lable at ScienceDirect

Insect Biochemistry and Molecular Biology 39 (2009) 287–293

Contents lists avai

Insect Biochemistry and Molecular Biology

journal homepage: www.elsevier .com/locate/ ibmb

A 25 bp-long insertional mutation in the BmVarp gene causes the waxytranslucent skin of the silkworm, Bombyx mori

Katsuhiko Ito a, Susumu Katsuma a, Kimiko Yamamoto b, Keiko Kadono-Okuda b,Kazuei Mita b, Toru Shimada a,*

a Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japanb Division of Insect Sciences, National Institute of Agrobiological Sciences, 1-2 Owashi, Tsukuba, Ibaraki 305-8634, Japan

a r t i c l e i n f o

Article history:Received 12 November 2008Received in revised form13 January 2009Accepted 15 January 2009

Keywords:Positional cloningowVacuolar sorting proteinAnkyrin repeatVarp

* Corresponding author. Tel.: þ81 3 5841 5057; faxE-mail address: shimada@ss.ab.a.u-tokyo.ac.jp (T.

0965-1748/$ – see front matter � 2009 Elsevier Ltd.doi:10.1016/j.ibmb.2009.01.005

a b s t r a c t

In Bombyx mori, there are more than 35 mutant strains whose larval skin color is transparent. The waxytranslucent strain ow is one of the oily mutants which lack accumulation of uric acid in the epidermis.Here we performed positional cloning of the ow gene using the Bombyx draft genome sequence. For finestructure mapping, we succeeded to narrow the ow linked region to approximately 150 kb, and identifiedthe ow candidate gene by annotation analysis and DNA sequencing. The complete cDNA sequences of theow gene from wild-type strains were 3501 bp-long and potentially encoded a protein of 920 amino acids.We found a 25 bp-long insertion in this gene in the ow mutant strain, resulting in a frame-shift mutationand generation of a premature stop codon. A BLAST search revealed that this protein had high homologyto Varp, a recently identified protein containing a vacuolar sorting protein 9 domain and ankyrin repeats,and we termed the silkworm protein BmVarp. Varp has been shown to regulate endosome dynamics,suggesting that BmVarp may play an important role in the incorporation and/or accumulation of uric acidin the epidermis.

� 2009 Elsevier Ltd. All rights reserved.

1. Introduction

The larval skin color of the silkworm, Bombyx mori, is generallywhite and opaque. However, more than 35 mutant strains havea transparent skin color, which makes them look like oily paper(Fujii et al., 1998). The transparent skin color concerns the inabilityto synthesize uric acid and the lack of accumulation of uric acid inthe epidermis. Tamura and Sakate showed that these oily mutantsare classified into two types (Tamura and Sakate, 1983). Threemutants, oq, og, and ogt, at two loci are caused by low or noxanthine dehydrogenase activity and thus they synthesize verylittle or no uric acid (Tamura and Sakate, 1983). Other mutants,most of which are of the same type and whose oily genes arelocated in more than 10 loci, result from the lack of incorporationand accumulation of uric acid from haemolymph to the hypo-dermal cells (Tamura and Sakate, 1983). Tamura and Akai (1990)compared the morphological change of the hypodermal cellsbetween normal silkworms and the various oily mutants usingultra-thin sections for electron microscopy and found that the urategranules in oily mutants were abnormal in shape and distribution.

: þ81 3 5841 5089.Shimada).

All rights reserved.

These results suggest that incorporation and accumulation of uricacid are differently controlled by each oily mutation.

The waxy translucent strain, ow, is one of the oily mutants thatlack accumulation of uric acid in the epidermis (Fig. 1). Electronmicroscopy revealed that the ow mutant was an intermediatelytransparent silkworm whose integument contains 10–20% of theuric acid of the normal strain, and whose hypodermal cells havespindle-shaped and disrupted granules (Tamura and Akai, 1990).The ow mutation has been reported only once by Chikushi (1960),suggesting that multiple alleles of the ow gene do not exist. The owgene was mapped at 36.4 cM on silkworm genetic linkage group 17.This linkage group contains the following 7 loci: Black moth (Bm;17-0.0; gene affecting pigmentation of the imago (black)), Wildwing spot (Ws; 17-14.7; black spot on the apex of the wing), non-susceptibility to DNV-2 (nsd-2; 17-24.5; controls non-susceptibilityto infection by BmDNV-2), brown head and tail spot (bts; 17-30.1;head cuticle and anal plates pigmented reddish brown after 3rd or4th instar), Non-infectious to densonucleosis virus (Nid-1; 17-31.1;controls non-susceptibility to infection by BmDNV-1), waxytranslucent (ow; 17-36.4; larval skin moderately translucent.), andnon-molting glossy (nm-g; 17-39.4; homozygotes survive about tendays as 1st instar larvae with lustrous skin, most die withoutmolting) (Fujii et al., 1998). Recently, we have reported the isolationand identification of the mutant gene, nsd-2, on this linkage group

Fig. 1. Wild-type and ow mutant strains. (A) Wild-type strain (þow/þow), p50T. (B) ow mutant strain (ow/ow), w17. (C) Wild-type, segments A1 and A2. The larval skin color is white.(D) The phenotype of the ow mutant, segments B1 and B2. The larval skin color is transparent, and the dorsal vein is visible beneath the surface.

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293288

by positional cloning (Ito et al., 2008). Using many genetic andmolecular markers on linkage group 17, we are attempting toisolate other genes mapped on this linkage group.

In this study, we report the isolation and identification of the owgene by positional cloning. The ow gene encodes a Varp homolog,which we termed BmVarp. Varp is a recently identified proteinwhich has been shown to regulate endosome dynamics (Zhanget al., 2006). Based on the collective data, we conclude that BmVarpmay be involved in the incorporation and/or accumulation of uricacid in the epidermis of B. mori.

2. Materials and methods

2.1. Silkworm strains

The ow mutant strain (ow/ow) was w17 (Kyushu University); thewild-type strains (þow/þow) were p50T, C108T (The University ofTokyo), u42, u49, and w43 (Kyushu University). A single-pair crossbetween a female (p50T) and a male (w17) produced the F1

offspring. For linkage and recombination analysis, F2 progeny fromthe cross (p50T�w17)� (p50T�w17), and BC1 progeny fromw17� (p50T�w17) were used. All silkworm larvae were reared onmulberry leaves at 25 �C.

2.2. Positional cloning

Positional cloning of the ow candidate gene was performed asdescribed previously (Ito et al., 2008). Polymerase chain reaction(PCR) and single nucleotide polymorphism (SNP) markers weregenerated at each position on linkage group 17, and the markersthat showed polymorphism between the parents were used for thegenetic analysis of 91 F2 and 380 BC1 individuals with the owphenotype (Tables 1 and 2).

2.3. Isolation of genomic DNA and total RNA

Genomic DNA was isolated from a small portion of the bodyfrom 3rd or 4th instar larvae using DNAzol (Invitrogen) according tothe manufacturer’s protocol. Total RNA was extracted from day0 3rd instar larvae. Day 3 5th instar larvae were used for theisolation of total RNA from 16 tissues, including brain, prothoracicgland, salivary gland, fat body, trachea, hemocyte, testis, ovary,anterior silk gland, middle silk gland, posterior silk gland, foregut,midgut, hindgut, Malpighian tubule, and integument. Total RNAwas also isolated from individuals of different stages, includingeggs of day 0, 4, and 8, whole body from day 0, 1, 2, and 3 of 1stinstar, day 0, 1, and 2 of 2nd instar, and day 0 of 3rd and 4th instar

Table 1The primers used in the linkage analysis.

Name Sequence (50–30 end) Scaffold Position

Sc4911-19H05T-F CAGAAATGCTTCACTATCAACCGTC Bm_scaf33 3817088–3817112Sc4911-19H05T-R ACGGCTAACTTAAGAAATCACGGAC Bm_scaf33 3817936–3817960nscaf2829-4F AGTGGTCTACGTTATGCCGAACAGA Bm_scaf33 1003332–1003356nscaf2829-4R TGGTACCGTGTGAACCTAATGTCAG Bm_scaf33 1004208–1004232nscaf2829-3F TCATTTCTATTCCCAGCCTGATTTTT Bm_scaf33 505573–505598nscaf2829-3R CTAGCGGTAGGTCAATGGTTGATTG Bm_scaf33 506487–506511nscaf2829-1F TGTCGCCATCCTCCTTAAGACATTA Bm_scaf33 501965–501999nscaf2829-1R TGAAGCTTCGTGTTTTCGATTTGAT Bm_scaf33 502896–502920nscaf2829-65K03T-F TATGCTGCTGGTAACCGTAGGATGT Bm_scaf33 269369–269393nscaf2829-65K03T-R AATCATTTCATCCACCAATCCACAC Bm_scaf33 270247–270271nscaf2829-2F CTTCTGATCGTAAACAATCCGTTCG Bm_scaf33 105046–105070nscaf2829-2R TTATCTATGGCAGGCAATGTGTCAA Bm_scaf33 105836–105860nscaf125-1F CTATCGGGAATTAGAGTCGGACGTG Bm_scaf154 153014–153038nscaf125-1R AAAGAAACATCGGCAACATTATGTGA Bm_scaf154 153889–153914nscaf125-6F GGCGGCTTTTGACGTTAAGTCTCTA Bm_scaf154 304354–304378nscaf125-6R ATCCAAACGAACGGCAATAATTTTC Bm_scaf154 305298–305322nscaf2876-605E15S-2F TTGCTACTCAAAAGTCGTTGCCTTTA Bm_scaf92 44196–44221nscaf2876-605E15S-2R CCAGTCAGGGTGAGGCTAAAATAGG Bm_scaf92 45074–45098nscaf2876-71M04T-2F TATCATCAGTAAGTGCTTCTGTATAG Bm_scaf92 267892–267917nscaf2876-71M04T-R GAGCGGTAGGATACGCACTGAAAT Bm_scaf92 268229–268252

Table 2Linkage analysis of F2 and BC1 segregants.

Primer Method p50T w17 F1 F2 and BC1a

Sc4911-19H05T-F/R PCR A B A/B n.d. A/B (57)nscaf2829-4F/4R PCR A B A/B B (0) A/B (8)nscaf2829-3F/3R PCR A B A/B n.d. A/B (8)nscaf2829-1F/1R PCR A B A/B n.d. A/B (8)nscaf2829-65K03T-F/R sequence A B A/B B (0) n.d.nscaf2829-2F/2R sequence A B A/B B (0) A/B (2)nscaf125-1F/1R sequence A B A/B B (0) A/B (2)ow linked region (about 150 kb)nscaf125-6F/6R PCR A B A/B A/B (5) B (0)nscaf2876-605E15S-2F/2R PCR A B A/B A/B (13) B (0)nscaf2876-71M04T-2F/R PCR A B A/B A/B (15) B (0)

‘A’ indicates p50T homozygous, ‘B’ indicates w17 homozygous and ‘A/B’ indicatesheterozygous genotype.Heterozygous genotypes indicate the shaded sections.The bold letters indicate primer sets designed at the most closely positions to owlinked region.n.d. indicates Not determined.The numbers shown in parentheses indicate the number of heterozygous genotypes(A/B).The ow linked region is between nscaf125-1F/1R and nscaf125-6F/6R.

a In linkage analysis, 91 F2 and 380 BC1 individuals with the ow phenotype wereused.

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293 289

larvae. Total RNA was purified using Trizol (Invitrogen), reverse-transcribed using Oligo (dT)12–18 primer (Invitrogen) and Super-script III reverse transcriptase (Invitrogen) according to themanufacturer’s protocol.

2.4. PCR and reverse transcription PCR (RT-PCR) analysis

PCR was performed using Ex Taq (TaKaRa) and primer setsdesigned from the SNP linkage map (Yamamoto et al., 2006, 2008)and the Bombyx draft genome sequence (Mita et al., 2004; Xia et al.,2004) (Table 1). The PCR conditions were as follows: initial dena-turation at 94 �C for 2 min, 35 cycles at 94 �C for 15 s, 60 �C for 15 s,and 72 �C for 1 min, followed by 72 �C for 4 min. RT-PCR was per-formed using Ex Taq (TaKaRa) under the following conditions:initial denaturation at 94 �C for 2 min, 35 cycles at 94 �C for 15 s,60 �C for 15 s, and 72 �C for 3 min, followed by 72 �C for 4 min.

2.5. Annotation analysis

The candidate genes in the region narrowed by linkage analysiswere annotated using KAIKObase (http://sgp.dna.affrc.go.jp/KAIKObase/), KAIKO blast (http://kaikoblast.dna.affrc.go.jp/), andNCBI blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.6. Cloning of the ow candidate genes

To clone the ow candidate genes, we performed RT-PCR usingcDNA prepared from the whole body from day 0 3rd instar larvae.The primer sets for PCR of the two ow candidate genes (Chinese genemodel BGIBMGA000173, and BGIBMGA000181) were as follows:50-TTACGACGAGATCGTCTCTGAGAATC-30 for the sense primer and50-CAGCTCCTATGTTGCCAGTTTCACT-30 for the antisense primer ofBGIBMGA000173, 50-GTAGCAATGGAAGCTGGTGATGAAC-30 for thesense primer and 50-TTACGCCACATGTAGCAAATCTGAG-30 for theantisense primer of BGIBMGA000181. RT-PCR was performed usingEx Taq (TaKaRa) under the following conditions: initial denaturationat 94 �C for 2 min, 35 cycles at 94 �C for 15 s, 60 �C for 15 s, and 72 �Cfor 3 min, followed by 72 �C for 4 min. For control experiments, thefollowing 18S RNA primers were used in all PCR experiments:50-TTGACGGAAGGGCACCACCAG-30 for the sense primer, 50-GCAC-CACCACCCACGGAATCG-30 for the antisense primer (Gopalapillai

et al., 2006). The PCR products were subcloned into the pGEM-Teasyvector (Promega) and sequenced using an ABI3130xl geneticanalyzer (Applied Biosystems).

2.7. Full length cDNA sequence of the BmVarp gene

The full length cDNA sequence of the BmVarp gene was deter-mined by sequencing the EST clone fner50i09. This EST clone wasfound in the B. mori EST database (http://morus.ab.a.u-tokyo.ac.jp/cgi-bin/index.cgi) by a homology search.

2.8. Prediction of BmVarp motifs

Motif prediction of BmVarp was performed using an NCBI blastsearch (http://blast.ncbi.nlm.nih.gov/Blast.cgi), a MOTIF search(http://motif.genome.jp/), and an InterProScan sequence search(http://www.ebi.ac.uk/Tools/InterProScan/).

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293290

2.9. Phylogenetic analysis

The amino acid sequences of the catalytic domains were alignedusing the ClustalX program (Thompson et al., 1997), and phyloge-netic trees were constructed by neighbor-joining methods usingthe MEGA4 program (Tamura et al., 2007) as previously described(Daimon et al., 2005). Sequences were as follows: B. mori (BmVarp),accession number AB467312; Nasonia vitripennis, XM_001607785;Ornithorhynchus anatinus, XM_001508816; Gallus gallus,XM_001232014; Monodelphis domestica, XM_001367714; Rattusnorvegicus, XM_001079798; Mus musculus, AK144733; M. musculus,NM_145633; M. musculus, AY336500; R. norvegicus, CH473979;M. musculus, BC065093; Canis familiaris, XM_541717; Acyrthosiphonpisum, XM_001943409; Tribolium castaneum, XM_963750.

2.10. Nucleotide sequence accession number

The nucleotide sequences reported in this study have beensubmitted to the DDBJ/EMBL/GenBank data bank under accessionnumbers of AB467312 (BmVarp) and AB467313 (BmVarp-ow).

3. Results

3.1. Mapping of the ow mutation

To identify a candidate region for the ow mutation, we performedgenetic linkage analysis using primer sets designed for the SNPlinkage map (Yamamoto et al., 2006, 2008) and the Bombyx draftgenome sequence (Mita et al., 2004; Xia et al., 2004) (Table 1). First,

Fig. 2. Mapping of the ow mutation on linkage group 17. (A) SNP markers and genetic analdistance is shown in centiMorgan units (cM). In the lower figure, a dotted line indicates the ron the narrowed region and fine structure mapping. A dotted line indicates the result of thannotation in the ow linked region. Two predicted genes, BGIBMGA000173 and BGIBMGA0

we roughly mapped the ow mutation using 91 F2 and 380 BC1 indi-viduals, and narrowed the ow linked region to between the T7 ends oftwo BAC clones, 065K03 and 605E15 (Fig. 2A). This region was 2.1 cM-long according to the SNP map (Yamamoto et al., 2008). Next, weidentified three scaffolds (Bm_scaf33, Bm_scaf154, and Bm_scaf92)corresponding to this 2.1 cM-long region using the KAIKObase. Wedesigned primer sets based on the sequences of these scaffolds, andfurther performed a fine structure mapping. By these approaches, wefurther narrowed the ow linked region to a position between 153,013nucleotide (nt) and 305,427 nt on Bm_scaf154. This region was about150 kb in length (Fig. 2B, and Table 2).

3.2. Identification of the ow candidate gene

We predicted two candidate genes (Chinese gene modelBGIBMGA000173 and BGIBMGA000181) by a gene model searchand one EST (fner05i09) by a BLAST search within the narrowedregion (Fig. 2C). BGIBMGA000173 and fner50i09 corresponded tothe same gene, suggesting that it is actually expressed in B. mori.First, we investigated whether the two candidate genes wereexpressed in the integument, which is the tissue showing the oilyphenotype. RT-PCR analysis showed that expressions of both geneswere expressed (data not shown). Next, we cloned and sequencedthe two candidate genes and compared the sequences between fivewild-type strains (p50T, C108T, u42, u49, and w43) and the owmutant strain, w17. Sequencing analysis showed one of the twogenes, BGIBMGA000173 had a 25 bp-long insertion in the ORF ofthe ow mutant strain. This insertion, AGAAGCCTACTACTATTATGAAAGT, was a tandem repeat (Fig. 3A). On the other hand, we did

ysis. Upper figure indicates the positions of SNP markers from BAC end sequences. Theesult of rough mapping to narrow the region linked to the ow mutation. (B) Bm_scaffold

e detailed linkage analysis to narrow the region linked to the ow mutation. (C) Gene00181, and two EST sequences, fner50i09r and fner50i09f, are shown.

Fig. 3. Schematic structures of the ow candidate gene from wild-type and ow mutant strains. (A) A 25 bp-long tandem repeat insertion of the ow mutant strain. The upper sequenceindicates the wild-type strain p50T, and the lower is ow mutant strain w17. The arrowhead on the wild-type strain shows the start position of the tandem repeat. The arrowhead onthe ow mutant strain shows a premature stop codon. (B) Genomic structure of the ow gene of the wild-type strain p50T (upper) and the ow mutant strain w17 (lower). Thearrowheads show the start and stop codons. The black box is the specific insertion found in the ow mutant strain. The arrows indicate the coding region. (C) The protein structure ofthe wild-type and the ow mutant strain. VPS9, vacuolar protein sorting 9 domain; ANK, ankyrin repeat.

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293 291

not find any differences in the ORF of the other gene,BGIBMGA000181, between the wild-type and the ow mutantstrains. Thus, we concluded that BGIBMGA000173 corresponded tothe ow gene.

3.3. Characterization of the ow candidate gene

To determine the sequence of the full length cDNA of thecandidate gene, we sequenced the EST clone, fner50i09. Thecomplete cDNA sequence was 3501 bp-long, potentially encodinga protein of 920 amino acids, and consisted of two exons and oneintron (Fig. 3B). Next, we compared the ORFs of the wild-type(p50T) and the ow mutant strain (w17) using a primer set designedon the 50 and 30 UTR. We found a 25 bp-long insertion in the ORF ofthe ow strain at position 1291 nt that resulted in a frame-shiftmutation and generated a premature stop codon (Fig. 3A, B).

By MOTIF and InterProScan searches, we found that thededuced amino acid sequences of this gene possessed two motifs,a vacuolar sorting protein 9 (VPS9) and two ankyrin repeats

(Fig. 3C). The predicted protein of the ow mutant, however, lackedthe two ankyrin repeats (Fig. 3C). These results suggested that theankyrin repeats were responsible for the normal skin colorphenotype.

3.4. Expression of the ow candidate gene

RT-PCR analysis using total RNA isolated from 16 differenttissues of 5th instar larvae showed that the ow candidate gene wasexpressed in all tissues examined (Fig. 4A). Expression of this genewas also detected in all stages including the embryo andthroughout the larval stages (Fig. 4B).

3.5. Phylogenetic analysis

A BLAST search revealed that the deduced amino acid sequenceof the candidate gene showed high homology with a recentlyidentified protein, Varp, which contains a VPS9 domain and twoankyrin repeats (Zhang et al., 2006). Thus, we termed this gene

Fig. 4. Expression analysis of the ow candidate gene. (A) RT-PCR analysis in 16 tissuesof wild-type strain p50T. Lane 1, brain (BR); 2, prothoracic gland (PG); 3, salivary gland(SG); 4, fat body (FB); 5, trachea (TR); 6, hemocyte (HC); 7, testis (TES); 8, ovary (OV); 9,anterior silk gland (ASG); 10, middle silk gland (MSG); 11, posterior silk gland (PSG);12, foregut (FG); 13, midgut (MG); 14, hindgut (HG); 15, Malpighian tubule (MT); 16,integument (IG). (B) RT-PCR analysis of stage-specific expression in wild-type strainp50T. Lanes 1–3, egg, day 0, 4 and 8; Lanes 4–7, whole body, day 0–3 from 1st instar;Lanes 8–11, whole body, day 0–2 from 2nd instar larva; Lanes 12 and 13, whole body,day 0 from 3rd and 4th instar.

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293292

BmVarp (B. mori Varp). To investigate the evolutionary relationshipbetween BmVarp and other Varp proteins, we searched for proteinsshowing homology to BmVarp in public databases using the BLASTprogram, and constructed a phylogenetic tree by the neighbor-joining method (Fig. 5). The phylogenetic analysis showed thatBmVarp belongs to invertebrate lineages, and is closely related toa Varp of the parasitic wasp, N. vitripennis. In all four Varp proteinsfrom invertebrates have been deposited in public databases, buttheir functions are still unknown.

4. Discussion

In this study, we performed positional cloning of the ow geneusing Bombyx genome information, and demonstrated that a 25 bp-long insertional mutation in the candidate gene caused the owphenotype. The deduced amino acid sequence from this geneshowed high homology to a recently reported protein called Varp,

Fig. 5. Phylogenetic analysis of BmVarp and other Varps. Amino acid sequences were alineighbor-joining method. Bootstrap values after 1000 replications are shown. GenBank acc

and thus we termed the ow gene BmVarp. So far as we know, this isthe first report to characterize an invertebrate Varp.

Varp is a novel protein identified from M. musculus that containsa VPS9 domain and two ankyrin repeats (Zhang et al., 2006; Wanget al., 2008). Wang et al. reported that Varp functions as a Rab38effector (Wang et al., 2008). Co-immunoprecipitation assaysshowed that Varp associates with Rab38 in mammalian cells in vivo,and the first ankyrin repeat is critical for mediating the Varp–Rab38interaction.

The mutation in BmVarp of the ow strain resulted in thegeneration of a truncated protein lacking ankyrin repeats (Fig. 3C),suggesting that a truncated BmVarp may not interact with Rabproteins, causing abnormal vesicle transport in B. mori larvae. Takentogether, these results suggest that BmVarp is involved in theincorporation and/or accumulation of uric acid in the epidermisthrough its ankyrin repeats. Further biochemical studies arerequired to determine/investigate whether BmVarp interacts withBombyx Rab proteins.

Interestingly, RT-PCR analysis showed that BmVarp wasexpressed in all tissues and developmental stages examined. Theseresults support the idea that BmVarp may play some roles inendosome formation and vesicle trafficking not only at the integ-ument of the larval stage but also at other tissues and stages.However, in the ow strain, abnormal phenotypes other than the oilyskin were not observed. In addition, the ow larvae were growingnormally without the delay compared to other strains, suggestingthat BmVarp may not be important for the silkworm growth.

Recently, Fujii et al. reported the isolation of another oily mutantgene, od which is mapped on the Bombyx Z chromosome (Fujii et al.,2008). The od gene encodes a Bombyx homolog of the BLOS2subunit of the human ‘‘Biogenesis of Lysosome-related OrganellesComplex-1’’ (BLOC-1). In human and mouse, biogenesis of a seriesof lysosome-related organelles complexes (BLOC-1, BLOC-2, andBLOC-3) is related to a genetic disease, the Hermansky–Pudlaksyndrome (HPS) (Wei, 2006). These complexes are also known toplay important roles in endosomal transport, together with twoother well-known complexes, Adaptor Protein-3 (AP-3) andHomotypic vacuolar Protein Sorting complex (HOPS). Li et al.reported that mutations in the subunits of AP-3 (b3A andd subunits) or HOPS (Vps33a) cause HPS phenotypes in human andmouse (Li et al., 2004; Wei, 2006). HPS is an example of a geneti-cally heterogeneous syndrome that is the result of defects in

gned using the ClustalX program, and the phylogenetic tree was constructed by theession numbers of each protein are given in Materials and Methods.

K. Ito et al. / Insect Biochemistry and Molecular Biology 39 (2009) 287–293 293

protein trafficking along the endocytic/lysosomal pathway (Wei,2006; Li et al., 2007). The HOPS subunit includes the VPS motif-containing proteins, vps41 and vps18, which interact with AP-3(Li et al., 2007). In the present study, we identified a novel gene,BmVarp, encoding a VPS-containing protein as the gene responsiblefor the oily mutation, ow. Other genes encoding proteins with VPSdomains could be promising candidates for uncharacterizedBombyx oily mutation.

Currently, Bombyx genomic information has been updated. In2004, Japanese and Chinese groups independently published theirBombyx draft whole genome shotgun (WGS) sequence data (Mitaet al., 2004; Xia et al., 2004). In 2008, a newly assembled sequencedatabase (Build2) was constructed by integrating both sets of WGSdata. In addition, a high resolution SNP linkage map was developed(Yamamoto et al., 2006, 2008). Combined with the classical geneticresources, this information and molecular markers will be powerfultools for map-based cloning of genes of industrial, agricultural, andpotentially medical interest.

Acknowledgments

This work was supported by grants from MEXT (No. 17018007 toT.S), MAFF-NIAS (Agrigenome Research Program), NBRP (NationalBioResource Project), and JST (Professional Program for AgriculturalBioinformatics), Japan.

References

Chikushi, H., 1960. A new linkage group of the silkworm, Bombyx mori. J. Seric. Sci.Jpn 29, 278 (in Japanese).

Daimon, T., Katsuma, S., Iwanaga, M., Kang, W., Shimada, T., 2005. The BmChi-hgene, a bacterial-type chitinase gene of Bombyx mori, encodes a functionalexochitinase that plays a role in the chitin degradation during the moltingprocess. Insect Biochem. Mol. Biol. 35, 1112–1123.

Fujii, H., Banno, Y., Doira, H., Kawaguchi, Y., 1998. Genetical Stocks and Mutations ofBombyx mori: Important Genetic Resources, second ed. Institute of GeneticResources, Faculty of Agriculture, Kyusyu University, Fukuoka.

Fujii, T., Abe, H., Katsuma, S., Mita, K., Shimada, T., 2008. Mapping of sex-linkedgenes onto the genome sequence using various aberrations of the Z chromo-some in Bombyx mori. Insect Biochem. Mol. Biol. 38, 1072–1079.

Gopalapillai, R., Kadono-Okuda, K., Tsuchida, K., Yamamoto, K., Nohata, J.,Ajimura, M., Mita, K., 2006. Lipophorin receptor of Bombyx mori: cDNA cloning,genomic structure, alternative splicing, and isolation of a new isoform. J LipidRes. 47, 1005–1013.

Ito, K., Kidokoro, K., Sezutsu, H., Nohata, J., Yamamoto, K., Kobayashi, I., Uchino, K.,Kalyebi, A., Eguchi, R., Hara, W., Tamura, T., Katsuma, S., Shimada, T., Mita, K.,Kadono-Okuda, K., 2008. Deletion of a gene encoding an amino acid transporterin the midgut membrane causes resistance to a Bombyx parvo-like virus. Proc.Natl. Acad. Sci. USA 105, 7523–7527.

Li, W., Rusiniak, M.E., Chintala, S., Gautam, R., Novak, E.K., Swank, R.T., 2004. MurineHermansky–Pudlak syndrome genes: regulators of lysosome-related organ-elles. Bioessays 26, 616–628.

Li, W., Feng, Y., Hao, C., Guo, X., Cui, Y., He, M., He, X., 2007. The BLOC interactomesform a network in endosomal transport. J. Genet. Genomics 34, 669–682.

Mita, K., Kasahara, M., Sasaki, S., Nagayasu, Y., Yamada, T., Kanamori, H., Namiki, N.,Kitagawa, M., Yamashita, H., Yasukochi, Y., Kadono-Okuda, K., Yamamoto, K.,Ajimura, M., Ravikumar, G., Shimomura, M., Nagamura, Y., Shin-I, T., Abe, H.,Shimada, T., Morishita, S., Sasaki, T., 2004. The genome sequence of silkworm,Bombyx mori. DNA Res. 11, 27–35.

Tamura, T., Akai, H., 1990. Comparative ultrastructure of larval hypodermal cell innormal and oily Bombyx mutant. Cytologia 55, 519–530.

Tamura, T., Sakate, S., 1983. Relationship between expression of oily character anduric acid incorporation in the larval integument of various oily mutants of thesilkworm, Bombyx mori. Bull. Seric. Exp. Stat. 28, 719–740 (in Japanese).

Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular EvolutionaryGenetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24,1596–1599.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. TheCLUSTAL_X windows interface: flexible for multiple sequence alignment aidedby quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Wang, F., Zhang, H., Zhang, X., Wang, Y., Ren, F., Zhang, X., Zhai, Y., Chang, Z., 2008.Varp interacts with Rab38 and functions as its potential effector. Biochem.Biophys. Res. Commun. 372, 162–167.

Wei, M.L., 2006. Hermansky–Pudlak syndrome: a disease of protein trafficking andorganelle function. Pigment Cell Res. 19, 19–42.

Xia, Q., Zhou, Z., Lu, C., Cheng, D., Dai, F., Li, B., Zhao, P., Zha, X., Cheng, T., Chai, C.,Pan, G., Xu, J., Liu, C., Lin, Y., Qian, J., Hou, Y., Wu, Z., Li, G., Pan, M., Li, C., Shen, Y.,Lan, X., Yuan, L., Li, T., Xu, H., Yang, G., Wan, Y., Zhu, Y., Yu, M., Shen, W., Wu, D.,Xiang, Z., Yu, J., Wang, J., Li, R., Shi, J., Li, H., Li, G., Su, J., Wang, X., Li, G., Zhang, Z.,Wu, Q., Li, J., Zhang, Q., Wei, N., Xu, J., Sun, H., Dong, L., Liu, D., Zhao, S., Zhao, X.,Meng, Q., Lan, F., Huang, X., Li, Y., Fang, L., Li, C., Li, D., Sun, Y., Zhang, Z., Yang, Z.,Huang, Y., Xi, Y., Qi, Q., He, D., Huang, H., Zhang, X., Wang, Z., Li, W., Cao, Y.,Yu, Y., Yu, H., Li, J., Ye, J., Chen, H., Zhou, Y., Liu, B., Wang, J., Ye, J., Ji, H., Li, S., Ni, P.,Zhang, J., Zhang, Y., Zheng, H., Mao, B., Wang, W., Ye, C., Li, S., Wang, J.,Wong, G.K., Yang, H., 2004. A draft sequence for the genome of the domesti-cated silkworm (Bombyx mori). Science 306, 1937–1940.

Yamamoto, K., Narukawa, J., Kadono-Okuda, K., Nohata, J., Sasanuma, M.,Suetsugu, Y., Banno, Y., Fujii, H., Goldsmith, M.R., Mita, K., 2006. Constructionof a single nucleotide polymorphism linkage map for the silkworm, Bombyxmori, based on bacterial artificial chromosome end sequences. Genetics 173,151–161.

Yamamoto, K., Nohata, J., Kadono-Okuda, K., Narukawa, J., Sasanuma, M.,Sasanuma, S., Minami, H., Shimomura, M., Suetsugu, Y., Osoegawa, K., deJong, P.J., Goldsmith, M.R., Mita, K., 2008. A BAC-based integrated linkage mapof the silkworm Bombyx mori. Genome Biol. 9, R21.

Zhang, X., He, X., Fu, X.Y., Chang, Z., 2006. Varp is a Rab21 guanine nucleotideexchange factor and regulates endosome dynamics. J Cell Sci. 119, 1053–1062.