas monitored daily for Kaplan-Meier survival analysis in addition to daily water changesand feeding. (b) The bulk experimental setup to obtain su�cient L. vannamei biomassfor HBCD analysis. Fifty postlarvae were placed in a 20 L tank filled with 14 L of waterfed with the same experimental diets as those in the toxicity setup. A 50% water changewas conducted every 3 days. After 14 days, the surviving shrimp were sacrificed for HBCDanalysis. Images not to scale.
130 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
Figure C.3: Sample preparation for HBCD analysis via gas chromatography equipped witha micro electron capture detector (GC- µECD). Schematic diagram showing the sampleprocessing for HBCD analysis for the three types of samples studied. On the left, mealwormbiomass sample processing including the three types of biomass tested (gut track, non-guttrack, frass). In the middle, shrimp biomass sample processing. On the right, plasticcontrols sample processing. Addition of surrogate standard and internal standard in thesample analysis represented by Surg. Std. and Int. Std., respectively.
C.3. FIGURES 131
50 100 15050
100
150
Actual Number of Pupae
Pre
dict
ed N
umbe
r of
Pup
ae
BranPS-HPS-H + branPS-LPS-L+branLine of identity
Figure C.4: Predicted versus actual number of pupae, based on a multiple regression analysisto assess the impact of amount of bran, PS, and HBCD consumed on pupation (model R2 =0.95), plotted by diet. The grey dashed line shows the line of identity (y = x). This analysisrevealed that bran consumption was a significant (p < 0.0001) predictor of pupation ratewhile HBCD consumption was not (p > 0.05)
132 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
Week 1 Week 2 Week 3 Week 40
2×105
4×105
6×105
8×105
HB
CD
(ng)
Week 1 Week 2 Week 3 Week 40
20
40
60
100001200014000
Bod
y B
urde
n PS
- H
(ng
HB
CD
/ g dw
)
EWI
Week 1 Week 2 Week 3 Week 40
100
200
300
HB
CD
(ng)
Consumed in PS
Egested in Frass
Week 1 Week 2 Week 3 Week 40.00.10.20.30.40.50.63.03.54.0
Bod
y B
urde
n PS
- L
(ng
HB
CD
/ g dw
) Gut trackBody tissuesMDL
EWI
(a) (b)
(c) (d)
Figure C.5: Fate tracking of HBCD in T. molitor in co-fed diets (PS-H + bran, PS-L +bran). (a, b) Amount of HBCD consumed in PS (grey bars) coupled with the amountof HBCD egested in frass (purple bars) from each container (a: PS-H + bran, b: PS-L +bran). Amount of HBCD consumed was calculated as total plastic consumed per week [g] ⇥the concentration of HBCD in the plastic [ng/g]. Amount of HBCD egested was calculatedas the concentration of HBCD in the weekly representative clean frass sample [ng/g] ⇥the total frass collected for the week [g]. (c, d) Body burden of HBCD [ng/g dry weight]in mealworm tissues (gut track or non-gut body tissues) weekly, plotted with the methoddetection limit (MDL) (c: PS-H + bran, d: PS-L + bran). Expected weekly intake (EWI)of HBCD was calculated as the average amount of HBCD consumed for each diet [ng/week],normalized to 10 mealworms, and is plotted for comparison. All values represent mean SD,n = 2.
PS-H PS-L Mealworm gut biomass
Mealworm biomass
Shrimp biomass
0
10
20
30
40
50
60
70
80
90
100
110
Rec
over
y Ef
ficie
ncy
(%)
PS-H PS-L Mealworm gut-track
Mealworm non-gut biomass
Mealworm frass
Shrimp biomass
0
10
20
30
40
50
60
70
80
90
100
110
Rec
over
y Ef
ficie
ncy
(%)
Accepted range 40 - 100%
(a) (b)
Figure C.6: Recovery e�ciency of surrogate standard in di↵erent sample types includingPS foams (PS-L, PS-H) as well as mealworm and shrimp biomass. (a) Results from thepreliminary analysis of each sample type to determine an accepted range for recovery e�-ciency. (b) Recovery e�ciencies across all samples in this study. Gray dashed lines showthe upper and lower bound of the accepted range, 40 -– 100%.
C.3. FIGURES 133
Week 1 Week 2 Week 3 Week 40
50
100PS-H
PS-L
PS-H + Bran
PS-L + Bran
HB
CD
Rec
over
ed (%
)
Figure C.7: Mass balance on HBCD in the mealworm experiments. Percent of ingestedHBCD recovered (combined) in the three types of mealworm tissues (frass, gut track, bodytissues) by diet for each week. Surrogate standard recovery e�ciencies (Fig. C.6b) wereused to estimate the HBCD recovered each week. Average HBCD recovered by diet, PS-H:94.14 ± 4.73%; PS-H + Bran: 94.65 ± 4.75%; PS-L: 92.60 ± 7.23%; PS-L + Bran: 94.48± 4.33%.
0 500 10000
5000
10000
15000
20000
25000
HBCD Concentration (µg)
Res
pons
e Fa
ctor
α-HBCDβ-HBCDγ-HBCDα-, β-, γ-HBCD (equal concentrationof each)
Figure C.8: Standard curves for the main stereoisomers of HBCD (a-, b-, and g-HBCD)individually and in combination (at equal concentrations of each) on the GC-ECD, plottedwith 95% confidence intervals. The slopes of response factors are statistically indistinguish-able (p = 0.16).
134 APPENDIX C. SUPPORTING INFORMATION FOR CHAPTER 4
24-hour Starvation
48-hour Starvation
0.0
0.5
1.0
1.5
2.0
2.5
3.0
3.5
Log
redu
ctio
n
PS-HPS-Lns
ns
Bran-HBran-L
nsns
***
***
Figure C.9: Log removal of HBCD at each sampling time for mealworms fed PS-H, PS-Lor bran-spiked with HBCD (Bran-H and Bran-L). All values represent mean SD, n = 3.Significance (two-way ANOVA, Bonferroni multiple test correction) p 0.001 indicated by⇤ ⇤ ⇤, no statistical significance indicated by ns.
136 APPENDIX D. SUPPORTING INFORMATION FOR CHAPTER 5
D.1 Tables
Table D.1: Cost, material properties, and suitability for various thermal manufacturing pro-cesses for common synthetic petroleum-derived plastics and plastic replacement materials.Cost estimates for petroleum-derived plastic were obtained from the historic resin pricingdatabase for 2018, range of lowest to highest prices reported (a) [138]. Cost estimates for re-placement materials were obtained from the 2013 Bioplastics in California report (b) [155].References for thermal and material properties for each polymer listed after the polymername: (c) Castilho et al., 2009 [26]; (d) Andreeben et al., 2014 [4]; (e) Farah et al., 2016[57]. Suitability for manufacturing based on insights from (f) Applied Plastics EngineeringHandbook [98] as well as (g) 3D printing with biomaterials: Towards a sustainable andcircular economy [186].
Bibliography
[1] American Chemical Society National Historic Chemical Landmarks. Bakelite: The
World’s First Synthetic. American Chemistry Society, 1993.
[2] Aly E. Abo-Amer. Biodegradation of diazinon by Serratia marcescens DI101 and
its use in bioremediation of contaminated environment. Journal of Microbiology and
Biotechnology, 21(1):71–80, 2011.
[3] Anthony L Andrady. Common Plastics Materials. In Plastics and Environment,
chapter Common Pla, pages 77–121. 2005.
[4] Bjorn Andreeben, Nicolas Taylor, and Alexander Steinbuchela. Poly(3-
hydroxypropionate): A promising alternative to fossil fuel-based materials. Applied
and Environmental Microbiology, 80(21):6574–6582, 2014.
[5] David A Armbruster and Terry Pry. Limit of blank, limit of detection and limit of
quantitation. The Clinical biochemist. Reviews, 2008.
[6] L. Bardi, A. Mattei, and S. Ste↵an. Hydrocarbon degradation by a soil microbial
population with �-cyclodextrin as surfactant to enhance bioavailability. Enzyme and
Microbial Technology, 27(9):709–713, 2000.
[7] Evan S. Beach, Brian R. Weeks, Rebecca Stern, and Paul T. Anastas. Plastics addi-
tives and green chemistry. Pure and Applied Chemistry, 85(8):1611–1624, 2013.
[8] Yoav Benjamini and Yosef Hochberg. Controlling the false discovery rate: a practical
and powerful approach to multiple testing. Journal of the Royal Statistical Society.
Series B (Methodological), 57(1):289–300, 1995.
137
138 BIBLIOGRAPHY
[9] Ellen Besseling, Anna Wegner, Edwin M. Foekema, Martine J. Van Den Heuvel-Greve,
and Albert A. Koelmans. E↵ects of microplastic on fitness and PCB bioaccumula-
tion by the lugworm Arenicola marina (L.). Environmental Science and Technology,
47(1):593–600, 2013.
[10] I. Biasato, M. De Marco, L. Rotolo, M. Renna, C. Lussiana, S. Dabbou, M.T. Capuc-
chio, E. Biasibetti, P. Costa, F. Gai, L. Pozzo, D. Dezzutto, S. Bergagna, S. Martınez,
M. Tarantola, L. Gasco, and A. Schiavone. E↵ects of dietary Tenebrio molitor meal
inclusion in free-range chickens. Journal of Animal Physiology and Animal Nutrition,
100(6):1104–1112, 2016.
[11] Linda S Birnbaum and Daniele F Staskal. Brominated flame retardants: cause for
concern? Environmental health perspectives, 112(1):9–17, 2004.
[12] Christopher Blum, Dirk Bunke, Maximilian Hungsberg, Elsbeth Roelofs, Anke Joas,
Reinhard Joas, Markus Blepp, and Hans Christian Stolzenberg. The concept of sus-
tainable chemistry: Key drivers for the transition towards sustainable development.
Sustainable Chemistry and Pharmacy, 5(June 2016):94–104, 2017.
[13] Cedric Boisart and Emmanuel Maille. Method for Recycling Plastic Products, 2014.
[14] Paolo Bombelli, Christopher J. Howe, and Federica Bertocchini. Polyethylene bio-
degradation by caterpillars of the wax moth Galleria mellonella. Current Biology,
27(8):R292–R293, 2017.
[15] Sudarat Boonchan, Margaret L. Britz, and Grant A. Stanley. Surfactant-enhanced
biodegradation of high molecular weight polycyclic aromatic hydrocarbons by
stenotrophomonas maltophilia. Biotechnology and Bioengineering, 59(4):482–494,
1998.
[16] Anja Malawi Brandon and Craig S. Criddle. Can biotechnology turn the tide on
plastics? Current Opinion in Biotechnology, 57:160–166, 2019.
[17] Anja Malawi Brandon, Sahar H El Abbadi, Uwakmfon A Ibekwe, Yeo-Myoung Cho,
Wei-Min Wu, and Craig S Criddle. Fate of Hexabromocyclododecane (HBCD), A
Common Flame Retardant, In Polystyrene-Degrading Mealworms: Elevated HBCD
Levels in Egested Polymer but No Bioaccumulation. Environmental Science & Tech-
nology, 54(1):acs.est.9b06501, dec 2019.
BIBLIOGRAPHY 139
[18] Anja Malawi Brandon, Shu-Hong Gao, Renmao Tian, Daliang Ning, Shanshan Yang,
Jizhong Zhou, Wei-Min Wu, and Craig S. Criddle. Biodegradation of Polyethylene
and Plastic Mixtures in Mealworms (Larvae of Tenebrio molitor ) and E↵ects on the
Gut Microbiome. Environmental Science & Technology, 52(11):6526–6533, jun 2018.
[19] J. Breznak. Role of Microorganisms in the Digestion of Lignocellulose by Termites.
Annual Review of Entomology, 39(1):453–487, 1994.
[20] Amy L Brooks, Shunli Wang, and Jenna R Jambeck. The Chinese import ban and
its impact on global plastic waste trade. 4:eaat0131, 2018.
[21] Andreas Brune. Termite guts : the world ’s smallest bioreactors. Trends in Biotech-
nology, 16:115–120, 1998.
[22] Andreas Brune, Zachary J. Karl, Michael E. Scharf, D. G. Boucias, Y. Cai, Y. Sun,
V. U. Lietze, R. Sen, R. Raychoudhury, M. E. Scharf, A. Brune, L. Deschaletes,
K. C. Yu, J. E. Eger, M. D. Lees, P. A. Neese, T. H. Atkinson, E. M. Thoms, M. T.
Messenger, J. J. Demark, L. C. Lee, E. L. Vargo, M. P. Tolley, J. E. Eger, D. E.
Williams, S. M. Mirasol, M. P. Tolley, J. J. DeMark, M. T. Messenger, P. J. Howard,
J. E. Eger, R. L. Hamm, J. J. Demark, E. Chin-Heady, M. P. Tolley, E. P. Benson,
P. A. Zungoli, M. S. Smith, N. A. Spomer, T. A. Evans, N. Iqbal, G. M. Getty,
C. W. Solek, R. J. Sbragia, M. I. Haverty, V. R. Lewis, G. J. Glenn, J. W. Austin,
R. E. Gold, I. Haifig, F. B. F. Marchetti, A. M. Costa-Leonardo, R. L. Hamm, J. J.
DeMark, E. Chin-Heady, M. P. Tolley, Z. J. Karl, M. E. Scharf, J. Ni, G. Tokuda,
W. L. Nutting, B. F. Peterson, H. L. Stewart, M. E. Scharf, J. H. Roe, E. W. Price,
R. K. Saran, M. K. Rust, R. K. Saran, M. K. Rust, M. E. Scharf, M. E. Scharf, M. E.
Scharf, A. Tartar, M. E. Scharf, Z. J. Karl, A. Sethi, D. G. Boucias, A. Sethi, M. E.
Scharf, A. Sethi, J. M. Slack, E. S. Kovaleva, G. W. Buchman, M. E. Scharf, A. Sethi,
E. S. Kovaleva, J. M. Slack, S. Brown, G. W. Buchman, M. E. Scharf, A. L. Szalanski,
J. W. Austin, C. B. Owens, A. Tartar, M. M. Wheeler, X. Zhou, M. R. Coy, D. G.
Boucias, M. E. Scharf, G. Tokuda, H. Watanabe, B. A. Wallace, T. M. Judd, D. A.
Waller, and A. D. Curtis. Symbiotic digestion of lignocellulose in termite guts. Nature
Reviews Microbiology, 12(3):168–80, 2014.
[23] L. D. Bushnell and H. F. Haas. The Utilization of Certain Hydrocarbons by Microor-
ganisms. Journal of Bacteriology, 1941.
140 BIBLIOGRAPHY
[24] J Gregory Caporaso, Justin Kuczynski, Jesse Stombaugh, Kyle Bittinger, Fred-
eric D Bushman, Elizabeth K Costello, Noah Fierer, Antonio Gonzalez Pena, Julia K
Goodrich, Je↵rey I Gordon, Gavin A Huttley, Scott T Kelley, Dan Knights, Jeremy E
Koenig, Ruth E Ley, Catherine A Lozupone, Daniel McDonald, Brian D Muegge,
Meg Pirrung, Jens Reeder, Joel R Sevinsky, Peter J Turnbaugh, William A Walters,
JeremyWidmann, Tanya Yatsunenko, Jesse Zaneveld, and Rob Knight. QIIME allows
analysis of high-throughput community sequencing data. Nature methods, 7(5):335–6,
2010.
[25] Bryan J Cassone, Harald C Grove, Oluwadara Elebute, Sachi M P Villanueva, and
Christophe M R Lemoine. Role of the intestinal microbiome in low-density polyethy-
lene degradation by caterpillar larvae of the greater wax moth , Galleria mellonella.
pages 9–11, 2020.
[26] Leda R. Castilho, David A. Mitchell, and Denise M.G. Freire. Production of poly-
hydroxyalkanoates (PHAs) from waste materials and by-products by submerged and
solid-state fermentation. Bioresource Technology, 100(23):5996–6009, 2009.
[27] Frederic Chaillan, Anne Le Fleche, Edith Bury, Y. Hui Phantavong, Patrick Grimont,
Alain Saliot, and Jean Oudot. Identification and biodegradation potential of tropical
aerobic hydrocarbon-degrading microorganisms, 2004.
[28] Min Fey Chek, Sun-Yong Kim, Tomoyuki Mori, Hasni Arsad, Mohammed Razip
Samian, Kumar Sudesh, and Toshio Hakoshima. Structure of polyhydroxyalkanoate
(PHA) synthase PhaC from Chromobacterium sp. USM2, producing biodegradable
plastics. Scientific Reports, 7(1):1–15, 2017.
[29] Guo-Qiang Chen and Xiao-Ran Jiang. Engineering bacteria for enhanced polyhydrox-
yalkanoates (PHA) biosynthesis. Synthetic and Systems Biotechnology, 2(3):192–197,
2017.
[30] Guo-Qiang Chen, Xiao-Ran Jiang, and Yingying Guo. Synthetic biology of microbes
synthesizing polyhydroxyalkanoates (PHA). Synthetic and Systems Biotechnology,
1(4):236–242, 2016.
BIBLIOGRAPHY 141
[31] Shuona Chen, Hua Yin, Jinshao Ye, Hui Peng, Na Zhang, and Baoyan He. E↵ect
of copper(II) on biodegradation of benzo[a]pyrene by Stenotrophomonas maltophilia.
Chemosphere, 90(6):1811–1820, 2013.
[32] In-hag Choi, Joo-min Kim, Nam-jung Kim, Jeong-dae Kim, Chul Park, and Jong-
hwan Park. Replacing fish meal by mealworm (Tenebrio molitor) on the growth
performance and immunologic responses of white shrimp (Litopenaeus vannamei).
Acta Scientiarum. Animal Sciences, 40:e39077, 2018.
[33] Clean Production Action. What is Clean Production Action?, 2018.
[34] Matthew Cole, Pennie Lindeque, Elaine Fileman, Claudia Halsband, Rhys Goodhead,
Julian Moger, and Tamara S. Galloway. Microplastic ingestion by zooplankton. En-
vironmental Science and Technology, 47(12):6646–6655, 2013.
[35] Matthew Cole, Pennie Lindeque, Claudia Halsband, and Tamara S. Galloway. Mi-
croplastics as contaminants in the marine environment: A review. Marine Pollution
Bulletin, 62(12):2588–2597, 2011.
[36] Adrian Covaci, Andreas C. Gerecke, Robin J. Law, Stefan Voorspoels, Martin Kohler,
Norbert V. Heeb, Heather Leslie, Collin R. Allchin, and Jacob De Boer. Hexabromo-
cyclododecanes (HBCDs) in the environment and humans: A review. Environmental
Science and Technology, 40(12):3679–3688, 2006.
[37] Kieran D. Cox, Garth A. Covernton, Hailey L. Davies, John F. Dower, Francis Juanes,
and Sarah E. Dudas. Human Consumption of Microplastics. Environmental Science
and Technology, 53(12):7068–7074, 2019.
[38] Roselien Crab, Bram Chielens, Mathieu Wille, Peter Bossier, and Willy Verstraete.
The e↵ect of di↵erent carbon sources on the nutritional value of bioflocs, a feed for
Macrobrachium rosenbergii postlarvae. Aquaculture Research, 2010.
[39] You Wei Cui, Xiao Yu Gong, Yun Peng Shi, and Zhiwu Wang. Salinity e↵ect on
production of PHA and EPS by Haloferax mediterranei. RSC Advances, 2017.
[40] Mariusz Cycon, Marcin Wojcik, and Zofia Piotrowska-Seget. Biodegradation of the
organophosphorus insecticide diazinon by Serratia sp. and Pseudomonas sp. and their
use in bioremediation of contaminated soil. Chemosphere, 76(4):494–501, 2009.
142 BIBLIOGRAPHY
[41] Kishore Das and Ashis K. Mukherjee. Crude petroleum-oil biodegradation e�ciency
of Bacillus subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil
contaminated soil from North-East India. Bioresource Technology, 98(7):1339–1345,
2007.
[42] Defra, Enviros, Scott Wilson, and Mark Hannan. Review of England’s Waste Strategy
Environmental Report under the “SEA” Directive. Technical report, 2006.
[43] Peter L. DeFur. Use and role of invertebrate models in endocrine disruptor research
and testing. ILAR journal, 45(4):484–493, 2004.
[44] T.S. Dhadialla, A. Retnakaran, and G. Smagghe. Insect Growth- and Development-
Disrupting Insecticides. In Comprehensive Molecular Insect Science. 2005.
[45] Karolin Dietrich, Marie Josee Dumont, Luis F. Del Rio, and Valerie Orsat. Producing
PHAs in the bioeconomy — Towards a sustainable bioplastic. Sustainable Production
and Consumption, 9(August 2016):58–70, 2017.
[46] Rachid Dris, Johnny Gasperi, and Bruno Tassin. Sources and Fate of Microplastics
in Urban Areas: A Focus on Paris Megacity. In Martin Wagner and Scott Lambert,
editors, Freshwater Microplastics : Emerging Environmental Contaminants?, pages
69–83. Springer International Publishing, Cham, 2018.
[47] Robert C Edgar. UPARSE: highly accurate OTU sequences from microbial amplicon
reads. Nature Methods, 10(10):996–998, 2013.
[48] Ellen MacArthur Foundation. The New Plastics Economy: Rethinking the future of
plastics. Ellen MacArthur Foundation, (January):120, 2016.
[49] Moataz A. Elsawy, Ki Hyun Kim, Jae Woo Park, and Akash Deep. Hydrolytic degra-
dation of polylactic acid (PLA) and its composites. Renewable and Sustainable Energy
Reviews, 79(June 2016):1346–1352, 2017.
[50] Satoshi Endo and Albert A. Koelmans. Sorption of Hydrophobic Organic Compounds
to Plastics in the Marine Environment: Equilibrium. Hdb Env Chem, (October):41–
53, 2010.
[51] Philipp Engel and Nancy A Moran. The gut microbiota of insects - diversity in
structure and function. FEMS microbiology reviews, 37(5):699–735, 2013.
BIBLIOGRAPHY 143
[52] Richard E. Engler. The complex interaction between marine debris and toxic chemicals
in the ocean. Environmental Science and Technology, 46(22):12302–12315, 2012.
[53] EPA. Advancing Sustainable Materials Management: Facts and Figures Report.
United States Environmental Protection Agency, (November), 2019.
[54] AM Escalona, AM Gomis, and FR Varela. Procedure for extraction of polyhydrox-
yalkanoates from halophilic bacteria which contain them. US Patent 5,536,419, pages
3–6, 1996.
[55] AM Escalona, AM Gomis, and FR Varela. Procedure for extraction of polyhydrox-
yalkanoates from halophilic bacteria which contain them, 1996.
[56] European Bioplastics. Bioplastics- facts and figure. Technical report, 2017.
[57] Shady Farah, Daniel G. Anderson, and Robert Langer. Physical and mechanical
properties of PLA, and their functions in widespread applications — A comprehensive
review. Advanced Drug Delivery Reviews, 107:367–392, 2016.
[58] Pengfei Feng, Jinzhao He, Min Lv, Guanghua Huang, Xiuli Chen, Qiong Yang, Jianbo
Wang, Dapeng Wang, and Huawei Ma. E↵ect of dietary Tenebrio molitor protein on
growth performance and immunological parameters in Macrobrachium rosenbergii.
Aquaculture, page 734247, 2019.
[59] Michael M. Fisher. Plastics Recycling. 2005.
[60] Mary Ann Franden, Lahiru N. Jayakody, Wing-Jin Li, Neil J. Wagner, Nicholas S.
Cleveland, William E. Michener, Bernhard Hauer, Lars M. Blank, Nick Wierckx,
Janosch Klebensberger, and Gregg T. Beckham. Engineering Pseudomonas putida
KT2440 for e�cient ethylene glycol utilization. Metabolic Engineering, 48(June):197–
207, 2018.
[61] Mary Ann Franden, Lahiru N. Jayakody, Wing Jin Li, Neil J. Wagner, Nicholas S.
Cleveland, William E. Michener, Bernhard Hauer, Lars M. Blank, Nick Wierckx,
Janosch Klebensberger, and Gregg T. Beckham. Engineering Pseudomonas putida
KT2440 for e�cient ethylene glycol utilization. Metabolic Engineering, 48(June):197–
207, 2018.
144 BIBLIOGRAPHY
[62] R R Fulthorpe and D G Allen. Evaluation of biolog MT plates for aromatic and
chloroaromatic substrate utilization tests. Can. J. Microbiol./Rev. Can. Microbiol.,
40:1067–1071, 1994.
[63] Jay L Garland and Aaron L Mills. Classification and Characterization of Het-
erotrophic Microbial Communities on the Basis of Patterns of Community-Level.
Applied and Environmental Microbiology, 57(8):2351–2359, 1991.
[64] Laura Gasco, Morgane Henry, Giovanni Piccolo, Stefania Marono, Francesco Gai,
Manuela Renna, Carola Lussiana, Efthimia Antonopoulou, Paula Mola, and Stavros
Chatzifotis. Tenebrio molitor meal in diets for European sea bass (Dicentrarchus
labrax L.) juveniles: Growth performance, whole body composition and in vivo ap-
parent digestibility. Animal Feed Science and Technology, 220:34–45, 2016.
[65] R. Gautam, A .S. Bassi, and E. K. Yanful. A Review of Biodegradation of Synthetic
Plastic and Foams. Applied Biochemistry And Biotechnology, 141(2):85–108, 2007.
[66] Roland Geyer, Jenna R. Jambeck, and Kara Lavender Law. Production, use, and fate
of all plastics ever made. Science Advances, 3(7):e1700782, 2017.
[67] D. J.W. Grant. The oxidative degradation of benzoate and catechol by Klebsiella
aerogenes (Aerobacter aerogenes). Antonie van Leeuwenhoek, 36(1):161–177, 1970.
[68] Kevin Gravouil, Romain Ferru-Clement, Steven Colas, Reynald Helye, Linette Kadri,
Ludivine Bourdeau, Bouziane Moumen, Anne Mercier, and Thierry Ferreira. Tran-
scriptomics and Lipidomics of the Environmental Strain Rhodococcus ruber Point out
Consumption Pathways and Potential Metabolic Bottlenecks for Polyethylene Degra-
dation. Environmental Science and Technology, 51(9):5172–5181, 2017.
[69] James E Guillet, Thomas W. Regulski, and T Brian Mcaneney. Biodegradability of
Photodegraded Polymers II. Tracer Studies of Biooxidation of Ecolyte PS Polystyrene.
Environmental Science & Technology, 8(10):923–925, 1974.
[70] Mahbod Hajighasemi, Boguslaw P. Nocek, Anatoli Tchigvintsev, Greg Brown, Robert
Flick, Xiaohui Xu, Hong Cui, Tran Hai, Andrzej Joachimiak, Peter N. Golyshin,
Alexei Savchenko, Elizabeth A. Edwards, and Alexander F. Yakunin. Biochemi-
cal and Structural Insights into Enzymatic Depolymerization of Polylactic Acid and
BIBLIOGRAPHY 145
Other Polyesters by Microbial Carboxylesterases. Biomacromolecules, 17(6):2027–
2039, 2016.
[71] Lauren Hale and David Crowley. DNA extraction methodology for biochar-amended
sand and clay. Biology and Fertility of Soils, 51(6):733–738, 2015.
[72] Miranda Harmon-Smith, Laura Celia, Olga Chertkov, Alla Lapidus, Alex Copeland,
Tijana Glavina Del Rio, Matt Nolan, Susan Lucas, Hope Tice, Jan-Fang Cheng,
Cli↵ Han, John C Detter, David Bruce, Lynne Goodwin, Sam Pitluck, Amrita Pati,
Konstantinos Liolios, Natalia Ivanova, Konstantinos Mavromatis, Natalia Mikhailova,
Amy Chen, Krishna Palaniappan, Miriam Land, Loren Hauser, Yun-Juan Chang,
Cynthia D Je↵ries, Thomas Brettin, Markus Goker, Brian Beck, James Bristow,
Jonathan a Eisen, Victor Markowitz, Philip Hugenholtz, Nikos C Kyrpides, Hans-
Peter Klenk, and Feng Chen. Complete genome sequence of Sebaldella termitidis
type strain (NCTC 11300). Standards in genomic sciences, 2(2):220–7, 2010.
[73] Line S. Haug, Cathrine Thomsen, Veronica H. Liane, and Georg Becher. Comparison
of GC and LC determinations of hexabromocyclododecane in biological samples -
Results from two interlaboratory comparison studies. Chemosphere, 71(6):1087–1092,
2008.
[74] Je↵erson Hopewell, Robert Dvorak, and Edward Kosior. Plastics recycling: Chal-
lenges and opportunities. Philosophical Transactions of the Royal Society B: Biological
Sciences, 364(1526):2115–2126, 2009.
[75] Alice A. Horton, Alexander Walton, David J. Spurgeon, Elma Lahive, and Claus
Svendsen. Microplastics in freshwater and terrestrial environments: Evaluating the
current understanding to identify the knowledge gaps and future research priorities.
Science of The Total Environment, 2017.
[76] Valeria Iaconisi, Stefania Marono, Giuliana Parisi, Laura Gasco, Lucrezia Genovese,
Giulia Maricchiolo, Fulvia Bovera, and Giovanni Piccolo. Dietary inclusion of Tene-
brio molitor Larvae meal: E↵ects on growth performance and final quality treats of
blackspot sea bream (Pagellus bogaraveo). Aquaculture, 476:49–58, 2017.
146 BIBLIOGRAPHY
[77] Haytham M.M. Ibrahim. Biodegradation of used engine oil by novel strains of
Ochrobactrum anthropi HM-1 and Citrobacter freundii HM-2 isolated from oil-
contaminated soil. 3 Biotech, 6(2):1–13, 2016.
[78] Hedda Inderthal, Siew Leng Tai, and Susan T.L. Harrison. Non-Hydrolyzable Plastics
– An Interdisciplinary Look at Plastic Bio-Oxidation. Trends in Biotechnology, pages
1–12, 2020.
[79] Jenna R Jambeck, Roland Geyer, Chris Wilcox, Theodore R Siegler, Miriam Perry-
man, Anthony Andrady, Ramani Narayan, and Kara Lavender Law. Plastic waste
inputs from land into the ocean. Science (New York, N.Y.), 347(6223):768–771, 2015.
[80] Mi Jang, Won Joon Shim, Gi Myung Han, Manviri Rani, Young Kyoung Song, and
Sang Hee Hong. Styrofoam Debris as a Source of Hazardous Additives for Marine
Organisms. Environmental Science & Technology, 50(10):4951–4960, 2016.
[81] Dieter Jendrossek and Daniel Pfei↵er. New insights in the formation of polyhydrox-
yalkanoate granules (carbonosomes) and novel functions of poly(3-hydroxybutyrate),
2014.
[82] Yang Jiang, Yu Dimitry, Robbert Kleerebezem, Gerard Muyzer, and Mark van Loos-
drecht. Plasticicumulans acidivorans gen. nov., sp. nov., a polyhydroxyalkanoate-
accumulating gammaproteobacterium from a sequencing-batch bioreactor. Interna-
tional Journal of Systematic and Evolutionary Microbiology, 61(9):2314–2319, 2011.
[83] Katja Johnson, Yang Jiang, Robbert Kleerebezem, Gerard Muyzer, and Mark C.M.
Van Loosdrecht. Enrichment of a mixed bacterial culture with a high polyhydrox-
yalkanoate storage capacity. In Biomacromolecules, 2009.
[84] L D Jones, R W Cooper, R S Harding, R S Harding, J W M Rudd, C A Kelly, D W
Schindler, and M A Turner. Composition of Mealworm Tenebrio molitor Larvae. The
Journal of Zoo Animal Medicine, 3(4):34–41, 1972.
[85] Yu Kyung Jung and Sang Yup Lee. E�cient production of polylactic acid and its
copolymers by metabolically engineered Escherichia coli. Journal of Biotechnology,
151(1):94–101, 2011.
BIBLIOGRAPHY 147
[86] Mehlika Karamanlioglu, Richard Preziosi, and Geo↵rey D. Robson. Abiotic and bi-
otic environmental degradation of the bioplastic polymer poly(lactic acid): A review.
Polymer Degradation and Stability, 137:122–130, 2017.
[87] Shane T. Kenny, Jasmina Nikodinovic Runic, Walter Kaminsky, Trevor Woods,
Ramesh P. Babu, and Kevin E. O’Connor. Development of a bioprocess to convert
PET derived terephthalic acid and biodiesel derived glycerol to medium chain length
polyhydroxyalkanoate. Applied Microbiology and Biotechnology, 95(3):623–633, 2012.
[88] Azeem Khalid, Muhammad Arshad, and David E. Crowley. Biodegradation potential
of pure and mixed bacterial cultures for removal of 4-nitroaniline from textile dye
wastewater. Water Research, 43(4):1110–1116, 2009.
[89] Hong Rae Kim, Hyun Min Lee, Hee Cheol Yu, Eunbeen Jeon, Sukkyoo Lee, Jiaojie
Li, and Dae-Hwan Kim. Biodegradation of Polystyrene by Pseudomonas sp. Isolated
from the Gut of Superworms (Larvae of Zophobas atratus). Environmental Science
& Technology, 2020.
[90] Jieun Kim, Yeo Jin Kim, So Young Choi, Sang Yup Lee, and Kyung Jin Kim. Crystal
structure of Ralstonia eutropha polyhydroxyalkanoate synthase C-terminal domain
and reaction mechanisms. Biotechnology Journal, 12(1), 2017.
[91] Hyun Gi Kong, Hyun Ho Kim, Joon hui Chung, Je Hoon Jun, Soohyun Lee, Hak Min
Kim, Sungwon Jeon, Seung Gu Park, Jong Bhak, and Choong Min Ryu. The Galleria
mellonella Hologenome Supports Microbiota-Independent Metabolism of Long-Chain
Hydrocarbon Beeswax. Cell Reports, 26(9):2451–2464.e5, 2019.
[92] Emmanouela Korkakaki, Mark C.M. van Loosdrecht, and Robbert Kleerebezem. Im-
pact of phosphate limitation on PHA production in a feast-famine process. Water
Research, 126:472–480, 2017.
[93] Martin C. Krueger, Hauke Harms, and Dietmar Schlosser. Prospects for microbio-
logical solutions to environmental pollution with plastics. Applied Microbiology and
Biotechnology, 99(21):8857–8874, 2015.
[94] R. Ajay Kumar, P. Gunasekaran, and M. Lakshmanan. Biodegradation of tannic acid
by Citrobacter freundii isolated from a tannery e✏uent. Journal of Basic Microbiology,
39(3):161–168, 1999.
148 BIBLIOGRAPHY
[95] Harsha Kundungal, Manjari Gangarapu, Saran Sarangapani, and Arunkumar
Patchaiyappan. E�cient biodegradation of polyethylene (HDPE) waste by the plastic-
eating lesser waxworm (Achroia grisella). Environmental Science and Pollution Re-
search, 2019.
[96] Joshua Kurek, Paul W. MacKeigan, Sarah Veinot, Angella Mercer, and Karen A.
Kidd. Ecological Legacy of DDT Archived in Lake Sediments from Eastern Canada.
Environmental Science & Technology, 2019.
[97] Gurusamy Kutralam-Muniasamy and Fermın Perez-Guevara. Genome characteristics
dictate poly-R-(3)-hydroxyalkanoate production in Cuprividus necator H16. World
Journal of Microbiology and Biotechnology, 34(6):1–23, 2018.
[98] Myer Kutz. Applied Plastics Engineering Handbook. 2011.
[99] Heock Hoi Kwon, Eun Young Lee, Kyung Suk Cho, and Hee Wook Ryu. Benzene
biodegradation using the polyurethane biofilter immobilized with Stenotrophomonas
maltophilia T3-c. Journal of Microbiology and Biotechnology, 13(1):70–76, 2003.
[100] Kara Lavender Law. Plastics in the marine environment. Annual Review of Marine
Science, 9:205–229, 2017.
[101] M Lemoigne. Products of dehydration and of polymerization of �-hydroxybutyric
acid. Bull. Soc. Chim. Biol., 1926.
[102] Dan Li, Ping’an Peng, Zhiqiang Yu, Weilin Huang, and Yin Zhong. Reductive trans-
formation of hexabromocyclododecane (HBCD) by FeS. Water Research, 101:195–202,
2016.
[103] Zibiao Li, Jing Yang, and Xian Jun Loh. Polyhydroxyalkanoates: Opening doors for
a sustainable future. NPG Asia Materials, 8(4):e265–20, 2016.
[104] J on E Lindstrom, Ronald P Barry, and Joan F Braddock. Microbial Community
Analysis: A Kinetic Approach to Constructing Potential C Source Utilization Pat-
terns. Soil Biology and Biochemistry, 30(2):231–239, 1998.
[105] Yu Lou, Pererva Ekaterina, Shanshan Yang, Baiyun Lu, Bing-Feng Liu, Nanqi Ren,
Philippe F.-X. Corvini, and Defeng Xing. Bio-degradation of Polyethylene and
BIBLIOGRAPHY 149
Polystyrene by Greater Wax Moth Larvae (Galleria mellonella L.) and the E↵ect
of Co-diet Supplementation on the Core Gut Microbiome. Environmental Science &
Technology, page acs.est.9b07044, 2020.
[106] Michael I Love, Wolfgang Huber, and Simon Anders. Moderated estimation of fold
change and dispersion for RNA-seq data with DESeq2. Genome Biology, 15(12):550,
2014.
[107] Gordon Lowe and Robert Bogue. Design for disassembly: A critical twenty-first
century discipline. Assembly Automation, 27(4):285–289, 2007.
[108] Richard G. Luthy, Yeo-Myoung Cho, Upal Ghosh, Todd S. Bridges, and Alan J.
Kennedy. Field testing of activated carbon mixing and in situ stabilization of PCBs
in sediment. Technical report, Stanford University, Department of Civil and Environ-
mental Engineering, 2009.
[109] R. M. Macrae and J. F. Wilkinson. Poly- -hyroxybutyrate Metabolism in Washed Sus-
pensions of Bacillus cereus and Bacillus megaterium. Journal of General Microbiology,
19(1):210–222, 1958.
[110] Mohamed H. Madkour, Daniel Heinrich, Mansour A. Alghamdi, Ibraheem I. Shab-
baj, and Alexander Steinbuchel. PHA recovery from biomass. Biomacromolecules,
14(9):2963–2972, 2013.
[111] Pathmalal M. Manage, Christine Edwards, Brajesh K. Singh, and Linda A. Law-
ton. Isolation and identification of novel microcystin-degrading bacteria. Applied and
Environmental Microbiology, 75(21):6924–6928, 2009.
[112] Xuhui Mao, Rui Jiang, Wei Xiao, and Jiaguo Yu. Use of surfactants for the remedi-
ation of contaminated soils: A review. Journal of Hazardous Materials, 285:419–435,
2015.
[113] Sherri A. Mason, Danielle Garneau, Rebecca Sutton, Yvonne Chu, Karyn Ehmann,
Jason Barnes, Parker Fink, Daniel Papazissimos, and Darrin L. Rogers. Microplastic
pollution is widely detected in US municipal wastewater treatment plant e✏uent.
Environmental Pollution, 218:1045–1054, 2016.
150 BIBLIOGRAPHY
[114] Yukie Mato, Tomohiko Isobe, Hideshige Takada, Haruyuki Kanehiro, Chiyoko Ohtake,
and Tsuguchika Kaminuma. Plastic resin pellets as a transport medium for toxic
chemicals in the marine environment. Environmental Science and Technology,
35(2):318–324, 2001.
[115] Karin Mattsson, Elyse V. Johnson, Anders Malmendal, Sara Linse, Lars Anders Hans-
son, and Tommy Cedervall. Brain damage and behavioural disorders in fish induced
by plastic nanoparticles delivered through the food chain. Scientific Reports, 7(1):1–7,
2017.
[116] R. M. McCormick and B. L. Karger. Guidelines For Data Acquisition And Data
Quality Evaluation In Environmental Chemistry. Analytical Chemistry, 1980.
[117] Jason P. McDevitt, Craig S. Criddle, Molly Morse, Robert C. Hale, Charles B. Bott,
and Chelsea M. Rochman. Addressing the Issue of Microplastics in the Wake of
the Microbead-Free Waters Act - A New Standard Can Facilitate Improved Policy.
Environmental Science and Technology, 51(12):6611–6617, 2017.
[118] Valeria Mezzolla, Oscar Fernando D’Urso, and Palmiro Poltronieri. Role of PhaC
type I and type II enzymes during PHA biosynthesis. Polymers, 10(8):1–12, 2018.
[119] Pier Miglietta, Federica De Leo, Marcello Ruberti, and Stefania Massari. Mealworms
for Food: A Water Footprint Perspective. Water, 7(11):6190–6203, nov 2015.
[120] Marcela Moreira de Souza, Tatiana Simonetto Colla, Francielle Bucker, Marco Flores
Ferrao, Chun Te Huang, Robson Andreazza, Flavio Anastacio de Oliveira Camargo,
and Fatima Menezes Bento. Biodegradation potential of Serratiamarcescens for
diesel/biodiesel blends. International Biodeterioration and Biodegradation, 110:141–
146, 2016.
[121] Md Salatul Islam Mozumder, Heleen De Wever, Eveline I.P. Volcke, and Linsey
Garcia-Gonzalez. A robust fed-batch feeding strategy independent of the carbon
source for optimal polyhydroxybutyrate production. Process Biochemistry, 49(3):365–
373, 2014.
[122] Paramasivam Murugan, Lizhu Han, Chee-yuen Gan, Frans H J Maurer, and Kumar
Sudesh. A new biological recovery approach for PHA using mealworm, Tenebrio
molitor. Journal of Biotechnology, 239:98–105, 2016.
BIBLIOGRAPHY 151
[123] Jaewook Myung, Wakuna M. Galega, Joy D. Van Nostrand, Tong Yuan, Jizhong
Zhou, and Craig S. Criddle. Long-term cultivation of a stable Methylocystis-
dominated methanotrophic enrichment enabling tailored production of poly(3-
hydroxybutyrate-co-3-hydroxyvalerate). Bioresource Technology, 198:811–818, 2015.
[124] Tanja Narancic and Kevin E. O’Connor. Microbial biotechnology addressing the
plastic waste disaster. Microbial Biotechnology, 10(5):1232–1235, 2017.
[125] Pablo I. Nikel, Alejandra De Almeida, Evelia C. Melillo, Miguel A. Galvagno, and
M. Julia Pettinari. New recombinant Escherichia coli strain tailored for the pro-
duction of poly(3-hydroxybutyrate) from agroindustrial by-products. Applied and
Environmental Microbiology, 72(6):3949–3954, 2006.
[126] Jari Oksanen, FG Blanchet, Roeland Kindt, Pierre Legendre, and RB O’Hara. Vegan:
community ecology package, 2016.
[127] Miguel Oliveira, Olga M.C.C. Ameixa, and Amadeu M.V.M. Soares. Are ecosystem
services provided by insects ”bugged” by micro(nano) plastics? TrAC Trends in
Analytical Chemistry, 111:317–320, 2019.
[128] Dennis G. A. B. Oonincx and Imke J. M. de Boer. Environmental Impact of the
Production of Mealworms as a Protein Source for Humans – A Life Cycle Assessment.
PLoS ONE, 7(12):e51145, 2012.
[129] Vince Palace, Bradley Park, Kerri Pleskach, Bonnie Gemmill, and Gregg Tomy.
Altered thyroxine metabolism in rainbow trout (Oncorhynchus mykiss) exposed to
hexabromocyclododecane (HBCD). Chemosphere, 80(2):165–169, 2010.
[130] Roseane L. Panini, Luiz Eduardo Lima Freitas, Ariane M. Guimaraes, Cristina
Rios, Maria Fernanda O. da Silva, Felipe Nascimento Vieira, Debora M. Fracalossi,
Richard Ian Samuels, Elane Schwinden Prudencio, Carlos Peres Silva, and Re-
nata D.M.C. Amboni. Potential use of mealworms as an alternative protein source for
Pacific white shrimp: Digestibility and performance. Aquaculture, 473(April):115–120,
2017.
[131] Saranya Paranji, Muneeswari Rajasekaran, and Sekaran Ganesan. Biodegradation
of the endocrine disrupting chemical o-phenylenediamine using intracellular enzymes
152 BIBLIOGRAPHY
from Citrobacter freundii and its kinetic studies. Journal of Chemical Technology and
Biotechnology, 91(1):171–183, 2016.
[132] Rajesh Pasumarthi, Sivaraman Chandrasekaran, and Srikanth Mutnuri. Biodegrada-
tion of crude oil by Pseudomonas aeruginosa and Escherichia fergusonii isolated from
the Goan coast. Marine Pollution Bulletin, 76(1-2):276–282, 2013.
[133] Bo-Yu Peng, Yiran Li, Rui Fan, Zhibin Chen, Jiabin Chen, Anja Malawi Brandon,
Craig S. Criddle, Yalei Zhang, and Wei-Min Wu. Biodegradation of low-density
polyethylene and polystyrene in superworms, larvae of Zophobas atratus (Coleoptera:
Tenebrionidae): Broad and limited extent depolymerization. Environmental Pollu-
tion, page 115206, 2020.
[134] Bo-Yu Peng, Yiming Su, Zhibin Chen, Jiabin Chen, Xuefei Zhou, Mark Eric Benbow,
Craig S Criddle, Wei-Min Wu, and Yalei Zhang. Biodegradation of Polystyrene by
Dark (Tenebrio obscurus) and Yellow (Tenebrio molitor) Mealworms (Coleoptera:
Tenebrionidae). Environmental Science & Technology, 2019.
[135] Asal Peydaei, Hedayat Bagheri, Leonid Gurevich, Nadieh de Jonge, and Jeppe Lund
Nielsen. Impact of polyethylene on salivary glands proteome in Galleria melonella.
Comparative Biochemistry and Physiology - Part D: Genomics and Proteomics,
34(January):100678, 2020.
[136] G. Piccolo, V. Iaconisi, S. Marono, L. Gasco, R. Loponte, S. Nizza, F. Bovera, and
G. Parisi. E↵ect of <i>Tenebrio molitor</i> larvae meal on growth performance,
in vivo nutrients digestibility, somatic and marketable indexes of gilthead sea bream
(<i>Sparus aurata</i>). Animal Feed Science and Technology, 2017.
[137] K Pivnenko, K Granby, E Eriksson, and T F Astrup. Recycling of plastic waste:
Screening for brominated flame retardants (BFRs). Waste Management, 69:101–109,
2017.
[138] Plastic News. Plastics Resin Pricing, 2018.
[139] PlasticsEurope. Plastics – the Facts 2016. page www.plasticseurope.de/informations.
BIBLIOGRAPHY 153
[140] Journal Pre-proofs. Biodegradation and mineralization of polystyrene by plastic-
eating superworms Zophobas atratus. Science of the Total Environment, page 135233,
2019.
[141] Sebastian W. Przemieniecki, Agnieszka Kosewska, S lawomir Ciesielski, and Olga
Kosewska. Changes in the gut microbiome and enzymatic profile of Tenebrio moli-
tor larvae biodegrading cellulose, polyethylene and polystyrene waste. Environmental
Pollution, 256, 2020.
[142] Asif Rahman, Elisabeth Linton, Alex D. Hatch, Ronald C. Sims, and Charles D.
Miller. Secretion of polyhydroxybutyrate in Escherichia coli using a synthetic biolog-
ical engineering approach. Journal of Biological Engineering, 7(1), 2013.
[143] Krishna Prasad Rajan, Selvin P Thomas, Aravinthan Gopanna, and Murthy Chavali.
Polyhydroxybutyrate (PHB): A Standout Biopolymer for Environmental Sustainabil-
ity. In Leticia Myriam Torres Martınez, Oxana Vasilievna Kharissova, and Boris Il-
dusovich Kharisov, editors, Handbook of Ecomaterials, pages 1–23. Springer Interna-
tional Publishing, Cham, 2017.
[144] James Arthur Ramsay. The rectal complex of the mealworm Tenebrio molitor,
L.(Coleoptera, Tenebrionidae). Philosophical Transactions of the Royal Society B:
Biological Sciences, 248(748):279–314, 1964.
[145] Manviri Rani, Won Joon Shim, Gi Myung Han, Mi Jang, Young Kyoung Song, and
Sang Hee Hong. Hexabromocyclododecane in polystyrene based consumer products :
An evidence of unregulated use. Chemosphere, 110:111–119, 2014.
[146] D.-N. Rathi, H.G. Amir, R.M.M. Abed, A. Kosugi, T. Arai, O. Sulaiman, R. Hashim,
and K. Sudesh. Polyhydroxyalkanoate biosynthesis and simplified polymer recovery
by a novel moderately halophilic bacterium isolated from hypersaline microbial mats.
Journal of Applied Microbiology, 114(2):384–395, 2012.
[147] Liu Ren, Lina Men, Zhiwei Zhang, Feifei Guan, Jian Tian, Bin Wang, and Jihua
Wang. Biodegradation of Polyethylene by Enterobacter sp. D1 from the Guts of
Wax Moth Galleria mellonella. International Journal of Environmental Research and
Public Health, 16, 2019.
154 BIBLIOGRAPHY
[148] Yilin Ren, Chen Ling, Ivan Hajnal, Qiong Wu, and Guo Qiang Chen. Construction
of Halomonas bluephagenesis capable of high cell density growth for e�cient PHA
production. Applied Microbiology and Biotechnology, 102(10):4499–4510, 2018.
[149] Juan-Manuel Restrepo-Florez, Amarjeet Bassi, and Michael R. Thompson. Microbial
degradation and deterioration of polyethylene – A review. International Biodeterio-
ration & Biodegradation, 88:83–90, 2014.
[150] Lynn M. Riddiford. How does juvenile hormone control insect metamorphosis and
reproduction? General and Comparative Endocrinology, 179(3):477–484, 2012.
[151] Lynn M Riddiford and James W Truman. Hormone Receptors and the Regulation of
Insect Metamorphosis. American Zoologist, 33:340–347, 1993.
[152] Lorena M. Rios Mendoza, Hrissi Karapanagioti, and Nancy Ramırez Alvarez. Mi-
cro(nanoplastics) in the marine environment: Current knowledge and gaps. Current
Opinion in Environmental Science & Health, 1:47–51, 2018.
[153] D. F. Rodrigues, S. K. Sakata, J. V. Comasseto, M. C. Bıcego, and V. H. Pellizari.
Diversity of hydrocarbon-degrading Klebsiella strains isolated from hydrocarbon-
contaminated estuaries. Journal of Applied Microbiology, 106(4):1304–1314, 2009.
[154] Santiago Rodriguez-Perez, Antonio Serrano, Alba A. Pantion, and Bernabe Alonso-
Farinas. Challenges of scaling-up PHA production from waste streams. A review.
Journal of Environmental Management, 205:215–230, 2018.
[155] David Roland-Holst, Ryan Triolo, Sam Heft-Neal, and Bijan Bayrami. Bioplastics
in California: Economic assessment of market conditions for PHA/PHB bioplastics
produced from waste methane. 2013.
[156] Yukie Saegusa, Hitoshi Fujimoto, Gye Hyeong Woo, Kaoru Inoue, Miwa Takahashi,
Kunitoshi Mitsumori, Masao Hirose, Akiyoshi Nishikawa, and Makoto Shibutani.
Developmental toxicity of brominated flame retardants, tetrabromobisphenol A and
1,2,5,6,9,10-hexabromocyclododecane, in rat o↵spring after maternal exposure from
mid-gestation through lactation. Reproductive Toxicology, 28(4):456–467, 2009.
[157] Arnold Schecter, David Taylor Szabo, James Miller, Tyra L. Gent, Noor Malik-
Bass, Malte Petersen, Olaf Paepke, Justin Colacino, Linda S. Hynan, T. Robert
BIBLIOGRAPHY 155
Harris, Sunitha Malla, and Linda S. Birnbaum. Hexabromocyclododecane (HBCD)
stereoisomers in U.S. food from Dallas, Texas. Environmental Health Perspectives,
120(9):1260–1264, 2012.
[158] Aamer Ali Shah, Fariha Hasan, Abdul Hameed, and Safia Ahmed. Biological degra-
dation of plastics: A comprehensive review. Biotechnology Advances, 26(3):246–265,
2008.
[159] Ewa Siemianowska, Agnieszka Kosewska, Marek Aljewicz, Krystyna A. Skibniewska,
Lucyna Polak-Juszczak, Adrian Jarocki, and Marta Jedras. Larvae of mealworm
(Tenebrio molitor L.) as European novel food. Agricultural Sciences, 2013.
[160] Sang Jun Sim, Kristi D. Snell, Scott A. Hogan, Jo Anne Stubbe, Chokyun Rha,
and Anthony J. Sinskey. PHA synthase activity controls the molecular weight and
polydispersity of polyhydroxybutyrate in vivo. Nature Biotechnology, 15(1):63–67,
1997.
[161] Alex Sivan. New perspectives in plastic biodegradation. Current Opinion in Biotech-
nology, 22(3):422–426, 2011.
[162] Thomas Soin and Guy Smagghe. Endocrine disruption in aquatic insects: A review,
2007.
[163] Malcom P Stevens. Polymer Chemistry: An Introduction, volume 77. 1999.
[164] B. H. Stickel, A. Jahn, and W. Kier. The Cost To West Coast Communities Of
Dealing with Trash, Reducing Marine Debris. (September):21, 2012.
[165] J. Stoops, D. Vandeweyer, S. Crauwels, C. Verreth, H. Boeckx, M. Van Der Borght,
J. Claes, B. Lievens, and L. Van Campenhout. Minced meat-like products from
mealworm larvae (Tenebrio molitor and Alphitobius diaperinus): Microbial dynamics
during production and storage. Innovative Food Science & Emerging Technologies,
2017.
[166] Subcommittee on Ocean Science and Technology. Science and Technology for Amer-
ica’s Oceans: A Decadal Vision. Technical Report November, 2018.
156 BIBLIOGRAPHY
[167] Rebecca Sutton, Sherri A. Mason, Shavonne K. Stanek, Ellen Willis-Norton, Ian F.
Wren, and Carolynn Box. Microplastic contamination in the San Francisco Bay,
California, USA. Marine Pollution Bulletin, 109(1):230–235, 2016.
[168] D. T. Szabo, J. J. Diliberto, H. Hakk, J. K. Huwe, and L. S. Birnbaum. Toxicokinetics
of the Flame Retardant Hexabromocyclododecane Gamma: E↵ect of Dose, Timing,
Route, Repeated Exposure, and Metabolism. Toxicological Sciences, 117(2):282–293,
2010.
[169] Walter R Terra, C L I L I A Ferreira, Fernando Bastos, Departamento De Bloquimlca,
Instltuto De Quimma, Umversldade De Silo Paulo, and C P Paulo. Phylogenetic
considerations Digestion of Insect Disaccharidases: and the Spatial Organization of
Digestion in the Tenebrio Molitor Larvae. Insect Biochemistry, 15(4):443–449, 1985.
[170] Sourbh Thakur, Jyoti Chaudhary, Bhawna Sharma, Ankit Verma, Sigitas Tamule-
vicius, and Vijay Kumar Thakur. Sustainability of Bioplastics: Opportunities and
Challenges. Current Opinion in Green and Sustainable Chemistry, 2018.
[171] The Essential Chemical Industry. Polyethylene. page
http://www.essentialchemicalindustry.org/polymers/.
[172] R C Thompson, C J Moore, F S Vom Saal, and S H Swan. Plastics, the environment
and human health: current consensus and future trends. Philosophical Transactions
of The Royal Society B, 364(2009):2153–2166, 2009.
[173] Yutaka Tokiwa, Buenaventurada P. Calabia, Charles U. Ugwu, and Seiichi Aiba.
Biodegradability of Plastics. International Journal of Molecular Sciences, 10(9):3722–
3742, 2009.
[174] European Union. Commission Regulation (EU) 2016/293 Amending Regulation (EC)
No 850/2004 of the European Parliament and of the Council on persistent organic
pollutants as regards Annex I, 2016.
[175] United Nations (UN). United Nations Sustainable Development Goals. 2015.
[176] United States Environmental Protection Agency. Hexabromocyclododecane (HBCD)
action Plan. Technical report, 2010.
BIBLIOGRAPHY 157
[177] Aneta K Urbanek, Justyna Rybak, Magdalena Wrobel, Karol Leluk, and Aleksan-
dra M Mironczuk. A comprehensive assessment of microbiome diversity in Tenebrio
molitor fed with polystyrene waste. Environmental Pollution, page 114281, 2020.
[178] US EPA. Method 3630C: Silica gel cleanup. Technical Report December, 1996.
[179] US EPA. Method 8000C: Determinative chromatographic separations. Technical
Report March, 2003.
[180] US EPA. Method 3550B: Ultrasonic extraction. Technical report, 2007.
[181] US EPA. Method 8081: Organochlorine pesticides by gas chromatography. Technical
Report February, 2007.
[182] US EPA. Method 8082: Polychlorinated biphenyls (PCBs) by gas chromatography.
Technical report, 2007.
[183] US EPA. Flame Retardant Alternatives for Hexabromocyclododecane (HBCD). Tech-
nical Report September, 2013.
[184] U.S. EPA. Assessing Trends in Material Generation, Recycling, Composting, Com-
bustion with Energy Recovery and Landfilling in the United States. Technical report,
2016.
[185] REG 09 US EPA. Trash-Free Waters, 2018.
[186] Ad van Wijk and Iris van Wijk. 3D printing with biomaterials: Towards a sustainable
and circular economy. 2015.
[187] D. Vandeweyer, S. Crauwels, B. Lievens, and L. Van Campenhout. Microbial counts
of mealworm larvae (Tenebrio molitor) and crickets (Acheta domesticus and Gryl-
lodes sigillatus) from di↵erent rearing companies and di↵erent production batches.
International Journal of Food Microbiology, 242:13–18, 2017.
[188] G. D. Villanger, C. Lydersen, K. M. Kovacs, E. Lie, J. U. Skaare, and B. M. Jenssen.
Disruptive e↵ects of persistent organohalogen contaminants on thyroid function in
white whales (Delphinapterus leucas) from Svalbard. Science of the Total Environ-
ment, 409(13):2511–2524, 2011.
158 BIBLIOGRAPHY
[189] Marc Vinas. Enhanced Biodegradation of Casablanca Crude Oil by A Microbial
Consortium in Presence of a Rhamnolipid Produced by ... (April):249–260, 2017.
[190] K. S. Vinokurov, E. N. Elpidina, B. Oppert, S. Prabhakar, D. P. Zhuzhikov, Y. E.
Dunaevsky, and M. A. Belozersky. Fractionation of digestive proteinases from
Tenebrio molitor (Coleoptera: Tenebrionidae) larvae and role in protein digestion.
Comparative Biochemistry and Physiology - B Biochemistry and Molecular Biology,
145(2):126–137, 2006.
[191] F Volkering, A M Breure, and W H Rulkens. Microbiological aspects of surfactant
use for biological soil remediation. Biodegradation, 8(Volkering 1996):401–417, 1998.
[192] Chao Wang, Guanghua Lu, Wang Peifang, Hao Wu, Pengde Qi, and Yan Liang. As-
sessment of environmental pollution of Taihu Lake by combining active biomonitoring
and integrated biomarker response. Environmental Science and Technology, 2011.
[193] Qiong Wang, George M. Garrity, James M. Tiedje, and James R. Cole. Naıve Bayesian
classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy.
Applied and Environmental Microbiology, 73(16):5261–5267, 2007.
[194] Yao Wang and Yalin Zhang. Investigation of gut-associated bacteria in Tenebrio moli-
tor (Coleoptera: Tenebrionidae) larvae using culture-dependent and DGGE methods.
Annals of the Entomological Society of America, 108(5):941–949, 2015.
[195] Denice Wardrop, Charles Bott, Craig Criddle, Robert Hale, Jason McDevitt, Molly
Morse, and Chelsea M. Rochman. Technical Review of Microbeads / Microplastics in
the Chesapeake Bay. Technical report, STAC Publication 16-002, Edgewater, MD,
2016.
[196] Carina Weber, Stefan Pusch, and Till Opatz. Polyethylene bio-degradation by cater-
pillars? Current Biology, 27(15):R744–R745, 2017.
[197] Ren Wei and Wolfgang Zimmermann. Biocatalysis as a green route for recycling the
recalcitrant plastic polyethylene terephthalate. Microbial Biotechnology, 10(6):1302–
1307, 2017.
BIBLIOGRAPHY 159
[198] Ren Wei and Wolfgang Zimmermann. Microbial enzymes for the recycling of recalci-
trant petroleum-based plastics: how far are we? Microbial Biotechnology, 10(6):1308–
1322, 2017.
[199] Rim WerheniAmmeri, Sonia MokniTlili, Ines Mehri, Souhir Badi, and Abdennaceur
Hassen. Pentachlorophenol Biodegradation by Citrobacter freundii Isolated from For-
est Contaminated Soil. Water, Air, and Soil Pollution, 227(10), 2016.
[200] Nick Wierckx, Tanja Narancic, Christian Eberlein, Ren Wei, Oliver Drzyzga, Audrey
Magnin, Hendrik Ballerstedt, Shane T Kenny, Eric Pollet, Luc Averous, Kevin E
O’Connor, Wolfgang Zimmermann, Hermann J Heipieper, Auxiliadora Prieto, Jose
Jimenez, and Lars M Blank. Plastic biodegradation: challenges and opportunities.
In R. Ste↵an, editor, Handbook of Hydrocarbon and Lipid Microbiology Consequences,
pages 1–30. Springer International Publishing, 2018.
[201] R. A. Wilkes and L. Aristilde. Degradation and metabolism of synthetic plastics
and associated products by Pseudomonas sp.: capabilities and challenges. Journal of
Applied Microbiology, 123(3):582–593, 2017.
[202] Stephanie L Wright and Frank J Kelly. Plastic and human health: a micro issue?
Environmental Science & Technology, 51:6634-6647, 2017.
[203] Liyou Wu, Chongqing Wen, Yujia Qin, Huaqun Yin, Qichao Tu, Joy D. Van Nostrand,
Tong Yuan, Menting Yuan, Ye Deng, and Jizhong Zhou. Phasing amplicon sequencing
on Illumina Miseq for robust environmental microbial community analysis. BMC
Microbiology, 15(1):125, 2015.
[204] Sen Xie, Yahua Lan, Chao Sun, and Yongqi Shao. Insect microbial symbionts as a
novel source for biotechnology. World Journal of Microbiology and Biotechnology,
8(0):1–7, 2019.
[205] Dongqi Yang, Huahong Shi, Lan Li, Jiana Li, Khalida Jabeen, and Prabhu Koland-
hasamy. Microplastic Pollution in Table Salts from China. Environmental Science &
Technology, 49(22):13622–13627, 2015.
[206] Jun Yang, Yu Yang, Wei-Min Wu, Jiao Zhao, and Lei Jiang. Evidence of polyethy-
lene biodegradatiaon by bacterial strains from the guts of plastic-eating waxworms.
Environmental Science & Technology, 48(23):13776–13784, 2014.
160 BIBLIOGRAPHY
[207] Shan-Shan Yang, Anja Malawi Brandon, James Christopher Andrew Flanagan, Jun
Yang, Daliang Ning, Shen-Yang Yang Cai, Han-Qing Qing Fan, Zhi-Yue Yue Wang,
Jie Ren, Eric Benbow, Nan-Qi Qi Ren, Robert M. Waymouth, Jizhong Zhou, Craig S.
Criddle, and Wei-Min Min Wu. Biodegradation of polystyrene wastes in yellow meal-
worms (larvae of Tenebrio molitor Linnaeus): Factors a↵ecting biodegradation rates
and the ability of polystyrene-fed larvae to complete their life cycle. Chemosphere,
191:979–989, 2018.
[208] Shan-Shan Yang, Yi-di Chen, Jin-Hao Kang, Ting-Rong Xie, Lei He, De-Feng Xing,
Nan-Qi Ren, Shih-Hsin Ho, and Wei-Min Wu. Generation of high-e�cient biochar for
dye adsorption using frass of yellow mealworms (larvae of Tenebrio molitor Linnaeus)
fed with wheat straw for insect biomass production. Journal of Cleaner Production,
2019.
[209] Shan Shan Yang, Yi di Chen, Ye Zhang, Hui Min Zhou, Xin Yu Ji, Lei He, De Feng
Xing, Nan Qi Ren, Shih Hsin Ho, andWei Min Wu. A novel clean production approach
to utilize crop waste residues as co-diet for mealworm (Tenebrio molitor) biomass pro-
duction with biochar as byproduct for heavy metal removal. Environmental Pollution,
252:1142–1153, 2019.
[210] Shan-Shan Yang, Wei-Min Wu, Anja M. Brandon, Han-Qing Fan, Joseph P. Re-
ceveur, Yiran Li, Zhi-Yue Wang, Rui Fan, Rebecca L. McClellan, Shu-Hong Gao,
Daliang Ning, Debra H. Phillips, Bo-Yu Peng, Hongtao Wang, Shen-Yang Cai, Ping
Li, Wei-Wei Cai, Ling-Yun Ding, Jun Yang, Min Zheng, Jie Ren, Ya-Lei Zhang, Jie
Gao, Defeng Xing, Nan-Qi Ren, Robert M. Waymouth, Jizhong Zhou, Hu-Chun Tao,
Christine J. Picard, Mark Eric Benbow, and Craig S. Criddle. Ubiquity of polystyrene
digestion and biodegradation within yellow mealworms, larvae of Tenebrio molitor
Linnaeus (Coleoptera: Tenebrionidae). Chemosphere, 212:262–271, 2018.
[211] Taek Ho Yang, Yu Kyung Jung, Hye Ok Kang, Tae Wan Kim, Si Jae Park, and
Sang Yup Lee. Tailor-made type II Pseudomonas PHA synthases and their use for
the biosynthesis of polylactic acid and its copolymer in recombinant Escherichia coli.
Applied Microbiology and Biotechnology, 90(2):603–614, 2011.
BIBLIOGRAPHY 161
[212] Yu Yang, Jun Yang, Weimin Wu, Jiao Zhao, Yiling Song, Longcheng Gao, Ruifu
Yang, and Lei Jiang. Biodegradation and Mineralization of Polystyrene by Plastic-
Eating Mealworms. 1. Chemical and Physical Characterization and Isotopic Tests.
Environmental Science & Technology, 40(20):12080–12086, 2015.
[213] Yu Yang, Jun Yang, Weimin Wu, Jiao Zhao, Yiling Song, Longcheng Gao, Ruifu Yang,
and Lei Jiang. Biodegradation and Mineralization of Polystyrene by Plastic-Eating
Mealworms. 2. Role of Gut Microorganisms. Environmental Science & Technology,
page 150921171638000, 2015.
[214] Shosuke Yoshida, Kazumi Hiraga, Toshihiko Takehana, Ikuo Taniguchi, Hironao Ya-
maji, Yasuhito Maeda, Kiyotsuna Toyohara, Kenji Miyamoto, Yoshiharu Kimura, and
Kohei Oda. A bacterium that degrades and assimilates poly(ethylene terephthalate).
Science (New York, N.Y.), 351(6278):1196–1199, 2016.
[215] Bart N. Zegers, Anchelique Mets, Ronald Van Bommel, Chris Minkenberg, Timo
Hamers, Jorke H. Kamstra, Graham J. Pierce, and Jan P. Boon. Levels of Hexabro-
mocyclododecane in Harbor Porpoises and Common Dolphins fromWestern European
Seas, with Evidence for Stereoisomer-Specific Biotransformation by Cytochrome. En-
vironmental Science & Technology, 39:2095–2100, 2005.
[216] Jiajie Zhang, Kassian Kobert, Tomas Flouri, and Alexandros Stamatakis. PEAR: A
fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics, 30(5):614–620,
2014.
[217] Shan Zhong and Joshua M. Pearce. Tightening the loop on the circular economy:
Coupled distributed recycling and manufacturing with recyclebot and RepRap 3-D
printing. Resources, Conservation and Recycling, 128:48–58, 2018.
[218] Hailong Zhou, Yuhu Li, Lin Wei, Zhihuai Zhang, Hao Huang, Xiaoping Diao, and
Jianhai Xiang. Sensitivity of larvae and adult and the immunologic characteristics of
litopenaeus vannamei under the acute hypoxia. Journal of Chemistry, 2014.
[219] Jizhong Zhou, Mary Ann Bruns, and James M. Tiedje. DNA recovery from soils of
diverse composition. Applied and Environmental Microbiology, 62(2):316–322, 1996.