TotalSeq™ Antibody Oligonucleotide Conjugates NK B CD8 T ... · Great advances in next generation...

Preview:

Citation preview

TotalSeq™ Antibody Oligonucleotide ConjugatesReagents for High-Throughput Single Cell Proteogenomics

Great advances in next generation sequencing (NGS) and droplet-based microfluidic technologies have enabled transcriptome level data generation from thousands of single cells, simultaneously, via high-throughput single-cell RNA sequencing (scRNA-seq). Recently, the 10x Genomics Chromium™ System plus Single Cell 3’ Solution have facilitated widespread adoption of scRNA-seq in biomedical research, providing hope that the method can be used to expedite the path to precision medicine. Despite the vital importance of proteins in biology, it has not previously been possible to incorporate proteomics into these high throughput scRNA-seq assays. To this end, BioLegend is proud to announce our TotalSeq™ product line, which enables the generation of both single cell transcriptomic and proteomic data simultaneously, in high throughput, catalyzing the next wave of legendary discovery in biomedical research.

Clustering of 5,000 CITE-seq single-cell expression profiles of PBMCs reveals distinct cell populations based on transcriptome analysis. The top panel shows global gene expression relationships among all cells, and major cell types separated based on gene expression as indicated. The bottom panels show mRNA (blue) and corresponding Antibody-Derived Tag (ADT, green) signal.

Simultaneous Multiomic Data Generation: Increased power of single cell experiments by adding proteomic and transcriptomic data.

Reduced Dropouts: In contrast to mRNA, TotalSeq™- derived tags are not highly prone to dropouts, which are essentially false negative readouts.

Enhanced Cell Type Identification: This can be achieved thanks to lower dropout rate and thus, enhanced sample clustering.

Research Areas

• Personalized or Precision Medicine

• Cancer Research

• Stem Cell Research

• Basic and Applied Immunology

• Biomarker Discovery

• Characterization of New and Rare Cell Types

• Neuroimmunology

• Vaccine Research

Learn more at: biolegend.com/totalseq

High

Low

HighLow

CD3e CD4 CD8a

mRNA

ADT

mRNA

ADT

mRNA

ADT

CD19 CD11b IL7R

mRNA

ADT

mRNA

ADT

mRNA

ADT

B

tSNE1

tSN

E2

CD14mono

CD16mono

NK

NKT

CD8 T

CD4 T

CD8 T

DC

pDC

High

Low

HighLow

TotalSeq™-Enabled Seamless Workflow1. Stain cells with TotalSeq™ reagents

2. Transfer labelled cells containing Antibody-Derived Tags (ADT, antibody-oligo conjugates) into any poly-A compatible single cell RNA sequencing platform

3. Separate ADT-derived cDNA from mRNA-derived cDNA

4. Amplify both cDNA libraries independently

5. Mix libraries at desired proportions and sequence on the samelane

Table 1. Summary of TotalSeq™ formats. Other conjugates may be available in the futureTotalSeq™-A TotalSeq™-B TotalSeq™-C

10x Genomics compatibility

Single Cell Gene Expression Solution (3’, v2 and v3) and any system employing a poly-A capture method

Single Cell Gene Expression Solution (3’, v3) with Feature Barcoding Technology and 10x Genomics Data Analysis Software

Single Cell Immune Profiling Solution (5’) with Feature Barcoding technology and 10x Genomics Data Analysis Software

PCR handle CCTTGGCACCCGAGAATTCCA GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN CGGAGATGTGTATAAGAGACAGNNNNNNNNNN

Capture sequence Poly-A [(A)30*A*A] NNNNNNNNNGCTTTAAGGCCGGTCCTAGC*A*A NNNNNNNNNCCCATATAAGA*A*A

Next-Generation Sequencing compatibility

Compatible with Illumina® instruments Compatible with Illumina® instruments Compatible with Illumina® instruments

The TotalSeq™ product suite for comprehensive analysis of cellular processes

Diagram illustrating CITE-seq workflow using TotalSeq™ antibodies. Step 2 can be performed by Drop-Seq (depicted in the figure), or another compatible method such as the Chromium™ platform from 10x Genomics.

Our first reagent for proteogenomics applications, TotalSeq™-A oligonucleotide-antibody conjugates are designed for use with single-cell sequencing platforms that rely on Poly-dT oligonucleotides as the mRNA capture method (scRNA-seq). The antibodies integrate in the scRNA-seq workflow by mimicking natural mRNA, thanks to the poly-A tail sequence in the conjugated oligonucleotide. The oligonucleotide also contains a barcode that permanently labels a specific clone, and a PCR handle, which makes it compatible with Illumina® sequencing reagents and instruments.

We are also working with compatible partners, and supporting new versions of genomics reagents, such as the Feature Barcoding technology from 10x Genomics. We now offer our TotalSeq™-B reagents, which are compatible with the Chromium™ Single Cell Gene Expression Solution (v3). In addition, characterization of the adaptive immune response is critical for vaccine or cancer research for example. To that end, single-cell analysis of T and B cells has increased, as these key players will largely define the balance between health and disease. To support research in this field, we’ve expanded our offerings with TotalSeq™-C. These antibodies are compatible with the Chromium™ Single Cell Immune Profiling Solution.

N represents either randomly selected A, C, G, or T. The symbol * indicates a phosphorothioated bond, to prevent nuclease degradation.

HashtagsIn addition to our collection of TotalSeq™ conjugates for combined immunophenotyping and transcriptome readout in scRNA-seq platforms, we are also offering antibody-oligonucleotide conjugates that allow for sample multiplexing, robust multiplet detection and super-loading of scRNA-seq instruments. The method is powered by our cell Hashtag reagents, which contain a pool of antibodies recognizing ubiquitously expressed cell surface markers. For human samples, the hashtag reagents recognize CD298 and β2 microglobulin, and they are tagged with the same, unique DNA barcodes. For mouse samples, the surface markers are CD45 and H-2 MHC class I, also tagged with their own unique barcodes. The conjugates are already pre-mixed and ready to use.

tSNE1

tSN

E2

tSNE1

tSN

E2

Hashtag mRNA

Sample A B C D

A

B

C

D

CD4 T

CD8 T

NK

B

CD14mono

CD16mono

DC

pDC

Left panel shows Hashtag dataset resolving 4 different PBMC donors multiplexed in one single cell run. Multiplets (grey) form distinct smaller populations that can be removed from further analysis. Right panel shows transcriptome-based clustering after removing multiplets, revealing distinct immune cell populations interspersed across all four samples. B, B cells; T, T cells; NK, natural killer cells; mono, monocytes; DC, dendritic cells; pDC, plasmacytoid dendritic cells. Cells are colored based on their hashtag classification.

Hashtag reagents can help optimize workflows or complex experimental conditions. They can also help optimize TotalSeq™ antibody use. TotalSeq™ antibody titrations can be done using indirect and direct methods.

1. It is possible to perform flow cytometry experiments to find the optimal antibody amount for that antigen, using the same TotalSeq™ clone conjugated to PE. The flow cytometry antibody amount translates well to the amount of TotalSeq™ antibody to use.

2. Use a secondary reagent, such as a poly-dT oligo conjugated to a fluorophore, such as Alexa Fluor® 647, or a secondary antibody labeled with PE.

3. Performing titrations using sequencing is costly, but using Hashtags can make the process more affordable, as illustrated in the figure below.

Peripheral blood leukocytes from human and mouse were stained with a panel of TotalSeq™ antibodies with serial dilution (six points each). Additionally, each titration point was labeled with a distinct hashtag antibody (for human or mouse). After staining, all samples were pooled together for single-cell partitioning, library construction, and next-generation sequencing. Panel A shows cell clusters based on hashtag detection. Panel B shows signal levels of each human hashtag superimposed on the clusters. Panels C and D show examples of titration results (counts) after sequencing and after normalization (C, clone 3G8 for human CD16 and D, clone HI30 for human CD45). The data show clear sample identification by hashtag antibodies. Antibody derived sequence-counts showed a clear titration curve of TotalSeq™ antibodies, from which optimal staining concentrations can be selected.

TotalSeq™ Antibody Oligonucleotide Conjugates

Our Quality Promise At BioLegend we understand that innovation can’t last without quality. That’s why we make sure all our products meet the highest quality standard possible.

For our TotalSeq™ product line, we guarantee:Accurate Oligo Conjugation and Sequencing

All lots of TotalSeq™ products are conjugated to 1 or 2 oligos per antibody. We also guarantee the products contain no detectable traces of unconjugated antibody. We then sequence our lots to confirm the correct oligo barcode, and only the intended barcode, is attached to the antibody.

Stringent Flow Cytometry Testing

All lots are tested by flow cytometry to make sure they stain the expected cell population and that oligos are attached to the antibodies. This process has been validated by comparison with a traditional two-step flow cytometry staining as shown.

A B

A. Unconjugated antibody.

B. Pooled fractions of conjugated antibodies with one (lower band), or two (upper band) oligonucleotides.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer’s intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer’s sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Alexa Fluor® is a registered trademark of Life Technologies Corporation.

Chromium™ is a trademark of 10x Genomics.

Clone UCHT1 Clone RPA-T4A

Clone UCHT1 Clone RPA-T4B

Clone UCHT1 Clone RPA-T4C

Isoelectric focusing gel

(A) Purified, unconjugated antibody detected with a fluorescent secondary antibody. (B) TotalSeq™ antibody detected with the same fluorescent secondary antibody. (C) TotalSeq™ antibody hybridized to a fluorescent oligo-dT. All three methods give similar staining profiles on the proper cell populations. In this example, T cells are stained consistently for CD3 and CD4.

Service technique Réactifs : 01 34 60 60 24 - tech@ozyme.fr Instrumentation : 01 30 85 92 88 - instrum@ozyme.fr

Nous contacter

Recommended