View
69
Download
8
Category
Preview:
Citation preview
MolecularGeneticsLaboratory
Dr. Basim Ayesh
Medical Technology Department
Al Aqsa University
2014‐2015
AL Aqsa university Medical Technology department
2
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
1.GeneralLaboratoryProcedures,EquipmentUse,andSafetyConsiderations
SafetyProceduresChemicalsA number of chemicals used in any molecular biology laboratory are hazardous. All manufacturers of hazardous materials are required by law to supply the user with pertinent information on any hazards associated with their chemicals. This information is supplied in the form of Material Safety Data Sheets or MSDS. This information contains the chemical name, Chemical Abstracts Service (CAS)#, health hazard data, including first aid treatment, physical data, fire and explosion hazard data, reactivity data, spill or leak procedures, and any special precautions needed when handling this chemical. A file containing MSDS information on the hazardous substances should be kept in the lab. In addition, MSDS information can be accessed on World Wide Web. You are strongly urged to make use of this information prior to using a new chemical and certainly in the case of any accidental exposure or spill. The instructor/lab manager must be notified immediately in the case of an accident
involving any potentially hazardous reagents.
The following chemicals are particularly noteworthy:
Phenol ‐ can cause severe burns
Acrylamide ‐ potential neurotoxin
Ethidium bromide ‐ carcinogen These chemicals are not harmful if used properly:
always wear gloves when using potentially hazardous chemicals
never mouth‐pipet them
If you accidentally splash any of these chemicals on your skin, immediately rinse the area thoroughly with water and inform the instructor.
Discard the waste in appropriate containers
UltravioletLightExposure to ultraviolet light can cause acute eye irritation. Since the retina cannot detect UV light, you can have serious eye damage and not realize it until 30 min to 24 hours
after exposure. Therefore, always wear appropriate eye protection when using UV lamps.
ElectricityThe voltages used for electrophoresis are sufficient to cause electrocution. Cover the buffer reservoirs during electrophoresis. Always turn off the power supply and unplug the leads before removing a gel.
GeneralHousekeeping All common areas should be kept free of clutter and all dirty dishes,
electrophoresis equipment, etc. should be dealt with appropriately.
Since you have only a limited amount of space to call your own, it is to your advantage to keep your own area clean.
Since you will use common facilities, all solutions and everything stored in an incubator, refrigerator, etc. must be labeled. In order to limit confusion, each person should use his initials or other unique designation for labeling tubes, etc.
AL Aqsa university Medical Technology department
3
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Unlabeled material found in the refrigerators, incubators, or freezers may be destroyed. Always mark your materials with your initials, the date, and relevant experimental data.
PreparationofSolutionsCalculationofMolar,%and"X"Solutions.
1. A molar solution is one in which 1 liter of solution contains the number of grams equal to its molecular weight. Example: To make up 100 ml of a 5M NaCl solution = 58.456 (mw of NaCl) g/mol x 5 moles/liter x 0.1 liter = 29.29 g in 100 ml of solution
2. Percent solutions.Percentage (w/v) = weight (g) in 100 ml of solution; Percentage (v/v) = volume (ml) in 100 ml of solution. Example: To make a 0.7% solution of agarose in TBE buffer, weight 0.7 of agarose and bring up volume to 100 ml with TBE buffer.
3. "X" Solutions. Many enzyme buffers are prepared as concentrated solutions, e.g. 5X or 10X (five or ten times the concentration of the working solution) and are then diluted such that the final concentration of the buffer in the reaction is 1X. Example: To set up a restriction digestion in 25 µl, one would add 2.5 µl of a 10X buffer, the other reaction components, and water to a final volume of 25 µ l.
PreparationofWorkingSolutionsfromConcentratedStockSolutions.Many buffers in molecular biology require the same components but often in varying concentrations. To avoid having to make every buffer from scratch, it is useful to prepare several concentrated stock solutions and dilute as needed. Example: To make 100 ml of TE buffer (10 mM Tris, 1 mM EDTA), combine 1 ml of a 1 M Tris solution and 0.2 ml of 0.5 M EDTA and 98.8 ml sterile water. The following is useful for calculating amounts of stock solution needed: C i x V i = C f x V f , where C i = initial concentration, or conc. of stock solution; V i = initial vol, or amount of stock solution needed C f = final concentration, or conc. of desired solution; V f = final vol, or volume of desired solution
GlasswareandPlasticWare.Glass and plastic ware used for molecular biology must be clean. Dirty test tubes and traces of detergent can inhibit reactions or degrade nucleic acid.
Glassware should be rinsed with distilled water and autoclaved or baked at 150
degrees C for 1 hour.
For experiments with RNA, glassware and solutions are treated with diethyl‐
pyrocarbonate (DEPC) to inhibit RNases which can be resistant to autoclaving.
Plastic ware such as pipets and culture tubes are often supplied sterile. Tubes made
of polypropylene are turbid and are resistant to many chemicals, like phenol and
chloroform; polycarbonate or polystyrene tubes are clear and not resistant to many
chemicals. Make sure that the tubes you are using are resistant to the chemicals
used in your experiment.
Micro pipet tips and microfuge tubes should be autoclaved before use.
DisposalofBuffersandChemicals1. Any uncontaminated, solidified agarose should be discarded in the trash, not in
the sink, and the bottles rinsed well.
2. Any media that becomes contaminated should be promptly autoclaved before discarding it.
AL Aqsa university Medical Technology department
4
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Petri dishes and other biological waste should be discarded in Biohazard containers which will be autoclaved prior to disposal.
3. Organic reagents, e.g. phenol, should be used in a fume hood and all organic waste should be disposed of in a labeled container, not in the trash or the sink.
4. Ethidium bromide is a mutagenic substance that should be treated before disposal and should be handled only with gloves. Ethidium bromide should be disposed of in
a labeled container. 5. Dirty glassware should be rinsed, all traces of agar or other substance that will not
come clean in a dishwasher should be removed, all labels should be removed (if possible), and the glassware should be placed in the dirty dish bin. Bottle caps, stir bars and spatulas should be washed with hot soapy water, rinsed well with hot water, and rinsed three times with distilled water.
EquipmentGeneralCommentsIt is to everyone's advantage to keep the equipment in good working condition. As a rule of thumb, don't use anything unless you have been instructed in the proper use. This is true not only for equipment in the lab but also departmental equipment. Report any malfunction immediately. Rinse out all centrifuge rotors after use and in particular if anything spills. Please do not waste supplies ‐ use only what you need. If the supply is running low, please notify either the instructor/lab manager before the supply is completely exhausted.
MicropipettorsMost of the experiments you will conduct in this laboratory will depend on your ability to accurately measure volumes of solutions using micropipettors. The accuracy of your pipetting can only be as accurate as your pipettor and several steps should be taken to insure that your pipettes are accurate and are maintained in good working order. Since the pipettors will use different pipet tips, make sure that the pipet tip you are using is designed for your pipettor. DO NOT DROP IT ON THE FLOOR. If you suspect that something is wrong with your pipettor, first check the calibration to see if your suspicions were correct, then notify the instructor.
StorageofDNA.The following properties of reagents and conditions are important considerations in processing and storing DNA and RNA.
Heavy metals promote phosphodiester breakage. EDTA is an excellent heavy metal chelator.
Free radicals are formed from chemical breakdown and radiation and they cause phosphodiester breakage.
UV light at 260 nm causes a variety of lesions, including thymine dimers and cross‐link.
Biological activity is rapidly lost. 320 nm irradiation can also cause cross‐link, but less efficiently.
Ethidium bromide causes photo oxidation of DNA with visible light and molecular oxygen.
Oxidation products can cause phosphodiester breakage.
If no heavy metal are present, ethanol does not damage DNA.
Nucleases are found on human skin; therefore, avoid direct or indirect contact between nucleic acids and fingers. Most DNases are not very stable; however, many RNases are very stable and can adsorb to glass or plastic and remain active.
AL Aqsa university Medical Technology department
5
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
‐20 deg C: this temperature causes extensive single and double strand breaks. ‐70 E C is probable excellent for long‐term storage.
For long‐term storage of DNA, it is best to store in high salt ( >1M) in the presence of high EDTA ( >10mM) at pH 8.5.
There is about one phosphodiester break per 200 kb of DNA per year.
InstructionsforNotebookKeeping1. A notebook should be kept for laboratory experiments only using a scientific
notebook book or other bound book. The notebook should be written in ink, and each page signed and dated. Mistakes are not to be erased but should be marked out with a single line. Try to keep your notebook with the idea that someone else must be able to read and understand what you have done. The notebook should always be up‐to‐date and can be collected at any time.
2. INDEX: An index containing the title of each experiment and the page number should be included at the beginning of the notebook.
3. WHAT SHOULD BE INCLUDED IN THE NOTEBOOK? Essentially everything you do in the
4. laboratory should be in your notebook. The notebook should be organized by experiment only and should not be organized as a daily log. Start each new experiment on a new page. The top of the page should contain the title of the experiment, the date, and the page number. The page number is important for indexing, referring to previous experiments, and for labeling materials used in a given experiment. If an experiment spans more than one page, note the page on which the experiment continues if it's not on the next page. Each experiment should include the following:
Title/Purpose: Every experiment should have a title and it should be descriptive. Many experiments should also describe the purpose of the experiment and include any information that is pertinent to the execution of the experiment or to the interpretation of the results.
Background information: This section should include any information that is
pertinent to the execution of the experiment or to the interpretation of the
results. Include anything that will be helpful in carrying out the experiment
and deciphering the experiment at a later date. For the most part, notebooks
are not written for today but for the future.
Materials: This section should include the key materials, i.e., solutions or
equipment, that will be needed. It is not necessary to include every piece of
lab equipment required, i.e. vortexer, pipetman, etc, but you should include
any specialized equipment and the manufacturer, i.e, real‐time PCR
instrument. Composition of all buffers should be included unless they are
standard or are referenced. Pre‐packaged kits should be identified as to the
name of the kit, the vendor, and the catalog number. Biological samples should
be identified by genus and species, strain number, tissue type, and/or
genotype with the source of the material identified. Enzymes should be
identified by name, vendor, and concentration. DNA samples should be
identified as to 1: type of DNA, i.e., chromosomal, plasmid, etc, 2: purity
(miniprep, gel purified, PCR product) 3: concentration, if known, and 4:
source, (include prior experiment number if the DNA was isolated in a previous
experiment). Include all calculations made in preparing solutions. The
AL Aqsa university Medical Technology department
6
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
sequence of all oligonucleotides must be included or referenced. Agarose gels
should be identified by percentage and buffer used. If any of these materials
were used in previous experiments, include only the reference to that earlier
experiment, do not repeat the information again.
Procedure: Write down exactly what you are going to do before you do it and make sure you understand each step before you do it. In general, You should include everything you do including all volumes and amounts. Writing a procedure out helps you to remember and to understand what it is about. It will also help you to identify steps that may be unclear or that need special attention. Flow charts are sometimes helpful for experiments that have many parts. Tables are also useful if an experiment includes a set of reactions with multiple variables.
Results: This section should include all raw data, including gel photographs, printouts, etc. All lanes on gel photographs must be labeled and always identify the source and the amount of any standards. This section should also include your analyzed data, for example, calculations.
Conclusions/Summary: This is one of the most important sections. You should
summarize all of your results, even if they were stated elsewhere and state
any conclusions you can make. If the experiment didn't work, what went
wrong and what will you do the next time to try to trouble shoot?
These guidelines were briefed from: MOLECULAR BIOLOGY LAB MANUAL The Beginning.
Compiled by: Hikmet Geckil, Department of Molecular Biology and Genetics, Inonu
University, Malatya, Turkey
AL Aqsa university Medical Technology department
7
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
2.MetaphaseChromosomePreparationfromCulturedPeripheralBloodCellsThe protocols in this section were adopted from (Current Protocols in Human Genetics)
CULTUREANDMETAPHASEHARVESTOFPERIPHERALBLOODWhen T lymphocytes in whole blood are stimulated with the mitogenic plant lectin
phytohemagglutinin (PHA), they “activate” to blast‐like cells within 12 to 24 hr and con nue
to proliferate for 2 to 4 days. Metaphase cells are obtained by trea ng cultures with Colcemid,
a colchicine analog that disrupts the centriole/spindle‐fiber complex by interfering with
microtubule formation. This treatment results in mitotic arrest, which in turn leads to an
accumulation of cells in metaphase. Mitotic arrest is followed by treatment with a hypotonic
KCl solution (hypotonic “shock”) to increase cellular volume. The cells are then fixed with
methanol/acetic acid to remove water and disrupt cell membranes before being spread onto
slides.
Most clinical cytogene c laboratories culture peripheral blood lymphocytes for a period of 48‐
72 hours in a complete culture medium which consists of a basal medium supplemented with
approximately 10‐40% fetal bovine serum, PHA in the range of approximately 1‐2% v/v
depending on source, L‐glutamine and antibiotics. The optimum concentration usually needs
to be determined prior to use or one can follow vendor dilution recommendations for the lot
in use.
Materials Heparinized whole blood obtained via Vacutainer or syringe with preservative‐free
sodium heparin (25 U/ml blood)
CAUTION: Human blood is hazardous.
PB‐MAX™ culture medium (GIBCO): an op mized RPMI 1640 medium, supplemented
with Fetal Bovine Serum (FBS), L‐glutamine, and phytohemagglutinin (PHA).
optimized for the karyotype analysis of peripheral blood lymphocytes. Thawed
medium can be stored at 2–8°C for up to 14 days.
o Thaw PB‐MAX Karyotyping medium at 4 to 8°C. Warm the medium to room
temperature and gently swirl to mix prior to use.
o PB‐MAX Karyotyping medium can be thawed and aseptically transferred into
smaller aliquots for convenience. These aliquots can be frozen and thawed at
time of use, however multiple freeze‐thaw cycles should be avoided.
o Avoid prolonged exposure to light when using this culture medium product.
10 μg/ml Colcemid (GIBCO)
75 mM KCl (0.56 g in 100 ml H2O; store ≤2 weeks at room temperature)
Fixa ve: 3:1 (v/v) absolute methanol/glacial ace c acid, (prepare fresh and keep on
ice)
15‐ml sterile disposable conical polypropylene centrifuge tubes
AL Aqsa university Medical Technology department
8
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Collectsampleandinitiatecultures1. Collect peripheral blood by venipuncture into a sodium heparin Vacutainer or a
syringe with 25 U preserva ve‐free sodium heparin per milliliter of blood.
Other anticoagulants, such as lithium heparin or EDTA are toxic to cells and
should never be used.
Samples should be shipped at room temperature. Blood in sodium heparin can
be held for ≤4 days and s ll be cultured successfully, but cultures are best
initiated as soon as possible. If necessary, the specimen can be stored at 4◦C.
2. Inoculate 0.25 ml of the whole blood obtained in step 1 (0.2 ml for newborns ≤3 weeks
old) into a sterile 15‐ml centrifuge tube containing 5 ml PB‐MAX™ culture media.
A single culture typically yields three to five full‐slide preparations, or more if
only part of the slide is used. Multiple cultures may be set up to meet clinical
or research needs.
3. Incubate 2 to 4 days with tubes lted at 45◦ in order to promote air exchange.
Three‐day incuba ons are op mal, but 2‐ or 4‐day cultures can be used to
accommodate laboratory scheduling concerns.
Cultures from newborns will usually work well at 2 days but may also be
harvested either directly or following a 1‐day culture. Older patients’
leukocytes require 3‐ or 4‐day cultures because they do not seem to respond
as quickly to PHA stimulation.
Harvestculture4. Initiate harvest by adding 50 μl of 10 μg/ml Colcemid (0.1 μg/ml final). Incubate 30
min in a humidified 37◦C, 5% CO2 incubator.
The harvest can be initiated at any me 3 to 4 days following the culture
described in step 3.
5. Centrifuge 7 min at 500×g, room temperature. Discard supernatant.
6. Add 5 ml of 75 mM KCl pre‐wormed at 37◦C and gently resuspend cells. Let stand 15
min at 37◦C.
The amount of hypotonic solution to be added should be adjusted to the
volume of the pellet. Some laboratories vary the length of hypotonic
treatment. Increasing the time will increase chromosome spreading, but this
treatment is a hypotonic “shock,” so that increasing the amount of hypotonic
solution will have more impact than increasing the time of treatment.
7. Add 1ml of ice‐cold fixative drop by drop with a Pasteur pipet while mixing by vortex.
Centrifuge as in step 5.
This treatment serves to reduce the pH of the cells gradually to precondition
them for the following fixation steps. It also lyses remaining red blood cells
and begins the process of clearing resulting cellular debris.
8. Remove all but 0.5 ml of the supernatant and resuspend pellet in remaining
supernatant by drawing it gently up and down with a Pasteur pipet. Add 5 ml ice‐cold
fixative drop by drop while mixing by vortex. Leave on ice for 20 min. Centrifuge as in
step 5.
AL Aqsa university Medical Technology department
9
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
The pellet after step 7 will be brown and clumpy because of erythrocyte debris.
Resuspend gently but thoroughly to avoid clumped lymphocytes which may
complicate slide‐making.
Do not draw too much volume into the pipet while resuspending because the
cells will stick permanently to glass.
Do not press the pipet tip against the bottom of the tube when drawing and
delivering the suspension, as this will lyse cells. The pellet after step 8 will be
more homogeneous, and will usually have a light‐brown to white color. It may
be ≤0.1 ml in volume.
9. Aspirate supernatant, resuspend pellet and repeat step 8 (without incuba on) un l
the pellet is clear.
10. Remove supernatant and resuspend pellet in a volume of fixative sufficient to produce
a light milky suspension (about 0.5ml). Allow to stand 30 min at room temperature or
store overnight at 4◦C.
Longer fixation will often improve chromosome spreading in difficult harvests.
Keeping the suspension overnight at 4◦C can improve the quality of the
preparation or can be done for scheduling reasons. Suspensions should be kept
in polypropylene tubes containing plenty of fixa ve (e.g., 5 ml). Polystyrene
tubes will react with fixative and should not be used.
CHROMOSOMESLIDEPREPARATIONSlide‐making is the least standardized and understood of cytogenetic protocols, about which
technologists have widely variable and sometimes contradictory ideas. In the end what really
matters is that slide preparations are consistent and appropriate for the desired analysis. The
protocol presented here is not the only approach to chromosome slide preparation but it
works under varied physical conditions (slide‐making is very climate‐dependent) and for a
wide range of cell cultures. It can be used for peripheral blood, bone marrow, ascites and
pleural effusions, amniotic fluid and tissue flask harvests, somatic cell or radiation hybrids,
lymphoblastoid cell lines, and nonhuman and hybridoma cultures—in short, any culture
harvest that results in a fixed suspension of mitotic cells. Harvested peripheral blood cultures
suspended in methanol/acetic acid fixative are applied to wet microscope slides, flooded with
fixative, and air‐dried. The drying process is adjusted according to ambient temperature and
humidity to optimize spreading and morphology of chromosomes for subsequent banding and
analysis. The protocol described here produces preparations that are particularly suitable for
analysis by G‐banding or in situ hybridization, although many other staining techniques or
procedures may be used.
Materials Fixed cultures prepared as previously described
Fixa ve: 3:1 (v/v) methanol/ace c acid (use 100% methanol and glacial ace c acid)
Microscope slides (one end frosted) stored in 100% methanol (absolute) in Coplin jars
Lint‐free tissue (e.g., Kimwipe or gauze pad)
Standard phase‐contrast microscope
AL Aqsa university Medical Technology department
10
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Procedures1. Remove slide from methanol and polish with lint‐free tissue, such as a folded Kimwipe
or gauze pad. Dip slide once in methanol and then several times in deionized water
until the methanol is gone and a thin, uniform film of water covers the slide.
Good slides have few pits and imperfections and will hold a thin film of water
across the entire slide, which reduces the surface tension prior to addition of
the cell suspension. Cleaning each slide is essential, as few precleaned slides
are truly clean enough for chromosome preparations.
2. Holding the frosted end between the thumb and finger, position the slide with the
one long edge parallel to the bench top, and blot the lower long edge on a paper towel
to draw off excess water. Keeping the lower long edge in contact with the paper towel,
lower the opposite edge un l the slide forms a 30◦ angle with the bench top, with the
film of water facing up (Fig. 1).
3. From a Pasteur pipet held in a horizontal posi on 1 to 2 inches above the slide, place
3 drops of cell suspension, evenly spaced, onto the slide, moving successively toward
the frosted end. Drops should strike the tilted slide one‐third of its width from the
elevated long edge (Fig. 1.a). The drops should burst on the water film and spread out
evenly as they strike.
Positioning and spacing of drops is critical. The goal is even dispersal of cells
across the entire surface of the slide. This contributes to consistent and
uniform slide‐drying, which will optimize chromosome spreading. If discrete
areas of cells are observed at the drop sites, surrounded by areas with few
cells, the slide should be held at a lower angle (i.e., <30◦) when the drops are
applied. Applying drops in sequence toward the frosted end allows excess
water and fixative to flood onto the frosted end without pooling. Placing drops
closer to the elevated edge of the angled slide helps to disperse the cells in
suspension uniformly across the width of the slide. If amount of cell pellet is
limited, slides should be made using one or two drops.
Some in situ hybridization protocols call for an array of different hybridization
probes on the same slide. An array of metaphases can easily be prepared by
adding a small amount (e.g., 10 μl) to each area of the slide that is to be
hybridized. This is best done in succession before proceeding to step 4 below.
4. Position the slide with one long edge parallel to the bench top and blot the lower long
edge to draw off excess fixative. Tilt the slide at a 30◦ angle as in step 2 and flood with
fresh 3:1 methanol/ace c acid fixa ve, dropwise, using a Pasteur pipet. Start at the
elevated corner of the nonfrosted end and move toward the frosted end, placing
drops on the upper edge of the slide (Fig. 1.b).
This will uniformly displace any remaining water and allow the slide to dry
evenly. It is critical to flood the slide toward the frosted end so that excess
fixative does not pool on the slide surface. As fixative is placed across the top
of the slide, it will displace a front of water and leave a uniform surface of
fixative. This process also serves to remove debris that might otherwise collect
over cells and thus disturb any future procedures that are to be performed on
the preparations, such as banding or in situ hybridization.
AL Aqsa university Medical Technology department
11
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
5. Position the slide again so that one long edge is parallel to the bench top, blot the
lower long edge, and wipe off the back of the slide. Place so that the nonfrosted end
is elevated 30◦ with respect to the frosted end, with the cell side facing up. Air dry.
Correct drying, as indicated by chromosome spreading and contrast under
phase microscopy, must be monitored on a slide‐by‐slide basis. It is a function
of surface tension, which in turn is related to relative humidity and ambient
temperature. Simply placing a slide on an angle to dry as suggested above
may work well if ambient conditions are conducive (20◦ to 22◦C with a rela ve
humidity of ∼50%). More o en, addi onal manipula ons to control rate and
duration of drying will be necessary to optimize quality of preparations.
6. Examine slides for good chromosome spreading and morphology by phase‐contrast
microscopy.
Storage of a slide preparation will depend on its intended use. Slides to be used
for fluorescence in situ hybridization (FISH) should be used within several
weeks without baking or artificial aging. Because the chromosome
preparations on slides are biodegradable, they should be stored in a clean, dry
container in the dark at room temperature (short‐term storage), or frozen at
−70◦C (long‐term storage).
AGINGSLIDESWITHHEATTime, heat, and drying cause an alteration in chromosomal material (probably protein
denaturation) that affects banding. Underaged slides result in fuzzy banding. Overaged slides
do not band. Techniques for manipulating the aging of chromosome slides vary widely.
Optimal aging conditions may vary with cell type or tissue source.
Incubate air‐dried slide of metaphase chromosomes 2 days at 55°C or 20 min at 90° to 95°C
(using dry oven or slide warmer). If it is necessary to reduce time of incubation, increase
temperature. If incuba on me will be longer than 2 days (e.g., over a weekend), decrease
temperature. Optimal times and temperatures must be established empirically in each
laboratory.
AgingofSlideswithHydrogenPeroxideWhen immediate banding of slides is required, the effects of aging can be obtained with
hydrogen peroxide treatment.
Materials Air‐dried slides of metaphase chromosomes (prepare freshly)
15% (v/v) H2O2 (dilute 30% H2O2 1:1 with water immediately before use)
50°C hot plate or slide warmer
CAUTION: H2O2 is hazardous
1. Flood freshly prepared slide with 15% H2O2. Leave peroxide in contact with slide for
7 min.
Slide can be aged immediately after preparation.
2. Place slide in Coplin jar filled with water and rinse under running tap water 2 min.
AL Aqsa university Medical Technology department
12
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
3. Place slide on 50°C hot plate or slide warmer 1 hr to overnight. Cool to room
temperature and proceed with banding.
Figure 1 Chromosome slide preparation: (A) After blotting the long edge of the slide to obtain
a thin uniform layer of water, the slide is tilted to ∼30◦ and 3 separate drops of fixed cell suspension are applied starting away from and proceeding toward the frosted end. This
sequence allows excess fixative and water to flood onto the frosted end without pooling on the
slide. Application of the drops 1/3 of the distance from the top of the slide (indicated by Xs)
counteracts the downhill dispersal tendency of cells on the slide and promotes even dispersal
across the slide width. (B) After application of the cell suspension, the slide is flooded with
fixative across the top edge, again proceeding toward the frosted end. This displaces a front
of remaining water across the slide and onto the frosted end. It is important to avoid pooling
of excess fluid on the surface of the slide, and to obtain a thin, even film of fixative to ensure
uniform drying.
AL Aqsa university Medical Technology department
13
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
AL Aqsa university Medical Technology department
14
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
CHROMOSOMEBANDINGTECHNIQUESChromosome banding techniques produce a series of consistent landmarks along the length
of metaphase chromosomes that allow for both recognition of individual chromosomes within
a genome and identification of specific segments of individual chromosomes. These
landmarks facilitate assessment of chromosome normalcy, identification of sites of
chromosome breaks and alterations, and location of specific genes. The basic banding
techniques (Q‐banding, G‐banding, and R‐banding) produce virtually identical patterns of
bands along the length of human chromosomes, although the bands and polymorphic regions
highlighted may differ with each technique. Utility of these banding patterns stems from the
fact that the pattern of bands obtained will be identical from cell to cell, from tissue to tissue,
and, except within polymorphic regions, from individual to individual within a species. The
fidelity of chromosome‐banding patterns most likely stems from the underlying organization
of DNA sequences and associated proteins in chromosomes. This organization is faithfully
preserved at each cell division, and no mechanisms are currently recognized that disrupt these
patterns. Even in rearrangements of a chromosome, such as those that occur in
translocations, the fidelity of the banding pattern in the rearranged segment is maintained,
allowing identification of the translocated segment. These basic banding techniques highlight
reproducible landmarks along the length of the chromosome and specialized staining
techniques can be used to highlight particular regions of chromosomes, such as
heterochromatic and repeated‐sequence segments. The technique presented can be applied
to both metaphase and prometaphase (extended, high‐resolution) chromosome preparations
from any tissue source. Choice of staining technique will vary with the application and
available equipment (bright‐field versus fluorescence microscopy).
GTGTechniqueforG‐BandingG‐banding is the most frequently used technique in clinical cytogenetics laboratories because
of the permanence of the bands produced and the ease with which they can be photographed.
There are numerous G‐banding techniques, but all combine a pretreatment step that probably
alters chromosomal proteins, followed by a staining step with a Romanowsky‐type dye
mixture (a thiazine eosin‐azure dye mixture, usually Giemsa stain, hence G‐banding). The basic
protocol described below, known as GTG‐banding (G‐banding by trypsin with Giemsa), uses
the proteolytic enzyme trypsin for pretreatment followed by staining with Giemsa. G‐banding
patterns can be viewed and photographed with a bright‐field microscope.
Materials HBSS (Hanks balanced salt solution)
o 0.40 g KCl (5.4 mM)
o 0.09 g Na2HPO4⋅7H2O (0.3 mM)
o 0.06 g KH2PO4 (0.4 mM)
o 0.35 g NaHCO3 (4.2 mM)
o 0.14 g CaCl2 (1.3 mM)
o 0.10 g MgCl2⋅6H2O (0.5 mM)
o 0.10 g MgSO4⋅7H2O (0.6 mM)
o 8.0 g NaCl (137 mM)
o 1.0 g D‐glucose (5.6 mM)
AL Aqsa university Medical Technology department
15
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
o 0.01 g phenol red (0.01%; op onal)
o Add H2O to l liter and adjust to pH 7.4
o Filter sterilize and store at 4°C
HBSS can also be purchased from a number of commercial suppliers.
HBSS may be made or purchased without CaCl2 and MgCl2. These components
are optional and usually have no effect on an experiment; in a few cases, however,
their presence may be detrimental. Consult individual protocols to see if the
presence or absence of these components is recommended.
Trypsin solution (see recipe)
o Stock solution: 0.5% Trypsin‐EDTA (10X), no Phenol Red (GIBCO). Divide into
2‐ml aliquots and store frozen at −20°C.
o Working solution: Combine 2.5 ml 10X stock solu on with 47.5 ml disodium
phosphate buffer (see recipe) in a Coplin jar. Prepare fresh.
70% and 90% (v/v) ethanol
Giemsa Stain:
o Add 1g Giemsa powder to 66 ml methanol and 66 ml glycerin and s r for 2
days at room temperature.
o The stain should be prepared at least 2 weeks before used and stored in a
darkened container in a refrigerator
2% Giemsa (v/v) staining solu on
o 1 ml Giemsa stain
o 49 ml H2O
o Prepare fresh daily in Coplin jar
Disodium phosphate buffer, pH 7.0
o 0.2 g KCl (2 mM final)
o 8.0 g NaCl (0.14 M final)
o 0.2 g monobasic potassium phosphate (KH2PO4; 1.4 mM final)
o 1.16 g dibasic sodium phosphate (Na2HPO4; 8 mM final)
o 1 liter H2O
o Adjust pH to 7.0 with monobasic or dibasic phosphate solution if needed
o Store ≤6 months at room temperature
Aged slides of metaphase chromosomes (see support protocols)
Xylene (CAUTION: Xylene is hazardous)
NOTE: Because the stain is difficult to remove from skin, it is advisable to wear gloves
when working with Giemsa.
Procedures1. Prepare a series of Coplin jars containing the following at room temperature:
jar 1—HBSS
jar 2—trypsin solution
jar 3—HBSS
jar 4—70% ethanol
jar 5—90% ethanol
AL Aqsa university Medical Technology department
16
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
jar 6—2% Giemsa staining solu on
jar 7—H2O.
2. Place aged slide of metaphase chromosomes briefly (∼10 sec) in jar 1.
3. Transfer slide to jar 2. Incubate for op mal trypsiniza on me.
Insufficient trypsinization results in evenly stained slides with no bands. Over‐
trypsinization results in pale “puffy” chromosomes with staining around the
outside of the chromosome. Optimal trypsinization times will vary with the
source of cells. Three to five identical slides should be available so that it is
possible to vary trypsinization time as needed to obtain optimal banding.
Recommended initial trypsinization time is 60 sec for good‐quality, well‐aged
slides from lymphocytes or amniocytes, 90 sec for slides of other cells from
long‐term tissue culture (chorionic villus samples, solid tumors, skin
fibroblasts, etc.), and 30 sec for slides from bone marrow.
4. Place slide in jars 3 to 5, dipping slide 3 to 4 mes in each jar. Air dry.
It is possible to pause at this point for several hours before proceeding to step
5.
5. Place slide in jar 6 for 4 min.
Optimal staining time may need to be determined empirically.
6. Place slide in jar 7 for ∼30 sec. Air dry.
Once stained, slide can be stored for months or years.
7. View and photograph with bright‐field microscope (see Fig. 2).
It is not necessary to mount slide with a coverslip; oil can be placed directly on
the slide. For storage of slides, rinse off immersion oil using fresh xylene.
Use a green interference filter for black and white photography.
Figure 2 G‐banded metaphase spread from a phenotypically normal 46,XY male. X and Y
chromosomes indicated by arrows. Chromosomes are stained with Giemsa.
AL Aqsa university Medical Technology department
17
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
3.FluorescentIn‐SituHybridization(FISH)
ProcedureforFISHanalysisofchromosomes13/21/X/Y/18
Reagents:Poseidon™ Repeat Free™ Chromosome 13/21, X/Y/18 specific DNA Probes
Vial 1
Cri cal region 1 (red): The 21q specific DNA probe is direct‐labeled with Pla numBright550.
Cri cal region 2 (green): The 13q14 specific DNA probe is direct‐labeled with Pla numBright495.
Vial 2
Cri cal region 3 (blue): The 18 SE DNA probe is direct‐labeled with Pla numBright415.
Cri cal region 4 (green): The X SE DNA probe is direct‐labeled with Pla numBright495.
Cri cal region 5 (red): The Y SE DNA probe is direct‐labeled with
Pla numBright550.
Intendeduse:The chromosome 21 specific region probe is op mized to detect copy numbers of chromosome 21 at 21q22.1 on uncultured amnio c cells. The chromosome 13 specific region probes is op mized to detect copy numbers of Chromosome 13 at 13q14.2 on uncultured amnio c cells. The chromosome 18 specific Satellite probe (D18Z1) is op mized to detect copy numbers of Chromosome 18 at 18p11‐18q11 on uncultured amnio c cells. The chromosome X specific Satellite probe (DXZ1) is op mized to detect copy numbers of Chromosome X at Xp11‐Xq11 on uncultured amnio c cells. The chromosome Y specific Satellite probe (DYZ3) is op mized to detect copy numbers of Chromosome Y at Yp11‐Yq11 on uncultured amnio c cells.
The class will be divided into three groups. Each group will prepare 2 slides from uncultured
blood.
One interphase slide‐preparation (labeled I‐1) and one metaphase slide prepara on
(labeled M‐1) will be selected for chromosomes 13/21 probe mix.
One interphase slide‐preparation (labeled I‐2) and one metaphase slide prepara on
(labeled M‐2) will be selected for chromosomes X/Y/18 probe mix.
Specimen: Uncultured blood and bone marrow preparations for interphase FISH:
Sample preparation:
1. Add 10 ml of 75 mM KCl at room temperature to 0.25‐1 ml of blood or bone
marrow and gently mix. Let stand 15 min at room temperature.
AL Aqsa university Medical Technology department
18
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
2. Add 10 to 12 drops of fixative with a Pasteur pipet and mix well. Centrifuge
for 8 min at 180×g, room temperature.
3. Remove all but 0.5 ml of the supernatant and resuspend pellet in remaining
supernatant by drawing it gently up and down with a Pasteur pipet. Add 1 ml
fixative and immediately mix gently. Adjust volume to 5 ml with fixa ve and
mix thoroughly. Centrifuge as previously.
4. The pellet will be brown and clumpy because of erythrocyte debris.
Resuspend gently but thoroughly to avoid clumped lymphocytes which may
complicate slide‐making.
5. Aspirate supernatant, resuspend pellet in 5 ml fixa ve, and centrifuge as
previously.
6. Remove supernatant and resuspend pellet in a volume of fixative sufficient to
produce a light milky suspension. Allow to stand 30 min at room temperature
or store overnight at 4◦C.
Slidemaking:1. Clean microscope slides by dipping in methanol and drying by wiping with lint‐
free cloth to ensure the slides are grease‐free.
2. Add a drop of the fixed cells suspension onto a microscope slide.
3. Allow to air dry.
4. Check the cell density under phase contrast microscope.
Heparinized whole blood cultured in RPMI 1640 medium supplemented with fetal
bovine serum, penicillin, streptomycin and L‐glutamine and 2% PHA. The blood
cultures are harvested and fixed by methanol/acetic acid and the slides prepared
according to standard techniques (refer to materials from karyotyping training
session).
Slidespretreatment:1. Fill a ver cal Coplin jar with 50 ml pretreatment buffer (see preparations).
2. Incubate the jar at 37°C for enough time to worm the pretreatment buffer, before
proceeding with the procedure
3. Dip the prepared slides into the pre‐wormed buffer
4. Incubate at 37°C for 15 min.
Dehydration:During the incuba on period prepare 3 horizontal Coplin jars containing 100 ml of the
following ethanol concentra ons at room temperature: (70%, 85% and 100%).
a. Dip the slides in 70% ethanol for 1 min
b. Dip the slides in 85% ethanol for 1 min
c. Dip the slides in 100% ethanol for 1 min
d. Air‐dry the slides.
Co‐Denaturation/Hybridization:1. Apply 10μl of 13/21 probe prepara on or (ready to use) onto each of slides # I‐2 and
M‐1. Avoid genera on of air bubbles.
AL Aqsa university Medical Technology department
19
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
2. Apply 10μl of X/Y+18 probe prepara on or (ready to use) onto each of slides # I‐4
and M‐2. Avoid genera on of air bubbles.
3. Gently cover each slide with (22 X 22 mm) cover slip, and make sure that the applied
probe preparation is uniformly spread beneath the cover slips.
4. Seal the cover slips to the slides with Fixogum.
5. Incubate the slides at 75°C for 5‐10 min on a hotplate with precise temperature
control (Thermal cycler or a slide thermo‐mixer may be used).
6. Incubate the slides in a sealed humidified box or slide thermo‐mixer at 37°C for
overnight (12‐16 Hrs).
Post‐Hybridizationstringencywashing:1. Prepare two Coplin jars:
a. Fill the first with 100 ml of Post‐wash buffer I, and pre incubate in a water
bath adjusted at 72°C for enough me to raise the buffer temperature to the
desired temperature (72°C).
b. Fill the second jar with 100 ml of Post‐wash buffer II and keep at room
temperature.
2. Remove the Fixogum seal.
3. If necessary incubate the slides in Post‐wash buffer II for 2 min at room temperature
to slide off the cover slips.
4. Incubate the slides in a Coplin jar containing pre‐wormed (72°C) Post‐wash Buffer I
for 2 min.
5. Wash slides in Post‐ wash Buffer II for 1 min at room temperature.
6. Dehydrate the slides for 1 min in each of: 70 %, 85 % and 100 % ethanol.
7. Air‐dry at room temperature.
Counter‐staining: Apply 15 μl of DAPI/an fade and apply a glass cover slip
Visualize by a fluorescent microscope.
Interpretation:Recommendationsforfluorescencemicroscopy:For optimal visualization use a well maintained and regularly calibrated microscope equipped with a 100 W mercury lamp and a 63x or 100x fluorescent objec ve. Triple band‐pass filters (DAPI/FITC/Texas Red or DAPI/FITC/Rhodamine) are used to view multiple colours, single band‐pass filters are used for individual colour visualization. Suitable excitation and emission range for REPEAT‐FREE POSEIDON fluorophores:
Fluorophore Excitation Emission
Pla numBright415 415 ±20 nm 475 ±30 nm
Pla numBright 495 495 ±20 nm 525 ±30 nm
Pla numBright 550 546 ±12 nm 580 ±30 nm
The Chromosome 13/21 specific probe is designed as a dual‐color assay to detect gains of chromosome 21 and 13. Trisomy 21 will be detected by three red signal at the 21q22 region
AL Aqsa university Medical Technology department
20
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
and two green signals for chromosome 13 (3R2G). Trisomy 13 will be detected by 3 green signals at the 13q14 region and two red signals for chromosome 21 (2R3G). Two single color red (R) and green (G) signals will iden fy the normal chromosomes 13 and 21 (2R2G). The Chromosome X/Y/18 specific probe is designed as a triplecolour assay to detect gains or losses of chromosome X, Y and or 18. Turner syndrome will be detected by one green signal only at Xcen. Meta‐Females (or Triple‐X females) will be detected by three or more green signals at Xcen. Klinefelter will be detected by 2 or more green and 1 red signal. XYY males will be detected by one green and two red signals. Two single green (G) signals will identify the normal X chromosome in females, one green and one red signal will identify the normal X and Y chromosomes in male. Trisomy 18 will be detected by three blue signals at 18 cen. Two single blue signals will iden fy the normal chromosome 18.
InterpretationTable:
Normal Signal
Pattern Trisomy 21 Trisomy 13 Trisomy 18
Expected Signals Using 13/21
2R2G 3R2G 2R3G
Expected Signals Using 13/21+18
2R2G2B
3R2G2B 2R3G2B 2R2G3B
Female Male Female Male
Expected Signals Using X/Y + 18
2G2B 1R1G2B 2G3B 1R1G3B
Female Male Turner XO Meta‐female Klinefelter XYY
Expected Signals Using X/Y
2G 1R1G 1G 3‐5G
2G1R 3‐4G1R
1R1G/1R2G in mosaics
1G2R
Expected Signals Using X/Y + 18
2G2B 1R1G2B 1G2B 3‐5G2B
2G1R2B 3‐4G1R2B
1R1G2B/1R2G2B in mosaics
1G2R2B
Trisomy 21: One of the most common chromosomal abnormalities in live born children and causes Down syndrome, a particular combination of phenotypic features that includes mental retardation and characteristic facies. Molecular analysis has revealed that the 21q22.1‐q22.3 region appears to contain the gene(s) responsible for the congenital heart disease observed in Down syndrome.
Trisomy 13: Also called Patau syndrome, is a chromosomal condition that is associated with severe mental retardation and certain physical abnormalities. The critical region has been reported to include 13q14‐13q32 with variable expression, gene interac ons, or interchromosomal effects.
Trisomy 18: Causing Edwards syndrome is the second most common autosomal trisomy after trisomy 21. The disorder/condi on is characterized by severe psychomotor and growth retardation, microcephaly, microphthalmia, malformed ears, micrognathia or
AL Aqsa university Medical Technology department
21
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
retrognathia, microstomia, distinctively clenched fingers, and other congenital malformations. Chromosomal abnormalities involving the X and Y chromosome (sex chromosomes) are slightly less common than autosomal abnormalities and are usually much less severe in their effects. The high frequency of people with sex chromosome aberrations is partly due to the fact that they are rarely lethal conditions.
Turner syndrome: Occurs when females inherit only one X chromosome; their genotype is X0.
Metafemales or triple‐X females: Inherit three X chromosomes; their genotype is XXX or more rarely XXXX or XXXXX.
Klinefelter syndrome: Males inherit one or more extra X chromosomes; their genotype is XXY or more rarely XXXY, XXXXY, or XY/XXY mosaic.
XYY syndrome: Males inherit an extra Y chromosome; their genotype is XYY.
Buffersandpreparations:1. Fixative:
Component Amount Final conc.
Methanol (Absolute) 30 ml
Glacial acetic acid 10 ml
Total 40 ml
2. SSC (sodium chloride/sodium citrate), 20×
Component Amount Final conc.
NaCl 175 g 3 M
trisodium citrate dihydrate Na3C6H5O7⋅2H2O
88 g 0.3 M
H2O To 800 ml
Adjust pH to 7.0 with 1 M HCl
Add H2O to 1 liter
3. Pretreatment buffer: (2 x SSC / 0.5% igepal, pH 7.0)
Component Amount Final conc.
20 X SSC buffer pH 7.0 5 ml 2 X
Igepal or Triton‐X‐100 250 μl 0.5 %
Distilled Water 45 ml
Total 50 l
4. Probe preparation: (in case not ready to use)
Probe mix Hybridization Buffer Probe Total
13/21 ready to use
X/Y + 18 8 μl 2 μl 10 μl
ON, PN, and MD REPEAT‐FREE POSEIDON probes are supplied Ready to Use (RtU). SE, ST, and WC REPEAT‐FREE POSEIDON probes are provided at 5 x concentrated and must be diluted
AL Aqsa university Medical Technology department
22
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
To combine several 5 x conc. probes, replace FISH Hybridiza on Buffer (FHB or WHB) with 2 μl for each added probe.
51 Post‐Wash buffer I: (0.4 x SSC / 0.3% igepal)
Component Amount Final conc.
20 X SSC buffer pH 7.0 1 ml 0.4 X
Igepal or Triton‐X‐100 150 μl 0.3 %
Distilled Water 49 ml
Total 50 ml
52 Post‐Wash buffer II: (2 x SSC / 0.1% igepal)
Component Amount Final conc.
20 X SSC buffer pH 7.0 5 ml 2 X
Igepal or Triton‐X‐100 50 μl 0.1 %
Distilled Water 45 ml
Total 50 ml
AL Aqsa university Medical Technology department
23
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
4.GenomicDNAExtraction
Leukocytes genomic DNA will be extracted from pereferal blood using the (Wizard® Genomic
DNA Purifi cation Kit) according to the manufacturer instructions attached to the end of this
manual.
AL Aqsa university Medical Technology department
24
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
5.DetectionofCommonFamilialMediterraneanFever(FMF)MutationsByPCR/RFLP
Familial Mediterranean fever (FMF) is a genetic disease of the inflammatory pathway. FMF is
the most frequent of the hereditary fevers and mainly affects populations of the
Mediterranean basin, such as Arabs, Armenians, Sephardic Jews and Turks. The disease
typically presents as recurrent episodes of fever accompanied by topical signs of
inflammation, mainly involving the peritoneal, pleural and articular cavities. In most patients
the first symptoms may appear by the age of 10 and in 90% of the pa ents by the age of 20.
The symptoms and severity vary among affected individuals, sometimes even among
members of the same family. Amyloidosis, which can lead to renal failure, is the most severe
complica on. FMF type 2 is characterized by amyloidosis as the first clinical manifesta on of
FMF in an otherwise asymptomatic individual.
The gene responsible for FMF (designated MEFV) encodes a protein named marenostrin or
pyrin. The spectrum of MEFV mutations responsible for FMF has been regularly widening, and
more than fifteen mutations have now been discovered. There are five frequent mutations:
four regrouped in exon 10 (V726A, M694V, M694I, M680I) and one in exon 2 (E148Q). They
cover more than 85% of the muta ons present in the above‐mentioned populations.
Mutation M680I
2040 G>C
2040 G>A
M694V
2080A>G
M694I
2082 G>A
V726A
2177 T>C
E148Q
442 G>C
These muta ons and par cularly M694V were shown to be related to the severity of the
disease. The relationship with amyloidosis has also been demonstrated. Moreover, it seems
that other genetic modifiers and environmental factors may play a role in the manner of FMF
expression and its complications in the various populations.
The diagnosis of FMF is clinical and is suspected in individuals with recurrent episodes of fever
associated with abdominal pain (peritonitis) and/or pleuritic pain and/or arthritis (ankle/knee)
usually lasting two to three days. A high erythrocyte sedimentation rate, leukocytosis, and a
high serum concentration of fibrinogen are characteristic.
FMF is inherited in an autosomal recessive manner. In general, both parents of a proband are
considered to be obligate carriers. However, in populations with a high carrier rate and/or a
high rate of consanguineous marriages, it is possible that affected children may be born to an
affected individual and a carrier, or even to two affected individuals. Thus, it is appropriate to
consider molecular genetic testing of the parents of the proband to establish their genetic
status. If both parents are heterozygotes, the risk to sibs of being affected is 25%. Prenatal
testing is possible if the MEFV mutations in an affected family member are known.
AL Aqsa university Medical Technology department
25
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Procedures:
The primers used for amplifica on are listed in table 1.
ID Sequence (5' to 3')
FMF7 GAATGGCTACTGGGTGGAGAT
FMF8 GGCTGTCACATTGTAAAAGGAG
FMF9 GCTACTGGGTGGTGATAATCAT
p12.2 TATCATTGTTCTGGGCTC
met1 CTGGTACTCATTTTCCTTC
EQF GCCTGAAGACTCCAGACCACCCCG
EQR CAGAGAGAAGGCCTCGGAGGGCCT
To detect muta ons M694V and V726A, the primers FMF7 and FMF8 are used. The M694V
variant creates a Hph‐I restriction site in the PCR product of the mutant allele but not of the
normal allele. The FMF7 primer was designed (mismatch) to abolish another constitutive Hph‐
I site proximal to the mutation. After Hph‐I restriction the mutant allele yields one 118‐base
pair (bp) and one 36‐bp fragment; the normal allele gives a 154‐bp uncut fragment.
The V726A variant creates an Alu‐I restriction site in the PCR product of the mutant allele. The
Alu‐I restriction site yields a 122‐bp and a 32‐bp fragment for the mutant allele, whereas the
normal allele gives a 154‐bp uncut fragment.
M694V and V726A
Reaction Components:
Reagent Amount Final concentration
2X Master Mix 12.5 µl 1X
FMF7 (5 µM) 1.5 µ1 0.325 µM
FMF8 (5 µM) 1.5 µ1 0.325 µM
H2O 7.5 µl
DNA 2 µl
Total 25 µl
Cycling Conditions:
One Cycle:
95˚C 5 min.
35 Cycles:
95˚C 45 sec.
55˚C 30 sec.
72˚C 1 min.
One cycle: 72˚C 10 min.
AL Aqsa university Medical Technology department
26
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
M694V
Hph‐I Restriction reaction
Reagents Amount Final
Enzyme Hph‐I (5 U/l) 0.5 µl 0.12U/l
Water 7.5 l
NEBuffer 4 (10X) 2.0 µl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37˚C for 1 hour
mutant allele: 118‐bp + 36‐bp
normal allele: 154‐bp
V726A
Alu‐I Restriction reaction
Reagents Amount Final
Enzyme Alu‐I (10 U/l) 0.5 µl 0.25U/l
Water 7.5 l
NEBuffer 4 (10X) 2.0 µl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37˚C for 1 hour
mutant allele: 122‐bp + 32‐bp
normal allele: 154‐bp
To detect the M694I variant, a mismatch is introduced into a primer (FMF9) that anneals
adjacent to the mutation locus and thus creates a BspH‐I site in the normal allele restriction.
Primers FMF9 and FMF8 are used for PCR amplifica on. The BspH‐I restriction site yields a
130‐bp and a 19‐bp fragment for the normal allele whereas the mutant allele gives a 149‐bp
uncut fragment.
M694I
Reaction Components:
Reagent Amount Final concentration
2X Master Mix 7.5 µl 1X
FMF9 (5 µM) 1.0 µ1 0.325 µM
FMF8 (5 µM) 1.0 µ1 0.325 µM
H2O 4.5 µl
DNA 1 µl
Total 15 µl
AL Aqsa university Medical Technology department
27
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Cycling Conditions:
One Cycle:
95˚C 5 min.
35 Cycles:
95˚C 45 sec.
55˚C 30 sec.
72˚C 1 min.
One cycle: 72˚C 10 min.
M694I
BspH‐I Restriction reaction
Reagents Amount Final
Enzyme BspH‐I (10 U/l) 0.5 µl 0.25U/l
Water 7.5 l
NEBuffer 4 (10X) 2.0 µl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37˚C for 1 hour
mutant allele: 149‐bp
normal allele: 130‐bp + 19‐bp
The M680I variant abolishes a na ve Hinf‐I restriction site. The mutation is distinguished by
primers p12.2 and met1. The Hinf‐I restriction site yields a 124‐bp and a 60‐bp fragment for
the normal allele whereas the mutant allele gives a 184‐bp uncut fragment.
M680I
Reaction Components:
Reagent Amount Final concentration
2X Master Mix 7.5 µl 1X
p12.2 (5 µM) 1.0 µ1 0.325 µM
met1 (5 µM) 1.0 µ1 0.325 µM
H2O 4.5 µl
DNA 1 µl
Total 15 µl
Cycling Conditions:
One Cycle:
95˚C 5 min.
35 Cycles:
95˚C 1 min.
55˚C 1.5 min.
72˚C 1 min.
One cycle: 72˚C 10 min.
AL Aqsa university Medical Technology department
28
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
M680I
Hinf‐I Restriction reaction
Reagents Amount Final
Enzyme Hinf‐I (10 U/l) 0.5 µl 0.25U/l
Water 7.5 l
NEBuffer 4 (10X) 2.0 µl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37˚C for 1 hour
mutant allele: 184‐bp
normal allele: 124‐bp + 60‐bp
The E148Q muta on is detected by amplifica on of the region using the EQF and EQR primers.
The mutation creates a new MvaI (BstNI) restriction site in the amplified fragment. The
mutant allele will yield 92 bp and 65 bp restric on fragments while the uncut normal allele
will yield a 157 bp fragment.
E148Q
Reaction Components:
Reagent Amount Final
concentration
2X Master Mix 7.5 µl 1X
EQF (5 µM) 1.0 µ1 0.325 µM
EQR (5 µM) 1.0 µ1 0.325 µM
H2O 4.5 µl
DNA 1 µl
Total 15 µl
Cycling Conditions:
One Cycle:
95˚C 5 min.
35 Cycles:
95˚C 30 sec.
60˚C 30 sec.
72˚C 30 sec.
One cycle: 72˚C 10 min.
AL Aqsa university Medical Technology department
29
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
E148Q
MvaI (BstNI) Restriction reaction
Reagents Amount Final
Enzyme MvaI (BstNI) (10 U/l) 0.5 µl 0.25U/l
Water 7.5 l
Buffer R (10X) 2.0 µl 1X
PCR product 10 l
TOTAL 20 l
Incubate at 37˚C for 1 hour
mutant allele: 92‐bp + 65‐bp
normal allele: 157‐bp
The products are preferentially separated on 8% nondenatura ng polyacrylamide gel, or 3%
Agarose gels stained by ethidium bromide, and visualized under an ultraviolet lamp
References;
1. Brik R., Shinawi M., Kepten I., Berant M., And Gershoni‐Baruch R. Familial Mediterranean Fever: Clinical And Genetic Characterization In A Mixed Pediatric Population Of Jewish And Arab Patients. (1999) Pediatrics, 103(5).
2. Iffet Sahin, F., Yilmaz, Z., Erkan Yurtcu, E., And Esra Baskin, E. Comparison Of The Results Of PCR‐RFLP And Reverse Hybridization Methods Used In Molecular Diagnosis Of FMF.(2008) Genetic Testing, 12(1).
AL Aqsa university Medical Technology department
30
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
6. AgaroseGelElectrophoresis:
Agarose gel electrophoresis is a simple and highly effective method for separating,
iden fying, and purifying 0.5‐ to 25‐kb DNA fragments.
The protocol can be divided into three stages: (1) a gel is prepared with an agarose
concentra on appropriate for the size of DNA fragments to be separated; (2) the DNA
samples are loaded into the sample wells and the gel is run at a voltage and for a time
period that will achieve op mal separa on; and (3) the gel is stained or, if ethidium bromide
has been incorporated into the gel and electrophoresis buffer, visualized directly upon
illumination with UV light.
RESOLUTIONOFDNAFRAGMENTSONSTANDARDAGAROSEGELSMaterials
Electrophoresis buffer (TAE or TBE) TAE (Tris/acetate/EDTA) electrophoresis buffer
50× stock solu on:
242 g Tris base
57.1 ml glacial ace c acid
37.2 g Na2EDTA⋅2H2O
H2O to 1 liter
TBE (Tris/borate/EDTA) electrophoresis buffer
10× stock solu on, 1 liter:
108 g Tris base (890 mM)
55 g boric acid (890 mM)
40 ml 0.5 M EDTA, pH 8.0 (Dissolve 186.1 g Na2EDTA⋅2H2O in 700 ml H2O, Adjust pH to 8.0 with 10 M NaOH (∼50 ml), Add
H2O to 1 liter)
Ethidium bromide solution (10mg/ml)
Working solu on, 0.5 g/ml:
Dilute stock 5l for 100 ml gels or stain solution
Protect from light.
Electrophoresis‐grade agarose
10× loading buffer 20% Ficoll 400
0.1 M disodium EDTA, pH 8 (APPENDIX 2)
1.0% sodium dodecyl sulfate
0.25% bromphenol blue
0.25% xylene cyanol (op onal; runs ¡«50% as fast as bromphenol blue
and can interfere with visualization of bands of moderate molecular
weight, but can be helpful for monitoring very long runs)
AL Aqsa university Medical Technology department
31
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
DNA molecular weight markers To prepare loading mixutres:
Distilled water ‐ 4 μl
6X Blue Loading Dye ‐ 1 μl
DNA Ladder ‐ 1 μl
Total volume ‐ 6 μl
Mix gently
Load onto the agarose gel
100 bp DNA Ladder visualized by
ethidium bromide staining on a 1.3%
TAE agarose gel. Mass values are for
0.5 µg/lane.
55°C water bath
Horizontal gel electrophoresis apparatus
Gel casting platform
Gel combs
DC power supply
Preparingthegel1. Prepare an adequate volume of electrophoresis buffer (TAE or TBE) to fill the
electrophoresis tank and prepare the gel. To facilitate visualization of DNA fragments during the run, ethidium bromide
solution can be added to the electrophoresis buffer to a final concentration of
0.5 mg/ml.
If buffer is prepared for the electrophoresis tank and the gel separately, be sure
to bring both to an identical concentration of ethidium bromide.
CAUTION: Ethidium bromide is a mutagen and potential carcinogen. Gloves
should be worn and care should be taken when handling ethidium bromide
solutions.
AL Aqsa university Medical Technology department
32
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
2. Add the desired amount of electrophoresis‐grade agarose to a volume of electrophoresis buffer sufficient for construc ng the gel (see Table 1). Melt the agarose in a microwave oven or autoclave and swirl to ensure even mixing. Gels typically contain 0.8 to 1.5% agarose.
Melted agarose should be cooled to 55°C in a water bath before pouring onto
the gel platform. This prevents warping of the gel apparatus.
Gels are typically poured between 0.5 and 1 cm thick. Remember to keep in
mind that the volume of the sample/wells will be determined by both the
thickness of the gel and the size of the gel comb
Table 1. Appropriate Agarose
Concentrations for Separating DNA
Fragmentsof Various Sizes
Agarose (%)
Effective range of
resolution of linear
DNA fragments (kb)
0.5 30 to 1
0.7 12 to 0.8
1.0 10 to 0.5
1.2 7 to 0.4
1.5 3 to 0.2
3. Seal the gel casting platform if it is open at the ends. Pour in the melted agarose and insert the gel comb, making sure that no bubbles are trapped underneath the combs and all bubbles on the surface of the agarose are removed before the gel sets.
Most gel platforms are sealed by taping the open ends with adhesive tape. As
an added measure to prevent leakage, hot agarose can be applied with a
Pasteur pipet to the joints
and edges of the gel platform and allowed to harden.
AL Aqsa university Medical Technology department
33
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
Loadingandrunningthegel4. After the gel has hardened, remove the tape from the open ends of the gel
platform and withdraw the gel comb, taking care not to tear the sample wells. Most gel pla orms are designed so that 0.5 to 1 mm of agarose remains
between the bottom of the comb and the base of the gel platform. This is
usually sufficient to ensure that the sample wells are completely sealed
and to prevent tearing of the agarose upon removal of the comb. Low
percentage gels and gels made from low gelling/melting temperature
agarose should be cooled at 4°C to gain extra rigidity and prevent
tearing.
5. Place the gel casting platform containing the set gel in the electrophoresis tank. Add sufficient electrophoresis buffer to cover the gel to a depth of about 1 mm (or just un l the tops of the wells are submerged). Make sure no air pockets are trapped within the wells.
6. DNA samples should be prepared in a volume that will not overflow the gel wells by addi on of the appropriate amount of 6× loading buffer. Samples are typically loaded into the wells with a micropipet. Care should be taken to prevent mixing of the samples between wells.
Be sure to include appropriate DNA molecular weight markers.
7. Be sure that the leads are attached so that the DNA will migrate into the gel toward the anode or positive lead. Set the voltage to the desired level, typically 1 to 10 V/cm of gel, to begin electrophoresis. The progress of the separation can be monitored by the migration of the dyes in the loading buffer.
CAUTION: To prevent electrical shocks, the gel apparatus should always
be covered and kept away from heavily used work spaces.
AL Aqsa university Medical Technology department
34
Medical Genetics 2014‐2015 Dr. Basim M. Ayesh
8. Turn off the power supply when the bromphenol blue dye from the loading buffer has migrated a distance judged sufficient for separation of the DNA fragments. If ethidium bromide has been incorporated into the gel, the DNA can be visualized by placing on a UV light source and can be photographed directly.
Gels that have been run in the absence of ethidium bromide can be stained by
covering the �gel in a dilute solu on of ethidium bromide (0.5 g/ml in water)
and gently agita ng for 10 to 30 min. If necessary, gels can be destained by
shaking in water for an addi onal 30 min. This serves to remove excess ethidium
bromide which causes background fluorescence and makes visualization of small
quantities of DNA difficult.
PHOTOGRAPHYOFDNAINAGAROSEGELSDNA can be photographed in agarose gels stained with ethidium bromide by
illumination with UV light (>2500 μW/cm2). A UV transilluminator is typically used
for this purpose, and commercial models are available designed specifically for DNA
visualization and photography.
CAUTION: UV light is damaging to eyes and exposed skin. Protective eyewear
should be worn at all times while using a UV light source.
Wizard® Genomic DNA
Purifi cation Kit Instruc ons for use of ProductA1120 , A1123, A1125 AND A1620
T E C H N I C A L M A N U A L
Revised 12/10 TM050
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 1
1. Description ..........................................................................................................1
2. Product Components and Storage Conditions ............................................2
3. Protocols for Genomic DNA Isolation ..........................................................5A. Isolating Genomic DNA from Whole Blood
(300µl or 3ml Sample Volume)...........................................................................5B. Isolating Genomic DNA from Whole Blood
(10ml Sample Volume) ........................................................................................7C. Isolating Genomic DNA from Whole Blood
(96-Well Plate) .......................................................................................................9D. Isolating Genomic DNA from Tissue Culture Cells and
Animal Tissue .....................................................................................................11E. Isolating Genomic DNA from Plant Tissue ...................................................13F. Isolating Genomic DNA from Yeast................................................................14G. Isolating Genomic DNA from Gram Positive and
Gram Negative Bacteria ....................................................................................16
4. Troubleshooting...............................................................................................17
5. References .........................................................................................................18
6. Appendix ...........................................................................................................19A. Composition of Buffers and Solutions ............................................................19B. Related Products.................................................................................................19
1. Description
The Wizard® Genomic DNA Purification Kit is designed for isolation of DNAfrom white blood cells (Sections 3.A, B and C), tissue culture cells and animaltissue (Section 3.D), plant tissue (Section 3.E), yeast (Section 3.F), and Grampositive and Gram negative bacteria (Section 3.G). Table 1 lists the typical yieldfor DNA purified from each of these sources.
The Wizard® Genomic DNA Purification Kit is based on a four-step process (1).The first step in the purification procedure lyses the cells and the nuclei. Forisolation of DNA from white blood cells, this step involves lysis of the redblood cells in the Cell Lysis Solution, followed by lysis of the white blood cellsand their nuclei in the Nuclei Lysis Solution. An RNase digestion step may be
Wizard® Genomic DNAPurification Kit
All technical literature is available on the Internet at: www.promega.com/tbs/ Please visit the web site to verify that you are using the most current version of this
Technical Manual. Please contact Promega Technical Services if you have questions on useof this system. E-mail: techserv@promega.com.
included at this time; it is optional for some applications. The cellular proteinsare then removed by a salt precipitation step, which precipitates the proteinsbut leaves the high molecular weight genomic DNA in solution. Finally, thegenomic DNA is concentrated and desalted by isopropanol precipitation.
DNA purified with this system is suitable for a variety of applications,including amplification, digestion with restriction endonucleases and membranehybridizations (e.g., Southern and dot/slot blots).
2. Product Components and Storage Conditions
Small-Scale Isolation (minipreps)
Product Size Cat.#Wizard® Genomic DNA Purification Kit 100 isolations A1120Each system contains sufficient reagents for 100 isolations of genomic DNA from 300µlof whole blood samples. Includes:
• 100ml Cell Lysis Solution• 50ml Nuclei Lysis Solution• 25ml Protein Precipitation Solution• 50ml DNA Rehydration Solution• 250µl RNase Solution
Product Size Cat.#Wizard® Genomic DNA Purification Kit 500 isolations A1125Each system contains sufficient reagents for 500 isolations of genomic DNA from 300µlof whole blood samples. Includes:
• 500ml Cell Lysis Solution• 250ml Nuclei Lysis Solution• 125ml Protein Precipitation Solution• 100ml DNA Rehydration Solution• 1.25ml RNase Solution
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 2
Large-Scale Isolation (maxiprep)Product Size Cat.#Wizard® Genomic DNA Purification Kit 100 isolations A1620Each system contains sufficient reagents for 100 isolations of genomic DNA from 10mlof whole blood samples. Includes:
• 3L Cell Lysis Solution• 1L Nuclei Lysis Solution• 350ml Protein Precipitation Solution• 150ml DNA Rehydration Solution
Note: Cat.# A1620 does not include RNase Solution.
Items Available SeparatelyProduct Size Cat.#Cell Lysis Solution 1L A7933Nuclei Lysis Solution 1L A7943Protein Precipitation Solution 350ml A7953DNA Rehydration Solution 50ml A7963RNase A (4mg/ml) 1ml A7973
Storage Conditions: Store the Wizard® Genomic DNA Purification Kit at roomtemperature (22–25°C). See product label for expiration date.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 3
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 4
Species and MaterialAmount ofStarting Material
Typical DNAYield
RNaseTreatment
Human Whole Blood(Yield depends on thequantity of white bloodcells present)
96-well plate (Process as little as20µl/well; see Table 2.)
300µl1.0ml10.0ml50µl/well
5–15µg25–50µg250–500µg0.2–0.7µg
OptionalOptionalOptionalOptional
Mouse Whole BloodEDTA (4%) treatedHeparin (4%) treated96-well plate
300µl300µl50µl/well
6µg6–7µg0.2–0.7µg
OptionalOptionalOptional
Cell LinesK562 (human)COS (African green
monkey)NIH3T3 (mouse)PC12 (rat pheo-
chromocytoma)CHO (hamster)
3 × 106 cells
1.5 × 106 cells2.25 × 106 cells
8.25 × 106 cells1–2 × 106 cells
15–30µg
10µg9.5–12.5µg
6µg6–7µg
Required
RequiredRequired
RequiredRequired
Animal TissueMouse LiverMouse Tail
11mg0.5–1.0cm of tail
15–20µg10–30µg
RequiredOptional
InsectsSf9 cells 5 × 106 cells 16µg RequiredPlant TissueTomato Leaf 40mg 7–12µg RequiredGram Negative BacteriaEscherichia coli JM109
overnight culture, ~2 × 109 cells/ml
Enterobacter cloacaeovernight culture,~6 × 109 cells/ml
1ml5ml
1ml5ml
20µg75–100µg
20µg75–100µg
RequiredRequired
RequiredRequired
Gram Positive BacteriaStaphylococcus epidermis
overnight culture, ~3.5 × 108 cells/ml
1ml 6–13µg Required
YeastSaccharomyces cerevisiae
overnight culture, ~1.9 × 108 cells/ml
1ml 4.5–6.5µg Required
Table 1. DNA Yields from Various Starting Materials.
3. Protocols for Genomic DNA Isolation
We tested the purification of genomic DNA from fresh whole blood collected inEDTA, heparin and citrate anticoagulant tubes and detected no adverse effectsupon subsequent manipulations of the DNA, including PCR (2). Anticoagulantblood samples may be stored at 2–8°C for up to two months, but DNA yieldwill be reduced with increasing length of storage.
The protocol in Section 3.A has been designed and tested for blood samples upto 3ml in volume. The protocol in Section 3.B has been designed and tested forblood samples up to 10ml in volume. The yield of genomic DNA will varydepending on the quantity of white blood cells present. Frozen blood may beused in the following protocols, but yield may be lower than that obtainedusing fresh blood, and additional Cell Lysis Solution may be required.
Caution: When handling blood samples (Sections 3.A, B and C), followrecommended procedures at your institution for biohazardous materials or seereference 3.
3.A. Isolating Genomic DNA from Whole Blood (300µl or 3ml Sample Volume)
Materials to Be Supplied by the User
• sterile 1.5ml microcentrifuge tubes (for 300µl blood samples)• sterile 15ml centrifuge tubes (for 3ml blood samples)• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature• water bath, 65°C (optional, for rapid DNA rehydration)
1. For 300µl Sample Volume: Add 900µl of Cell Lysis Solution to a sterile1.5ml microcentrifuge tube.
For 3ml Sample Volume: Add 9.0ml of Cell Lysis Solution to a sterile 15mlcentrifuge tube.
Important: Blood must be collected in EDTA, heparin or citrateanticoagulant tubes to prevent clotting.
2. Gently rock the tube of blood until thoroughly mixed; then transfer blood tothe tube containing the Cell Lysis Solution. Invert the tube 5–6 times to mix.
3. Incubate the mixture for 10 minutes at room temperature (invert 2–3 timesonce during the incubation) to lyse the red blood cells. Centrifuge at13,000–16,000 × g for 20 seconds at room temperature for 300µl sample.Centrifuge at 2,000 × g for 10 minutes at room temperature for 3ml sample.
4. Remove and discard as much supernatant as possible without disturbingthe visible white pellet. Approximately 10–20µl of residual liquid willremain in the 1.5ml tube (300µl sample). Approximately 50–100µl ofresidual liquid will remain in the 15ml tube (3ml sample).
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 5
!
If blood sample has been frozen, repeat Steps 1–4 until pellet is white. Theremay be some loss of DNA from frozen samples.Note: Some red blood cells or cell debris may be visible along with thewhite blood cells. If the pellet appears to contain only red blood cells, addan additional aliquot of Cell Lysis Solution after removing the supernatantabove the cell pellet, and then repeat Steps 3–4.
5. Vortex the tube vigorously until the white blood cells are resuspended(10–15 seconds).
Completely resuspend the white blood cells to obtain efficient cell lysis.
6. Add Nuclei Lysis Solution (300µl for 300µl sample volume; 3.0ml for 3mlsample volume) to the tube containing the resuspended cells. Pipet thesolution 5–6 times to lyse the white blood cells. The solution should becomevery viscous. If clumps of cells are visible after mixing, incubate thesolution at 37°C until the clumps are disrupted. If the clumps are still visibleafter 1 hour, add additional Nuclei Lysis Solution (100µl for 300µl samplevolume; 1.0ml for 3ml sample volume) and repeat the incubation.
7. Optional: Add RNase Solution (1.5µl for 300µl sample volume; 15µl for 3mlsample volume) to the nuclear lysate, and mix the sample by inverting thetube 2–5 times. Incubate the mixture at 37°C for 15 minutes, and then coolto room temperature.
8. Add Protein Precipitation Solution (100µl for 300µl sample volume; 1.0mlfor 3ml sample volume) to the nuclear lysate, and vortex vigorously for10–20 seconds. Small protein clumps may be visible after vortexing.Note: If additional Nuclei Lysis Solution was added in Step 6, add a total of130µl Protein Precipitation Solution for 300µl sample volume and 1.3mlProtein Precipitation Solution for 3ml sample volume.
9. Centrifuge at 13,000–16,000 × g for 3 minutes at room temperature for 300µlsample volume. Centrifuge at 2,000 × g for 10 minutes at room temperaturefor 3ml sample volume.
A dark brown protein pellet should be visible. If no pellet is observed, referto Section 4.
10. For 300µl sample volume, transfer the supernatant to a clean 1.5mlmicrocentrifuge tube containing 300µl of room-temperature isopropanol.For 3ml sample volume, transfer the supernatant to a 15ml centrifuge tubecontaining 3ml room-temperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave this residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
11. Gently mix the solution by inversion until the white thread-like strands ofDNA form a visible mass.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 6
!
12. Centrifuge at 13,000–16,000 × g for 1 minute at room temperature for 300µlsample. Centrifuge at 2,000 × g for 1 minute at room temperature for 3mlsample. The DNA will be visible as a small white pellet.
13. Decant the supernatant, and add one sample volume of room temperature70% ethanol to the DNA. Gently invert the tube several times to wash theDNA pellet and the sides of the microcentrifuge tube. Centrifuge as in Step 12.
14. Carefully aspirate the ethanol using either a drawn Pasteur pipette or asequencing pipette tip. The DNA pellet is very loose at this point and caremust be used to avoid aspirating the pellet into the pipette. Invert the tubeon clean absorbent paper and air-dry the pellet for 10–15 minutes.
15. Add DNA Rehydration Solution (100µl for 300µl sample volume; 250µl for3ml sample volume) to the tube and rehydrate the DNA by incubating at65°C for 1 hour. Periodically mix the solution by gently tapping the tube.Alternatively, rehydrate the DNA by incubating the solution overnight atroom temperature or at 4°C.
16. Store the DNA at 2–8°C.
3.B. Isolating Genomic DNA from Whole Blood (10ml Sample Volume)
A large-scale kit is available for processing up to 1 liter of whole blood (Cat.#A1620). This kit does not include RNase Solution since the RNase digestionstep is optional. RNase A solution (4mg/ml) is available as a separate item(Cat.# A7973). If it is needed, a total of 5ml of RNase A solution is required toprocess 1 liter of blood.
Materials to Be Supplied by the User• sterile 50ml centrifuge tubes• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature• water bath, 65°C (optional; for rapid DNA rehydration)
1. For 10ml whole blood samples: Add 30ml of Cell Lysis Solution to a sterile50ml centrifuge tube.
Important: Blood must be collected in EDTA, heparin or citrateanticoagulant tubes to prevent clotting.
2. Gently rock the tube of blood until thoroughly mixed; then transfer 10ml ofblood to the tube containing the Cell Lysis Solution. Invert the tube 5–6times to mix.
3. Incubate the mixture for 10 minutes at room temperature (invert 2–3 timesonce during the incubation) to lyse the red blood cells. Centrifuge at 2,000 × g for 10 minutes at room temperature.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 7
!
4. Remove and discard as much supernatant as possible without disturbingthe visible white pellet. Approximately 1.4ml of residual liquid will remain.
If blood sample has been frozen, add an additional 30ml of Cell LysisSolution, invert 5–6 times to mix, and repeat Steps 3–4 until pellet is nearlywhite. There may be some loss of DNA in frozen samples.Note: Some red blood cells or cell debris may be visible along with thewhite blood cells. If the pellet appears to contain only red blood cells, addan additional aliquot of Cell Lysis Solution after removing the supernatantabove the cell pellet, and then repeat Steps 3–4.
5. Vortex the tube vigorously until the white blood cells are resuspended(10–15 seconds).
Completely resuspend the white blood cells to obtain efficient cell lysis.
6. Add 10ml of Nuclei Lysis Solution to the tube containing the resuspendedcells. Pipet the solution 5–6 times to lyse the white blood cells. The solutionshould become very viscous. If clumps of cells are visible after mixing,incubate the solution at 37°C until the clumps are disrupted. If the clumpsare still visible after 1 hour, add 3ml of additional Nuclei Lysis Solution andrepeat the incubation.
7. Optional: Add RNase A, to a final concentration of 20µg/ml, to the nuclearlysate and mix the sample by inverting the tube 2–5 times. Incubate themixture at 37°C for 15 minutes, and then cool to room temperature.
8. Add 3.3ml of Protein Precipitation Solution to the nuclear lysate, and vortexvigorously for 10–20 seconds. Small protein clumps may be visible aftervortexing.Note: If additional Nuclei Lysis Solution was added in Step 6, add 4ml ofProtein Precipitation Solution (instead of 3.3ml).
9. Centrifuge at 2,000 × g for 10 minutes at room temperature.
A dark brown protein pellet should be visible. If no pellet is observed, referto Section 4.
10. Transfer the supernatant to a 50ml centrifuge tube containing 10ml of roomtemperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave the residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
11. Gently mix the solution by inversion until the white thread-like strands ofDNA form a visible mass.
12. Centrifuge at 2,000 × g for 1 minute at room temperature. The DNA will bevisible as a small white pellet.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 8
!
13. Decant the supernatant and add 10ml of room temperature 70% ethanol tothe DNA. Gently invert the tube several times to wash the DNA pellet andthe sides of the centrifuge tube. Centrifuge as in Step 12.
14. Carefully aspirate the ethanol. The DNA pellet is very loose at this pointand care must be used to avoid aspirating the pellet into the pipette. Air-dry the pellet for 10–15 minutes.
15. Add 800µl of DNA Rehydration Solution to the tube, and rehydrate theDNA by incubating at 65°C for 1 hour. Periodically mix the solution bygently tapping the tube. Alternatively, rehydrate the DNA by incubatingthe solution overnight at room temperature or at 4°C.
16. Store the DNA at 2–8°C.
3.C. Isolating Genomic DNA from Whole Blood (96-well plate)
This protocol can be scaled to 20µl, 30µl or 40µl of blood. Table 2 outlines thevarious solution volumes used in each step. Fifty-microliter preps generallyyield genomic DNA in the range of 0.2–0.7µg, depending upon the number ofleukocytes in the blood sample.
Materials to Be Supplied by the User• V-bottom 96-well plate(s) able to hold 300µl volume/well (Costar® Cat.# 3896)• isopropanol, room temperature• 70% ethanol, room temperature• 96-well plate sealers (Costar® Cat.# 3095) (optional; for use with human
blood)
1. Add 150µl Cell Lysis Solution to each well.
Important: Blood must be collected in EDTA, heparin or citrateanticoagulant tubes.
2. Add 50µl of fresh blood to each well and pipet 2–3 times to mix.
3. Leave the plate at room temperature for 10 minutes, pipetting the solutiontwice during the incubation to help lyse the red blood cells.
4. Centrifuge at 800 × g for 5 minutes in a tabletop centrifuge to concentratethe cells.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 9
Sample
Cell LysisSolution(RBC Lysis)
Nuclei LysisSolution
ProteinPrecipitationSolution Isopropanol
DNARehydrationSolution
20µl 60µl 20µl 6.7µl 20µl 10µl30µl 90µl 30µl 10µl 30µl 15µl40µl 120µl 40µl 13.3µl 40µl 20µl50µl 150µl 50µl 16.5µl 50µl 25µl
Table 2. Volumes of Reagents Required for Various Starting Amounts of Blood.
!
5. Carefully remove and discard as much of the supernatant as possible with amicropipette tip, leaving a small pellet of white cells and some red bloodcells. The use of an extended pipette tip, such as a gel loading tip, isrecommended. Tilting the 96-well plate 50–80° (depending on the amountof liquid present per well) allows more thorough removal of liquid from thewell.
6. Add 50µl of Nuclei Lysis Solution to each well and pipet 5–6 times toresuspend the pellet and lyse the white blood cells. The solution shouldbecome more viscous. As an aid in DNA pellet visualization, 2µl per well ofa carrier (e.g., Polyacryl Carrier [Molecular Research Center, Inc., Cat.#PC152]) can be added at this step. DNA yields are generally equivalent withor without carrier use.
7. Add 16.5µl of Protein Precipitation Solution per well and pipet 5–6 times to mix.
8. Centrifuge at 1,400 × g for 10 minutes at room temperature. A brownprotein pellet should be visible. If no pellet is visible, refer to Section 4.
9. DNA Precipitation/Rehydration in 96-Well Plate
a. Carefully transfer the supernatants to clean wells containing 50µl per wellof room temperature isopropanol and mix by pipetting.
Note: Some of supernatant may remain in the original well containing theprotein pellet. Leave this residual liquid in the well to avoid contaminatingthe DNA solution with the precipitated protein. As in Step 5, tilting theplate will facilitate removal of liquid from the well. Using an extendedpipette tip in this step does not allow easy sample mixing with isopropanol.
b. Centrifuge at 1,400 × g for 10 minutes. Carefully remove the isopropanol with a micropipette tip.
c. Add 100µl of room temperature 70% ethanol per well.
d. Centrifuge at 1,400 × g for 10 minutes at room temperature.
e. Carefully aspirate the ethanol using either a drawn Pasteur pipette or a sequencing pipette tip. Care must be taken to avoid aspirating the DNA pellet. Place the tray at a 30–45° angle and air-dry for 10–15 minutes.
f. Add 25µl of DNA Rehydration Solution to each well. Allow the DNA torehydrate overnight at room temperature or at 4°C.
g. Store the DNA at 2–8°C.Note: Small volumes of DNA can be easily collected at the bottom of a V-well by briefly centrifuging the 96-well plate before use.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 10
3.D. Isolating Genomic DNA from Tissue Culture Cells and Animal Tissue
Materials to Be Supplied by the User• 1.5ml microcentrifuge tubes• 15ml centrifuge tubes• small homogenizer (Fisher Tissue Tearor, Cat.# 15-338-55, or equivalent)
(for animal tissue)• trypsin (for adherent tissue culture cells only)• PBS• liquid nitrogen (for mouse tail) (optional; for freeze-thaw, Step 1.d, and for
tissue grinding, Step 2.b, in place of small homogenizer)• mortar and pestle (optional; for tissue grinding, Step 2.b, in place of small
homogenizer)• 95°C water bath (optional; for freeze-thaw, Step 1.d)• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature• water bath, 65°C (optional; for rapid DNA rehydration)• 0.5M EDTA (pH 8.0) (for mouse tail)• Proteinase K (20mg/ml in water; Cat.# V3021) (for mouse tail)
1. Tissue Culture Cells
a. Harvest the cells, and transfer them to a 1.5ml microcentrifuge tube. Foradherent cells, trypsinize the cells before harvesting.
b. Centrifuge at 13,000–16,000 × g for 10 seconds to pellet the cells.
c. Remove the supernatant, leaving behind the cell pellet plus 10–50µl ofresidual liquid.
d. Add 200µl PBS to wash the cells. Centrifuge as in Step 1.b, and removethe PBS. Vortex vigorously to resuspend cells.
Note: For cells that do not lyse well in Nuclei Lysis Solution alone (e.g.,PC12 cells), perform an additional freeze-thaw step as follows beforeproceeding to Step 1.e: Wash the cells as in Step 1.d; then freeze in liquidnitrogen. Thaw the cells by heating at 95°C. Repeat this procedure for atotal of 4 cycles.
e. Add 600µl of Nuclei Lysis Solution, and pipet to lyse the cells. Pipet untilno visible cell clumps remain.
f. Proceed to Section 3.D, Step 4.
2. Animal Tissue (Mouse Liver and Brain)
a. Add 600µl of Nuclei Lysis Solution to a 15ml centrifuge tube, and chillon ice.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 11
b. Add 10–20mg of fresh or thawed tissue to the chilled Nuclei Lysis Solutionand homogenize for 10 seconds using a small homogenizer. Transfer thelysate to a 1.5ml microcentrifuge tube. Alternatively, grind tissue in liquidnitrogen using a mortar and pestle that has been prechilled in liquidnitrogen. After grinding, allow the liquid nitrogen to evaporate and transferapproximately 10–20mg of the ground tissue to 600µl of Nuclei LysisSolution in a 1.5ml microcentrifuge tube.
c. Incubate the lysate at 65°C for 15–30 minutes.
d. Proceed to Section 3.D, Step 4.
3. Animal Tissue (Mouse Tail)
a. For each sample to be processed, add 120µl of a 0.5M EDTA solution (pH8.0) to 500µl of Nuclei Lysis Solution in a centrifuge tube. Chill on ice.Note: The solution will turn cloudy when chilled.
b. Add 0.5–1cm of fresh or thawed mouse tail to a 1.5ml microcentrifuge tube.Note: The tissue may be ground to a fine powder in liquidnitrogen using a mortar and pestle that has been prechilled in liquidnitrogen. Then transfer the powder to a 1.5ml microcentrifuge tube.
c. Add 600µl of EDTA/Nuclei Lysis Solution from Step 3.a to the tube.
d. Add 17.5µl of 20mg/ml Proteinase K.
e. Incubate overnight at 55°C with gentle shaking. Alternatively, perform a3-hour 55°C incubation (with shaking); vortex the sample once per hour ifperforming a 3-hour incubation. Make sure the tail is completelydigested.
4. Optional for mouse tail: Add 3µl of RNase Solution to the nuclear lysateand mix the sample by inverting the tube 2–5 times. Incubate the mixturefor 15–30 minutes at 37°C. Allow the sample to cool to room temperaturefor 5 minutes before proceeding.
5. To the room temperature sample, add 200µl of Protein Precipitation Solution and vortex vigorously at high speed for 20 seconds. Chill sampleon ice for 5 minutes.
6. Centrifuge for 4 minutes at 13,000–16,000 × g. The precipitated protein willform a tight white pellet.
7. Carefully remove the supernatant containing the DNA (leaving the proteinpellet behind) and transfer it to a clean 1.5ml microcentrifuge tubecontaining 600µl of room temperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave this residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 12
8. Gently mix the solution by inversion until the white thread-like strands ofDNA form a visible mass.
9. Centrifuge for 1 minute at 13,000–16,000 × g at room temperature. TheDNA will be visible as a small white pellet. Carefully decant thesupernatant.
10. Add 600µl of room temperature 70% ethanol, and gently invert the tubeseveral times to wash the DNA. Centrifuge for 1 minute at 13,000–16,000 × gat room temperature.
11. Carefully aspirate the ethanol using either a drawn Pasteur pipette or asequencing pipette tip. The DNA pellet is very loose at this point, and caremust be used to avoid aspirating the pellet into the pipette.
12. Invert the tube on clean absorbent paper, and air-dry the pellet for 10–15minutes.
13. Add 100µl of DNA Rehydration Solution, and rehydrate the DNA byincubating at 65°C for 1 hour. Periodically mix the solution by gentlytapping the tube. Alternatively, rehydrate the DNA by incubating thesolution overnight at room temperature or at 4°C.
14. Store the DNA at 2–8°C.
3.E. Isolating Genomic DNA from Plant Tissue
Materials to Be Supplied by the User• 1.5ml microcentrifuge tubes• microcentrifuge tube pestle or mortar and pestle• water bath, 65°C• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature
1. Leaf tissue can be processed by freezing with liquid nitrogen and grindinginto a fine powder using a microcentrifuge tube pestle or a mortar andpestle. Add 40mg of this leaf powder to a 1.5ml microcentrifuge tube.
2. Add 600µl of Nuclei Lysis Solution, and vortex 1–3 seconds to wet thetissue.
3. Incubate at 65°C for 15 minutes.
4. Add 3µl of RNase Solution to the cell lysate, and mix the sample by invertingthe tube 2–5 times. Incubate the mixture at 37°C for 15 minutes. Allow thesample to cool to room temperature for 5 minutes before proceeding.
5. Add 200µl of Protein Precipitation Solution, and vortex vigorously at highspeed for 20 seconds.
6. Centrifuge for 3 minutes at 13,000–16,000 × g. The precipitated proteins willform a tight pellet.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 13
7. Carefully remove the supernatant containing the DNA (leaving the proteinpellet behind) and transfer it to a clean 1.5ml microcentrifuge tubecontaining 600µl of room temperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave this residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
8. Gently mix the solution by inversion until thread-like strands of DNA forma visible mass.
9. Centrifuge at 13,000–16,000 × g for 1 minute at room temperature.
10. Carefully decant the supernatant. Add 600µl of room temperature 70%ethanol and gently invert the tube several times to wash the DNA.Centrifuge at 13,000–16,000 × g for 1 minute at room temperature.
11. Carefully aspirate the ethanol using either a drawn Pasteur pipette or asequencing pipette tip. The DNA pellet is very loose at this point and caremust be used to avoid aspirating the pellet into the pipette.
12. Invert the tube onto clean absorbent paper and air-dry the pellet for 15 minutes.
13. Add 100µl of DNA Rehydration Solution and rehydrate the DNA byincubating at 65°C for 1 hour. Periodically mix the solution by gentlytapping the tube. Alternatively, rehydrate the DNA by incubating thesolution overnight at room temperature or at 4°C.
14. Store the DNA at 2–8°C.
3.F. Isolating Genomic DNA from Yeast
Materials to Be Supplied by the User• 1.5ml microcentrifuge tubes• YPD broth• 50mM EDTA (pH 8.0)• 20mg/ml lyticase (Sigma Cat.# L2524)• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature• water bath, 65°C (optional; for rapid DNA rehydration)
1. Add 1ml of a culture grown for 20 hours in YPD broth to a 1.5ml microcentrifuge tube.
2. Centrifuge at 13,000–16,000 × g for 2 minutes to pellet the cells. Remove thesupernatant.
3. Resuspend the cells thoroughly in 293µl of 50mM EDTA.
4. Add 7.5µl of 20mg/ml lyticase and gently pipet 4 times to mix.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 14
5. Incubate the sample at 37°C for 30–60 minutes to digest the cell wall. Coolto room temperature.
6. Centrifuge the sample at 13,000–16,000 × g for 2 minutes and then removethe supernatant.
7. Add 300µl of Nuclei Lysis Solution to the cell pellet and gently pipet tomix.
8. Add 100µl of Protein Precipitation Solution and vortex vigorously at highspeed for 20 seconds.
9. Let the sample sit on ice for 5 minutes.
10. Centrifuge at 13,000–16,000 × g for 3 minutes.
11. Transfer the supernatant containing the DNA to a clean 1.5mlmicrocentrifuge tube containing 300µl of room temperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave this residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
12. Gently mix by inversion until the thread-like strands of DNA form a visiblemass.
13. Centrifuge at 13,000–16,000 × g for 2 minutes.
14. Carefully decant the supernatant and drain the tube on clean absorbentpaper. Add 300µl of room temperature 70% ethanol and gently invert thetube several times to wash the DNA pellet.
15. Centrifuge at 13,000–16,000 × g for 2 minutes. Carefully aspirate all of theethanol.
16. Drain the tube on clean absorbent paper and allow the pellet to air-dry for10–15 minutes.
17. Add 50µl of DNA Rehydration Solution.
18. Add 1.5µl of RNase Solution to the purified DNA sample. Vortex thesample for 1 second. Centrifuge briefly in a microcentrifuge for 5 secondsto collect the liquid and incubate at 37°C for 15 minutes.
19. Rehydrate the DNA by incubating at 65°C for 1 hour. Periodically mix thesolution by gently tapping the tube. Alternatively, rehydrate the DNA by incubating the solution overnight at room temperature or at 4°C.
20. Store the DNA at 2–8°C.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 15
3.G. Isolating Genomic DNA from Gram Positive and Gram Negative Bacteria
Materials to Be Supplied by the User• 1.5ml microcentrifuge tubes• water bath, 80°C• water bath, 37°C• isopropanol, room temperature• 70% ethanol, room temperature• water bath, 65°C (optional; for rapid DNA rehydration)• 50mM EDTA (pH 8.0) (for gram positive bacteria)• 10mg/ml lysozyme (Sigma Cat.# L7651) (for gram positive bacteria)• 10mg/ml lysostaphin (Sigma Cat.# L7386) (for gram positive bacteria)
1. Add 1ml of an overnight culture to a 1.5ml microcentrifuge tube.
2. Centrifuge at 13,000–16,000 × g for 2 minutes to pellet the cells. Remove thesupernatant. For Gram Positive Bacteria, proceed to Step 3. For GramNegative Bacteria go directly to Step 6.
3. Resuspend the cells thoroughly in 480µl of 50mM EDTA.
4. Add the appropriate lytic enzyme(s) to the resuspended cell pellet in a totalvolume of 120µl, and gently pipet to mix. The purpose of this pretreatmentis to weaken the cell wall so that efficient cell lysis can take place.Note: For certain Staphylococcus species, a mixture of 60µl of 10mg/mllysozyme and 60µl of 10mg/ml lysostaphin is required for efficient lysis.However, many Gram Positive Bacterial Strains (e.g., Bacillus subtilis,Micrococcus luteus, Nocardia otitidiscaviarum, Rhodococcus rhodochrous, andBrevibacterium albidium) lyse efficiently using lysozyme alone.
5. Incubate the sample at 37°C for 30–60 minutes. Centrifuge for 2 minutes at13,000–16,000 × g and remove the supernatant.
6. Add 600µl of Nuclei Lysis Solution. Gently pipet until the cells areresuspended.
7. Incubate at 80°C for 5 minutes to lyse the cells; then cool to roomtemperature.
8. Add 3µl of RNase Solution to the cell lysate. Invert the tube 2–5 times to mix.
9. Incubate at 37°C for 15–60 minutes. Cool the sample to room temperature.
10. Add 200µl of Protein Precipitation Solution to the RNase-treated cell lysate.Vortex vigorously at high speed for 20 seconds to mix the ProteinPrecipitation Solution with the cell lysate.
11. Incubate the sample on ice for 5 minutes.
12. Centrifuge at 13,000–16,000 × g for 3 minutes.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 16
13. Transfer the supernatant containing the DNA to a clean 1.5mlmicrocentrifuge tube containing 600µl of room temperature isopropanol.Note: Some supernatant may remain in the original tube containing theprotein pellet. Leave this residual liquid in the tube to avoid contaminatingthe DNA solution with the precipitated protein.
14. Gently mix by inversion until the thread-like strands of DNA form a visiblemass.
15. Centrifuge at 13,000–16,000 × g for 2 minutes.
16. Carefully pour off the supernatant and drain the tube on clean absorbentpaper. Add 600µl of room temperature 70% ethanol and gently invert thetube several times to wash the DNA pellet.
17. Centrifuge at 13,000–16,000 × g for 2 minutes. Carefully aspirate theethanol.
18. Drain the tube on clean absorbent paper and allow the pellet to air-dry for10–15 minutes.
19. Add 100µl of DNA Rehydration Solution to the tube and rehydrate theDNA by incubating at 65°C for 1 hour. Periodically mix the solution bygently tapping the tube. Alternatively, rehydrate the DNA by incubatingthe solution overnight at room temperature or at 4°C.
20. Store the DNA at 2–8°C.
4. Troubleshooting
For questions not addressed here, please contact your local Promega Branch Office or Distributor.Contact information available at: www.promega.com. E-mail: techserv@promega.com
Symptoms Comments
Blood clots present in The tube may have been stored improperly;blood samples the blood was not thoroughly mixed, or
inappropriate tubes were used for drawing blood. Discard the clotted blood and drawnew samples using EDTA-, heparin- or citrate-treated anticoagulant tubes.
Poor DNA yield The blood sample may contain too few whiteblood cells. Draw new blood samples.
The white blood cell pellet was not resuspendedthoroughly in Step 5 of Section 3.A or B. Thewhite blood cell pellet must be vortexed vigorously to resuspend the cells.
The blood sample was too old. Best yields areobtained with fresh blood. Samples that havebeen stored at 2–5°C for more than 5 days maygive reduced yields.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 17
4. Troubleshooting (continued)
Symptoms Comments
Poor DNA yield The DNA pellet was lost during isopropanol(continued) precipitation. Use extreme care when removing
the isopropanol to avoid losing the pellet.
Degraded DNA Improper collection or storage of the blood (<50kb in size) sample. Obtain a new sample under the proper
conditions.
Poor DNA yield using Cultures grown for an extended time containGram positive bacteria a high proportion of cells that lyse easily uponprotocol exposure to lysostaphin treatment. Start
purifications with a healthy culture.
No protein pellet The sample was not cooled to room temperaturebefore adding the Protein Precipitation Solution.Cool the sample to room temperature (at least5 minutes) or chill on ice for 5 minutes, vortex20 seconds, centrifuge for 3 minutes at 13,000–16,000 × g (10 minutes at 2,000 × g for 3mlsample volume) and proceed with the protocol.
The Protein Precipitation Solution was notthoroughly mixed with the nuclear lysate.Always mix the nuclear lysate and Protein Precipitation Solution completely.
DNA pellet difficult to dissolve Samples may have been overdried. RehydrateDNA by incubating 1 hour at 65°C, and thenleave the sample at room temperature or 4°Covernight. Caution: Do not leave the DNA at65°C overnight.
Samples were not mixed during the rehydrationstep. Remember to mix the samples periodicallyduring the rehydration step.
5. References
1. Miller, S.A., Dykes, D.D. and Polesky, H.F. (1988) A simple salting out procedure forextracting DNA from human nucleated cells. Nucl. Acids Res. 16, 1215.
2. Beutler, E., Gelbart, T. and Kuhl, W. (1990) Interference of heparin with thepolymerase chain reaction. BioTechniques 9, 166.
3. U.S. Department of Labor, Occupational Safety and Health Administration (1991)Occupational exposure to bloodborne pathogens, final rule. Federal Register 56, 64175.
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 18
6. Appendix
6.A. Composition of Buffers and Solutions
6.B. Related Products
DNA Purification SystemsProduct Size Cat.#ReadyAmp™ Genomic DNA Purification System 100 reactions A7710Wizard® Plus SV Minipreps DNA Purification System 50 preps A1330Wizard® Plus SV Minipreps DNA Purification System + Miniprep Vacuum Adapters 50 preps A1340Wizard® Plus SV Minipreps DNA Purification System 250 preps A1460Wizard® Plus SV Minipreps DNA Purification System + Miniprep Vacuum Adapters 250 preps A1470Miniprep Vacuum Adapters 20 each A1331
DNA Amplification SystemsProduct Size Cat.#PCR Core System I 200 reactions M7660PCR Core System II 200 reactions M7665
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPrinted in USA. Part# TM050Revised 12/10 Page 19
DNA Rehydration Solution(provided)10mM Tris-HCl (pH 7.4)1mM EDTA (pH 8.0)
RNase ADissolve RNase A to 4mg/ml in DNARehydration Solution, boil 10 minutesto remove contaminating DNase andstore in aliquots at –20°C. This solutionis also available from Promega (Cat.#A7973).
Promega Corporation · 2800 Woods Hollow Road · Madison, WI 53711-5399 USA Toll Free in USA 800-356-9526 · Phone 608-274-4330 · Fax 608-277-2516 · www.promega.comPart# TM050 Printed in USA.
Revised 12/10Page 20
© 2010 Promega Corporation. All Rights Reserved.Wizard is a registered trademark of Promega Corporation. ReadyAmp is a trademark of Promega Corporation.Costar is a registered trademark of Corning, Inc.Products may be covered by pending or issued patents or may have certain limitations. Please visit our Web site for moreinformation.All prices and specifications are subject to change without prior notice.Product claims are subject to change. Please contact Promega Technical Services or access the Promega online catalog for themost up-to-date information on Promega products.
Printed in USA. Revised 10/10Part #9FB022
P R O T O C O LQuick
Blood
Transfer supernatantto new tube containingisopropanol.
Centrifuge.
Aspirate ethanol.Air-dry pellet.Rehydrate DNA.
Discard supernatant.Add ethanol.
Centrifuge.
Centrifuge.
Discard supernatant.Vortex pellet. Add Nuclei Lysis Solution.Mix. Add ProteinPrecipitation Solution.
Centrifuge.
Add Cell LysisSolution. Incubate.
•••••
•••
••
••••
•
••••
••
28
18
MA
11
_9
A
Isolation of Genomic DNA from Whole Blood
Wizard® Genomic DNA Purification KitINSTRUCTIONS FOR USE OF PRODUCTS A1120, A1123, A1125 AND A1620.
ORDERING / TECHNICAL INFORMATION:www.promega.com • Phone 608-274-4330 or 800-356-9526 • Fax 608-277-2601
©1999–2010 Promega Corporation. All Rights Reserved.
Lysis Protein DNASample Solution Precipitation RehydrationSize Cell Nuclei Solution Isopropanol Solution300µl 900µl 300µl 100µl 300µl 100µl
1ml 3ml 1ml 330µl 1ml 150µl3ml 9ml 3ml 1ml 3ml 250µl
10ml 30ml 10ml 3.3ml 10ml 800µlAs little as 20µl can be processed with this system. Please see Technical Manual #TM050, Section 3.C.
Red Blood Cell Lysis1. Using volumes from the table above, combine the appropriate volumes of
Cell Lysis Solution and blood. Mix by inversion.2. Incubate for 10 minutes at room temperature.3. Centrifuge:≤300µl sample 13,000–16,000 × g* ; 20 seconds1–10ml sample 2,000 × g ; 10 minutes
4. Discard supernatant. Vortex pellet.
Nuclei Lysis and Protein Precipitation5. Using volumes from the table above, add Nuclei Lysis Solution and mix by
inversion.6. Add Protein Precipitation Solution; vortex for 20 seconds.7. Centrifuge:≤300µl sample 13,000–16,000 × g*; 3 minutes1–10ml sample 2,000 × g; 10 minutes
DNA Precipitation and Rehydration8. Transfer supernatant to a new tube contaning isopropanol (using volumes
from table above). Mix.9. Centrifuge:≤300µl sample 13,000–16,000 × g*; 1 minute1–10ml sample 2,000 × g; 1 minute
10. Discard supernatant. Add 70% ethanol (same volume as isopropanol).11. Centrifuge as in Step 9.12. Aspirate the ethanol and air-dry the pellet (10–15 minutes).13. Rehydrate the DNA in the appropriate volume of DNA Rehydration Solution for
1 hour at 65°C or overnight at 4°C.*Maximum speed on a microcentrifuge.
Additional protocol information is available in Technical Manual #TM050,available online at: www.promega.com
Printed in USA. Revised 10/10Part #9FB022
Isolation of Genomic DNA from Animal Tissue and Tissue Culture Cells
Wizard® Genomic DNA Purification KitINSTRUCTIONS FOR USE OF PRODUCTS A1120, A1123, A1125 AND A1620. P R O T O C O LQuick
Cells or tissuewith Nuclei
Lysis Solution.
Transfersupernatantto new tubecontaining isopropanol.
Centrifuge.
Aspirate ethanol.Air-dry pellet.Rehydrate DNA.
Discardsupernatant.Add ethanol.
Centrifuge.
Centrifuge.
Add ProteinPrecipitationSolution.
Add RNaseSolution.Incubate at 37°C.
28
23
MA
11
_9
A
•••••
•••
••
••••
•
••••
••
Prepare TissuesTissue Culture Cells: Centrifuge at 13,000–16,000 × g* for 10 seconds.Wash the cell pellet with PBS, vortex and then add 600µl of Nuclei LysisSolution and mix by pipetting.Animal Tissue: Add 10–20mg of fresh or thawed tissue to 600µl of chilledNuclei Lysis Solution and homogenize for 10 seconds. Alternatively, use10–20mg of ground tissue. Incubate at 65°C for 15–30 minutes.Mouse Tail: Add 600µl of chilled EDTA/Nuclei Lysis Solution to 0.5–1cm offresh or thawed mouse tail. Add 17.5µl of 20mg/ml Proteinase K and incubateovernight at 55°C with gentle shaking.
Lysis and Protein Precipitation1. Add 3µl of RNase Solution to the cell or animal tissue nuclei lysate and mix.
Incubate for 15–30 minutes at 37°C. Cool to room temperature.2. Add 200µl of Protein Precipitation Solution. Vortex and chill on ice for
5 minutes.3. Centrifuge at 13,000–16,000 × g* for 4 minutes.
DNA Precipitation and Rehydration4. Transfer supernatant to a fresh tube containing 600µl of room temperature
isopropanol.5. Mix gently by inversion.6. Centrifuge at 13,000–16,000 × g* for 1 minute.7. Remove supernatant and add 600µl of room temperature 70% ethanol. Mix.8. Centrifuge as in Step 6.9. Aspirate the ethanol and air-dry the pellet for 15 minutes.
10. Rehydrate the DNA in 100µl of DNA Rehydration Solution for 1 hour at 65°Cor overnight at 4°C.
*Maximum speed on a microcentrifuge.
Additional protocol information is available in Technical Manual #TM050,available online at: www.promega.com
ORDERING / TECHNICAL INFORMATION:www.promega.com • Phone 608-274-4330 or 800-356-9526 • Fax 608-277-2601
©1999–2010 Promega Corporation. All Rights Reserved.
Printed in USA. Revised 10/10Part #9FB022
Isolation of Genomic DNA from Gram Positive and Gram Negative Bacteria
Wizard® Genomic DNA Purification KitINSTRUCTIONS FOR USE OF PRODUCTS A1120, A1123, A1125 AND A1620. P R O T O C O LQuick
•••••
•••
••
••••
•
••••
••ORDERING / TECHNICAL INFORMATION:www.promega.com • Phone 608-274-4330 or 800-356-9526 • Fax 608-277-2601
Transfer supernatant tonew tube containingisopropanol.
Centrifuge.
Aspirate ethanol.Air-dry pellet.Rehydrate DNA.
Discard supernatant.Add ethanol.
Centrifuge.
Centrifuge.
Add ProteinPrecipitationSolution.
Add Nuclei LysisSolution. Incubate at 80°C for 5 minutes,then add RNase solution and incubate.
Suspend in EDTA.Add lytic enzymes.
Gram –Pellet cells.
Gram +Pellet cells.
©1999–2010 Promega Corporation. All Rights Reserved.
Pellet CellsCentrifuge 1ml of overnight culture for 2 minutes at 13,000–16,000 × g*.Discard the supernatant.
A. For Gram Positive Bacteria1. Suspend cells in 480µl 50mM EDTA.2 Add lytic enzyme(s) (120µl) [lysozyme and/or lysostaphin].3 Incubate at 37°C for 30–60 minutes.4. Centrifuge for 2 minutes at 13,000–16,000 × g* and remove supernatant.5. Go to Step 1, Lyse Cells (below).
B. For Gram Negative BacteriaGo to Step 1, Lyse Cells (below).
Lyse Cells1. Add 600µl Nuclei Lysis Solution. Pipet gently to mix.2. Incubate for 5 minutes at 80°C, then cool to room temperature.3. Add 3µl of RNase Solution. Mix, incubate at 37°C for 15–60 minutes, then
cool to room temperature.
Protein Precipitation4. Add 200µl of Protein Precipitation Solution. Vortex.5. Incubate on ice for 5 minutes.6. Centrifuge at 13,000–16,000 × g* for 3 minutes.
DNA Precipitation and Rehydration7. Transfer the supernatant to a clean tube containing 600µl of room temperature
isopropanol. Mix.8. Centrifuge as in “Pellet Cells” above, and decant the supernatant.9. Add 600µl of room temperature 70% ethanol. Mix.
10. Centrifuge for 2 minutes at 13,000–16,000 × g*. 11. Aspirate the ethanol and air-dry the pellet for 10–15 minutes.12. Rehydrate the DNA pellet in 100µl of Rehydration Solution for 1 hour at 65°C
or overnight at 4°C.
*Maximum speed on a microcentrifuge.
Additional protocol information is available in Technical Manual #TM050,available online at: www.promega.com
28
25
MA
11
_9
A
Isolation of Genomic DNA from Yeast Cultures or Plant Tissue
Wizard® Genomic DNA Purification KitINSTRUCTIONS FOR USE OF PRODUCTS A1120, A1123, A1125 AND A1620. P R O T O C O LQuick
Transfersupernatantto new tubecontainingisopropanol.
Centrifuge.
Aspirate ethanol.Air-dry pellet.Rehydrate DNA.For yeast, addRNase and incubateat 37°C.
Discardsupernatant.Add ethanol.
Centrifuge.
Centrifuge.
Add Protein PrecipitationSolution.
PlantGrind 40mg of leaf tissue
Suspend in EDTA.Add lyticase.
Incubate at 37°C.
Centrifuge.Remove supernatant.
Add NucleiLysis Solution.
YeastPellet cells.
Add Nuclei LysisSolution. Incubate at
65°C. Add RNase.Incubate at 37°C.
28
26
MA
11
_9
A
Printed in USA. Revised 10/10Part #9FB022
•••••
•••
••
••••
•
••••
••ORDERING / TECHNICAL INFORMATION:www.promega.com • Phone 608-274-4330 or 800-356-9526 • Fax 608-277-2601
©1999–2010 Promega Corporation. All Rights Reserved.
Prepare Yeast Lysate1. Pellet cells from 1ml of culture by centrifugation at 13,000–16,000 × g* for
2 minutes.2. Suspend the cell pellet in 293µl of 50mM EDTA.3. Add 7.5µl of 20mg/ml lyticase and mix gently.4. Incubate for 30–60 minutes at 37°C. Cool to room temperature.5. Centrifuge as in Step 1. Discard the supernatant.6. Add 300µl of Nuclei Lysis Solution. Proceed to Protein Precipitation
and DNA Rehydration, Step 1 (below).
Prepare Plant Lysate1. Grind approximately 40mg of leaf tissue in liquid nitrogen.2. Add 600µl of Nuclei Lysis Solution. Incubate at 65°C for 15 minutes.3. Add 3µl of RNase Solution. Incubate at 37°C for 15 minutes. Cool sample to
room temperature for 5 minutes. Proceed to Protein Precipitation andDNA Rehydration, Step 1 (below).
Protein Precipitation and DNA RehydrationYeast Plant
1. Add Protein Precipitation Solution. Vortex. 100µl 200µlFor yeast only: Incubate 5 minutes on ice.
2. Centrifuge at 13,000–16,000 × g*. 3 minutes 3 minutes3. Transfer supernatant to clean tube
containing room temperature isopropanol. 300µl 600µl4. Mix by inversion and centrifuge at
13,000–16,000 × g*. 2 minutes 1 minute5. Decant supernatant and add room
temperature 70% ethanol. 300µl 600µl6. Centrifuge at 13,000–16,000 × g*. 2 minutes 1 minute7. Aspirate the ethanol and air-dry the pellet.8. Add DNA Rehydration Solution. 50µl 100µl9. For yeast only: Add RNase. Incubate
at 37°C for 15 minutes. 1.5µl —10. Rehydrate at 65°C for 1 hour or overnight at 4°C.
*Maximum speed on a microcentrifuge.
Additional protocol information is available in Technical Manual #TM050,available online at: www.promega.com
Recommended