View
2
Download
0
Category
Preview:
Citation preview
The Poly-Cis Pathway of Carotene Desaturation:
Enzymology, Herbicide Action and Retrograde Signaling
Inaugural Dissertation to obtain the Doctoral Degree
Faculty of Biology
Albert-Ludwigs-Universität
Freiburg im Breisgau
Presented by
Julian Koschmieder
born in Bühl (Baden), Germany
July 2017
Dean of the Faculty of Biology: Prof. Dr. Bettina Warscheid
Promotion chairman: Prof. Dr. Andreas Hiltbrunner
Supervisor of work: Prof. Dr. Peter Beyer
1st Reviewer: Prof. Dr. Peter Beyer
2nd Reviewer: Prof. Dr. Ralf Reski
3rd Reviewer: Prof. Dr. Jens Timmer
Date of defense: 12th of September 2017
This work was carried out from April 2014 to July 2017 under the supervision of
Prof. Dr. Peter Beyer, Institute of Biology II, Cell Biology.
Major parts of this thesis have been published in:
Bruno M*, Koschmieder J*, Wüst F, Schaub P, Fehling-Kaschek M, Timmer J,
Beyer P, Al-Babili S (2016) Enzymatic study on AtCCD4 and AtCCD7 and their
potential to form acyclic regulatory metabolites. J Exp Bot 67: 5993–6005
* equal contribution
Brausemann A, Gemmecker S, Koschmieder J, Ghisla S, Beyer P, Einsle O
(2017) Structure of Rice (O. sativa) Phytoene Desaturase Provides Insights Into
Herbicide Binding and Reaction Mechanisms Involved In Carotene
Desaturation. Structure, in press, DOI: 10.1016/j.str.2017.06.002
Gemmecker S, Schaub P, Koschmieder J, Brausemann A, Drepper F,
Rodriguez-Franco M, Ghisla S, Warscheid B, Einsle O, Beyer P (2015) Phytoene
Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association
and Preliminary 3D-Analysis. PLoS One 10: e0131717
Schaub P, Wüst F, Koschmieder J, Yu Q, Virk P, Tohme J, Beyer P (2017) Non-
Enzymatic β-Carotene Degradation in (Provitamin A-Biofortified) Crop Plants.
J Agr Food Chem, in press
Submitted for publication:
Koschmieder J, Fehling-Kaschek M, Schaub P, Ghisla S, Brausemann A, Timmer
J, Beyer P (2017) Rice (O. sativa) Phytoene desaturase: a Functional
Evaluation of Structural Implications.
Wagner H, Beyer H, Engesser R, Hörner M, Ermes K, Koschmieder J, Beyer P,
Timmer J, Zurbriggen M, Weber W (2017) Synthetic Biology-Inspired Design of
Information Processing Materials Systems.
Table of Contents
I
Table of Contents
1 INTRODUCTION 1
1.1 Chemical structure of carotenoids 1
1.2 Carotenoids: biosynthesis and functions in plants 2
1.2.1 Functions in plants 2
1.2.2 General biosynthesis pathway in plants 3
1.2.3 Biosynthesis and function of carotenoid-derived
phytohormones 6
1.3 Poly-cis pathway of carotene desaturation in plants and
all-trans desaturation pathway in bacteria 8
1.3.1 Carotene desaturases in plants and bacteria 9
1.3.1.1 Plant-type phytoene desaturase PDS and ζ-carotene
desaturase ZDS 9
1.3.1.2 Bacterial phytoene desaturase CrtI 15
1.3.1.3 Bleaching herbicides targeting PDS 17
1.3.2 ζ-Carotene isomerase ZISO 22
1.4 Apocarotenoids as novel signaling compounds in plants 23
1.5 Objectives of this work 26
1.5.1 Biochemical characterization of PDS and ZDS 26
1.5.1.1 Kinetic and structural investigations on PDS and ZDS 26
1.5.1.2 Action mode of bleaching herbicides targeting PDS 27
1.5.2 Elucidation of the function of ζ-carotene isomerase ZISO 27
1.5.3 Identification of apocarotenoids originating from the poly-cis
pathway of carotene desaturation 28
2 MATERIALS 29
2.1 Chemicals and materials 29
2.2 Primers 31
2.3 Plasmids 32
2.4 Consumption materials 33
2.5 Bacterial strains 33
Table of Contents
II
3 METHODS 34
3.1 Nucleic acid methods 34
3.1.1 Isolation of nucleic acids 34
3.1.2 Separation of nucleic acids 34
3.1.3 Sequencing of nucleic acids 34
3.1.4 Polymerase chain reaction 34
3.1.5 Site-directed mutagenesis 34
3.1.6 Gene cloning 35
3.1.6.1 OsPDS-His6 and OsZDS-His6 35
3.1.6.2 (Mistic-)OsZISO-His6 35
3.1.7 Transformation of E. coli with plasmid DNA 36
3.2 Protein methods 36
3.2.1 Protein expression and purification 36
3.2.1.1 Expression and IMAC purification of OsPDS-His6 36
3.2.1.2 Expression and IMAC purification of OsZDS-His6 36
3.2.1.3 Expression and crude preparation of Mistic-OsZISO-His6 37
3.2.1.4 Expression and IMAC purification of LeCRTISO-His6 37
3.2.1.5 Expression and crude preparation for AtCCDs 38
3.2.1.6 Gel permeation chromatography for OsPDS-His6 38
3.2.1.7 Gel permeation chromatography for OsZDS-His6 38
3.2.2 Enzymatic assays 39
3.2.2.1 OsPDS-His6 in vitro 39
3.2.2.2 OsZDS-His6 in vitro 39
3.2.2.3 Mistic-OsZISO-His6 in vitro 39
3.2.2.4 LeCRTISO-His6 in vitro 39
3.2.2.5 AtCCDs in vitro 40
3.2.2.6 OsZISO-His6 in vivo 40
3.2.3 SDS-PAGE 40
3.2.4 Protein precipitation 41
3.2.4.1 Ammonium sulfate precipitation 41
3.2.4.2 Chloroform-methanol precipitation 41
Table of Contents
III
3.2.5 Protein quantification 41
3.2.5.1 Bradford assay 41
3.2.5.2 Nanodrop 42
3.2.6 Membrane association assay 42
3.2.7 Preparation of carotenoid-containing liposomes 42
3.2.8 Photometric quantification of protein-bound FAD 42
3.3 Chromatography 42
3.3.1 High performance liquid chromatography 42
3.3.2 Extraction and purification of carotenoids from
tangerine tomato and carotenoid-containing bacteria 44
3.3.3 Effective liposomal concentrations of carotenes,
decylplastoquinone and norflurazon 45
3.3.4 Liquid chromatography – mass spectrometry
3.3.4.1 Identification of apocarotenoids and carotene
deuteration analysis 45
3.3.4.2 Identification of C35 carotenoids 45
3.3.4.3 Identification of protein-bound nucleotide cofactors 46
3.3.5 Gas chromatography – mass spectrometry and
solid phase micro extraction 46
3.4 Cryo scanning electron microscopy 46
3.5 Homology modeling and in silico docking of OsZDS-His6 47
3.6 Mathematical modeling of PDS reaction time courses
and kinetics 47
3.7 Deduction of non-covalent interactions from changes in
electron density gradients 48
4 RESULTS 49
4.1 Biochemical characterization of phytoene desaturase PDS 49
4.1.1 Association and oligomerization of OsPDS-His6 at
liposomal surfaces 49
4.1.1.1 Monotopic association of OsPDS-His6 with liposomes 49
Table of Contents
IV
4.1.1.2 Homooligomerization of OsPDS-His6 at liposomal
membrane surfaces 50
4.1.2 Regio-specificity of carotene desaturation by OsPDS-His6 51
4.1.2.1 Regio-specificity with 15-cis-penta-nor-phytoene (C35) 53
4.1.2.2 Regio-specificity upon mutation of the substrate
cavity back end 55
4.1.3 Reaction mechanism of carotene desaturation in OsPDS-His6 56
4.1.4 Kinetic mechanism of the bi-substrate reaction in OsPDS-His6 59
4.2 Kinetic characterization of PDS and mathematical modeling 61
4.2.1 Basic characterization of the OsPDS-His6 reaction 61
4.2.2 Mathematical modeling of OsPDS-His6 reaction time courses 64
4.2.3 Substrate concentration-dependent kinetics of OsPDS-His6 76
4.3 Investigations on herbicide resistance in PDS 80
4.3.1 Kinetic analysis of the mode of inhibition by
norflurazon for OsPDS-His6 80
4.3.2 Norflurazon resistance conferred by point mutations 82
4.3.3 Identification of non-covalent norflurazon – OsPDS-His6
interactions 87
4.4 ζ-Carotene desaturase ZDS 89
4.4.1 Basic biochemical characterization of OsZDS-His6 89
4.4.1.1 Establishing native OsZDS-His6 purification and
an in vitro assay 89
4.4.1.2 Identification of nucleotide redox cofactors bound
to OsZDS-His6 91
4.4.1.3 Kinetic mechanism of the OsZDS-His6 bi-substrate reaction 92
4.4.2 Structure and reaction mechanism of OsZDS-His6 93
4.4.2.1 Reaction mechanism of carotene desaturation
by OsZDS-His6 93
4.4.2.2 Homology modeling of OsZDS-His6 and analysis of
the active site 94
4.4.2.3 Homooligomerization of OsZDS-His6 in solution 97
4.4.3 Kinetic characterization of OsZDS-His6 99
Table of Contents
V
4.4.3.1 Basic characterization and optimization of
reaction parameters 99
4.4.3.2 Reaction time course of ζ-carotene conversion
by OsZDS-His6 100
4.4.3.3 Substrate concentration dependency of the
OsZDS-His6 reaction 101
4.5 ζ-Carotene isomerase ZISO 103
4.5.1 Substrate specificity of OsZISO-His6 in E. coli 103
4.5.2 Reconstitution of the poly-cis pathway of
carotene desaturation 105
4.5.3 Isomerization of 9,15,9’-tri-cis-ζ-carotene by ZISO in vitro 106
4.6 Apocarotenoids derived from the poly-cis pathway
of carotene desaturation 108
4.6.1 AtCCD4-mediated cleavage of acyclic
poly-cis carotenes 109
4.6.2 AtCCD7-mediated cleavage of acyclic
poly-cis carotenes 112
4.6.3 Identification of apocarotenoids originating from
acyclic 9-cis-carotenes by AtCCD7 cleavage 115
4.6.4 Secondary cleavage of 9-cis-ζ-apo-10’-carotenal
by AtCCDs 119
5 DISCUSSION 122
5.1 Phytoene desaturase PDS: evaluation of implications
deduced from the OsPDS-His6 structure 122
5.1.1 OsPDS-His6 is a monotopic membrane protein 122
5.1.2 OsPDS-His6 employs an unprecedented “flavin only”
reaction mechanism during carotene desaturation 123
5.1.3 OsPDS-His6 follows an ordered ping pong
bi bi mechanism 123
5.1.4 Substrate and regio-specificity of PDS: role of
the 15-cis-configuration 125
Table of Contents
VI
5.1.5 Kinetic characterization and mathematical
modeling of OsPDS-His6 128
5.1.5.1 Modeling supports substrate channeling in
OsPDS-His6 homotetramers 128
5.1.5.2 Rate-limiting steps in OsPDS-His6 130
5.1.6 Characterization of norflurazon - OsPDS-His6 interactions 132
5.1.6.1 Quinone-competitive inhibition by norflurazon is
mediated by several non-covalent interactions 132
5.1.6.2 Site-directed mutagenesis confers norflurazon
resistance at the expense of catalytic activity 135
5.2 ζ-carotene desaturase ZDS: a comparison to PDS 138
5.2.1 OsZDS-His6 utilizes an ordered ping pong bi bi
mechanism and a “flavin only” mechanism 138
5.2.2 OsZDS-His6 might not employ homooligomerization
and substrate channeling 139
5.3 ζ-Carotene Isomerase ZISO: a bona fide enzyme with
the potential for additional functions 141
5.4 The poly-cis pathway of carotene desaturation
and retrograde signaling 143
5.4.1 AtCCD7 forms linear 9-cis-apocarotenoids as
potential signaling molecule precursors 143
5.4.2 Linear 9-cis-apocarotenoids are not converted into
strigolactone-like metabolites by AtCCD8 145
6 SUMMARY 147
7 REFERENCES 149
8 ACKNOWLEDGEMENTS 157
Abbreviations
VII
Abbreviations
A. thaliana Arabidopsis thaliana
ABA abscisic acid
Acc. no. accession number
APCI atmospheric pressure chemical ionization
BCH β-carotene hydroxylase
bp base pairs
CCD carotenoid cleavage dioxygenase
CCO carotenoid cleavage oxygenase
ceff effective liposomal concentration
CHAPS 3-((3-cholamidopropyl)dimethylammonio)-1-
propanesulfonate
Chl chlorophyll
CMC critical micellar concentration
CrtI bacterial phytoene desaturase
CRTISO carotene isomerase
CYP cytochrome P450 hydroxylase
DFT density functional theory
DMAPP dimethylallyl diphosphate
DNA desoxyribonucleic acid
dNTP desoxyribonucleotide triphosphate
DPQ decylplastoquinone
E. coli Escherichia coli
e.g. for example (exempli gratia)
EDTA ethylenediaminetetraacetic acid
FAD flavin adenine dinucleotide
FMN flavin adenine mononucleotide
GC-MS gas chromatography mass spectrometry
GGPP geranylgeranyl diphosphate
GGPPS geranylgeranyl diphosphate synthase
GPC gel permeation chromatography
Abbreviations
VIII
GST glutathione S-transferase
HPLC high performance liquid chromatography
i.e. that is (id est)
IMAC immobilized metal affinity chromatography
IPP isopentenyl diphosphate
IPTG isopropyl-β-D-thiogalactopyranoside
kDa kilodalton
LC-MS liquid chromatography mass spectrometry
LHC light harvesting complex
M molar
mAU milli arbitrary unit
MEP 2-C-methyl-D-erythritol-4-phosphate pathway
MES 2-(N-morpholino)ethanesulfonic acid
min minutes
n.d. not determined
NAD nicotinamide adenine dinucleotide
NADP nicotinamide adenine dinucleotide phosphate
NCED nine-cis-epoxycarotenoid dioxygenase
NDH NAD(P)H:quinone oxidoreductase
NFZ norflurazon
nm nanometer
NPQ non-photochemical quenching
NXS neoxanthin synthase
O. sativa Oryza sativa
ODE ordinary differential equation
PAGE poly acrylamide gelectrophoresis
PCR polymerase chain reaction
PDS phytoene desaturase
PQ plastoquinone
PSY phytoene synthase
PTOX plastid terminal oxidase
Abbreviations
IX
Q quinone
ROS reactive oxygen species
SDS sodium dodecyl sulfate
SEM scanning electron microscopy
SL strigolactone
TBME tert-butylmethylether
TCEP tris(2-carboxyethyl)phosphine
TEMED N,N,N’,N’-tetramethylethylendiamin
TLC thin layer chromatography
Tris tris(hydroxymethyl)aminomethane
UTR untranslated region
v/v volume per volume
VDE violaxanthin deepoxidase
w/v weight per volume
wt wild type
ZDS ζ-carotene desaturase
ZEP zeaxanthin epoxidase
ZISO ζ-carotene Isomerase
β-LCY lycopene-β-cyclase
ε-LCY lycopene-ε-cyclase
Introduction
1
1 Introduction
1.1 Chemical structure of carotenoids
Carotenoids comprise a group of more than 700 isoprenoids that are mostly
C40 compounds (Britton et al., 2004). They originate from the condensation of
six units of isopentenyl diphosphate (IPP) and two units of its isomer,
dimethylallyl diphosphate (DMAPP). Carotenoids can be either acyclic
hydrocarbons or have cyclic ionone end groups and are subdivided into non-
oxygenated carotenes and oxygenated xanthophylls. All carotenoids possess
a polyene system consisting of 3 to 15 conjugated double bonds and
absorbing light between 285 nm and 500 nm. Depending on the number of
double bonds present, this chromophore confers a yellow to red color. Albeit
trivial names are commonly used, C40 carotenoids are systematically
numbered according to IUPAC (International Union of Pure and Applied
Chemistry) guidelines to unambiguously assign positions, such as of cis or trans
double bonds, cleavage sites or substituents. Numbering for carotenoids starts
from C1 or C1’ at the outermost carbon of the backbone and is proceeded
towards the central C15 or C15’ at the molecule symmetry center (Fig.1-1 A).
Counting is continued from the outermost methyl position C16 or C16’
onwards to methyl groups C20 or C20’.
Fig.1-1 Structure of carotenoids and numbering of carbon atoms.
(A) Structure and numbering of all-trans-ζ-carotene as an acyclic carotene. (B)
Structure and numbering of all-trans-ζ-apo-10-carotenal. (C) Structure and carbon
numbering in cyclic carotenoids and apocarotenoids.
A
B CR
Introduction
2
Apocarotenoids represent oxidative cleavage products of carotenoids. They
are named after their carotenoid precursor, the carbon position adjacent to
the cleaved double bond and the oxygen function they contain (suffixes: -al,
aldehyde; -one, ketone). For instance, ζ-apo-10-carotenal originates from
cleavage of ζ-carotene next to C9-C10 and possesses an aldehyde function
(Fig.1-1 B). The structure and numbering of carbons in cyclic carotenoids is
given in Fig.1-1 C.
1.2 Carotenoids: biosynthesis and functions in plants
1.2.1 Functions in plants
In plants, carotenoids exert essential photosynthetic functions which are
based on their physicochemical properties. Carotenoids, xanthophylls in
particular, are major pigments in light harvesting complexes (LHC). They
expand the absorption spectrum of LHC chlorophylls (Chl) and contribute to
photosynthetic light reactions by transferring excitation energy from the
antenna towards reaction centers via Förster resonance energy transfer (for
review, see Demmig-Adams et al., 1996).
Furthermore, they play a key role in protecting plant cells from photooxidative
damage in two different ways. In contrast to Chl, they easily dissipate
excitation energy thermally after excitation, a process called non-
photochemical quenching (NPQ) (for review, see Jahns and Holzwarth, 2012).
They consequently diminish the formation of 3Chl and subsequently of 1O2
and other reactive oxygen species (ROS) that would otherwise damage cell
components. Furthermore, the xanthophyll cycle – in which zeaxanthin,
antheraxanthin and violaxanthin are rapidly interconverted by ZEP and VDE
(see 1.2.2) – is essential to adaptation of NPQ capacity according to light
supply. The existence of a second xanthophyll cycle consisting of lutein and
lutein-epoxide remains controversial. The photoprotective essentiality of
carotenoids is underscored by the mode of action of bleaching herbicides –
e.g. norflurazon, diflufenican, fluridone or J852. They are carotenoid
Introduction
3
biosynthesis inhibitors whose application causes lethal photooxidative
damage. Moreover, carotenoids are antioxidants and quench ROS by their
own oxidation which frequently leads to their cleavage. Additionally, β-
cyclocitral, a cleavage product of β-carotene, serves as a mediator of
adaptation to light stress by inducing genes involved in ROS scavenging (for
review, see Ramel et al., 2012 and Havaux et al., 2014).
Moreover, carotenoids exert structural functions by stabilizing and organizing
components of plastid membranes and photosynthetic complexes (Havaux,
1998; Gruszecki and Strzalka, 2005). Plastid membrane fluidity is strongly
influenced by xanthophyll cycle carotenoids. Zeaxanthin is presumably
released into the membrane during light stress, converted to violaxanthin with
a higher NPQ capacity and rebound to antenna complexes. Both
xanthophylls lower membrane fluidity and improve thermal membrane
stability in their transiently unbound state (Havaux et al., 1998). Furthermore,
carotenoids are essential for the functional assembly, structural integrity and
stability of light harvesting complexes, photosystem II and of the Cytb6f
complex (Plumley and Schmidt, 1987; Santabarbara et al., 2013). Finally,
carotenoids serve as colorants in tissues such as fruits or flowers and contribute
to the attraction of pollinators and the zoochoric dispersal of seeds (for
review, see Cazzonelli, 2011).
1.2.2 General biosynthesis pathway in plants
In plants, carotenoid biosynthesis takes place in plastids catalyzed by
membrane-associated enzymes (for a review on subplastid localization, see
Joyard et al., 2009). The plant-type biosynthetic pathway (Fig.1-2) is of
cyanobacterial origin and is regulated at multiple levels (for review, see
Cazzonelli und Pogson, 2010). Carotenoid biosynthesis starts from the central
metabolites isopentenyl diphosphate (IPP) and its isomer dimethylallyl
diphosphate (DMAPP). In plants, these precursors are not provided by the
cytosolic mevalonate pathway but by the methylerythritol-4-phosphate
pathway in the plastid stroma (for review, see Rodriguez-Concepción and
Introduction
4
Boronat, 2002). Geranylgeranyl diphosphate synthase (GGPPS) yields the
central C20 metabolite GGPP – a precursor involved in the formation of
several plant metabolites, e.g. chlorophylls, tocopherols or gibberellins.
GGPPS is a prenyltransferase condensing one DMAPP and three IPP in a head
to tail fashion (Dogbo et al., 1988). Subsequently, phytoene synthase (PSY)
catalyzes the first committed step in carotenoid biosynthesis by condensing
two molecules of GGPP to yield 15-cis-phytoene (Dogbo et al., 1988). Due to
the hydrophobicity of phytoene (and all carotenoids), PSY is thought to be
attached to thylakoids when active in order to deposit phytoene into the
hydrophobic membrane core (Schledz et al., 1996; Welsch et al., 2000).
Phytoene formation is followed by the so-called poly-cis pathway of
carotenoid desaturation (Fig.1-2) in which 15-cis-phytoene is desaturated and
isomerized to all-trans-lycopene by two desaturases and two cis-trans
isomerases. The poly-cis configuration of the carotenes involved was
elucidated by nuclear magnetic resonance spectroscopy (Clough and
Pattenden, 1979). The desaturation reactions extend the chromophore from a
triene in phytoene to an undecaene in lycopene resulting in a maximal
absorption at 470 nm and a red color. Phytoene desaturase (PDS)
symmetrically desaturates 15-cis-phytoene twice and yields the intermediate
9,15-di-cis-phytofluene and the end product 9,15,9’-tri-cis-ζ-carotene (Bartley
et al., 1999). ζ-carotene-isomerase (ZISO) isomerizes 9,15,9’-tri-cis-ζ-carotene
to 9,9’-di-cis-ζ-carotene (Li et al., 2007; Chen et al., 2010) which is then
symmetrically desaturated twice by ζ-carotene desaturase (ZDS) to yield the
intermediate 7,9,9’-tri-cis-neurosporene (syn. proneurosporene) and end
product 7,9,7’,9’-tetra-cis-lycopene (syn. prolycopene; Beyer et al., 1989;
Breitenbach and Sandmann, 2005). Finally, carotene isomerase (CRTISO)
symmetrically isomerizes prolycopene twice to all-trans-lycopene via the
intermediate 7,9-di-cis-lycopene (Isaacson et al., 2002; Isaacson et al., 2004;
Yu et al., 2011). The poly-cis pathway of carotene desaturation is one of the
major topics of this work and will be dealt with in greater detail in 1.3.1.
Introduction
5
Fig. 1-2 Biosynthesis of carotenoids and carotenoid-derived phytohormones in plants.
The biosynthetic pathway of carotenoids, including the poly-cis pathway of
carotene desaturation, is shown. Links to strigolactones and abscisic acid
biosynthesis are highlighted. The all-trans pathway of carotene desaturation in
bacteria and fungi, mediated by phytoene desaturase CrtI, is indicated by a red
arrow. GGPP, geranylgeranyl diphosphate; PSY, phytoene synthase; PDS, phytoene
desaturase; ZISO, ζ-carotene isomerase; ZDS, ζ-carotene desaturase; CRTISO,
carotene isomerase; β-LCY, lycopene-β-cyclase; ε-LCY, lycopene-ε-cyclase; BCH, β-
carotene hydroxylase; CYP97A/B, cytochrome P450 hydroxylases; ZEP, zeaxanthin
epoxidase; VDE, violaxanthin deepoxidase NXS, neoxanthin synthase.
15-cis-phytoene
9,15,9‘- tri-cis-ζ-carotene
9,9‘-di-cis-ζ-carotene
7,9,7‘,9‘-tetra-cis-lycopene
all-trans-lycopene
GGPP2x
β-carotene
zeaxanthin
antheraxanthin
violaxanthin
neoxanthin
α-carotene
lutein
PSY
PDS
ZDS
CRTISO
ZISO
NXS
ZEP
BCH
β-LCYβ-LCYε-LCY
CYP97A CYP97C
abscisic acid
strigolactones
poly-cis pathway
VDE
ZEPVDE
CrtI
Introduction
6
Subsequent to desaturation, all-trans-lycopene is cyclized by lycopene-β-
cyclase (β-LCY) and / or lycopene-ε-cyclase (ε-LCY) introducing β-ionone or
ε-ionone rings, respectively, which only differ in the position of one double
bond (C5=C6 in β-ionone, C4=C5 in ε-ionone; Yu et al., 2010; Yu and Beyer,
2012; Cunningham et al., 1996). The introduction of two β-ionone rings at the
ends of the lycopene backbone yields β-carotene, whereas introduction of
one β- and ε-ionone ring results in α-carotene.
The final phase of the pathway includes various oxygenation reactions of α-
carotene and β-carotene, resulting in xanthophyll formation. Hydroxylases
with ε-/β-ring specificities hydroxylate at C3 / C3’ (for review, see Tian et al.,
2004 and Kim et al., 2009): α-carotene is first converted to zeinoxanthin by a ε-
hydroxylase and then to lutein by a β-hydroxylase. β-Carotene is hydroxylated
twice by a β-hydroxylase to yield zeaxanthin. Zeaxanthin epoxidase (ZEP)
introduces epoxy functionalities to form antheraxanthin and violaxanthin
(Bouvier et al., 1996). In the context of the so-called xanthophyll cycle (see
1.2.1), these reactions are reversed by violaxanthin deepoxidase (VDE) (Bugos
et al., 1998; Arnoux et al., 2009; Fufezan et al., 2012). It remains unclear how
neoxanthin biosynthesis is accomplished. The involvement of a specific
neoxanthin synthase (NXS) or of a bifunctional β-LCY enzyme is debated
(North et al., 2007; Al-Babili et al., 2000; Bouvier et al., 2000). Furthermore, it
remains elusive whether or not a 9-cis-isomerase for violaxanthin and
neoxanthin exists in order to provide the precursors for abscisic acid
biosynthesis (North et al., 2007; see 1.2.3).
1.2.3 Biosynthesis and function of carotenoid-derived phytohormones
Two important phytohormones are biosynthesized from carotenoids through
oxidative cleavage catalyzed by carotenoid cleavage oxygenases (CCOs):
abscisic acid (ABA) and strigolactones. CCOs use molecular oxygen to
cleave double bonds in their carotenoid substrates, yielding two
apocarotenoid products with aldehyde or keto functionalities.
Introduction
7
ABA biosynthesis (for review, see Nambara and Marion-Poll, 2005) is initiated
by the oxidative cleavage of 9-cis-violaxanthin and 9-cis-neoxanthin at the
C11-C12 double bond by a 9-cis-epoxy-carotenoid cleavage dioxygenase
(NCED) – and yields the C15 ABA precursor xanthoxin. In the cytosol, xanthoxin
is then converted into ABA via abscisic aldehyde. ABA is a phytohormone
with versatile functions (for review, see Nambara and Marion-Poll, 2005), e.g.
induction of abiotic and biotic stress tolerance, regulation of stomata closure
and water balance, seasonal leaf abscission as well as the control of seed
dormancy in an interplay with gibberellic acid.
Strigolactones (SL) comprise a structurally and functionally diverse group of
phytohormones. However, they all share a core biosynthetic pathway (for
review, see Ruyter-Spira et al., 2013 and Al-Babili and Bouwmeester, 2015). SLs
derive from β-carotene which is first isomerized to 9-cis-β-carotene by the
isomerase D27 and then cleaved by CCD7 to form 9-cis-β-apo-10’-carotenal.
The latter is converted to the universal strigolactone precursor carlactone by
CCD8 by simultaneously occurring oxidative cleavage and complex
intramolecular rearrangement reactions (Alder et al., 2012; Bruno et al., 2017).
Carlactone is then further modified by P450 enzymes and hydroxylases to form
the sensu stricto SLs, such as 5’-deoxystrigol. SLs shape plant architecture by
enforcing apical dominance, i.e. inhibition of shoot branching, and by
regulating lateral root formation and root hair growth in response to nutrient
deprivation. Furthermore, SLs are involved in symbiotic as well as parasitic
relations after their secretion into the soil. On the one hand, SLs facilitate the
establishment of a symbiosis with arbuscular mycorrhizal fungi and serve as
inducers of hyphal branching. On the other hand, SLs are exploited by
parasitic plants of the Striga und Orobanche genera. Their seeds only
germinate in the presence of SLs that indicate the presence of a host plant
on which they are obligatorily dependent.
Introduction
8
1.3 Poly-cis pathway of carotene desaturation in plants and all-trans
desaturation pathway in bacteria
In the 1970s cis-carotenes were found as biosynthetic intermediates in fruits of
the tangerine mutant of tomato (Qureshi et al., 1974). Their stereo-
configuration was assigned by nuclear magnetic resonance (NMR)
spectroscopy, identifying 15-cis-phytoene, 9,15-di-cis-phytofluene, 9,9’-di-cis-
ζ-carotene, 7,9,9’-tri-cis-neurosporene and 7,9,7’,9’-tetra-cis-lycopene
(Clough and Pattenden, 1979). These isomers were also found in the mutant
CD-6 of the green algae Scenedesmus obliquus (Ernst and Sandmann, 1988).
With the identification of carotene isomerase (CRTISO; Isaacson et al., 2002;
Park et al., 2002), being affected in the above mentioned mutants, and with
the demonstration that the wild type carotenogenic enzymes of A. thaliana
yield poly-cis carotenes (Bartley et al., 1999), the ubiquitous occurrence of the
poly-cis carotene desaturation pathway in plants became generally
accepted. In contrast, the bacterial phytoene desaturase products were
trans-configured (Linden et al., 1991; Fraser et al., 1992). As of today, plant
carotene desaturation employs two homologous desaturases PDS and ZDS
and the two cis-trans isomerases ZISO and CRTISO (see 1.2), together yielding
all-trans-lycopene from 15-cis-phytoene. The all-trans pathway of carotene
desaturation in bacterial carotenogenesis employs only one enzyme, namely
phytoene desaturase CrtI, to produce the identical product from the
identical precursor (Fig.1-2, red arrow). It remains enigmatic what favored the
evolution of the complex poly-cis pathway in plants. One hypothesis is that its
complexity allows better fine-tuning of pathway flux (see 1.3.1.1; Sandmann,
2009). Recent findings suggest that apocarotenoids originating from the poly-
cis pathway are involved in plastid development and biosynthetic feedback
regulation (see 1.4).
PDS, ZDS and ZISO are the subjects of this work. The current knowledge of
these enzymes is summarized below.
Introduction
9
1.3.1 Carotene desaturases in plants and bacteria
1.3.1.1 Plant-type phytoene desaturase PDS and ζ-carotene desaturase ZDS
Phytoene desaturase (PDS) has a long history of research but remains poorly
understood. PDS and its cyanobacterial ortholog CrtP convert 15-cis-
phytoene via two formally identical reactions at both half sides of the
symmetrical substrate. Trans-configured double bonds are introduced at C11-
C12 and C11’-C12’ and concomitantly, trans-to-cis isomerization occurs at
the existing double bond at C9-C10 and C9’-C10’. Consequently, PDS yields
the intermediate 9,15-di-cis-phytofluene and the end product 9,15,9’-tri-cis-ζ-
carotene (Fig. 1-3 A; Bartley et al., 1999; Breitenbach and Sandmann, 2005;
for stereo-configuration, see Clough and Pattenden, 1979).
Fig.1-3 Scheme of the PDS reaction with the involved carotene stereoisomers and
homotetramerization of OsPDS-His6 in crystallo.
(A) 15-cis-phytoene is converted by PDS to yield 9,15,9’-tri-cis-ζ-carotene via the
intermediate 9,15-di-cis-phytofluene. Desaturation sites are highlighted in red. The
9,15-di-cis-phytofluene
15-cis-phytoene
9,15,9‘-tri-cis-ζ-carotene
FADoxPQ
PQH2
hνNDH
PTOX
2e-
FADred
FADoxPQ
PQH2
hνNDH
PTOX
2e-
FADred
12
11
12‘
11‘
109
9‘10‘
substrate cavity entranceA B
Introduction
10
enzyme-bound redox reactions involving FAD and plastoquinone as well as redox
chains that influence the PQ/PQH2 ratio - and consequently PDS activity - are
depicted. PQ, plastoquinone; PQH2, plastohydroquinone; hν, light energy
(photosynthetic electron transport chain); NDH, NAD(P)H:quinone oxidoreductase;
PTOX, plastid terminal oxidase. (B) Structure of OsPDS-His6 homotetramer obtained
upon protein crystallography (modified from Brausemann et al., 2017). Every
monomer is given in a different color and the substrate cavities are indicated.
Sequence alignments revealed that PDS possesses a (di)nucleotide cofactor
binding motif at the N-terminus, the Rossmann fold (for review, see Hanukoglu,
2015), and a stretch of 22 conserved hydrophobic amino acids has been
suggested to represent the phytoene binding site (Pecker et al., 1992). PDS
was shown to bind flavin adenine dinucleotide (FAD) as a redox cofactor (Al-
Babili et al., 1996; Hugueney et al., 1992). Al-Babili et al. (1996) observed that
PDS is targeted to plastids by a cleavable N-terminal transit peptide and
localized in the stroma in association with the chaperon Hsp70 as an
unflavinylated and inactive species. This is in line with the findings by Bonk et
al. (1997) which are related to the fate of the immature protein after in vitro
import into pea chloroplasts. A second PDS species is bound to plastid
membranes, flavinylated and enzymatically active. A concerted flavinylation
and membrane association of PDS assisted by chaperones was suggested
(Al-Babili et al., 1996) because membrane association in the absence of FAD
led to inactive PDS that was unable to bind this cofactor. Consequently, PDS
binds FAD as a non-exchangeable redox cofactor requiring its reoxidation
after every redox reaction for repeated catalysis (Al-Babili et al., 1996).
In the past, redox processes during PDS desaturation have been investigated
in complex systems. In daffodil chromoplasts, PDS and ZDS were only active in
the presence of oxygen that was replaceable by oxidized quinones (Beyer et
al., 1989, Mayer et al., 1990). Consequently, quinones were considered as
exchangeable electron acceptors requiring subsequent reoxidation by
oxygen (Mayer et al., 1990). In accordance with this, findings of Norris et al.
(1995) showed that PDS was inactive in the plastoquinone(PQ)–deficient
Introduction
11
Arabidopsis mutants pds1 and pds2. First in vitro experiments with
heterologously expressed Gentiana lutea PDS and Synechococcus CrtP
supported this notion (Breitenbach et al., 2001). Thus, FADox acts as an
intermediary electron acceptor. After reduction by electrons originating from
carotene desaturation, FAD reoxidation by PQ as an exchangeable terminal
electron acceptor is required to regenerate FADox for another round of
catalysis.
PDS activity strongly depends on the redox state of the plastid PQ pool that is
finely regulated by a network of redox chains (for review, see Mc Donald et
al., 2011 and Carol and Kuntz, 2001; Fig.1-3; Fig.1-4). In green tissues, it
primarily depends on the relative activities of the Cytb6f complex and the
photosystems, i.e. the photosynthetic electron transport. In non-
photosynthetic tissues, two additional redox systems come into play. First,
plastid terminal oxidase PTOX mediates plastohydroquinone (PQH2)
reoxidation by oxygen (Josse et al., 2003), explaining the dependence of PDS
activity on oxygen observed in daffodil chromoplasts (Beyer et al., 1989;
Mayer et al., 1990). In chromoplasts, PTOX is essential for carotenogenesis as it
provides plastoquinone whereas it is dispensable in photosynthetic tissues
when chloroplasts and photosynthetic electron transport are fully developed
(Carol and Kuntz, 2001). Second, a NAD(P)H:quinone oxidoreductase was
described in chromoplasts that mediates quinone reduction with NAD(P)H,
providing plastohydroquinone (Nievelstein et al., 1995). Interestingly, a
PQ/PQH2 redox optimum is required in chromoplasts to attain optimal PDS
activity (Nievelstein et al., 1995). This might suggest that PQ does not simply
act as a PDS electron acceptor. Thus, PDS has been envisioned as being
integrated into the above described redox chains that cover the redox
potential difference of the PDS-bound FAD/FADH2 and O2/H2O redox pairs of
approximately E0’ = 0.7 – 0.9 V. It remains to be elucidated whether the
accompanying ∆G0 is thermodynamically required to drive the PDS reaction,
i.e. whether carotene desaturation needs to be energetically coupled to PQ
and oxygen reduction. Otherwise, the participation of PQ and oxygen would
affect the PDS reaction only kinetically.
Introduction
12
Fig.1-4 Plastoquinone-mediated redox control of the PDS and ZDS reactions.
PDS and ZDS utilize plastoquinones as diffusible terminal electron acceptor to
reoxidize their bound FAD after carotene desaturation. The redox state of the
plastoquinone pool in plastid membranes controls the plastoquinone supply and
therefore, PDS activity. Thus, PDS activity is influenced by three redox chains that
utilize plastoquinones as electron donor or acceptor, namely PTOX and NDH (mainly
relevant in chromoplasts and non-photosynthetic tissues) as well as the
photosynthetic electron transport chain with PSII and the Ctyb6f complex. NDH,
NAD(P)H:quinone oxidoreductase; PTOX, plastid terminal oxidase, PSII, photosystem
II, PDS, phytoene desaturase; ZDS, ζ-carotene desaturase. Modified from Carol and
Kuntz (2001).
Regarding its topology, a proteomics approach showed that PDS is
associated to the inner envelope and thylakoid membranes (Joyard et al.,
2009). There is some speculation about the presence of a carotenoid-forming
metabolon allowing substrate channeling. However, supporting experimental
evidence is scarce (Cunningham and Gantt, 1998; Shumskaya et al., 2013;
Nisar et al., 2015). The use of two-dimensional BN-PAGE and western blotting
revealed that PDS is a constituent a 350 kDa complex in chromoplast and
chloroplast membranes (Lopez et al., 2008). However, other possible protein
constituents of the complex were not identified. In the stroma, PDS was part of
a 660 kDa complex, presumably due to chaperon association (Al-Babili et al.,
1996). Lundqvist et al. (2017) applied 1D BN-PAGE followed by mass
Cytb6f
PSIINDH
NADPH NADP+
carotene
product
carotene
substrate
Introduction
13
spectrometry. In a chloroplast envelope fraction of Arabidopsis, comigration
of PDS and ZISO in a 75 – 200 kDa fraction and of ZDS and CRTISO in a 200 –
350 kDa fraction was observed suggesting heteromeric complexes. This might
indicate metabolon formation between these enzymes. Similar data obtained
with cyanobacteria support this notion (Takabayashi et al., 2013). Moreover,
gel permeation chromatography, negative staining electron microscopy and
protein X-ray crystallography of soluble OsPDS-His6 in combination with activity
assays suggested the enzyme to be flavinylated and active as homotetramer,
with monomers being deflavinylated and irreversibly inactivated
(Gemmecker et al., 2015; Fig. 1-3 B). However, it remained unclear whether
the homotetramer represents the enzyme’s active state at membrane
surfaces or occurs artifactually.
Investigations carried out in the 1990s revealed differences between bacterial
and plant carotene desaturation. In bacteria, the 4-step carotene desaturase
CrtI (1.3.1.2) introduces all four double bonds yielding lycopene from
phytoene (Linden et al., 1991). PDS as a 2-step desaturase yielded cis-ζ-
carotene from phytoene and was found to be unrelated to CrtI (Pecker et al.,
1992; Linden et al., 1991; Linden et al., 1993). The therefore anticipated plant
ζ-carotene desaturase (ZDS) and its cyanobacterial ortholog CrtQb were later
identified and found to be homologous to PDS (Albrecht et al., 1995 and
Breitenbach et al., 1998, respectively). Compared to PDS, ZDS is much less
studied since sequence homology with PDS and the common introduction of
two double bonds indicated functional analogy. ZDS converts 9,9’-di-cis-ζ-
carotene via identical desaturation reactions at both half sides of the
symmetrical substrate. Double bonds are introduced in cis-configuration at
the positions C7 and C7’, yielding 7,9,9’-tri-cis-neurosporene
(proneurosporene) and 7,9,7’,9’-tetra-cis-lycopene (prolycopene) (Fig.1-5;
Bartley et al., 1999; Breitenbach and Sandmann, 2005). Protein alignments
showed a conserved N-terminal Rossman fold indicating the binding of a
(di)nucleotide cofactor (Breitenbach et al., 1998). Binding of FAD as a redox
cofactor was shown only recently with CrtQb, the ZDS homolog from Nostoc
Introduction
14
(Breitenbach et al., 2013). Accordingly, PQ was shown to be the terminal
electron acceptor of ZDS to reoxidize FAD (Breitenbach et al., 1999;
Breitenbach et al., 2013), as already concluded from earlier experiments
(Beyer et al., 1989; Mayer et al., 1990). ZDS activity is consequently thought to
depend on redox regulation via the PQ pool, like PDS (Fig.1-4; Carol and
Kuntz, 2001; McDonald et al., 2011).
Fig.1-5 Scheme of the ZDS reaction with the involved carotene stereoisomers.
9,9’-di-cis-ζ-carotene is converted by ZDS to yield the end product 7,9,7’,9’-tetra-cis-
lycopene via the intermediate 7,9,9’-tri-cis-neurosporene. Desaturation sites are
highlighted in red. The enzyme-bound redox reactions involving FAD and
plastoquinone as well as redox chains that influence the supply of PQ and PQH2 and
thus ZDS activity are depicted. PQ, plastoquinone; PQH2, plastohydroquinone; hν,
light energy (photosynthetic electron transport chain); NDH, NAD(P)H:quinone
oxidoreductase; PTOX, plastid terminal oxidase.
9,9‘-di-cis-ζ-carotene
7,9,9‘-tri-cis-neurosporene
FADoxPQ
PQH2
hνNDH
PTOX
2e-
FADred
FADoxPQ
PQH2
hνNDH
PTOX
2e-
FADred
7,9,7‘,9‘-tetra-cis-lycopene
7
8
8‘7‘
Introduction
15
Regarding cis-trans configuration of its substrate, ZDS has special
requirements. Observations in daffodil chromoplasts (Beyer et al., 1989; Mayer
et al., 1990) demonstrated that the 15-cis double bond in the ζ-carotene, as
formed by PDS, needs to be isomerized to trans for ZDS activity (see also
1.3.2). Prolycopene and proneurosporene can only be formed from 9,9’-di-cis-
ζ-carotene in vivo (Bartley et al., 1999) and in vitro (Breitenbach et al., 2005).
9-cis-ζ-carotene was converted to 7,9-di-cis-neurosporene (Breitenbach et al.,
2005) and 9-cis-neurosporene to 7,9-di-cis-lycopene (Bartley et al., 1999). It
was concluded that ZDS recognizes its substrates by the 9-cis configuration of
one half side and can only introduce a 7-cis double bond in the same half
side (Breitenbach et al., 2005). In summary, there are clear similarities
between PDS and ZDS. The main differences are in the regio-specificity of
desaturation and the stereo-configuration of the introduced double bonds.
ZDS introduces cis-double bonds at C7-C8 and C7’-C8’ whereas PDS
introduces trans-double bonds at C11-C12 and C11’-C12’ and simultaneously
isomerizes C9-C10 and C9’-C10’ from trans to cis. It is therefore obvious that
both enzymes must differ mechanistically despite of their overall similarity.
Regarding its localization and topology, a proteomics approach showed that
ZDS is associated with the inner envelope membrane of chloroplasts (Joyard
et al., 2009). Some experiments indicate that ZDS and CRTISO form a
carotenogenic metabolon (Lundqvist et al., 2017). Breitenbach et al. (1999)
suggested dimerization of Capsicum annuum ZDS using gel permeation
chromatography but stated that dimerization was not necessary for ZDS
activity and may be due to unspecific hydrophobic aggregation.
1.3.1.2 Bacterial phytoene desaturase CrtI
Based on sequence comparison, the phytoene desaturase CrtI of bacteria
and fungi appears as evolutionarily unrelated to plant-type PDS. Some
similarities do exist but are largely restricted to the common N-terminal
Rossman fold to bind (di)nucleotide cofactors (Pecker et al., 1992). In
bacteria, there are CrtI enzymes introducing three to six double bonds (3- to
Introduction
16
6-step phytoene desaturases; Sandmann, 2009). Only the 4-step CrtI enzymes
yielding lycopene will be discussed here.
CrtI from Pantoea ananatis (formerly Erwinia uredovora) was thoroughly
investigated by Schaub et al. (2012). It catalyzes the sequential desaturation
of 15-cis-phytoene at C11-C12, C11’-C12’, C7-C8 and C7’-C8’, yielding the
end product all-trans-lycopene while only traces of the (presumably) trans-
configured intermediates phytofluene, ζ-carotene, neurosporene are
released (Linden et al., 1991; Fraser et al., 1992). CrtI is thus capable of
performing the entire all-trans carotene desaturation pathway (Fig.1-2). The
enzyme can be isolated as soluble protein but was shown to associate
spontaneously to liposomal membranes representing a monotopic
membrane protein (Schaub et al., 2012). It needs to bind FAD during
membrane association for activity (Schaub et al., 2012; Fraser et al., 1992), a
behavior that is similar to PDS (Al-Babili et al., 1996). FAD serves as the sole
non-exchangeable intermediary electron acceptor which is reoxidized by the
terminal electron acceptor oxygen. This defines CrtI as phytoene:oxygen
oxidoreductase. However, the enzyme was capable of utilizing quinones as
alternative terminal electron acceptors under anaerobic conditions. This
might allow redox regulation via bacterial photosynthetic redox chains
(Schaub et al., 2012). Apart from carotene desaturation, CrtI possesses cis-
trans-isomerase activity under anaerobic conditions, an activity that is
dependent on FADred. The formation of 7,9-di-cis-lycopene from prolycopene
implied half side recognition of carotenoid substrates (Schaub et al., 2012)
which is in accordance with the activity of its homolog, the plant carotene
cis-trans isomerase CRTISO (Isaacson et al., 2002; Isaacson et al., 2004; Yu et
al., 2011).
As CrtI cannot be purified in its flavinylated form (see above), the structure of
the CrtI apoprotein was resolved followed by in silico docking to identify the
position of the isoalloxazine moiety of FAD and of carotene fragments
(Schaub et al., 2012). The CrtI substrate cavity was lined with hydrophobic
residues and accommodated C18 – C20 truncations of phytoene, ζ-carotene
and lycopene which is consistent with a half side recognition of carotenes.
Introduction
17
The authors hypothesized that CrtI is active as a dimer that may form on
membrane surfaces possibly upon the binding of a phytoene half side. The
dimer would sequentially introduce all four double bonds after the
isomerization of the central C15-C15´double bond to trans and before
product release (Schaub et al., 2012), as witnessed by the release of only
traces of trans- intermediates. The model of Schaub et al. (2012) is in
accordance with the findings of Raisig and Sandmann (2001). Regio-
specificity of CrtI desaturation was maintained with a C30 15-cis-phytoene that
is truncated by five carbon atoms on both sides, showing that the length of
the substrate half sides is not the sole determinant for regio-specificity. The
central cis-configured triene might be used for the correct positioning of the
substrate (Sandmann, 2009). Site directed mutagenesis revealed that three
conserved histidines at the end of the substrate cavity help determine regio-
specificity of CrtI desaturation (Schaub et al., 2012).
Regarding the reaction mechanism of carotene desaturation, Schaub et al.
(2012) pointed out an aspartate and two arginine residues in active center
acting as a catalytic triad for the acid-base initiated activation of a hydride
that is transferred onto the redox cofactor FAD.
1.3.1.3 Bleaching herbicides targeting PDS
Bleaching herbicides lead to lethal photooxidative destruction of plant cells,
for instance by targeting PDS and ZDS, i.e. carotenogenesis (for review, see
Sandmann et al., 1991; Sandmann and Böger, 1997 and references therein).
Their mode of action, target selectivity and inhibitory effectiveness have been
investigated since the 1980s, however, the native purification of the targeted
carotene desaturases has seldomly been achieved (see 1.3.1.1 and 1.3.1.2).
Consequently, herbicide research relied on observations made in vivo or in
complex cell-free in vitro assays. Considering the interference of, inter alia,
cell structures, cofactors and redox chains with the examined enzymes and
inhibitors, the reliability of such findings may be doubtful. Nowadays, the
emergence of resistances towards widely used herbicides requires a new
focus on herbicide research. This calls for basic research addressing the
Introduction
18
native purification of PDS and ZDS and elucidating the inhibitory modes of
action, binding sites, target selectivity and effectiveness of herbicides in order
to possibly design novel agronomically valuable bleaching herbicides.
The most important groups of carotene desaturase inhibitors have been
reviewed by Sandmann (1991). Amongst them, there is a structurally
heterogenous group of PDS inhibitors such as norflurazon (NFZ), fluridone,
diflufenican, fluortamone and fluorochloridone. They share a meta-
trifluoromethylphenyl (m-CF3-phenyl) moiety that is often fused to a second
(heterocyclic) ring structure with a carbonyl group (Babczinski et al., 1995;
Fig.1-6). Among these, the most extensively studied inhibitor is NFZ.
Fig.1-6 Structures of bleaching herbicides targeting PDS.
PDS inhibitors share common structural features as described by Babczinski et al.
(1995), namely a meta-trifluoromethylphenyl moiety that is mostly fused to a second
(heterocyclic) ring structure with a carbonyl group.
NFZ was reported to inhibit PDS non-competitively regarding phytoene
(Sandmann et al., 1989; Mayer et al., 1989) and competitively regarding
plastoquinone, suggesting that NFZ is to be regarded as a structural analog of
PQ (Breitenbach et al., 2001). The mode of action of other m-CF3-phenyl
containing inhibitors has not been examined, except fluridone that was
shown to be non-competitive towards phytoene (Kowalczyk-Schröder et al.,
fluridone
O-(2-phenoxy)ethyl-N-
aralkylcarbamate
fluorochloridone
3-trifluoromethyl-
1,1’-biphenyl
diflufenicannorflurazon
flurtamone trifluoromethyl-phenyl-
ketomorpholine
Introduction
19
1992). Flurtamone, fluorochloridone and diflufenican were shown to be more
effective PDS inhibitors than NFZ (Mayer et al., 1989; Sandmann, 1990;
Sandmann and Fraser, 1993; Laber et al., 1999). At the same time, they were
reported to barely impair ZDS activity (Mayer et al., 1989).
Several studies were carried out in the 1980s and 1990s to investigate
structure-activity correlations. NFZ derivatives that had the m-CF3 substituent
replaced by less lipophilic and/or electron-withdrawing substituents showed
substantially decreased inhibition in daffodil chromoplasts and
cyanobacterial membranes (Mayer et al., 1989; Sandmann et al., 1989).
Accordingly, more lipophilic and electron-withdrawing substituents improved
in vivo inhibition in the green algae Scenedesmus obliquus (Sandmann and
Böger, 1982). Quantitative structure-activity correlations were reported with
fluridone derivatives as well (Sandmann et al., 1992) and pointed once more
towards the special importance of the m-CF3 substituent. Additional
important features reside in the second (heterocyclic) ring structure, such as a
carbonyl group in vicinity to the m-CF3-phenyl and the overall lipophilicity and
electronegativity of additional ring substituent (e.g. fluorine atoms).
Cramp et al. (1987) examined different diflufenican derivatives containing a
phenoxy ring replacing the phenyl group in NFZ. They corroborated the results
of Sandmann et al. (1992) regarding lipophilicity and electronegativity of m-
CF3 and demonstrated that the meta position was essential. Sandmann and
Mitchell (2001) examined ketomorpholine herbicides, inhibiting PDS non-
competitively regarding phytoene and consisting of m-CF3-phenyl fused to a
heterocyclic ketomorpholine with a carbonyl (Fig.1-6). The distance between
the carbonyl of the ketomorpholine and m-CF3-phenyl appeared decisive for
inhibitory effectiveness. Ohki et al. (2003) investigated the so-called O-(2-
phenoxy)ethyl-N-aralkylcarbamates, containing a CF3-substituted phenyl
group with a vicinal phenoxy group (Fig.1-6). They emphasized that the
phenoxy group was essential which is in line with the findings on the relevance
of the carbonyl group in other inhibitors. Using daffodil chromoplasts, Laber et
al. (1999) investigated 3-trifluoromethyl-1,1’-biphenyl herbicides. These
contain a m-CF3-phenyl moiety fused to an oxygenated phenyl ring (Fig.1-6).
Introduction
20
In accordance with Mayer et al. (1989) and Sandmann et al. (1989), the
replacement of the CF3 group by less lipophilic and electronegative methyl or
hydrogen decreased PDS inhibition. These recurrent principles led to the
assumption that m-CF3-phenyl herbicides all bind to the same site in PDS
(Laber et al., 1999), which was recently shown to be the plastoquinone
binding site for NFZ (Breitenbach et al., 2001; Gemmecker et al., 2015;
Brausemann et al., 2017). This notion finds further support with PDS mutants
showing cross-resistance to these herbicides (see below). Laber et al.
postulated that the binding site consists of a lipophilic pocket
accommodating the m-CF3-phenyl residue, a functionality donating or
accepting hydrogen bonds in vicinity to the m-CF3-phenyl and a lipophilic
area rotated by 30 ° against the plane of the m-CF3-phenyl.
It is noteworthy that the non-homologous bacterial phytoene desaturase CrtI
is not susceptible to these herbicides, probably due to structural differences
and the lack of PQ utilization (see 1.3.1.1 and 1.3.1.2). Consequently, its
expression confers NFZ resistance in plants (Misawa et al., 1994).
Herbicide research also aims at identifying herbicide-resistant enzymes for use
as selective markers. There are several reports on in vivo mutagenesis and NFZ
resistance screening, mainly in cyanobacteria and algae. Five conserved
amino acids in CrtP and PDS were found to mediate resistance against NFZ
upon mutation (Table 1). However, it is elusive whether these residues directly
interact with NFZ or whether allosteric effects are to be considered
(Chamovitz et al., 1993). Some mutants were reported to have partially lost
enzymatic activity, as witnessed by phytoene accumulation and the lowered
carotenoid content in vivo as well as by lowered activity in vitro (Chamovitz
et al., 1993; Martinez-Férez et al., 1994; Table 1). Nevertheless, the
overexpression of such mutated PDS enzymes mediates NFZ resistance in
transgenic plants (Arias et al., 2006; Wagner et al., 2002). Many of these
mutations mediated cross resistance against several m-CF3-phenyl herbicides
to varying degrees (Chamovitz et al., 1993; Martinez-Férez et al., 1994; Arias et
al., 2006), suggesting they occupy the same binding site (Laber et al., 1999).
Introduction
21
Table 1 Mutations of conserved amino acids conferring NFZ resistance to CrtP and
PDS enzymes.
Cell-free assays with cell lysates or membranes as enzyme and phytoene sources
were employed to determine PDS activity and NFZ susceptibility. Resistance factors
represent the ratio of the in vitro IC50 for wild type and mutated enzyme. Numbering
of the corresponding mutation site in Oryza sativa PDS refers to the immature protein
including its N-terminal 87 amino acid transit peptide (Acc. A2XDA1.2). Conserved
residues were identified by global protein sequence alignments using the Blosum 62
matrix. n.d., not determined.
publication organism Corresponding
OsPDS mutation
Resistance
factor
Activity
(% wild type)
Suarez et al. (2014) C. reinhardtii Phe162Val n.d. n.d.
Chamovitz et al. (1993) S. sp. PCC 7942 Arg300Pro 23 24
Martinez-Férez et al. (1994) S. sp. PCC 6809 Arg300Cys 25 n.d.
Martinez-Férez et al. (1994) S. sp. PCC 6809 Arg300Ser 220 n.d.
Martinez-Férez et al. (1994) S. sp. PCC 6809 Arg300Pro 149 n.d.
Arias et al. (2006) H. verticillata Arg300His 2 n.d.
Arias et al. (2006) H. verticillata Arg300Ser 18 n.d.
Arias et al. (2006) H. verticillata Arg300Thr 52 n.d.
Arias et al. (2006) H. verticillata Arg300Cys 29 n.d.
Chamovitz et al. (1993) S. sp. PCC 7942 Leu421Pro 8 91
Chamovitz et al. (1993) S. sp. PCC 7942 Val505Gly 15 83
Steinbrenner and
Sandmann (2006) H. pluvialis Leu538Arg 43 n.d.
Huang et al. (2008) C. zofingiensis Leu538Arg 36 n.d.
Liu et al. (2010) C. zofingiensis Leu538Phe 31 129
Liu et al. (2013) C. reinhardtii Leu538Arg 23 80
Liu et al. (2013) C. reinhardtii Leu538Phe 28 129
Chamovitz et al. (1993) S. sp. PCC 7942 Leu538Arg 76 67
Introduction
22
1.3.2 ζ-Carotene isomerase ZISO
As outlined in 1.3.1.1, PDS produces 9,15,9’-tri-cis-ζ-carotene whereas the ZDS
substrate is 9,9`-di-cis-ζ-carotene. Observations in daffodil chromoplasts
indicated that the 15-cis double bond is readily photoisomerized to trans, so
that illumination was assumed to be sufficient for the purpose (Beyer et al.,
1989). Accordingly, photoisomerization of ζ-carotene was generally sufficient
in E. coli coexpressing PDS and ZDS – but was rate-limiting for the pathway flux
towards prolycopene (Bartley et al., 1999). Moreover, carotenogenesis occurs
in plant tissues such as roots and inner parts of fruits that are not exposed to
light. The requirement for a ζ-carotene isomerase (ZISO) became obvious.
Li et al. (2007) characterized a maize mutant pale y9 that accumulates
9,15,9’-tri-cis-ζ-carotene in roots and etiolated leaves. The mutated gene,
responsible for the formation of the 9,9’-di-cis isomer, was named ζ-carotene
isomerase (ZISO). Chen et al. (2010) isolated the ZISO ortholog from the A.
thaliana mutant zic1-1 and showed that the Arabidopsis and maize ZISO
orthologs mediated the isomerization of 9,15,9’-tri-cis-ζ-carotene to 9,9’-di-cis-
ζ-carotene in E. coli engineered to accumulate ζ-carotene (Fig. 7). In maize
and Arabidopsis ZISO mutants, the enzyme was found to be essential for
carotenoid biosynthesis both in green and non-green tissues.
Fig. 1-7 Scheme of the ZISO reaction with the involved carotene stereoisomers.
9,15,9’-di-cis-ζ-carotene is converted by ZISO to yield 9,9’-di-cis-ζ-carotene.
9,15,9‘-tri-cis-ζ-carotene
9,9‘-di-cis-ζ-carotene
Introduction
23
Bioinformatic analysis revealed that ZISO is conserved amongst
cyanobacteria, algae and plants and that its closest relative is the nitrite and
nitric acid reductase NnrU, a transmembrane protein involved in bacterial
denitrification (Bartnikas et al., 1997). Accordingly, hydropathicity plots
predicted ZISO to possess several transmembrane helices (Chen et al., 2010).
Interestingly, ZISO is a constituent of the Synechococcus elongatus
carotenoid gene cluster that encodes for the enzymes of the poly-cis
desaturation pathway (Chen et al., 2010). In contrast, ZISO orthologs are
absent in the gene cluster coding for the all-trans desaturation pathway in
Rhodobacter sphaeroides, but its homolog NnrU clusters with genes involved
in denitrification. This adds to the notion that NnrU underwent
neofunctionalization in cyanobacteria.
1.4 Apocarotenoids as novel signaling compounds in plants
Apocarotenoids arise from carotenoids upon (non-)enzymatic oxidative
cleavage of a double bond, yielding a ketone or an aldehyde. The plenitude
of cleavable double bonds (see 1.1) and further modification give rise to this
structurally diverse group of metabolites. In plants, they are enzymatically
formed by carotenoid cleavage oxygenases, including carotenoid cleavage
dioxygenases (CCDs) and 9-cis-epoxy carotenoid cleavage dioxygenases
(NCEDs) (for review, see Walter and Strack, 2011 and Hou et al., 2016). They
serve as colorants, odorants and flavors and can attract pollinators or repel
herbivores (for review, see Walter and Strack, 2011 and Hou et al., 2016).
Additionally, the phytohormones ABA and strigolactones are apocarotenoid-
derived signaling compounds (see 1.2.3).
Indirect evidence has pointed towards additional, hitherto unidentified
apocarotenoid derivatives serving as signals in plant developmental
processes and carotenogenesis feedback regulation (for review, see Hou et
al., 2016 and Tian, 2015). For instance, there is ample evidence for positive
and negative feedback regulation originating from lycopene, β-carotene or
xanthophylls (Arango et al., 2014; Bai et al., 2009; Beyer et al., 2002; Bramley et
Introduction
24
al., 2002; Cazzonelli and Pogson, 2010; Cuttris et al., 2007; Diretto et al., 2007;
Giuliano et al., 1993; Nogueira et al., 2013; Ronen et al., 2000; Römer et al.,
2000; Römer et al., 2002). However, the sum of observations made with various
plants and tissues are divergent and remain descriptive in the absence of an
identified compound. Apocarotenoids represent prime candidates as they
are less lipophilic and capable of leaving the plastid, especially upon
modification as in ABA and SL biosynthesis.
Two recent publications suggest that apocarotenoid signals originating from
the poly-cis pathway of carotene desaturation regulate carotenogenesis and
plant development (Fig.1-8). If true, this would provide a clue to the
conundrum as to why plants developed the intricate poly-cis desaturation
pathway instead of relying on the simple bacterial trans desaturation
pathway. Avendaño-Vázquez et al. (2014) described a Arabidopsis ZDS
knockout mutant accumulating 9,9’-di-cis-ζ-carotene and traces of 9,15-di-
cis-phytofluene. It showed impaired expression of plastid- and nucleus-
encoded genes and chloroplast biogenesis and possessed needle-like leaves
(Dong et al., 2007). This phenotype was not due to a lack of photoprotection
because it was absent in PSY- or PDS-deficient mutants, devoid of
carotenoids. Blockage of ζ-carotene formation by either PDS inhibition with
fluridone, PDS knockout or PSY knockout alleviated the phenotype of the ZDS
mutant – as well as a AtCCD4 knockout. In contrast, additional knockout
mutants of AtCCD7 and AtCCD8 did not alleviate the ZDS mutant phenotype.
The hypothesis arose that AtCCD4 might cleave putatively cis-configured ζ-
carotene and that the resulting apocarotenoid participates in retrograde
signaling affecting seedling development.
Kachanovsky et al. (2012) examined the carotenoid-deficient yellow flesh
mutant of tomato defective in PSY. Crossing yellow flesh into various CRTISO-
deficient tangerine backgrounds partially restored transcript levels of the
pathway upstream LePSY1 and consequently of carotenoid levels. CRTISO-
deficient tangerine is thus epistatic yellow flesh whereas the ZISO-deficient
zeta is not. The authors concluded that the rescue might be due to the
accumulation of cis-carotenes exclusively accumulating in tangerine but not
Introduction
25
in zeta, namely cis-neurosporene or prolycopene. These might be cleaved to
cis-configured apocarotenoids exerting positive feedback regulation on
carotenoid biosynthesis through PSY.
Fig.1-8 The carotenoid biosynthesis pathway in plants and formation of carotenoid
derived signaling molecules.
Desaturation intermediates are shaded in grey. Established and hypothetical signals
(indicated by question marks) that are formed by CCD-mediated cleavage of
desaturation intermediates are given. The formation of abscisic acid and
strigolactones is initiated by NCEDs and CCD7, respectively. GGPP, geranylgeranyl
diphosphate; PSY, phytoene synthase; PDS, phytoene desaturase; ZISO, ζ-carotene
isomerase; ZDS, ζ-carotene desaturase; CRTISO, carotene isomerase; β-LCY,
lycopene-β-cyclase; D27 (DWARF27), all-trans/9-cis-β-carotene isomerase NCED; 9-
cis-epoxycarotenoid cleavage dioxygenase; CCD, carotenoid cleavage
oxygenase. Modified from Bruno et al. (2016).
NCEDs
CCD4 ?
15-cis-phytoene
9,15-di-cis-phytofluene9,15,9‘-tri-cis-ζ-carotene
9,9‘-di-cis-ζ-carotene
7,9,9‘-tri-cis-neurosporene7,9,9‘,7‘-tetra-cis-lycopene
all-trans-lycopene
all-trans-β-carotene
PDS
ZISO
ZDS
CRTISO
β-LYC
abscisic acid
PSY
CCD(s)?
cis-apocarotenoid (?)
2x GGPP
cis-apocarotenoid
chloroplast &leaf developmentfeedback
strigolactones
CCD7
9-cis-β-carotene
CCD8
9-cis-epoxy-xanthophylls
D27
Introduction
26
The recent findings by Álvarez et al. (2016) add to this notion. AtPSY transcripts
occur in two alternative splice variants, one with a short 5’UTR that is
abundant, e.g. under light stress for immediate PSY translation. The other one
possesses a long 5’UTR that occurs in two conformations and allows PSY
translation to be finely tuned. The proposed regulation mechanism for the
long 5’UTR resembles a bacterial riboswitch acting as a flux sensor (for review,
see Serganov and Nudler, 2013): A feedback signal from carotenoid
biosynthesis, presumably a short chain apocarotenoid, could directly bind to
the 5’UTR and convert it into a translationally non-permissive configuration.
The decrease in PSY levels would reduce the flux through the pathway (for
review, see Álvarez et al., 2016 and references therein). The authors
emphasize that this post-transcriptional feedback mechanism seems to apply
only to species with one PSY gene such as Arabidopsis. No translation
inhibition was found for a full-length 5’UTR of PSY1 from O. sativa, a species
encoding three PSY genes.
1.5 Objectives of this work
1.5.1 Biochemical characterization of PDS and ZDS
1.5.1.1 Kinetic and structural investigations on PDS and ZDS
The purification to homogeneity of native, highly active PDS and ZDS is
required to enable the detailed investigations on both enzymes (see 1.3.1).
Recently, high quality purification of OsPDS-His6 was achieved, allowing
unprecedented activity in a biphasic in vitro assay and preliminary structure
elucidation by protein crystallography (Gemmecker et al., 2015). In the
course of this work, the protein structures were to be further resolved for PDS
and additionally for ZDS (in collaboration with the team of Prof. Dr. Einsle,
Dept. of Chemistry, University of Freiburg). Implications derived from the PDS
structure would require validation employing kinetic investigations including
mathematical modeling as well as site-directed mutagenesis. Revealing
structure-function relationships regarding the mode of membrane interaction,
Introduction
27
substrate recognition and specificity, regio-specificity and reaction
mechanism of carotene desaturation and the identification of rate-limiting
steps stood in the center of the planned research. Comparative kinetic
analyses between OsPDS-His6 and OsZDS-His6 were envisioned as the method
of choice to reveal common and distinct features of the two homologous
carotene desaturases. The comparison with the kinetics and structure of the
bacterial phytoene desaturase CrtI (Schaub et al., 2012) was planned to shed
light on the differences between the two distinct carotene desaturation
systems in bacteria and plants.
1.5.1.2 Action mode of bleaching herbicides targeting PDS
As laid out in 1.3.1.3, structurally different PDS inhibitors share a meta-
trifluoromethylphenyl group and a vicinal oxygen-containing functionality.
The lack of structural information about PDS did not allow the targeted design
of herbicides for the optimization of effectiveness and increased water
solubility leading to increased phloem mobility. With the help of kinetic
inhibitor studies and the interpretation of the OsPDS-His6 crystal structure in a
complex with NFZ, we aimed at elucidating amino acid residues that interact
with the meta-CF3 and carbonyl functionality of NFZ. In cooperation with
researchers of the agrochemical company Syngenta, results might create
knowledge to develop valuable herbicides targeting PDS and herbicide-
resistant PDS mutant enzymes.
1.5.2 Elucidation of the function of ζ-carotene isomerase ZISO
At the beginning of this work, ZISO had not been biochemically characterized
and results from in vivo assays carried out in E. coli had left ample room for
interpretation. For instance, it remained to be elucidated whether ZISO was a
bona fide isomerase for the central C15-C15’ double bond in ζ-carotene or a
modulator of the activity of PDS, capable of isomerizing the C9-C10 double
bond. Additionally, questions related to topology, cofactor requirement,
reaction mechanism and substrate specificity also remained to be addressed.
In view of the experimental challenges with transmembrane proteins like ZISO,
Introduction
28
the minimal goal was to establish an in vitro assay based on ZISO
overexpression in E. coli to examine whether ZISO is in fact an isomerase. If
possible native, homogenous purification was to be established in order to
address remaining questions.
1.5.3 Identification of apocarotenoids originating from the poly-cis pathway
of carotene desaturation
Recently published evidence pleads for the participation of apocarotenoids
derived from poly-cis pathway of carotene desaturation in plastid
development and carotenogenesis feedback regulation (see 1.4). Cleavage
of linear cis-carotenes by a CCD enzyme has been suggested based on
mutant analyses, however, such CCD cleavage activity has not been
investigated so far. It is an objective of this work to assay linear poly-cis
carotene cleavage in vitro with AtCCD1, AtCCD4 and AtCCD7 in search of a
yet unidentified apocarotenoid that might exert signaling functions directly or
upon modification. This could provide an answer to the question why the
much simpler CrtI-based all-trans carotene desaturation pathway in bacteria
and fungi (see 1.3.1) has been abandoned during the evolution of
cyanobacteria and plants.
Materials
29
2 Materials
2.1 Chemicals and materials
carotenoids and apocarotenoids
9-cis-lycopene Buchem, Netherlands
9-cis-β-apo-10’-carotenal Dr. Mark Bruno (University Freiburg)
9-cis-β-carotene Carotenature, Switzerland
all-trans-apo-10-lycopenal BASF, Ludwigshafen
all-trans-lycopene Roth, Karlsruhe
all-trans- / 15-cis-phytofluene (1/1) Carotenature, Switzerland
all-trans-β-carotene Sigma-Aldrich, Taufkirchen
all-trans-β-apo-8-carotenal Sigma-Aldrich, Taufkirchen
15-cis-1´,2´,3´,16´,17´-penta-nor-phytoene Buchem, Netherlands
enzymes
Accuprime GC-rich DNA polymerase ThermoFisher, Dreiech
catalase Sigma, Deisenhofen
deoxyribonuclease I (bovine pancreas) Sigma, Deisenhofen
diaphorase, human Sigma, Deisenhofen
glucose oxidase Sigma, Deisenhofen
lysozyme Roth, Karlsruhe
Phusion High-Fidelity DNA polymerase NEB, Schwalbach
restriction enzymes NEB, Schwalbach
T4 DNA ligase NEB, Schwalbach
Z-competent E. coli Transformation buffer set Zymo Research, Freiburg
kits
Pure YieldTM Plasmid Midiprep System Promega, Mannheim
Pure YieldTM Plasmid Miniprep System Promega, Mannheim
ECLTM Western Blotting Detection Reagents GE Healthcare, Freiburg
GFX PCR DNA / Gel Band Purification Kit GE Healthcare, Freiburg
proteins
alcohol dehydrogenase from S. cerevisiae Sigma, Deisenhofen
apoferritin from equine spleen Sigma, Deisenhofen
bovine serum albumin (BSA) Sigma, Deisenhofen
Materials
30
carboanhydrase from bovine erythrocytes Sigma, Deisenhofen
cytochrome c from equine heart Sigma, Deisenhofen
ovalbumin GE Healthcare, Freiburg
β-amylase from sweet potato Sigma, Deisenhofen
chemicals
β-mercaptoethanol Roth, Karlsruhe
2-(N-morpholino)ethanesulfonic acid (MES) Sigma, Deisenhofen
3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate (CHAPS)
Roth, Karlsruhe
agarose Roth, Karlsruhe
ammonium persulfate Roth, Karlsruhe
ampicillin Roth, Karlsruhe
Bacto Agar BD Biosciences, USA
BactoTM Tryptone BD Biosciences, USA
BactoTM Yeast BD Biosciences, USA
blue dextran Sigma, Deisenhofen
bradford staining solution Bio-Rad, München
bromophenol blue Serva, Heidelberg
chloramphenicol Duchefa, Netherlands
Coomassie Brillant Blue G250 Serva, Heidelberg
decylplastoquinone Sigma, Deisenhofen
imidazole Sigma, Deisenhofen
isopropyl-β-D-thiogalactopyranoside (IPTG) Roth, Karlsruhe
kanamycin Sigma, Deisenhofen
L-α-phosphatidylcholine, Type IV-S, > 30 % TLC Sigma, Deisenhofen
Midori green Biozym Scientific, Oldendorf
N,N,N’,N’-tetramethylethylendiamin (TEMED) Roth, Karlsruhe
octyl-β-D-glucopyranoside Biomol, Hamburg
Rotiphorese gel 30 Roth, Karlsruhe
streptomycin Duchefa, Netherlands
tris(2-carboxyethyl)phosphine (TCEP) Thermo Scientific, Dreieich
tris(hydroxymethyl)aminomethane (Tris) Sigma, Deisenhofen
Triton X100 Roth, Karlsruhe
Triton X165 Sigma, Deisenhofen
Materials
31
xylene cyanol Sigma, Deisenhofen
xylenol orange Sigma, Deisenhofen
α-tocopherolacetate Sigma, Deisenhofen
growth media
LB Roth, Karlsruhe
2YT Sigma, Deisenhofen
herbicides
norflurazon Sigma, Deisenhofen
fluridone Sandoz, Switzerland
diflufenican Santa Cruz, Heidelberg
All organic solvents were purchased as pro analysi quality from common suppliers, if used for HPLC analysis as HPLC / LC-MS grade. All other chemicals were purchased as pro analysi quality from common suppliers.
2.2 Primers
P1 5’acaaggaccatagcatatggct3’
P4 5’acggccagtgccaagcttca3’
P2A 5’cctgaagaaatgtgtttaaagcaa3’
P2B 5’cctgaagaaaactgtttaaagcaa3’
P2C 5’catcgaagcgaaatatttctgct3’
P2D 5’catcgaagccctatatttctgc3’
P2E 5’ccaaaaaagatagcaagcccagtttc3’
P2F 5’gggataagctccaacaaagatatg 3’
P3A 5’ttgctttaaacacatttcttcagg3’
P3B 5’ttgctttaaacagttttcttcagg3’
P3C 5’agcagaaatatttcgcttcgatg3’
P3D 5’gcagaaatatagggcttcgatg3’
P3E 5’gaaactgggcttgctatcttttttgg3’
P3F 5’catatctttgttggagcttatccc3’
PDS internal RV 5’catggcaaatatcatggagtgttccttc3‘
PDS into tag 5’ggattataaaatgctatctc3‘
pCDF- Mistic FW 5’ctttaataaggagatatacatgttttgtacattttttgaaaaacatca3‘
Materials
32
linker- Mistic RV
5’ctgctctgaaaatacaggttttcgccgccgctgccaccgccaccttctttttctccttcttcagatactgagatg3‘
linker-ZISO FW 5’gaaaacctgtattttcagagcagcggtggcccgggcagcatggcctccgccgtccgtcc3‘
pCDF-ZISO RV 5‘ccgagctcgaattcggatctcagtgatggtgatggtgatg3‘
pCDF-ZISO FW 5’ctttaataaggagatatacatggcctccgccgtccgtcc3‘
Duet Seq RV 5‘atttcgattatgcggccgtg3‘
2.3 Plasmids
plasmid source description
pRiceOsPDS-His6 Dr. Patrick Schaub (University Freiburg)
IPTG-induced expression of OsPDS with C-terminal His6 tag
pRicemutA I see 3.1.5 IPTG-induced expression of OsPDS mutants with C-terminal His6 tag
pRiceOsZDS-His6 see 3.1.6.1 IPTG-induced expression of OsZDS with C-terminal His6 tag
pCDFDuet-Mistic- OsZISO-His6
see 3.1.6.2 IPTG-induced expression of OsZISO with C-terminal His6 tag and N-terminal Mistic tag
pCDFDuet-OsZISO-His6 see 3.1.6.2 IPTG-induced expression of OsZISO with C-terminal His6 tag
pPhytoen_PS Dr. Patrick Schaub (University Freiburg)
constitutive expression of bacterial CrtE, IPP/DMAPP Isomerase and CrtB to yield phytoene
pz-carotene Prof. Dr. Salim Al-Babili (KAUST, Saudi-Arabia)
constitutive expression of bacterial CrtE, IPP/DMAPP isomerase, CrtB and CrtP to yield cis-ζ-carotenes
pThio-Dan1-AtCCD1 Dr. Mark Bruno (University Freiburg)
arabinose-induced expression of AtCCD1 with N-terminal thioredoxin
pThio-Dan1-AtCCD4 Dr. Mark Bruno (University Freiburg)
arabinose-induced expression of AtCCD4 with N-terminal thioredoxin
pThio-Dan2-AtCCD7 Dr. Adrian Alder (University Freiburg)
arabinose-induced expression of AtCCD7 with N-terminal thioredoxin
pThio- AtCCD8 Dr. Adrian Alder (University Freiburg)
arabinose-induced expression of AtCCD8 with N-terminal thioredoxin
pThio- AtD27 Dr. Mark Bruno (University Freiburg)
arabinose-induced expression of AtD27 with N-terminal thioredoxin
pHLT-LeCrtISO Prof. Dr. Joseph Hirschberg (Hebrew University Jerusalem)
arabinose-induced expression of LeCrtISO with an N-terminal HLT tag
Materials
33
2.4 Consumption materials
thin layer chromatography plates silica 60 F254 Merck, Darmstadt
dialysis tubing Spectra/Por1 30kDa MWCO Spektrum Laboratories, USA
concentrator vivaspin2 hydrosart, 30 kDa MWCO Sartorius, Göttingen
TALON® Metal Affinity Resin Clontech, Saint-Germain-en-
Laye, France
GeneRuler 1 kb DNA ladder Fermentas, St. Leon-Rot
PageRulerTM Prestained Protein Ladder Fermentas, St. Leon-Rot
2.5 Bacterial strains
� DH5α (Thermo Scientific, Dreieich): F- Φ80lacZ∆M15 ∆(lacZYA-argF)
U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1
� BL21 (DE3) Gro7 (Clontech, France): F- ompT hsdSB(rB-, mB-) gal dcm (DE3) pGRO7 (CamR)
� Tuner (DE3) (Merck, Darmstadt): F- ompT hsdSB (rB- mB-) gal dcm lacY1 (DE3)
� Rosetta (DE3) (Merck, Darmstadt): F- ompT hsdSB(rB- mB-) gal dcm (DE3) pRARE (CamR)
Methods
34
3 Methods
3.1 Nucleic acid methods
3.1.1 Isolation of nucleic acids
PCR products and other DNA fragments were purified from agarose gels and enzymatic reactions using the Illustra GFXTM PCR DNA / Gel Band Purification Kit (GE Healthcare) according to manufacturer instructions. Plasmids were isolated from E.
coli using the kits PureYieldTM Plasmid Miniprep / Midiprep System (Promega) according to manufacturer instructions.
3.1.2 Separation of nucleic acids
PCR products and plasmids were separated by agarose gelelectrophoresis. Gels with an agarose concentration of 1.0 – 1.2 % (w/v) were prepared with TAE buffer (0.484 % (w/v) Tris, 0.114 % (v/v) glacial acetic acid, 0.037 % (w/v) disodium-EDTA, pH 8.0 adjusted with acetic acid). 0.002 % (v/v) of Midori Green was added for DNA visualization. Samples were mixed with 6x DNA loading buffer (30 % (v/v) glycerol, 0.25 % (w/v) xylencyanol, Orange G and bromophenol blue each). Gels were run in TAE buffer at 7 V cm-1. GeneRulerTM 1 kb DNA ladder (Fermentas) served as a size marker.
3.1.3 Sequencing of nucleic acids
DNA sequencing was carried out by GATC Biotech (Constance, Germany) with the appropriate primers given in 2.2.
3.1.4 Polymerase chain reaction
All reactions were carried out with Phusion ® High Fidelity DNA Polymerase (NEB) or AccuPrime GC-rich DNA polymerase (ThermoFisher) for OsZISO amplification according to manufacturer instructions. Melting temperatures were calculated with the Geneious 8.0.2 software.
3.1.5 Site-directed mutagenesis
Site-directed point mutations were introduced into OsPDS-His6 using overlap extension PCR (Heckman and Pease, 2007). For amplification of the PDS fragment 5’ of the mutated site, primers P1 and P2x were used and primers P4 and P3x for the 3’ fragment. “x” stands for the letter assigned to the mutation (Table 2).
Table 2 Primers used for site-directed mutagenesis of OsPDS and resulting mutations
P1 5’acaaggaccatagcatatggct3’
P4 5’acggccagtgccaagcttca3’
P2A 5’cctgaagaaatgtgtttaaagcaa3’ P3A 5’ttgctttaaacacatttcttcagg3’
P2B 5’cctgaagaaaactgtttaaagcaa3’ P3B 5’ttgctttaaacagttttcttcagg3’
P2C 5’catcgaagcgaaatatttctgct3’ P3C 5’agcagaaatatttcgcttcgatg3’
P2D 5’catcgaagccctatatttctgc3’ P3D 5’gcagaaatatagggcttcgatg3’
P2E 5’ccaaaaaagatagcaagcccagtttc3’ P3E 5’gaaactgggcttgctatcttttttgg3’
Methods
35
P2F 5’gggataagctccaacaaagatatg 3’ P3F 5’catatctttgttggagcttatccc 3’
mutA Arg300Thr mutF Phe162Val
mutB Arg300Ser mutG Met277Leu and Met310Leu
mutC Leu538Phe mutH Thr506Phe and Tyr508Val
mutD Leu538Arg mutI Met277Leu
mutE His159Ala
For mutations mutG / mutH / mutI, a mutated fragment of the PDS cDNA was synthesized and cloned into puC57 by GenScript (New Jersey, USA), excised directly 5’ / 3’ of the fragment with either HindIII and BglII (mut H) or NdeI and SphI (mutG / I) and cloned into the pRice expression backbone previously digested with the required restriction enzymes to reconstitute a point-mutated full length PDS cDNA. Besaid primers were also used to verify all sequences and point mutations in all pRiceOsPDS-His6 plasmids.
3.1.6 Gene cloning
3.1.6.1 OsPDS-His6 and OsZDS-His6
The plasmid pRiceOsPDS-His6 was kindly provided by Dr. Sandra Gemmecker and Dr. Patrick Schaub (University of Freiburg). Briefly, the OsPDS (Gen Bank AF049356) sequence was deprived of the 87 amino acid transit peptide sequence, equipped with a 5´ NdeI site and 3´ His6 coding sequence followed by a HindIII site and synthesized by GenScript®. The vector pCrtI-His6, used previously to express the bacterial carotene desaturase CrtI (Schaub et al., 2012), was digested with NdeI and HindIII to remove the CrtI-His6 cassette and replace it by the OsPDS-His6 coding sequence, resulting in the vector pRicePDS-His6. To obtain a vector pRiceOsZDS-His6, the same procedure as described above was performed with rice ZDS (Gen Bank Acc. AP004273.2), based on a sequence which was codon-optimized, synthesized and sequence-verified by GenScript®.
3.1.6.2 (Mistic-)OsZISO-His6
The coding sequence of OsZISO (Gen Bank Acc. AK066126.1) was deprived of the N-terminal 46 amino acid transit peptide sequence and equipped with a 5’ His6 tag. The sequence was synthesized and cloned into the pUC57 plasmid by GenScript®. The OsZISO-His6 sequence was amplified from pUC57 by PCR using the primers linker-ZISO FW and pCDF-ZISO RV (see 2.2). The sequence for Mistic M110 (Gen Bank Acc. AY874162.1) was amplified from Bacillus subtilis genomic DNA (kindly provided by Dr. Hervé Joel Soufo, University of Freiburg) using the primers pCDF-Mistic FW and linker-Mistic RV (see 2.2), thus depriving it from its stop codon. The coding sequences for Mistic and OsZISO-His6 were cloned into NcoI / BamHI – digested pCDFDuetTM-1 plasmid (Novagen) by Gibson assembly (Gibson et al., 2009). The resulting plasmid pCDFDuet-MisticOsZISO-His6 encoded a chimeric ZISO protein fused to Mistic at its N-terminus via a 20 amino acid flexible linker with a TEV protease cleavage site and rich in glycine, serine and proline. The OsZISO-His6 coding sequence was cloned into pCDFDuetTM-1 stand alone by the same procedure using primers pCDF-ZISO FW and pCDF-ZISO RV (see 2.2), resulting in the plasmid pCDFDuet-OsZISO-His6 encoding a ZISO-His6 protein.
Methods
36
3.1.7 Transformation of E. coli with plasmid DNA
E. coli cells were made competent with the Z-competent E. coli Transformation buffer set (Zymo Research, USA) according to manufacturer instructions and were stored at – 80 °C. 50 µl aliquots of cells were thawed on ice for 5 min, 100 ng of plasmid DNA was added and cells were kept on ice for 30 min. Cells were grown at 37 °C for 1 h after the addition of 1 ml LB medium. They were selected on LB agar plates (1 % (w/v) agar in LB) with the required antibiotic over night at 37 °C (ampicillin, 100 µg ml-1; kanamycin, 50 µg ml-1; chloramphenicol, 20 µg ml-1; streptomycin, 20 µg ml-1).
3.2 Protein methods
3.2.1 Protein expression and purification
3.2.1.1 Expression and IMAC purification of OsPDS-His6
Tuner (DE3) E. coli cells were transformed with pRice-PDS-His6 and grown in 2YT-medium containing ampicillin (100 µg ml-1) under agitation (120 rpm) at 37 °C using baffled Erlenmeyer flasks. The expression of PDS-His6 was induced at OD600nm of 0.5 – 0.7 with 0.5 mM IPTG and took place at 15 °C over night. Cells were harvested by centrifugation, frozen in liquid nitrogen and stored at - 20 °C. IMAC purification was carried out keeping samples on ice. 15 g of cells were resuspended in 20 ml lysis buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl, 1 mM TCEP) and catalytic amounts of DNase I were added. Cells were disintegrated by using a French Pressure Cell at 1380 bar twice. After 10 min of centrifugation at 20,000 x g, 90 ml of lysis buffer were added to the supernatant and the cell lysate was supplemented with 0.25 % (w/v) CHAPS (0.7 CMC). 4.5 ml of TALON® Metal Affinity Resin (Takara Bio Europe / Clontech) was equilibrated in lysis buffer and added. The mixture was incubated for 30 min at 10 °C under over head agitation (10 rpm). The resin was collected by centrifugation for 5 min at 800 x g. The resin pellet was washed twice – with 40 ml of wash buffer 1 (lysis buffer containing 500 mM NaCl and 2 % glycerol) and 40 ml of wash buffer 2 (wash buffer 1 containing 10 mM imidazole-HCl (pH 8.0)). After reequilibration of the resin with 40 ml of lysis buffer, PDS was eluted from the resin on gravity flow columns with 5 ml of elution buffer (lysis buffer containing 150 mM imidazole-HCl (pH 8.0)). This was followed by dialysis at 10 °C against dialysis buffer (lysis buffer containing 10 % (v/v) glycerol) for imidazole removal. The protein could then be stored at - 80 °C for several months in an active state.
3.2.1.2 Expression and IMAC purification of OsZDS-His6
Rosetta (DE3) E. coli cells were transformed with pRiceZDS-His6 and grown in 2YT-medium containing ampicillin (100 µg ml-1) and chloramphenicol (10 µg ml-1) under agitation (120 rpm) at 37 °C using baffled Erlenmeyer flasks. ZDS-His6 expression was induced at OD600nm 0.5 – 0.7 with 0.2 mM IPTG and protein was expressed at 16 °C over night. Cells were harvested by centrifugation, frozen in liquid nitrogen and stored at - 20 °C. IMAC purification was carried out keeping samples on ice. 15 g of cells were resuspended in 20 ml lysis buffer (20 mM Tris-HCl pH 8.0, 100 mM NaCl, 2 % (v/v) glycerol, 10mM MgCl2, 0.05 % (v/v) Triton X-100 (2.5 CMC), spatula tip of DNase I and lysozyme). Cells were disintegrated by using a French Pressure Cell at 1380 bar twice. After 10 min of centrifugation at 20,000 x g, 90 ml of lysis buffer were added to the supernatant. 4.5 ml of TALON® Metal Affinity Resin (Takara Bio Europe / Clontech) was equilibrated in lysis buffer and added. The mixture was incubated for 30 min at
Methods
37
10 °C under over head agitation (10 rpm). The resin was collected by centrifugation for 5 min at 800 x g. The resin pellet was washed with 40 ml of wash buffer (20 mM Tris-HCl pH 8.0, 500 mM NaCl, 10mM MgCl2,5 % (v/v) glycerol, 15 mM imidazole-HCl (pH 8.0)). After reequilibration of the resin with 40 ml of lysis buffer, ZDS was eluted from the resin on gravity flow columns with 5 ml of elution buffer (20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 10mM MgCl2, 5 % (v/v) glycerol and 100 mM imidazole-HCl (pH 8.0)). This was followed by dialysis at 10 °C against dialysis buffer (lysis buffer containing 10 % glycerol) for imidazole removal. The protein could then be stored at - 80 °C for several weeks in an active state.
3.2.1.3 Expression and crude preparation of Mistic-OsZISO-His6
C43 (DE3) E. coli cells were transformed with pCDFDuet-MisticOsZISO-His6 and grown in 2YT-medium containing streptomycin (50 µg ml-1) under agitation at 37 °C using non-baffled Erlenmeyer flasks. The expression of Mistic-OsZISO-His6 was induced at OD600nm 0.5 – 0.7 with 1 mM IPTG and took place at 20 °C over night. Cells were harvested by centrifugation, frozen in liquid nitrogen and stored at - 20 °C. For crude protein preparation samples were kept on ice. 0.25 g of cells were resuspend in 2 ml of lysis buffer (50 mM Tris-HCl (pH 8.0), 100 mM NaCl, spatula tip of DNase I and lysozyme) and disintegrated by two passages through a French Pressure cell at 1380 bar. The cell lysate was clarified by centrifugation at 20000 x g for 1 min and the supernatant as a crude enzyme source was stored on ice and used for in vitro assays within 2 h.
3.2.1.4 Expression and IMAC purification of LeCRTISO-His6
The plasmid pHLT-CRTISO was kindly provided by Dr. Qiuju Yu (University of Freiburg) in order to express LeCRTISO as a HLT fusion protein with His6 tag and to purify it according to Yu et al. (2011) with minor changes. Briefly, pHLT-LeCRTISO was transformed into BL21 (DE3) E. coli cells harboring the plasmid pGro7 (Takara Bio Inc.), grown in 2YT-medium containing ampicillin (100 µg ml-1) and chloramphenicol (10 µg ml-1) in baffled flasks at 37 °C to an OD600nm of 0.5 – 0.8, induced by adding arabinose (0.2 % (w/v)) and IPTG (0.2 mM) and protein expression took place over night at 16 °C. Cells were harvested and stored at - 20 °C. For IMAC purification, samples were kept on ice or at 4 °C. Cells were disintegrated in 1.5 ml lysis buffer per gram of cell mass (25 mM sodium phosphate buffer (pH 7.5), 2.5 mM MgCl2, 300 mM NaCl, 15 % (v/v) glycerol) by two passages through a French Press Cell at 1380 bar. The crude lysate was clarified by centrifugation at 20,000 × g for 10 min and could either be used as a crude protein preparation directly or for IMAC purification. For further purification, Tween 20 was added to the supernatant to a final concentration of 10 x CMC (0.067 % (v/v)) for membrane solubilization. After 30 min of incubation on ice, TALON® was added and binding was allowed for 45 min at 10 rpm in an overhead shaker. The resin was pelleted by centrifugation at 800 x g for 5 min, washed three times with wash buffer (25 mM sodium phosphate buffer (pH 7.5), 2.5 mM MgCl2, 300 mM NaCl, 15 % (v/v) glycerol, 0.02 % (v/v) Tween 20 and 15 mM imidazole (pH 8.0)). Elution of LeCRTISO-His6 was accomplished on small gravity flow columns by the addition of 100 mM imidazole (pH 8) to the wash buffer. The protein was dialyzed against dialysis buffer (25 mM sodium phosphate buffer (pH 6.2), 2.5 mM MgCl2, 300mM NaCl, 15 % (v/v) glycerol) in a 30 kDa MWCO dialysis tube in order to remove imidazole. The protein was then stored at - 80 °C.
Methods
38
3.2.1.5 Expression and crude preparation for AtCCDs
All four AtCCD enzymes were expressed as thioredoxin fusion proteins using the pThio-vector system. The vectors pThio-Dan1-AtCCD1 and pThio-Dan1-AtCCD4 were kindly provided by Dr. Mark Bruno (University of Freiburg; Bruno et al., 2016), the vectors pThio-Dan2-AtCCD7 and pThio-AtCCD8 were kindly provided by Dr. Adrian Alder (University of Freiburg; Alder et al., 2012). pThio-AtCCD plasmids were transformed into BL21 (DE3) E. coli cells harboring the plasmid pGro7 (Takara Bio Inc.). Cells were grown at 37 °C in 50 ml 2YT growth medium supplemented with ampicillin (100 µg ml-1) and chloramphenicol (10 µg ml-1). Protein expression was induced with 0.2 % (w/v) arabinose at an OD600nm of 0.5. Cells were grown for 4 h at 28 °C, harvested and stored at - 20 °C. For crude protein preparation, cell pellets were resuspended in 1 ml modified LEW buffer (50 mM NaH2PO4, 300 mM NaCl, 1 mg ml-1 lysozyme, 1 mM dithiothreitol (pH 8.0)), passed twice through a French pressure cell at 690 bar and centrifuged at 20,000 x g for 5 min. Protein concentration was quantified using the Quick StartTM Bradford Protein Assay (Bio-Rad Laboratories) and adjusted to 20 µg µl-1.
3.2.1.6 Gel permeation chromatography for OsPDS-His6
For gel permeation chromatography (GPC) analysis of PDS, the GPC system Äkta Explorer 10 consisting of Box-900, pH/C-900, UV-900 und P-900 (Pharma Biotech, Uppsala, Sweden) was used. Samples were separated on a Superose 6 10/300 GL column (GE Healthcare) preequilibrated in GPC buffer (50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 150 mM imidazole-HCl (pH 8.0), 5 mM TCEP) at an isocratic flow rate of 0.8 – 1 ml min-1. Protein elution was monitored via absorption at 280 nm, fluorescence of free and protein-bound FAD at 535 nm upon excitation at 450 nm was monitored with a WatersTM 474 Scanning Fluorescence Detector (Waters GmbH). GPC control and data analysis was carried out using the Unicorn 5.0 software (GE Healthcare). Peak area was quantified by multiplying height of the peak and its width at 50 % height.
3.2.1.7 Gel permeation chromatography for OsZDS-His6
For gel permeation chromatography analysis of ZDS, see 3.2.1.6 with the following changes. Samples were separated in GPC buffer (20 mM Tris-HCl (pH 8.0), 100 mM NaCl, 100 mM imidazole-HCl (pH 8.0), 0.5mM TCEP if not stated otherwise) at an isocratic flow rate of 0.8 – 1ml min-1. For determination of native protein size and potential oligomerization, samples were separated on the columns HiLoad 16/60 (fractionation range 10 – 600 kDa), Superose 6 10/300 (fractionation range 5 – 5000 kDa), Superdex 75 10/300GL (fractionation range 3-75 kDa) (all GE Healthcare) that were calibrated with the following proteins / organic compounds: Blue dextran, carboanhydrase from bovine erythrocytes, alcohol dehydrogenase from S.
cerevisiae, β-amylase from sweet potato, cytochrome c from equine heart, apoferritin from equine spleen, albumin from bovine serum (all Sigma) and ovalbumin (GE Healthcare).
Methods
39
3.2.2 Enzymatic assays
3.2.2.1 OsPDS-His6 in vitro
Under standard conditions, 100 µl of liposomes containing 5 nmol of 15-cis-phytoene (prepared according to 3.2.8) were vortexed after the addition of 0,6 µl of methanolic decylplastoquinone (30 mM). Assay buffer (50 mM MES-KOH (pH 6.0), 100 mM NaCl) was added to a final volume of 700 µl. Assays were started by the addition of 25 µg OsPDS-His6 (ca. 10 µl; see 3.2.1.1). The incubation was carried out at 37 °C in the dark for 15 min. Assays were stopped and carotenoids extracted by mixing them with 300 µl of CHCl3/methanol (2:1, v/v) with α-tocopherol acetate (0.1 mg ml-1) as internal standard. After 5 min of centrifugation at 20000 x g, the carotenoid-containing hypophase was dried, resuspended in 40 µl of CHCl3/methanol (2:1, v/v) and 5 µl were analyzed by HPLC (system 1, see 3.3.1). For inhibitor studies, 2 µl of methanolic inhibitor solution was added to the assay buffer and control assays contained 2 µl of methanol.
3.2.2.2 OsZDS-His6 in vitro
Under standard conditions, 100 µl of liposomes containing 5 nmol of 9,9’-di-cis-ζ-carotene (prepared according to 3.2.8) and were vortexed after the addition of 0.6 µl of methanolic decylplastoquinone (6 mM). Assay buffer (50 mM MES-KOH (pH 6.5), 100 mM NaCl) was added to a final volume of 700 µl. Assays were started by the addition of 25 µg OsZDS-His6 (ca. 10 µl; see 3.2.1.2). The incubation was carried out at 36 °C in the dark for 30 min. Assays were stopped and carotenoids extracted by mixing them with 300 µl of CHCl3/methanol (2:1, v/v) with α-tocopherol acetate (0.1 mg ml-1) as internal standard. After 5 min of centrifugation at 20000 x g, the carotenoid-containing hypophase was dried, resuspended in 40 µl of CHCl3/methanol (2:1, v/v) and 5 µl were analyzed by HPLC (system 2, see 3.3.1). For inhibitor studies, 2 µL of methanolic inhibitor solution was added to the assay buffer and control assays contained 2 µl of methanol. When determining the pH dependency of OsZDS-His6 activity, a combined MES-Tris buffer system (50 mM MES-Tris, 100 mM NaCl, pH adjusted by MES-Tris titration) was used.
3.2.2.3 Mistic-OsZISO-His6 in vitro For in vitro activity measurements, 100 µl of liposomes containing 5 nmol of 9,15,9’-tri-cis-ζ-carotene (prepared according to 3.2.8) were mixed with 100 µl of Mistic-OsZISO-His6–containing cell lysate (see 3.2.1.3) and assay buffer (50mM MES-KOH (pH 6.0), 100 mM NaCl) was added to a final volume of 700 µl. Assays were incubated for 2 h at 30° C in the dark and carotenoids were extracted by mixing samples with 1 volume of CHCl3/methanol (2:1, v/v) with α-tocopherol acetate (0.1 mg ml-1) as internal standard. After 5 min of centrifugation at 20000 x g, the carotenoid-containing hypophase was dried, resuspended in 40 µl of CHCl3/methanol (2:1, v/v) and 5 µl were analyzed by HPLC (system 1, see 3.3.1).
3.2.2.4 LeCRTISO-His6 in vitro
In vitro assays were based on crude enzyme preparation (3.2.1.4). 100 µl of substrate-containing liposomes (prepared according to 3.2.8) were mixed with 191 µl of crude protein preparation and 3 µl of FAD (5 mM). Anaerobic conditions were achieved by adding 3 µl of NADH (5 mM) and freshly prepared sodium dithionite (100 mM) each, resulting in a final volume of 300 µl. Assays were incubated at 37 °C for 1 – 3 h in the dark, depending on the carotenoid substrate. Carotenoid extraction was achieved
Methods
40
by the addition of 900 µl acetone, 300 µl of petroleum ether/diethyl ether (2:1, v/v) with α-tocopherol acetate (0.1 mg ml-1) as internal standard and sonication (Branson Digital Sonifier, USA). After 5 min of centrifugation at 20000 x g, the carotenoid-containing hypophase was dried, resuspended in 40 µl of CHCl3/methanol (2:1, v/v) and 5 µl were analyzed by HPLC (system 6, see 3.3.1). Prolycopene served as a positive activity control.
3.2.2.5 AtCCDs in vitro
Assays were performed in a total volume of 200 µl. Purified substrates were dissolved in CHCl3 (equaling 30 µM as final concentration if not stated otherwise) and mixed with 20 µl ethanolic Triton X-100 (2 % (v/v)) in the case of AtCCD 4 / 7 / 8 and with 50 µl ethanolic ß-octylglucoside (4 % (v/v)) in the case of AtCCD1 dried using a vacuum evaporator and dissolved in 100 µl of 2x incubation buffer (2 mM TCEP, 0.4 mM FeSO4, 200 mM HEPES-NaOH (pH 7.8)and 2 mg ml-1 catalase (Sigma). For 9-cis-lycopene micelles, the substrate was mixed with 10 µl of ethanolic Triton X165 (3 % (v/v)). Assays were started by the addition of each, 50 µl lysate and H2O and then incubated for 1 h, if not stated otherwise, under shaking (200 rpm) at 30 °C in darkness. For extraction, 400 µl acetone were added, followed by short sonication (Branson Digital Sonifier, USA) and the addition of 600 µl petroleum ether/diethyl ether (2:1, v/v) using α-tocopherol acetate (0.1 mg ml-1) as an internal standard. After centrifugation, the epiphase was dried and redissolved in 40 µl CHCl3. 5 µl of the extract were subjected to HPLC (system 7 if not stated otherwise, see 3.3.1). The following substrates served as positive activity controls: β-carotene (AtCCD4), β-apo-8-carotenal (AtCCD1), 9-cis-β-carotene (AtCCD7) and 9-cis-β-apo-10’-carotenal (AtCCD8).
3.2.2.6 OsZISO-His6 in vivo
DH5α E. coli cells were transformed with the plasmid pζ-carotene (see 2.3; kanamycin) to produce tri-cis-ζ-carotene and di-cis-phytofluene by the expression of, inter alia, phytoene desaturase from Synechococcus sp. PCC 6803. For exclusive phytoene production, E. coli was transformed with the plasmid pPhytoene_PS (see 2.3; kanamycin). Cells were cotransformed with pCDFDuet-MisticOsZISO-His6 or pCDFDuet as a control, grown in LB to an OD600nm of 0.5 – 0.7 at 28 °C and ZISO expression was induced by the addition of 0.2 mM IPTG. Cells were further grown in the dark for 18 h at 28 °C, harvested by centrifugation at 8000 x g for 5 min and carotenoids were extracted in the dark by the addition of 3 times 2 ml acetone and sonication (Branson Digital Sonifier, USA). 2 ml of petroleum ether / diethyl ether (2:1, v/v) were added to the combined acetone extract, filled up to 14 ml with water, partitioned and centrifuged at 4000 x g for 5 min. The epiphase was dried and carotenoid extracts were subjected to HPLC to investigate ζ-carotene isomerization (system 3, see 3.3.1). In order to reconstitute the entire poly-cis desaturation pathway and investigate how well light can substitute for ZISO activity in vivo, cells were cotransformed with the plasmids pRiceOsZDS-His6 (ampicillin) and pCDFDuet-MisticOsZISO-His6 (streptomycin) or pCDFDuet-empty as a control. Cells were grown at 32 °C for 8 h after IPTG induction at OD 0.5 – 0.7, either in the dark or under light (800 µmol m-2 sec-1). Carotenoids were extracted and analyzed as given above.
3.2.3 SDS-PAGE
For protein separation, discontinuous sodium dodecyl – polyacrylamide gelelectrophoresis (SDS-PAGE) was applied. Self-casted gels (8.5 x 8.2 x 0.1 cm)
Methods
41
consisted of a 4 % collecting gel and a 8 % / 12 % separation gel composed as follows:
Separation gel 12 % Separation gel 8 % Collecting gel
acrylamide 30 18 ml 12 ml 2,4 ml
separation buffer (1.88 M Tris-HCl; pH 8.8)
9 ml 9 ml x
collecting buffer (1.25 M Tris-HCl; pH 6.8)
x x 1,5 ml
aqua dd 17,4 ml 23,4 ml 10,8 ml
10 % (w/v) SDS 450 µl 450 µl 150 µl
TEMED 22,5 µl 22,5 µl 15 µl
10 % (w/v) APS 210 µl 210 µl 150 µl
Protein samples were mixed with 3 x protein loading buffer (65 mM Tris-HCl (pH 6.75), 20 % (v/v) glycerol, 10 % (v/v) β-mercaptoethanol, 4 % (w/v) SDS, spatula tip of Coomassie Brilliant Blue (CBB) G250), solubilized at 90 °C for 5 min and separated for 1.5 – 2 h at 230 V and 30 mA. Gels were run in SDS-PAGE running buffer (0.25 M Tris, 2 M glycine, 1 % (w/v) SDS). PageRulerTM Prestained-Protein Ladder (Fermentas, St.Leon-Rot) was used as a size marker if not stated otherwise. Gels were stained using Coomassie staining solution (2.5 % (w/v) CBB G250 in ethanol/H2O/acetic acid (227:227:46; v/v/v)) and destaining solution (ethanol/H2O/acetic acid (30:60:10; v/v/v) and scanned.
3.2.4 Protein precipitation
3.2.4.1 Ammonium sulfate precipitation
31 % (w/v) ammonium sulfate was added to PDS or ZDS samples originating from GPC analyses (see 3.2.1.6 and 3.2.1.7), equaling 60 % saturation at 4 °C. Samples were incubated on ice on a rotary shaker (50 rpm) for 30 min and then centrifuged at 20000 x g for 20 min at 4 °C. Protein pellets were resuspended in appropriate volumes of GPC buffer and centrifuged at 20000 x g for 10 min at 4 °C to remove aggregates and denatured protein.
3.2.4.2 Chloroform-methanol precipitation
Proteins samples were denatured and precipitated according to Wessel and Flügge (1984) and resolubilized at 90 °C in 3 x SDS loading buffer for SDS-PAGE (see 3.2.3).
3.2.5 Protein quantification
3.2.5.1 Bradford assay
Protein concentrations were determined using the Quick StartTM Bradford Protein Assay (Bio-Rad Laboratories) according to the manufacturer’s protocol.
Methods
42
3.2.5.2 Nanodrop
IMAC-purified protein was quantified in its dialysis buffer with a Nanodrop photometer (Implen, Munich) using ε280nm = 72,400 l mol-1 cm-1 for OsPDS-His6 and ε280nm = 68,300 l mol-1 cm-1 for OsZDS-His6, both extinction coefficients calculated for the fully reduced proteins with the ExPASy protein parameter online tool.
3.2.6 Membrane association assay
Standard PDS in vitro assays with 50 µg OsPDS-His6 each (see 3.2.2.1) were incubated for 15 min at 37 °C, layered on top of a 30 % (w/v) sucrose in PDS assay buffer (50 mM MES-KOH (pH 6.0), 100 mM NaCl) and centrifuged for 30 min at 110000 x g. The liposomes were isolated from the density boundary, PDS was precipitated by CHCl3/methanol precipitation (see 3.2.4.2) and SDS-PAGE was carried out (see 3.2.3). To test if PDS interaction with liposomes is based on ionic interactions, isolated liposomes were washed with PDS assay buffer supplemented with 0.5 M KCl, incubated for 15 min and PDS liposomes were isolated as described above.
3.2.7 Preparation of carotenoid-containing liposomes
For liposome preparation for in vitro assay with OsPDS-His6, OsZDS-His6 or MIstic-OsZISO-His6 , 5 mg phosphatidylcholine were dissolved in CHCl3 and added to 50 nmol of the required carotenoid substrate. After vortexing, the lipid-carotene mixture was dried under N2 and 1 ml liposome buffer (50 mM Tris-HC (pH 8.0), 200 mM NaCl) was added, followed by 15 min incubation on ice. Liposomes were formed by gentle sonication (Branson Digital Sonifier, USA). Small unilamellar vesicles were formed by a passage through a French pressure cell at 1380 bar. For liposome preparation for CRTISO in vitro assays, 10 mg phosphatidylcholine ml-1 were used as final concentration and liposome buffer consisted of 25 mM sodium phosphate buffer (pH 7.5), 2.5 mM MgCl2, 300mM NaCl and 15 % (v/v) glycerol.
3.2.8 Photometric quantification of protein-bound FAD
OsPDS-His6 or OsZDS-His6 were denatured in dialysis buffer (see 3.2.1.1 and 3.2.1.2) for 10 min at 80 °C in order to release non-covalently bound FAD from the flavoenzymes. Protein was pelleted by centrifugation at 20000 x g for 10 min. FAD in the supernatant was quantified photometrically at 450 nm after establishing a FAD calibration curve. The percentage of flavinylation on a monomeric protein base was calculated from the FAD concentration in the supernatant and the initial protein concentration determined according to 3.2.5.2.
3.3 Chromatography
3.3.1 High performance liquid chromatography
Analytical carotenoid samples were dissolved in 40 µl CHCl3:methanol (2:1, v/v) and 2 – 5 µl were analyzed using a Prominence UFLC XR separation module equipped with a SPD-M20A photodiode array detector (Shimadzu). The column temperature was 40 °C. Peak area integration and data analysis was carried out using the Shimadzu software LabSolutions. For quantification of carotenoids, the HPLC system was calibrated with β-carotene. For PDS assays, molar extinctions coefficients for the all-trans species were used (Britton et al., 1995): 15-cis-phytoene (285 nm) = 68125 l mol-1 cm-1; 9,15-di-cis-phytofluene (350 nm) = 73300 l mol-1 cm-1; 9,15,9’-tri-cis-ζ-
Methods
43
carotene: 400nm = 138000 l mol-1 cm-1. For ZDS assays, values were estimated based on the coefficients published for the trans-carotenoid and the influence of cis-configuration in lycopene isomers according to Hengartner et al. (1992): 9,9’-di-cis-ζ-carotene (400 nm) = 97000 l mol-1 cm-1; 7,9,9’-tri-cis-neurosporene (433 nm) = 108,000 l mol-1 cm-1; 7,9,7’,9’-tetra-cis-lycopene (440 nm) = 100840 l mol-1 cm-1. All other carotenoids were quantified based on molar extinction coefficients published for the trans-configured species (Britton et al., 1995).
HPLC system 1 for PDS assays and ZISO in vitro and in vivo assays: Samples were separated on a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / tert-butyl methyl ether (TBME) (1:1, v/v) and B: methanol / TBME / water (5:1:1, v/v/v). The flow rate was 0.7 ml min-1. Separation started at 60 % A and increased linearly to 86 % A within 6.5 min, followed by 2 min of reequilibration.
HPLC system 2 for ZDS assays: Samples were separated on an Accucore C30 column (150 mm x 3.0 mm, 2.6 µm; Thermo Scientific) with the solvent system A: methanol / TBME (1:1, v/v) and B: methanol / TBME / water (5:1:1, v/v/v). The flow rate was 0.7 ml min-1. Separation started at 40 % A and increased linearly to 80 % A within 8 min, followed by 2 min of reequilibration.
HPLC system 3 for ZISO in vivo assays upon co-expression with PDS and ZDS: Samples were separated on a Nucleosil C18 100-5 (150 mm x 4.6 mm, 5 µm; Macherey-Nagel) with an isocratic flow of acetonitrile at 1.4 ml min-1.
HPLC system 4 for purification of ζ-carotene isomers and 9,15-di-cis-phytofluene from
tangerine tomato: Samples were separated on a YMC Carotenoid C30 column (250 mm x 10 mm, 5 µm; YMC) with an isocratic flow of methanol / TBME (4:1, v/v) at 2.0 ml min-1.
HPLC system 5 for purification of prolycopene and proneurosporene from tangerine
tomato: Samples were separated on a Nucleosil C18 100-10 (250 mm x 4.6 mm, 10 µm; Macherey-Nagel) with an isocratic flow of acetonitrile / water (98:2, v/v) at 1.2 ml min-1.
HPLC system 6 for CRTISO in vitro assays and all-trans- and 9-cis-neurosporene
purification: Samples were separated on a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / TBME (1:1, v/v) and B: methanol / TBME / water (5:1:1, v/v/v). The flow rate was 0.75 ml min-1. Separation started at 0 % A and increased linearly to 100 % A within 20 min. Final conditions were maintained for 4 min, followed by 2 min of reequilibration.
HPLC system 7 for analysis of CCD assays with phytofluene, ζ-carotene, prolycopene,
proneurosporene: Samples were separated on a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / TBME (4:1, v/v) and B: methanol / TBME / water (30:1:10, v/v/v). The flow rate was 0.6 ml min-1. Separation started at 0 % A and increased linearly to 60 % A within 20 min and to 0 % A within 5 min. Conditions were maintained for 9 min, followed by 6 min of reequilibration.
HPLC system 8 for CCD assays with 9-cis-lycopene and all-trans-lycopene: Samples were separated on a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / TBME (4:1, v/v) and B: methanol / TBME / water (5:1:1, v/v/v). The flow rate was 0.6 ml min-1. Separation started at 0 % A and
Methods
44
increased linearly to100 % A within 24 min. Conditions were maintained for 4 min, followed by 6 min of reequilibration.
HPLC system 9 for CCD assays with 9-cis-neurosporene: Samples were separated on a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / TBME (4:1, v/v) and B: methanol / TBME / water (30:1:10, v/v/v). The flow rate was 0.6 ml min-1. Separation started at 0 % A and increased linearly to100 % A within 20 min. Conditions were maintained for 4 min, followed by 6 min of reequilibration.
3.3.2 Extraction and purification of carotenoids from tangerine tomato and
carotenoid-containing bacteria
Total carotenoid extraction from from bacteria or plants: Either bacterial cell pellets or tomato fruit tissue that was previously homogenized in a blender was extracted in the dark with acetone under sonication (Branson Digital Sonifier, USA) until sufficient decoloration was achieved. The acetone extract was mixed with 1/10 volume of petroleum ether / diethyl ether (2:1, v/v) in a separating funnel. Water was added for partitioning of the carotenoids into the epiphase until a clear phase separation was achieved. The epiphase was collected and dried under vacuum, dissolved in an appropriate volume of CHCl3/methanol (2:1, v/v) and subjected to chromatography required for isolation of the desired carotenoid as follows.
Purification of phytoene from transgenic E. coli containing the plasmid pPhytoene_PS
(see 2.3): The phytoene extract from E. coli was applied on a thin layer silica gel plate 60 F254 (Merck) and developed sufficiently with petroleum ether / diethyl ether (4:1, v/v). The running front containing the phytoene was scrapped and phytoene was eluted with five times 2ml acetone. The eluate was dried under vacuum and phytoene was stored in petroleum ether at - 20 °C in the dark.
Purification of ζ-carotene isomers from transgenic E. coli containing the plasmid pz-
carotene (see 2.3): The extract from ζ-carotene producing E. coli was applied on a silica TLC plate and developed sufficiently with petrolether / diethylether / acetone (4:1:1, v/v/v). The running front, containing the ζ-carotene (and its precursors phytoene and phytofluene), was scrapped and ζ-carotene was eluted from the silica with five times 2 ml acetone. The eluate was dried under vacuum and resuspended in CHCl3/methanol (2:1, v/v). ζ-carotene isomers were isolated with HPLC system 4 (see 3.3.1).
Purification of all-trans-neurosporene from Rhodovulum sulfidophilum (Hagemann et
al. (1996); kindly provided by Nasser Gad’on, University of Freiburg, Microbiology): The carotenoid extract was separated with HPLC system 6 (see 3.3.1) and neurosporene was collected.
Purification of carotenes from tangerine tomato: Total carotene extracts from tangerine tomato (kindly provided by Prof. Dr. Joseph Hirschberg, Hebrew University Jerusalem, Israel) fruits were applied on a silica TLC plate and developed sufficiently in pure petroleum ether. Three fractions were scrapped and eluted with acetone, listed by weaker adsorption: 1) a colorless 9,15-di-cis-phytofluene fraction identified by green fluorescence upon excitation with 350 nm UV light, 2) a bright yellow fraction of 9,9’-di-cis-ζ-carotene below fraction 1 and 3) a dark orange proneurosporene / prolycopene fraction close to the starting point. 9,15-di-cis-phytofluene and 9,9’-di-cis-ζ-carotene were further purified using HPLC system 4 (see
Methods
45
3.3.1). Proneurosporene and prolycopene were further purified using HPLC system 5 (see 3.3.1). The isomeric state of these carotenoids in tangerine tomato fruit was reported by Clough and Pattenden (1979) using nuclear magnetic resonance analysis.
3.3.3 Effective liposomal concentrations of carotenes, decylplastoquinone
and norflurazon
In the PDS assay established by Gemmecker et al. (2015), liposomes are used to accommodate the highly hydrophobic substates phytoene during liposome formation. The second substrate decylplastoquinone and the inhibitor NFZ are added after liposome formation from organic solvent solutions (see 3.2.2.1), both being hydrophobic and partially partitioning into the lipid layer. It is assumed that PDS as a monotopic membrane protein only gains access to its substates and NFZ via the lipid bilayer. Therefore, effective concentrations of besaid compounds – meaning their concentration in the lipid bilayer volume of liposomes (ceff) – are relevant. Therefore, in the framework of the dissertation of Dr. S. Gemmecker (University of Freiburg, 2015) incorporation efficiencies into liposomes were determined according to procedures of Degli Esposti et al. (1983). The incorporation efficiencies were: 100 % for carotenes, 55 % for DPQ and 86 % for NFZ. Given the partial volume of phosphatidylcholine (PC) of 0.997 ml g-1 (Greenwood et al., 2006) and the presence of 0.5 mg PC per assay (see 3.2.2.1), the compounds are present in a lipid bilayer volume of 0.5 µl. Accordingly, ceff is calculated as follows: ceff [mM] = (compound [nmol] / 0.5 µl) * x, with “n” being the amount of carotene, DPQ or NFZ added into the assay and “x” being the incorporation efficiency of the compound given above.
3.3.4 Liquid chromatography – mass spectrometry
3.3.4.1 Identification of apocarotenoids and carotene deuteration analysis
Non-volatile cleavage products produced by CCDs were identified by LC-MS using a Dionex UltiMate 3000 UPLC coupled to a Q-Exactive mass spectrometer (Thermo Fisher Scientific). Sample separation was achieved with a Hypersil Gold C18 UPLC-column (150 x 2.1 mm i.d., 1.9 µm) and the solvent system A, 0.05 % (v/v) formic acid in H2O and B, 0.05 % (v/v) formic acid in acetonitrile. Initial conditions were 70 % B for one minute, followed by a gradient to 100 % B within four minutes. The final conditions were maintained for ten minutes, all at a flow-rate of 0.5 ml min-1. Ionization of apocarotenoids was achieved with atmospheric pressure chemical ionization (APCI) and analyzed in the positive mode. Nitrogen was used as sheath and auxiliary gas, set to 20 and 10 arbitrary units, respectively. The vaporizer temperature was set to 350 °C and the capillary temperature was 320 °C. The spray voltage was set to 5 kV and the normalized collision energy (NCE) to 35 arbitrary units. For data analysis the TraceFinder (3.1) software and authentic apocarotenoid standards were used.
3.3.4.2 Identification of C35 carotenoids
PDS desaturation products originating from 15-cis-nor-phytoene (15-cis-1´,2´,3´,16´,17´-penta-nor-phytoene) were identified by LC-MS using a Dionex UltiMate 3000 UPLC coupled to a Q-Exactive mass spectrometer (Thermo Fisher Scientific). Sample separation was achieved with a YMC carotenoid C30 column (150 mm x 3 mm, 5 µm; YMC) with the solvent system A: methanol / TBME / water (5:1:1, v/v/v) in 0.1 % (v/v) formic acid and B: methanol / TBME (1:1, v/v) in 0.1 % (v/v) formic
Methods
46
acid. Conditions started at 50 % B, increased linearly to 60 % B within 15 min and to 100 % B within further 5 min. Final conditions were maintained for 10min, all at a flow-rate of 0.6 ml min-1. Ionization of apocarotenoids was achieved with atmospheric pressure chemical ionization (APCI) and analyzed in the positive mode. Nitrogen was used as sheath and auxiliary gas, set to 20 and 10 arbitrary units, respectively. The vaporizer temperature was set to 350 °C and the capillary temperature was 320 °C. The spray voltage was set to 5 kV and the normalized collision energy (NCE) to 35 arbitrary units. For data analysis the TraceFinder (3.1) software and authentic apocarotenoid standards were used.
3.3.4.3 Identification of protein-bound nucleotide cofactors
Sample separation was achieved with a Hypersil Gold C18 UPLC column (150 x 2.1 mm i.d., 1.9 µm) and the solvent system A: 50 mM ammonium acetate in 1 % (v/v) formic acid in H2O and B: 1.7 mM ammonium acetate in H2O. The flow rate was maintained at 0.5 ml min-1. Conditions started at 100 % A, decreased to 50 % A within 10 min and finale conditions were maintained for 5 min. Ionization of mono-/dinucleotide cofactors was achieved with electrospray ionization (ESI) and analyzed in the positive mode. Nitrogen was used as sheath and auxiliary gas, set to 40 and 10 arbitrary units, respectively. The vaporizer temperature was set to 300 °C and the capillary temperature was 350 °C. The spray voltage was set to 3.5 kV and the normalized collision energy (NCE) to 25 / 40 arbitrary units. For analysis of the full MS and data dependant MS2 data the TraceFinder 3.1 software was used. For cofactor identification, the following combinations of precursor ions [M+H]+ in MS1 and fragment ions in MS2 (in brackets) were established with authentic, purified standards: FAD, MS1 m/z 786.16441 (348.1, 439); FMN, MS1 m/z 457.11689 (359.2, 439.1); NAD+, MS1 m/z 664.11640 (524, 542.1); NADH, MS1 m/z 666.13205 (348.2, 649.2); NADPH, MS1 m/z 745.09055 (428.1, 729.1).
3.3.5 Gas chromatography – mass spectrometry
Volatile cleavage products such as 6-methyl-5-hepten-2-one and geranylacetone were collected by solid phase micro extraction (SPME; PDMS, 100 µm; Supelco). The fiber was exposed to the in vitro assay head space for 15 min and thermodesorbed in the injector of the Trace GC coupled to a Trace DSQ II mass spectrometer (Thermo Fisher Scientific). Separation was achieved on a 30 m Zebron ZB-5 column 0.25 mm i.d., 0.25 µm film thickness (Phenomenex). The initial temperature of 50 °C was maintained constant for five minutes, followed by a ramp of 25 °C min-1 to a final temperature of 280 °C which was maintained for five minutes. The helium carrier gas flow rate was 1 ml min-1 and the injector temperature was set to 220 °C. Electron impact ionization (EI) was used at an ion source potential of 70 eV and a source temperature of 200 °C. Spectra were matched to the NIST (2.0) database using the Excalibur software. Additionally, standards of geranylacetone and 6-methyl-5-hepten-2-one were used (Sigma).
3.4 Cryo scanning electron microscopy
The liposomes with bound OsPDS-His6 were isolated from membrane binding assays (see 3.2.6) and concentrated by ultracentrifugation at 150000 x g for 30 min. The enzymatic activity of PDS was verified by the observed yellow color of the liposomes upon conversion of phytoene to ζ-carotene. The isolated liposomes of four PDS in
vitro assays (see 3.2.2.1) with 50 µg PDS each were combined to 40 µl of PDS-
Methods
47
liposome suspension (in 12.5 mM MES-KOH, pH 6.0). After the addition of 30 % (v/v) glycerol, suspension was pipetted into the 50 µm cavity of two 3 mm aluminum specimen carriers before sandwiching them. The assembly was frozen using the HPM 100 (Leica) freezer, transferred into the Freeze Fracture System EM BAF060 (Leica) and fractured. Samples were visualized directly in a Zeiss Auriga SEM system (- 115 °C, 5 kV acceleration voltage, 20 µm aperture using the inlens SE detector) or after 5 min of sublimation at - 105 °C in order to display liposomal surfaces. Sublimated as well as untreated samples were coated with 2.5 nm of platinum/carbon and backed with 4 nm of carbon at a gun angle of 45° and under steady stage rotation with 40 rpm.
3.5 Homology modeling and in silico docking of OsZDS-His6
Homology modeling of Oryza sativa ZDS (XP_015646524.1), deprived of its N-terminal plastid target peptide and equipped with an N-terminal methionine, was carried out using the SWISS-MODEL protein structure homology modeling server in automated mode with the PDS structure as template (Brausemann et al., 2017). The obtained ZDS structure represented the apoenzyme. Riboflavin as a precursor of the ZDS redox cofactor FAD was docked into the ZDS structure using the SwissDock ligand docking web service. The thermodynamically most favorable holoenzyme structure, i.e. the structure with the lowest free enthalpy ΔG, obtained from in silico docking was chosen for structural analysis of OsZDS.
3.6 Mathematical modeling of PDS time courses and kinetics
General procedures. The model consists of a set of ordinary differential equations (ODEs) for the contributing processes following mass action kinetics. The maximum likelihood method is used to estimate parameters such that the model prediction optimally describes the observed PDS time courses. Setting up the likelihood,
normally distributed noise is assumed. The cost function χ�(θ) = ∑ (��(�, ))���� needs to
be minimized in order to maximize the likelihood. Here, θ denotes the model parameters, the index i runs over the data points taken at time ti with value xi and uncertainty σ� and x(t�, θ) is the model prediction at time t� . The nonlinear minimization of the cost function is performed by a trust region optimizer (Nocedal and Wright, 1999). Derivatives of the cost function, upon which the optimizer relies, are provided by sensitivity equations. Prior knowledge about parameter values, e.g. values of the initial states, are incorporated by either fixing the parameter value or adding a penalty to the cost function via a quadratic prior function. In general, the cost function can have several local optima, besides the global optimum. In order to find the global optimum a multistart approach is performed by seeding the optimization in different points of the parameter space. The ODEs and sensitivity equations are integrated with the lsodes solver (Soetaert et al., 2010). Identifiability of the parameters and their confidence intervals are determined by the profile likelihood method (Raue et al., 2009). The model was implemented using the dMod package for dynamic modeling in R (Kaschek et al., 2016). Data preprocessing. For PDS time courses of the conversion of phytoene and phytofluene, the amounts of phytoene, phytofluene and ζ-carotene were measured over time. The experiments were conducted in triplicate. Uncertainties for the computed mean values were first estimated by a maximum likelihood method
Methods
48
combining the empirical mean values and variances with an error model. However, additional fluctuations between neighboring time points, larger than those represented by the replicates, were observed. They cannot be captured by the error model described above, but would lead to an underestimation of the derived parameter profiles and uncertainties. Therefore, the uncertainty parameters of the error model were estimated together with the other model parameters, including the log(σ�)-term originally contained in the log-likelihood, leading to a new cost function:
−2 log L (θ) = ��x�(θ) −x��σ�(θ) ��
�+ log (σ�(θ)�)
The uncertainty parameters σ� include a relative and an absolute contribution for each observable, e.g. σ[!] =σ[!]#$% ∙ [p] + σ[!]()* and may vary between the different
reaction time courses. The relative normalizations of phytoene, phytofluene and ζ-carotene measurements were investigated by a preceding optimization. It is based on conservation of mass, i.e. the total sum of carotenes is conserved during reaction time courses. Such normalization is needed because of inaccuracies during carotene quantification. The molar extinction coefficient is known for 15-cis-phytoene but not for 9,15-di-cis-phytofluene and 9,15,9’-tri-cis-ζ-carotene. Therefore, the molar extinction coefficients for the all-trans species of phytofluene and ζ-carotene are used as approximation. Scaling parameters s,!, s,!- and s,. for phytoene, phytofluene and ζ-carotene,
respectively, were estimated by minimizing the discrepancy s,! ∙ [p]�/� +s,!- ∙ [pf]�/� +s,. ∙ [z]�/� − c
at all time points t� for an arbitrary constant c. Since the absolute scale incorporated
by the constant c is unknown, the ratios l3 = *,4*,5 and ratios l� = *,�
*,5 including their
confidence intervals are estimated by a least squares approach. The scaling parameters s! , s!- and s. used for phytoene, phytofluene and ζ-carotene in the
model prediction are related to the ratios via s! = l� ∙ s!- and s. = %4%� s!- and the
constraints on l3 and l� are added via a quadratic prior to the cost function. For additional information about data preprocessing, see supplemental data.
3.7 Deduction of non-covalent interactions from changes in electron
density gradients
A single point ab initio quantum mechanical calculation (density functional theory,
6-31G* model chemistry) was performed on the complex of interest, the PDS – NFZ
cocrystal structure (Brausemann et al., 2017). Non-covalent interactions were
deduced from changes in the gradient of the electron density between atoms
according to the methods described by Johnson et al. (2010). The system for
calculations consisted of only 16 flavin and PDS residues with a total of 313 atoms
that are in direct contact with norflurazon (irrelevant parts of each residue
disconsidered), representing a pared down representation of the PDS – NFZ binding
site.
Results
49
4 Results
4.1 Biochemical characterization of phytoene desaturase PDS
4.1.1 Association and oligomerization of OsPDS-His6 at liposomal surfaces
PDS associates with plastid membranes to access its hydrophobic,
membrane-soluble carotene substrates and plastoquinone. As suggested by
hydropathy plots, the protein has no transmembrane helices. Moreover, it can
be natively purified as soluble in the absence of detergents and associates
spontaneously to liposomes to convert phytoene to ζ-carotene (Gemmecker
et al., 2015). Accordingly, PDS is assumed to represent a monotopic
membrane protein, interacting with only one lipid leaflet. Furthermore,
experiments pointed towards homotetrameric assembly of OsPDS-His6 in
solution (Fig. 1-3 B). It remained unclear whether homotetramers represent the
catalytically active form at membrane surfaces.
4.1.1.1 Monotopic association of OsPDS-His6 with liposomes
In order to better characterize the mode of membrane association, the
interaction of OsPDS-His6 with phosphatidylcholine liposomes was examined.
First, it was tested whether membrane interaction required only the
phospholipid bilayer or whether the simultaneous presence of substrates (DPQ
and phytoene) was required (Fig. 4-1 A). As depicted in lane “1 L”, OsPDS-His6
readily attached to phosphatidylcholine liposomes containing the substrates.
A small portion of the protein formed aggregates that appeared in the pellet
upon centrifugation (lane 1 P). In the absence of liposomes, OsPDS-His6
formed aggregates (lane 2 P) since the assay buffer contained neither
imidazole nor glycerol, both promoting protein solubility in the absence of
membranes (Gemmecker et al., 2015). Lane “3 L” shows that OsPDS-His6
readily attached to membranes in the absence of substrates. Second, it was
tested whether PDS membrane association mainly relies on electrostatic
interactions or rather on hydrophobic interactions. Washing proteoliposomes
with a high-salt buffer did not detach PDS, as the amount of protein
recovered was very similar as upon washing with a low-salt buffer (Fig. 4-1 B,
Results
50
compare lanes 1 and 2). This points towards hydrophobic interaction of the
protein with the membrane and accordingly, PDS could only be released
from liposomes by solubilization with detergents (not shown). The OsPDS-His6
interaction with membranes requires only phospholipid bilayers and is mainly
mediated by hydrophobic interactions with the membrane core.
Fig. 4-1 SDS-PAGE analysis of OsPDS-His6 liposome binding assays.
(A) Dependency of OsPDS-His6 membrane association on substrate-containing
liposomes (lane 1) and substrate-free phosphatidylcholine liposomes (lane 3).
Fraction L represents liposome-bound OsPDS-His6 and fraction P represents pelletable
aggregates of unbound enzyme. Conducting the assay in the absence of liposomes
led to complete OsPDS-His6 precipitation (lane 2). (B) Characterization of the mode
of interaction between OsPDS-His6 and liposomes. Lane 1 represents protein bound
to liposomes washed with 100 mM KCl, lane 2 washed with 500 mM KCl.
4.1.1.2 Homooligomerization of OsPDS-His6 at liposomal membrane surfaces
Cryo scanning electron microscopy (cryo-SEM) was used to address the
question whether the PDS homotetramers found in solution (Gemmecker et
al., 2015; Fig. 1-3 B) are artifactual or rather represent the biologically active
form at membrane surfaces. The size of OsPDS-His6 in its active state at
membrane surfaces should be compared to the size of soluble OsPDS-His6
homotetramers previously investigated by negative staining. Additionally,
liposome fracture faces should reveal the presumed absence of membrane
spans.
21 3
L P L P L P
1 2A BL L
Results
51
Supporting monotopic membrane interaction, fracture faces of PDS
proteoliposomes capable of performing phytoene desaturation (Fig. 4-2 A, B,
black arrow in Fig. 4-2 B) did not support the presence of membrane spans.
Sublimation revealed the liposomal surface with OsPDS-His6 particles (Fig. 4-2
B, red arrows) that were 14.5 ± 1.9 nm in diameter (n = 30), whereof 2 nm are
due to Pt/C-coating. Accordingly, active OsPDS-His6 at liposomal surfaces is
12.5 nm ± 1.9 nm in size. This corresponds well with the reported size of soluble
homotetramers of 11.8 ± 1.3 nm (Gemmecker et al., 2015).
Fig. 4-2 Freeze fracture electron microscopy of OsPDS-His6 proteoliposomes.
(A) Membrane fracture face of OsPDS-His6 proteoliposome visualized by cryo
scanning electron microscopy. The outer fracture face boundary, surrounded by ice,
is indicated by a black arrow. (B) Membrane fracture face (surface/fracture face
boundary indicated by black arrow) and membrane surface with associated OsPDS-
His6 particles (red arrows) exposed upon ice sublimation.
In summary, cryo-SEM analysis corroborated the notion that PDS is a
monotopic enzyme being present as homotetramer in its active state on
membrane surfaces. In accordance with this, PDS monomers were shown to
be unflavinylated and enzymatically inactive (Gemmecker et al., 2015).
4.1.2 Regio-specificity of carotene desaturation by OsPDS-His6
PDS catalyzes a highly regio-specific reaction. No carotene desaturation at
positions other than C11-C12 and C11’-C12’ has ever been reported. It
remains elusive how the correct positioning of the reaction sites relative to the
PDSA B
200 nm
Results
52
active center is achieved. In VP14, a 9-cis-epoxy-carotenoid cleavage
dioxygenase, the 9-cis-configured double bond acts as a restrictor arresting
the carotenoid in the correct position relative to the active site (Messing et al.,
2010). Alternatively, the long carotenoid substrate might be introduced into
the substrate cavity until reaching the cavity end that acts as restrictor. In this
case, the substrate length might mediate correct positioning.
The modeling of 15-cis-phytoene in its extended conformation into the
substrate cavity of OsPDS-His6 supports both scenarios (Fig. 4-3). Charged
amino acid residues at the back end of the hydrophobic substrate cavity
might limit phytoene introduction by repulsive forces (Fig. 4-3 B). Notably,
displacement of coordinated water molecules from the cavity would be
required upon phytoene binding to properly align the C11-C12 bond with the
isoalloxazine (Fig. 4-3 B). Alternatively, the bent topology of the substrate
channel in vicinity of the isoalloxazine might arrest the kinked 15-cis double of
phytoene and mediate adequate positioning (Fig. 4-3 A, B).
Fig. 4-3 Hydrophobic substrate cavity of OsPDS-His6.
(A) The hydrophobic channel of OsPDS-His6 is depicted and colored-coded
according to its electrostatic surface potential from - 5 to 5 kbT/e. The channel-
forming residues are shown as sticks, FAD is given as stick and balls. (B) The channel
topography was determined with the Caver 3.0 software. 15-cis-phytoene is shown in
C
BA
Results
53
its approximate size. The reaction sites of desaturation (C11-C12; C11’-C12’) are
highlighted in red, the sites of isomerization (C9-C10; C9’-C10’) with triangles.
Hydrophobic and hydrophilic cavity sections as well as the position of the redox-
active isoalloxazine of FAD are marked. Water molecules are given as blue circles.
(C) Waters molecules in the charged channel part are shown as spheres and
numbered as in (B). The coordinating amino acids, inter alia Thr508 and Tyr506, are
shown as sticks. Figures are from Brausemann et al. (2017).
4.1.2.1 Regio-specificity with 15-cis-penta-nor-phytoene (C35)
To elucidate the mode of substrate positioning, a C5-truncated variant of 15-
cis-phytoene (15-cis-1’,2’,3’,16’,17’-penta-nor-phytoene; hereafter 15-cis-nor-
phytoene; Fig. 4-4 A) was incorporated into liposomes and used as a
substrate. Assuming the 15-cis-configuration to be decisive (scenario I),
OsPDS-His6 would maintain specificity for C11-C12 and C11’-C12’, irrespective
whether the full length or the truncated half side of 15-cis-nor-phytoene is
introduced into the cavity (Fig. 4-4 A, scenario I). Accordingly, this asymmetric
substrate would be desaturated twice, yielding an end product with a
chromophore and UV/VIS spectrum identical to that of 9,15,9’-tri-cis-ζ-
carotene. Assuming that the cavity back end is crucial (scenario II), the regio-
specificity of desaturation is expected to be disturbed when the truncated
half side of 15-cis-nor-phytoene is introduced (Fig. 4-4 A, scenario IIb). Being
shorter, the C11’-C12’ bond would slip beyond the redox-active isoalloxazine
and instead, the central triene around C15=C15’ would occupy this position.
Consequently, carotene desaturation would be impossible. In contrast, regio-
specificity for C11-C12 would be maintained with the untruncated half and
carotene desaturation could occur (Fig. 4-4 A, scenario IIa). In scenario II, 15-
cis-nor-phytoene could only be desaturated once to yield a product with a
pentaene chromophore identical to that of 9,15-di-cis-phytofluene.
Results
54
Fig. 4-4 LC-MS analysis of desaturation products formed from 15-cis-nor-phytoene.
(A) Structure of 15-cis-1´,2´,3´,16´,17´-penta-nor-phytoene (15-cis-nor-phytoene, C35).
The desaturation sites C11-C12 and C11’-C12’ and the central C15-C15’ double
bond are labeled. The single bonds to be desaturated, i.e. to be positioned correctly
above the isoalloxazine are indicated by arrows. If substrate positioning is mediated
by the 15-cis double bond (I), two double bonds can be formed. With the substrate
cavity end being decisive, substrate length would be crucial allowing only one
desaturation reaction to take place (II). (B) Product formation from 15-cis-nor-
phytoene was assessed by LC-MS and detected photometrically at 275 – 400 nm
(top panel). The UV/VIS spectra of substrate and products are shown in the central
panel. The bottom panel shows the corresponding MS1 spectra, [M+H]+ masses, the
derived sum formulas and the mass deviation.
285 nm 348 nm366
331
398 nm
423378
295
400 450 500 550m/z
102030405060708090
100
Rel
ativ
e A
bun
dan
ce 477.44563C35H57
0.31184 ppm
0
m/z420 460 500 540
475.43002
0.39311 ppmC35H55
468 472 476m/z
473.41434
0.33579 ppmC35H53
18.21 min 20.68 min 24.06 min
min17 18 19 20 21 22 23 24 25
18.17I
20.63
II24.01m
AU
(275
-40
0n
m)
I*22.36
II*22.92
A
B
1 4‘
11‘12‘12
11
15 15´
I
IIa IIb
15-cis-nor-phytoene
Results
55
The products formed by OsPDS-His6 from 15-cis-nor-phytoene were analyzed
by LC-MS. The substrate 15-cis-nor-phytoene revealed an UV/VIS spectrum
resembling the one of 15-cis-phytoene and the quasimolecular ion [M+H]+
corresponded to the calculated exact mass of C35H57 (Fig. 4-4 B left). The
molecular mass of the major desaturation product I corresponded to C35H55. It
had thus undergone one desaturation reaction, and its UV/VIS spectrum
strongly resembled the one of 9,15-di-cis-phytofluene, revealing the presence
of a pentaene chromophore (Fig. 4-4 B, middle). The minor product I* with a
similar UV/VIS spectrum and the same molecular mass represents a geometric
isomer of product I. Two additional desaturation products, II and II*, were
formed at lower levels and shared a UV/VIS spectrum strongly resembling the
one of 9,15,9’-tri-cis-ζ-carotene. This indicates the presence of a heptaene
chromophore. The molecular mass of II and II* corresponded to C35H53,
implying two desaturation reactions of 15-cis-nor-phytoene (Fig. 4-4 B right).
Conclusively, the identification of a desaturation product with two introduced
double bonds, i.e. the loss of four mass units for [M+H]+ (from C35H57 to C35H53),
and the ζ-carotene-like heptaene chromophore and UV/VIS spectrum
support that the 15-cis-configuration of phytoene is decisive to attain regio-
specificity in PDS. However, it is to be noted that this is not the main product.
The intermediate with one introduced double bond (C35H55 for [M+H]+)
exhibiting a phytofluene-like UV/VIS spectrum predominates. This may be due
to the truncation hindering substrate binding at this end.
4.1.2.2 Regio-specificity upon mutation of the substrate cavity back end
As depicted in Fig. 4-3 B, Thr508 and Tyr506 reside at the postulated hydrophilic
cavity back end coordinating water molecules. In order to scrutinize if these
residues contribute to the regio-specificity of desaturation (scenario II, see
4.1.2.1), the mutations Tyr506Phe and Thr508Val were simultaneously introduced.
We hypothesized that introducing hydrophobic residues would elongate the
cavity, prevent water coordination and result in erroneous regio-specificity if
the cavity back end was decisive. However, HPLC analysis revealed that 15-
Results
56
cis-phytoene was converted into canonical 9,15-di-cis-phytofluene and
9,15,9’-tri-cis-ζ-carotene, albeit at lowered activity (< 5% activity of the wild
type enzyme; data not shown). Thus, regio-specificity persisted. This
corroborates the relevance of the cis-configured central double and the
bent substrate cavity topology. The fact that Tyr506 is conserved in PDS
enzymes whereas position 508 can be occupied by hydrophilic as well as
hydrophobic amino acids (see protein alignment in Fig. 4-16) adds to the
notion that the cavity back end is of minor relevance in this respect.
4.1.3 Reaction mechanism of carotene desaturation in OsPDS-His6
The structure of the bacterial phytoene desaturase CrtI, a flavoprotein that is
inhomologous to PDS, has been elucidated and a reaction mechanism was
postulated (Schaub et al., 2012). In short, the involvement a catalytic triad of
acidic and basic amino acid residues was proposed that activated hydride
abstraction and carbocation formation. During the proposed carotene
desaturation mechanism, protons are supplied via the acidic residue, as
corroborated by the incorporation of deuterium from heavy water (D2O).
The analysis of the PDS structure revealed that the FAD-containing active
center lacks functional residues that could form such a catalytic triad. There
are only two charged residues in less than 8 Å distance from the isoalloxazine
that could initiate an acid-base type mechanism of catalysis: His159,
potentially acting both as a base and an acid due to its neutral pK, and the
basic Arg300 (Fig. 4-5 A). Both residues are conserved in PDS enzymes (Fig. 4-
16). However, a direct interaction of His159 and the carotene appears unlikely
since it is not in a direct contact with the substrate cavity but localized
beneath the isoalloxazine (Fig. 4-5 A). The position of Arg300 might allow direct
interaction with the reaction site whereas Lys142, Glu451 and Glu542 are most
likely too distant (Fig. 4-5 A). Arg300 and His159 were exchanged individually for
uncharged amino acids by site directed mutagenesis (Arg300Ser, Arg300Thr,
His159Phe). The mutant enzymes exhibited catalytic activity, albeit at lower
Results
57
levels. This indicates that Arg300 and His159 are not catalytically essential, i.e.
not involved in acid-base catalysis of carotene desaturation.
This lack of functional active center residues is unprecedented in
flavoproteins, particularly in those catalyzing the formation or rupture of more
than one stable chemical bond. FAD occurs in a plenitude of redox states
and is thus able to mediate a variety of reaction mechanisms. Taking into
account that PDS catalyzes simultaneous trans-desaturation of phytoene at
position C11-C12 and trans-to-cis isomerization at position C9-C10, two “flavin
only” reaction mechanisms for PDS are conceivable. The redox-reactive N1-
N5 isoalloxazine functionalities might act as the sole catalyst in carotene
desaturation (Fig. 4-5 A and B; for details, see Brausemann et al., 2017). Since
acidic amino acids are catalytically involved, no proton incorporation from
external sources into the carotene product is postulated (Fig. 4-5 B).
In order to verify the absence of acid-base mechanisms, phytoene
desaturation was carried out in reaction buffers prepared in D2O and
deuterium incorporation into ζ-carotene was monitored by LC-MS (Fig. 4-5 B,
C). Canonical 9,15,9’-tri-cis-ζ-carotene was formed both in buffers containing
D2O or H2O, as witnessed by the UV/VIS spectra (Fig. 4-6 A), the same [M+H]+
mass of 541.47678 ± 5 ppm corresponding to C40H61 (Fig. 4-6 B, C) and the
same mass for the M+1 signal that is due to 13C incorporation. Thus, unlike the
situation found with CrtI (Schaub et al., 2012), there is no deuterium
incorporation so that an acid-base initiated catalysis of carotene
desaturation by PDS appears improbable. This result and the lack of charged
residues in proximity to the active site rather support a “flavin only” reaction
mechanism.
Results
58
Fig. 4-5 Active center of OsPDS-His6 and proposed “flavin only” reaction mechanisms
for phytoene desaturation.
(A) The active center of OsPDS-His6 is depicted with the substrate cavity surface
given as grey shadow and FAD as orange sticks. All charged residues within 8 Å of
the redox-active isoalloxazine moiety are given as sticks color-coded by elements
(red, oxygen; blue, nitrogen; grey, carbon). The redox-active N1-N5 functionalities of
the isoalloxazine are postulated as the sole catalysts of carotene desaturation and
isomerization in PDS. (B) “Flavin only” reaction mechanism involving carotene radical
formation. A complete transfer of redox equivalents yields a reduced flavin and a
trans double bond at C11-C12. Reverse electron transfer from the reduced flavin to
the double bond yields a carotene radical that is stabilized by delocalization
allowing rotation (trans-cis isomerization) at C9-C10. (C) “Flavin only” reaction
mechanism involving carotene carbocation formation. The flavin mediates hydride
abstraction, yielding a FAD anion and a delocalization-stabilized carbocation that
allows rotation of the molecule at C9-C10. The FAD anion catalyzes proton
abstraction leading to formation of a trans double bond at C11-C12. The sites of
desaturation (C11-C12) and isomerization (C9-C10) are given in red. Fl denotes FAD.
B
C
2
Glu451
His159
Arg300
Glu542
Lys142
A
Results
59
Fig. 4-6 LC-MS analysis of ζ-carotene formed in buffer containing heavy water.
(A) The formation of ζ-carotene was detected photometrically at 400 nm upon
incubation in buffers with heavy water (D2O) and H2O. The UV/VIS spectrum of the ζ-
carotene formed is given as inset. (B) XIC for [M+H]+ of ζ-carotene (calculated m/z =
541.47678 ± 5 ppm) verifying its formation in the absence and the presence of D2O
and indicating that no 2D was incorporated into the carotene. (C) The
corresponding MS1 spectra of ζ-carotene formed with H2O (left) and D2O (right) in
buffers reveal identical [M+H]+ and M+1 signals, excluding deuterium incorporation.
4.1.4 Kinetic mechanism of the bi-substrate reaction in OsPDS-His6
As detailed in 1.3.1.1, PDS catalyzes the desaturation of 15-cis-phytoene in a
bi-substrate reaction also requiring plastoquinone (PQ) as a directly
interacting co-substrate. PQ acts as diffusible terminal electron acceptor to
reoxidize the enzyme-bound FADred formed upon carotene desaturation
(Gemmecker et al., 2015). The PDS structure suggests that phytoene and PQ
occupy the same cavity but cannot bind simultaneously, both fully
occupying the cavity. This suggests an ordered ping pong bi bi mechanism in
which the two substrates bind in sequential order. Moreover, this implies that
min min12 13 14 15 16
14.13
D2OH2O
14.15
Rel
ativ
e ab
und
ance
C40H61
m/z = 541.47407- 541.47949
A B
C
535 536 537 538 539 540 541 542 543m/z
0
10
20
30
40
50
60
70
80
90
100
Rel
ativ
e A
bun
dan
ce
541.47664
542.47992
PDS + H2O[M
+H
]+
14.05-14.20 min
535 536 537 538 539 540 541 542 543m/z
541.47661
542.47989
PDS + D2O
0
10
20
30
40
50
60
70
80
90
100
Rel
ativ
e A
bun
dan
ce
14.05-14.20 min
399 nm
297
12 13 14 15 16
14.09
mA
U(4
00 n
m)
D2O
14.13
H2O
424379
M+1
[M+
H]+
M+1
Results
60
carotene desaturation can per se occur in the absence of PQ, i.e. carotene
desaturation and PQ reduction are two successive, independent reactions.
Consequently, OsPDS-His6 should be able to desaturate phytoene in the
absence of DPQ. In fact, when DPQ was omitted in PDS assays, 1.25 nmol of
flavinylated PDS monomers led to the formation of 0.66 ± 0.01 nmol
phytofluene and 0.61 ± 0.14 nmol ζ-carotene within 30 min (n = 2). This equals
1.88 nmol of formed double bonds which is not far off the protein
concentration used. Consequently, each OsPDS-His6 monomer would
introduce one single double bond in the absence of DPQ. These findings
support that phytoene and phytofluene desaturation per se is
thermodynamically favored and independent of PQ. PQ is only required to
reoxidize the enzyme-bound FADred and to enable repeated cycles of
carotene desaturation. Consequently, PQ supply enables the progression of
phytoene desaturation and controls it kinetically. Additionally, despite the
presence of oxygen, no carotene desaturation beyond equimolarity (see
above) was observed. This supports that oxygen cannot serve as an electron
acceptor (Gemmecker et al., 2015). This is in contrast to CrtI in which FAD
reoxidation is dependent on molecular oxygen (Schaub et al., 2012).
The ordered ping pong bi bi mechanism is further supported by the fact that
PDS catalyzes the desaturation of 15-cis-phytoene to 9,15,9’-tri-cis-ζ-carotene
via the intermediate 9,15-di-cis-phytofluene (see 1.3.1.1), the latter being
released in substantial amounts (Gemmecker et al., 2015). This pleads for the
independency of the two formally identical carotene desaturation reactions
that take place at phytoene half sides. The intermediate is released from the
enzyme before being rebound by its undesaturated half to be converted into
ζ-carotene. The structure of OsPDS-His6 supports this notion because every
monomeric PDS subunit possesses one FAD to catalyze a single carotene
desaturation reaction. The intermediate needs to be expelled into the
membrane to allow reoxidization by PQ (see above). This suggests that each
monomeric subunit within the PDS homotetramers can be independently
Results
61
active. This raises questions on the mechanistic relevance of homotetrameric
assembly of OsDPS-His6 at membrane surfaces (see 4.1.1.2).
Taken together, the data presented support that PDS employs the following
ordered ping pong bi bi mechanism: Phytoene is bound in the substrate
cavity and converted to phytofluene that is then released. PQ now occupies
the same cavity to reoxidize the FADred formed upon phytoene desaturation.
In a subsequent round of carotene desaturation, PDS then binds either
phytoene or the saturated half of phytofluene as substrate. Accordingly, PDS
represents a bifunctional phytoene and phytofluene desaturase, with both
carotenes competing for binding. The two-step desaturation reaction from
phytoene to ζ-carotene resembles a two-enzyme cascade with the
intermediate phytofluene being in a steady state (McClure et al., 1969). This is
to be considered upon kinetic characterization (see 4.2).
4.2 Kinetic characterization of PDS and mathematical modeling
The investigation of the kinetics of OsPDS-His6 in the established biphasic
liposomal assay has been defined as a main aim of this thesis. This should
allow scrutinizing the functional implications deduced from the enzyme
structure. In this context, the mechanistic relevance of homotetrameric
assemblies in the active state of the enzyme at membrane surfaces (see
4.1.1.2) and in crystallo is of special interest (see 4.1.4). Traditional kinetic
investigations complemented by mathematical modeling (in collaboration
with the team of Prof. Dr. Timmer, Department of Physics, University of
Freiburg) were employed towards a better understanding of the sub-
processes involved in PDS catalysis.
4.2.1 Basic characterization of the OsPDS-His6 reaction
Using the biphasic liposomal assay established for OsPDS-His6 by Gemmecker
et al. (2015), the dependency of the OsPDS-His6 reaction on the added
Results
62
enzyme amount, pH and temperature was investigated. An approximately
linear correlation with ζ-carotene formation was observed for up to ca. 100 µg
PDS per assay (Fig. 4-7 A)), with end product formation then being limited by
phytoene supply (> 80 % conversion). Phytofluene levels remained unaffected
at increasing OsPDS-His6 amounts. This is consistent with this intermediate
being in a steady state (McClure et al., 1969; see 4.1.4). Consequently,
increasing enzyme amounts favored only ζ-carotene formation. Regarding
temperature and the pH, phytofluene formation again remained fairly
unaffected presumably due to a steady state situation whereas ζ-carotene
formation showed a broad pH optimum at pH ≈ 6.0 (Fig. 4-7 B) and
temperature optimum close to 40 °C (Fig. 4-7 C). These optima defined the
standard conditions for OsPDS-His6 assays at a saturating plastoquinone
concentration (see 4.2.3; Fig. 4-7 legend).
Reaction time courses of the OsPDS-His6 reaction (Fig. 4-8 D) revealed a rapid
decrease in phytoene within the first 10 min of incubation, accompanied by
rapid formation of 9,15-di-cis-phytofluene and 9,15,9’-tri-cis-ζ-carotene. As is
typical of a two-step reaction, the intermediate phytofluene approached a
steady state situation after 5 min and formation of the end product ζ-
carotene set in with a lag phase as it depends on the availability of the
intermediate (McClure et al., 1969). Strikingly, after 30 min phytoene and
phytofluene conversion ceased although 30 % of phytoene were left
unconverted.
An approach to equilibrium attaining 50 % ζ-carotene might be an
explanation. Alternatively, OsPDS-His6 might undergo inactivation, as
frequently observed with purified enzymes (Copeland, 2000). In fact, the
addition of fresh enzyme during the plateau phase restarted phytoene
conversion, indicating that PDS inactivation had occurred (Fig. 4-7 D), and led
to an equilibrium of > 95 % ζ-carotene. In contrast, no additional ζ-carotene
was formed upon disturbing a potential equilibrium by the addition of
substrates (phytoene or DPQ) during the plateau phase. Moreover, the
Results
63
reverse reaction carried out with ζ-carotene and phytofluene in the presence
of DPQH2, produced by DPQ reduction with diaphorase (Yu et al., 2014), did
not result in detectable formation of saturated carotenes. In summary, this
supports that reverse reactions of the catalytic steps in PDS are negligibly slow
and that the equilibrium is far on the side of the end product.
Fig. 4-7 Basic characterization of the OsPDS-His6 reaction.
(A – C) protein, pH and temperature dependency of phytofluene and ζ-carotene
formation from phytoene. Circle, phytofluene; square, ζ-carotene. Data represent
the mean of duplicates (A, C) or triplicates (B) ± SEM. Data were fitted with a spline in
A and C and with the dibasic pH equation in B. Each experiment was carried out
using the optimum values of the respective non-variable parameters, e.g. pH 6.0, 37
°C in A, etc. These optimum values determined the standard conditions: 25 µg PDS
per assay, 10 mM phytoene, (≈ 0.2 x KM; see 4.2.3) 19.25 mM DPQ (≈ 14 x KM; see
4.2.3), pH 6.0, 37 °C at 10 min incubation. (D) Reaction time course of phytofluene
and ζ-carotene formation from phytoene. Triangle, phytoene; circle, phytofluene;
0 50 100 1500.0
0.1
0.2
0.3A B
25 30 35 40 45 500
2
4
6
8
Temp [°C]
v [n
mol
min
-1m
g-1]
pK=4.5
pK=8.5
C
v [n
mol
min
-1m
g-1]
0 10 20 30 40 50 600
1
2
3
4
5
6 + PDS
D
6.0
5.0
4.0
3.0
2.0
1.0
0.0
pHPDS [µg]
v [n
mol
min
-1m
g-1]
4 5 6 7 8 9
1
6
5
2
3
4
Car
oten
es[n
mol
]
Time [min]
Results
64
square, ζ-carotene. Data represent single measurements. Asterisks denote the
activation of phytofluene and ζ-carotene formation upon the addition of 25 µg of
fresh PDS during the plateau phase after 30 min. Data were fitted with a spline.
4.2.2 Mathematical modeling of OsPDS-His6 reaction time courses
As laid out in 4.1.4, PDS employs an ordered ping pong bi bi mechanism
comprising three per se independent reactions – phytoene desaturation,
phytofluene desaturation and plastoquinone reduction. Every monomeric
subunit within a PDS homotetramer can act independently despite the
observation that homotetramers are the minimal assembly required for
enzymatic activity and represent the active state at membrane surfaces (see
4.1.1.2). Thus, the relevance of these oligomers was doubtful.
Traditional Michaelis-Menten kinetics cannot capture and explain kinetic
phenomena encountered with homooligomeric enzymes. Therefore, a
mathematical model of the PDS reaction based on mass action kinetics was
envisioned that could describe OsPDS-His6 reaction time courses as well as
substrate concentration dependencies. Mathematical modeling of reaction
time courses would allow determining rate constants for the main processes,
enable a better understanding of the enzyme kinetics and potentially provide
a testable hypothesis on the functional relevance of homomers.
As detailed above, a model of the PDS overall reaction (Fig. 4-9) necessarily
comprises three fundamental, per se independent processes:
(i) the desaturation of phytoene (p) to phytofluene (pf)
(ii) the desaturation of phytofluene (pf) to ζ-carotene (z)
(iii) reoxidation of the intermediary electron acceptor FADred by
reduction of the oxidized terminal acceptor DPQ (Q)
Additionally, as witnessed by rapid loss of activity in vitro (see 4.2.1), a fourth
process needs to be considered for modeling of reaction time courses:
(iv) time-dependent enzyme inactivation
As established in Michaelis-Menten kinetics, the three catalytic main
processes consist at minimum of three sub-processes that represent equilibria
Results
65
of forward and reverse reactions: association and dissociation of enzyme and
substrate, desaturation and saturation of substrate as the catalytic step, as
well as dissociation and association of enzyme and product. The “monomeric
model” for the PDS reaction (Fig. 4-8 A) assumes, as laid out in 4.1.4, that each
monomer within the homotetramer acts independently regarding the main
catalytic processes (i – iii). Thus, intermediary phytofluene pf is expelled from
PDS into the hydrophobic liposome core, diffuses amidst the phytoene
molecules deposited into liposomes as initial substrate and will eventually be
bound and converted by an oxidized PDS subunit (the same one after
reoxidation by DPQ or a different one).
Alternatively, taking homotetrameric assemblies into account, the following
“substrate channeling model” is conceivable (Fig. 4-8 B): In crystallo, the
substrate channels of the homotetramer subunits point towards each other
with only few Å between the entrances (Brausemann et al., 2017). Thus, as
phytoene and phytofluene desaturation are formally identical reactions on
substrate half sides, one can intuitively assume that intermediary phytofluene
formed by one subunit can be directly channeled into an adjacent oxidized
one of the same homotetramer. This means that upon release from the first
subunit, this phytofluene population – termed nascent phytofluene pf* – is
restricted in diffusion occupying a membrane microdomain below the
homotetramer. Two fates of phytofluene pf* may coexist. The non-channeled
fate corresponds to the situation in the “monomeric model” in which pf* is in
any case released into the hydrophobic membrane core and then represents
freely diffusing pf (right side Fig. 4-9 B). In the channeled fate, pf* can be
rapidly channeled into another oxidized subunit within the same
homotetramer by substrate channeling to be more directly converted to ζ-
carotene (right side Fig. 4-8 B). Substrate channeling as a form of cooperation
between enzyme subunits requires various substrate cavities within short
distances to restrict diffusion (Wheeldon et al., 2016), a prerequisite that is met
by PDS homooligomers. It would facilitate and accelerate end product
formation and progression of the entire carotene desaturation pathway.
Results
66
Fig. 4-8 Kinetic schemes and models of the PDS overall reaction.
(A) Monomeric model: PDS monomeric subunits (rectangles) within the
homotetramer work independently. Orange/blue color denotes reduced/oxidized
half sides of phytoene (p), phytofluene (pf) and ζ-carotene (z) and the respective
redox state of the PDS-bound FAD. The overall reaction comprises the three main
processes phytoene desaturation (i), phytofluene desaturation (ii) and plastoquinone
reduction (iii) with the rate constants kp, kpf and krox, respectively. Each rate constant
encompasses three equilibria represented by the reaction arrows associated to
each of the three main processes as highlighted by shadowed areas: association-
dissociation of enzyme and substrate, desaturation-saturation of substrate and
dissociation-association of enzyme and product. All hydrophobic carotene
substrates and decylplastoquinone (Q) are soluble in the hydrophobic core of
liposomal membranes. (B) Substrate channeling model: It accounts for substrate
channeling between subunits within a homotetramer. Two populations and fates of
Membrane
QH2
kpf
kp
krox
(i)
(ii)
(iii)
A
Membrane
p
pf
z
Q
QH2
kdif
kp
kpf
kp
krox
(i)
(ii)
(iii)
B
kpf*
Q
kage
z
pf
pf
p
QH2
kage
kage kage
p p
pf*
pf* pf
z
zz
Q
QH2
pf
pf
p
Q
zpf *
pf*
pf*
Monomeric model Substrate channeling model
(iv)
(iv)
Results
67
phytofluene coexist. Left; nascent phytofluene (pf*) that is produced from phytoene
(p) can be restricted in its diffusion into the membrane upon release from the
enzyme, thus remaining in proximity to the homotetramer as indicated by the bent
arrow. It can be channeled into a second subunit of the same homotetramer
containing FADox, allowing rapid conversion to ζ-carotene (z) with the rate constant
kpf*. Right; pf* can alternatively diffuse into PDS-distant membrane areas with rate
constant kdif, then defining the population pf. From there it can be taken up and
converted into ζ-carotene (z) with rate constant kpf. The process kage, represents
enzyme inactivation (iv) which refers to both the reduced and oxidized state of PDS.
Both models were implemented into mathematical models, each
represented by a set of ordinary differential equations (ODEs). Based on mass
action kinetics, these allow simulating and describing the changes of all
reactants – namely p, pf, z, Q and FAD (representing the catalytic
components of each PDS subunit) – during PDS reaction time courses by
providing the initial amounts of reactants at t = 0 min (Table 3).
Table 3 Initial amounts of reactants in reaction time course with OsPDS-His6.
Reactant amounts in the OsPDS-His6 reaction time course assays are given in [nmol]
for t = 0 min. Q * indicates that the amount of oxidized quinone was held constant
throughout reaction time courses in modeling because rapid non-enzymatic
reoxidation of DPQH2 in liposomes was observed (e.g. despite 2 e- transfer involved in
both carotene desaturation and DPQ reduction, up to 26 carotene desaturation
reactions per DPQ were observed experimentally).
reaction time
course
FADox
[nmol]
FADred
[nmol]
p
[nmol]
pf
[nmol]
z
[nmol]
oxidized Q
[nmol]
p high 0.18 0 3.7 0 0 9.6 *
p low 0.18 0 1.3 0 0 9.6 *
pf 0.18 0 0 5.2 0 9.6 *
A rate constant k (parameter) is assigned to every sub-process, reflecting its
reaction velocity. Both models should be evaluated in order to distinguish
which would best describe PDS behavior in three reaction time courses that
Results
68
were conducted for this purpose. Two contained different initial phytoene
amounts (p high, p low) and one contained phytofluene as a substrate (pf)
(Table 3). The aim was to determine which model could provide a single set
of rate constants to adequately describe all reaction time courses
(simultaneous parameter estimation; opposed by individual parameter
estimation, providing a set of rate constants for every single reaction time
course). Mathematical modeling was initiated with the “monomeric model”
including all 18 forward and reverse reactions but no enzyme inactivation
(Fig. 4-9).
Fig. 4-9 “Monomeric PDS model” including all forward and reverse reactions.
For details, see legend Fig. 4-9 A. All forward and reverse reactions of sub-processes
are considered and were assigned a rate constant (R indicates reverse reactions).
The following set of ODEs and rate constants (parameters) was used to
describe the amounts of p, pf, z, Q and oxidized and reduced FAD over time
(“o” indicates complexation; R indicates reverse reaction):
p
kr2
kr1
kr3
Me
mb
rane
pf
p
pf
pf pf
zz
QH2QH2
kRp
kRr2
kRr3
kf2
kRf2
kRf
kf
kRz
kz
kRpf
kpf
kpf2
kRpf2
kp
kRr1
(i)
(ii)
(iii)
The large number of reversible reactions
plateaus. Thus, it describe
individual parameter estimation
enzyme inactivation (as the
However, the model fail
simultaneous parameter estimation even
reaction time courses “p high” and “p low”
Fig. 4-10 Observed data and modeling of
model” including forward and reverse reactions
The observables p (black), pf (red) and z (blue)
high” (A) and “p low” (B)
Time [min]
p high
Car
oten
es[n
mol
]
A
Results
large number of reversible reactions allows steady states, i.e. modeling of
described the plateaus of each reaction time course
estimation (dashed lines Fig. 4-10), without implementing
as the proven cause for observed plateaus
model failed to describe the reaction time course
simultaneous parameter estimation even when only the
p high” and “p low” were included (Fig. 4
Observed data and modeling of reaction time courses with the “monomeric
model” including forward and reverse reactions.
p (black), pf (red) and z (blue) during the reaction time
(B) are given as data points, representing the mean
Time [min]
B
Car
oten
es[n
mol
]
p low
pf
z
p
pf
z
p
69
, i.e. modeling of
reaction time course upon
without implementing
observed plateaus; see 4.2.1).
reaction time courses upon
two phytoene
Fig. 4-10).
with the “monomeric
reaction time courses “p
are given as data points, representing the mean of
Results
70
triplicates ± SEM. The predictions are based on the “monomeric model” including all
forward and reverse reactions (Fig. 4-9) and are given as lines, either upon individual
parameter estimation (dashed) or upon simultaneous parameter estimation (solid).
The model proved to be overparameterized (Chen et al., 2010): Estimated
parameter values were poorly determined and could vary over a wide range
without impairing the goodness of fit (parameter likelihood profiles not
shown). This is encountered when model complexity (the degrees of freedom)
is too high in relation to the available data describing the modeled system.
This is the case with 18 sub-processes but only three time-resolved observables
(p, pf and z). To reduce model complexity and tailor it to the available data,
only the most relevant processes were included. Successive rounds of model
reduction and reevaluation indicated the feasibility of narrowing down the
model to the three main catalytic processes (i – iii) with one rate constant
each – namely phytoene desaturation (kp), phytofluene desaturation (kpf)
and plastoquinone reduction (krox) (Fig. 4-8 A, shaded areas). Moreover,
enzyme inactivation (iv; implemented by decreasing the amount of oxidized
and reduced FAD over time with rate constant kage) was required as an
essential process to describe the plateaus because no reverse reactions were
considered, as they were found to be negligibly slow (see 4.2.1). The simplified
“monomeric model” comprised the four rate constants in a set of five ODEs:
�
���p� = − ∙ �p� ∙ �FAD��� (1)
�
���pf� = −� ∙ �pf� ∙ �FAD��� + ∙ �p� ∙ �FAD��� (2)
�
���z� = � ∙ �pf� ∙ �FAD��� (3)
�
���FAD��� = − ∙ �p� ∙ �FAD��� − � ∙ �pf� ∙ �FAD��� + ��� ∙ �Q� ∙ �FAD���� − ��� ∙ �FAD��� (4)
�
���FAD���� = ∙ �p� ∙ �FAD��� + � ∙ �pf� ∙ �FAD��� − ��� ∙ �Q� ∙ �FAD���� − ��� ∙ �FAD���� (5)
This allowed describing the three reaction time courses, however, only upon
individual parameter estimation (not shown). Upon simultaneous parameter
estimation z formation was not adequately described in “p low” and “p high”
Results
71
(solid lines in Fig. 4-11 A, B) while pf formation was generally well described –
and so was z formation for “pf” (solid lines in Fig. 4-11 C). Subsequent
evaluation revealed that individual estimation of kpf for every reaction time
course was sufficient to fit the data, while all other parameter values could be
estimated simultaneously (dotted lines in Fig. 4). The deduced rate constants,
with the varying kpf values for the three reaction time courses, are summarized
in Table 2. The difference between kpf in the “p low” and “p high” reaction
time courses is insignificant, both being ca. 5 nmol-1 min-1. In contrast, kpf for
the “pf” reaction time course is as low as 1.1 ± 0.1 nmol-1 min-1. Consequently,
the model suggests that the conversion of “nascent” pf produced from
phytoene (as in “p high” and “p low) proceeds 5 x faster at the same
concentration of reactants than the conversion of pf experimentally
deposited in liposomes (as in “pf”).
Fig. 4-11 Observed data and modeling of reaction time courses with the “monomeric
model”.
0 10 20 30 40 50 60
0.5
1.0
1.5
2.0
2.5
3.0
3.5
0 10 20 30 40 50 600.0
1.0
2.0
3.0
4.0
5.0
0 10 20 30 40 50 600.0
0.2
0.4
0.6
0.8
1.0
1.2
p
pf
z
z
pf
p
Time [min] Time [min]
Time [min]
pf
z
p
pf
p high p low
Car
oten
es[n
mol
]
Car
oten
es[n
mol
]
Car
oten
es[n
mol
]
B
C
A
Results
72
The observables p (black), pf (red) and z (blue) during the reaction time courses “p
high” (A) and “p low” (B) are given as data points, representing the mean of
triplicates. The model predictions are based on the “monomeric model” (Fig. 4-8 A)
only comprising kp, kpf, krox and kage, either upon simulatenous parameter estimation
for all three reaction time courses (solid lines) or upon simultaneous parameter
estimation for kp, krox and kage and individual estimation for kpf (dashed lines).
Apparently, the model requires two kinetically inequivalent phytofluene
populations for simultaneous parameter estimation. These requirements are
met by the “substrate channeling model” introduced in Fig. 4-8 B, allowing
two fates of “nascent” intermediary phytofluene pf*, namely free diffusion in
the membrane core and restricted diffusion in vicinity of the PDS tetramer.
The “substrate channeling model” was implemented with the following ODEs:
�
���p� = − ∙ �p� ∙ �FAD��� (1)
�
���pf ∗� = −�∗ ∙ �pf
∗� ∙ �FAD��� −��� ∙ �pf∗� + � ∙ �p� ∙ �FAD��� (6)
�
���pf� = −� ∙ �pf� ∙ �FAD��� + ��� ∙ �pf
∗� (7)
�
���z� = � ∙ �pf� ∙ �FAD��� + �∗ ∙ �pf
∗� ∙ �FAD��� (8)
�
���FAD� = − ∙ �p� ∙ �FAD��� − � ∙ �pf� ∙ �FAD��� − �∗ ∙ �pf
∗� ∙ �FAD��� + ��� ∙ �DPQ� ∙
�FAD���� − ��� ∙ �FAD��� (9)
�
���FAD���� = ∙ �p� ∙ �FAD��� + � ∙ �pf� ∙ �FAD��� + �∗ ∙ �pf
∗� ∙ �FAD��� − ��� ∙ �DPQ� ∙
�FAD���� − ��� ∙ �FAD���� (10)
In fact, the “substrate channeling model” fitted all reaction time courses well
upon simultaneous parameter estimation (Fig. 4-12 A – C). The resulting set of
rate constants is given in Table 4. The parameter likelihood profiles (Fig. 4-13)
demonstrate that all parameters are well defined, i.e. their values cannot vary
without impairing the goodness of fit.
Results
73
Fig. 4-12 Observed data and modeling of the PDS reaction time courses with the
“substrate channeling model”.
(A – C) The observables p (black), pf (red) and z (blue) during the reaction time
courses “p low” (A), “p high” (B) and “pf”(C) are given as data points representing
the mean of triplicates. The model prediction (lines) is based on the “substrate
channeling model” (equ. 1 and 6 – 10; Fig. 4-8 B) and simultaneous parameter
estimation. Shadowed areas indicate one standard deviation as estimated by the
error model. (D) Prediction of the amount of oxidized, active (ox) and reduced (red)
PDS upon simultaneous parameter estimation. (E, F) Predicted carotene fluxes in the
reaction time course “p high” through the different sub-processes of the model,
denoted by their rate constants (Fig. 4-8 B). Note the different scaling in E and F.
0 10 20 30 40 50 600.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4
0 10 20 30 40 50 600.0
1.0
2.0
3.0
4.0
5.0
0 10 20 30 40 50 600.0
0.1
0.2
0.3
0.4
kpkpf*
krox
Car
oten
es[n
mol
]
Time [min]
Time [min]
B
C D
FA
D [n
mol
]
0 10 20 30 40 50 600.0
0.1
0.2
Time [min]
pf
E F
ox
red
Car
oten
es[n
mol
min
-1]
Time [min]
p high
Time [min]
Car
oten
es[n
mol
min
-1]
pf
z
0 10 20 30 40 50 600.000
0.001
0.002
0.003
0.004
0.005 p highkdif
kpf
Time [min]
A
0 10 20 30 40 50 60
0.5
1.0
1.5
2.0
2.5
3.0
3.5
pf
z
p
Car
oten
es[n
mol
]
Car
oten
es[n
mol
]
p high
pf
z
p
p low
Results
74
Fig. 4-13 Likelihood profiles for the parameters values deduced from the “substrate
channeling model”.
The profile likelihood, ∆χ2, is plotted over a range of parameter values around the
estimated optimal value marked by a dot. As reference, the 68 % / 90 % / 95 %
confidence level (CL) thresholds corresponding to ∆χ2 = 1 / 2.71 / 3.84 are given as
horizontal lines.
Table 4 Parameter values deduced from the “monomeric model” and the “substrate
channeling model”.
Parameter values deduced from the PDS reaction time courses “p high”, “p low”
and “pf” with the “monomeric model “(Fig. 4-8 A) and “substrate channeling model”
(Fig. 4-8 B) are given. Parameter values are given as mean ± SD. For the “monomeric
model”, simultaneous parameter estimation was applied to krox and kage, assuming
that FAD reoxidation and enzyme inactivation are independent of the carotene
substrate present (p or pf), and to kp. Individual parameter estimation for every
reaction time course was applied to kpf. For the “substrate channeling model”,
kp kpf kdif
kpf* krox kage
Parameter value
Results
75
simultaneous parameter estimation was applied to all parameters across all reaction
time courses.
Monomeric model
Parameter Value
Substrate channeling model
Parameter Value
Phytoene
conversion
�� 0.54 ± 0.02 nmol-1 min-1 �� 0.55 ± 0.02 nmol-1 min-1
Phytofluene
conversion
�� (pf) 1.14 ± 0.04 nmol-1 min-1 �� 1.15 ± 0.04 nmol-1 min-1
�� (p high) 5.10 ± 0.24 nmol-1 min-1
�� (p low) 4.77 ± 0.22 nmol-1 min-1
- - �� ∗ 5.44 ± 0.32 nmol-1 min-1
- - �!" 0.02 ± 0.01 min-1
PDS
reoxidation
�#$% 5.76 (-1.92 +5.84)
nmol-1 min-1
�#$% 5.40 ( − 1.86 + 5.67)
nmol-1 min-1
PDS
inactivation
�&'(
0.22 ± 0.01 min-1
�&'( 0.22 ± 0.01 min-1
According to the rate constants, the conversion of lipid-diffusible p (kp ≈ 0.55
nmol-1 min-1) is only half as fast as the conversion of lipid-diffusible pf (kpf ≈ 1.15
nmol-1 min-1). However, both substrates in the hydrophobic liposome core are
converted more slowly than “nascent” pf* (kpf* ≈ 5.44 nmol-1 min-1). According
to the working hypothesis, the restricted diffusion of pf* in a membrane
microdomain close to the PDS homotetramer increases its local
concentration and allows a different subunit of the same PDS homotetramer
to rapidly bind and convert it into z. Thus, conversion of pf* is 5 x faster than
conversion of pf (at the same reactant concentrations). It is worth noting that
the reoxidation of FADred by Q is very fast with a krox of 5.40 nmol-1 min-1 (up to
11.17 nmol-1 min-1 within one standard deviation). As a result, the PDS
reoxidation flux through krox is high and easily compensates for the fluxes
through PDS-reducing carotene desaturation processes through kp, kpf and
kpf*, (Fig. 4-12 E). Accordingly, only a small proportion of PDS is predicted to be
Results
76
in its reduced state during reaction time courses (Fig. 4-12 D). This suggests
that PDS reoxidation is not rate-limiting. Regarding inactivation, the model
predicts decreasing levels of the oxidized and reduced OsPDS-His6 with kage ≈
0.22 min-1, meaning that 22 % are inactivated each minute and resulting in a
half life of ca. 4 min (Fig. 4-12 D). The rate constant kdif (≈ 0.02 min-1),
representing the release of nascent pf* from the membrane microdomain
into the hydrophobic membrane core as freely diffusing pf, suggests that only
2 % of pf* leave the microdaim each minute. Accordingly, the calculated
carotene fluxes through all carotene desaturation processes (Fig. 4-12 E) show
that the pf* flux into z through kpf* exceeds by far the phytofluene fluxes
through kdif and kpf. Thus, pf* has a low probability of escaping channeling
that strongly accelerates end product formation.
In summary, the “substrate channeling model” – in contrast to the
“monomeric model” – describes all PDS reaction time courses well with a
single set of rate constants. Thus, substrate channeling appears as necessary
process to describe PDS behavior. This finding corroborates the relevance of
PDS homotetramers in the enzyme’s active state at membrane surfaces (see
4.1.1.2). The model suggests that channeling of phytofluene between the
subunits, i.e. restricting intermediate diffusion, allows more rapid formation of
the end product ζ-carotene than possible with monomeric action of PDS.
4.2.3 Substrate concentration-dependent kinetics of OsPDS-His6
PDS catalyzes a bi-substrate reaction involving a carotene, either phytoene or
phytofluene, and DPQ. In order to investigate the concentration-dependent
enzyme behavior by their Michaelis-Menten parameters, pseudo-first order
conditions were attained in assays. The concentration of the carotene
substrate was varied while using the quinone substrate at invariable,
saturating concentrations – and vice versa. Additionally, the validity of the
“substrate channeling model” was tested by investigating whether it would
Results
77
adequately simulate substrate concentration dependencies based on the
rate constants (Table 4) and initial enzyme and substrate amounts (Table 3).
First, the concentration dependency on DPQ was examined at the maximally
attainable concentration of 40 mM phytoene (higher concentrations lead to
liposome precipitation). The formation of ζ-carotene could be fitted with the
Michaelis-Menten (MM) equation (Fig. 4-14 A). Since the intermediate
phytofluene is in a steady state, its formation did not show MM conformity.
Consequently, product:intermediate ratios varied substantially (dotted line in
Fig. 4-15 A), with increasing DPQ concentrations favoring end product
formation by OsPDS-His6. Simulation of the DPQ dependency with the
“substrate channeling model” revealed the same trend (compare Fig. 4-15 A
and D). While the observed and estimated apparent Vmax values were very
similar, there was a ca. 4-fold difference in the respective KM values (Table 5).
Second, the enzyme’s dependency on phytoene and phytofluene
concentration was examined under DPQ saturation (19.25 mM ≈ 15 x KM; Fig.
4-15 B and C). Both carotene substrates could not be increased to saturation
for reasons of liposome integrity (see above). Fitting ζ-carotene formation
from phytoene with the MM equation (Fig. 4-14 B) allowed determining
apparent phytoene KM and Vmax values that are in agreement with the
simulated values (Table 5). Again, the formation of the intermediate did not
show MM conformity. Notably, no sigmoidality – a hallmark of cooperative
substrate binding in homooligomeric enzymes – was observed.
As seen with DPQ, the inequivalent kinetic behavior of phytofluene and ζ-
carotene formation affects the product:intermediate ratio in a substrate
concentration-dependent manner. Increasing phytoene concentrations
favored phytofluene release with the z:pf ratio decreasing from ca. 4:1 to 1:1
(Fig. 4-14 B, dotted line). These relations are well reflected in the simulation of
the phytoene dependency (compare Fig. 4-14 B and E). Thus, low carotenoid
fluxes through PDS favor end product formation, while the opposite favors
intermediate release. For the phytofluene dependency, ζ-carotene formation
Results
78
could be fitted with the Michaelis-Menten equation (Fig. 4-14 C), revealing
apparent KM and Vmax values that differ from those derived from simulation
(compare Fig. 4-14 C and F; Table 5).
Fig. 4-14 Data and model predictions for substrate concentration-dependent kinetics
of OsPDS-His6.
Measured (A-C) and simulated (D-E) concentration dependency of the PDS
reaction. (A) DPQ concentration dependency determined at a fixed 40 mM (≈ 1 x
KM) phytoene concentration. (B) Phytoene concentration dependency measured at
a fixed 19.25 mM (≈ 15 x KM) DPQ concentration. (C) Phytofluene concentration
0 10 20 30 40 500
5
10
15
20
0 10 20 30 40
0
5
10
15
20
0 10 20 30 40 500
5
10
15
20
25
30
0 1 2 3 4 5 6 7 80
5
10
15
20
0 1 2 3 4 5 6 7 80
5
10
15
20
25
0
1
2
3
DPQ [mM]
v [n
mo
lmin
-1 m
g-1
]
0 10 20 30 400
5
10
15
20
0
2
4
6
8
Phytoene [mM]
B
Phytofluene [mM]
A
C
z/fp[m
mo
l/mm
ol]z/p
f[mm
ol/m
mol]v
[nm
olm
in-1
mg
-1]
v [n
mo
lmin
-1 m
g-1
]
v [n
mo
lmin
-1 m
g-1
]v
[nm
olm
in-1
mg
-1]
v [n
mo
lmin
-1 m
g-1
]
Phytoene [mM]
DPQ [mM]
D
E
Phytofluene [mM]
F
Results
79
dependency measured at a fixed 19.25 mM DPQ concentration. Data represent the
mean of triplicates ± SEM. Phytofluene and ζ-carotene formation in A – C were fitted
with the Michaelis-Menten equation (solid lines; goodness of fit for ζ-carotene
formation: A, R2 = 0.98; B, R2 = 0.97; C, R2 = 0.98). Phytofluene formation in B was fitted
with a spline. The ζ-carotene:phytofluene ratios in A and B were derived from the
measured pf and z amounts, are given as dotted lines and plotted to the right y-axis.
Red squares, ζ-carotene; blue squares = phytofluene. In D – F, the model prediction
of phytofluene and ζ-carotene formation is depicted as solid line (red, phytofluene;
blue, ζ-carotene). Shaded areas represent one standard deviation.
Table 5 Observed and estimated apparent KM and Vmax values for PDS substrates.
Apparent KM and Vmax values were determined based on ζ-carotene formation for
the observed and estimated concentration-dependent kinetics of OsPDS-His6 (Fig. 4-
14) and the mutated PDS enzyme Arg300Ser. Values represent the mean ± SD). The
observed data (obs.) were fitted with the Michaelis-Menten equation. Estimated
values (est.) were obtained by simulation with the “substrate channeling model”.
Substrate KM obs.
[mM]
KM est.
[mM]
Vmax obs.
[nmol min-1 mg-1]
Vmax est.
[nmol min-1 mg-1]
DPQ 1.3 ± 0.2 6.2 ± 0.2 28.1 ± 1.4 26.1 ± 0.6
Phytoene 53.9 ± 18.1 71 (-27 +160) 46.3 ± 10.7 51 (-18 +43)
Phytofluene 66.8 ± 20.7 126 (-40 +120) 48.4 ± 10.3 195 (-67 +187)
In summary and in support of the validity of the “substrate channeling model”,
the concentration-dependent relations of intermediate and end product
formation are well reflected across all simulations. However, the model
overestimates Michaelis-Menten parameters, used here as a quantitative
measure to allow comparisons, by factors of 1.1 to 4.1 (Table 5). This deviation
and its importance regarding model validity will be addressed in the
discussion (see 5.1.5).
Results
80
4.3 Investigations on herbicide resistance in PDS
As detailed in 1.3.1.3, phytoene desaturase PDS is a prominent target for a
structurally heterogenous group of bleaching herbicides, such as norflurazon
(NFZ), fluridone and diflufenican, that share a meta-trifluoromethylphenyl (m-
CF3-phenyl) moiety that is often fused to a second (heterocyclic) ring with a
carbonyl group. The lack of protein structural information has hampered the
molecular understanding of the mode of action of these compounds. The
refinement of the OsPDS-His6 structure in a complex with NFZ during this thesis
(in collaboration with the team of Prof. Dr. Einsle, Department of Chemistry,
University of Freiburg) has changed this situation allowing in depth
investigations. Such work is of interest in the light of emerging resistances
against commonly used herbicides in various crops.
4.3.1 Kinetic analysis of the mode of inhibition by norflurazon for OsPDS-His6
The OsPDS-His6 crystal structure shows NFZ bound to the assumed PQ binding
site within the substrate cavity. If true, NFZ and plastoquinone should compete
for binding to this site. Phytoene occupies the same substrate cavity (see
4.1.4) and therefore it might as well interfere with NFZ binding.
In order to investigate this, in vitro inhibition kinetics with norflurazon were
carried out with OsPDS-His6. NFZ inhibition could be overcome by increasing
DPQ concentrations, i.e. Vmax was attained in the presence of NFZ (Fig. 4-15
A). Thus, inhibition regarding PQ could be best described with the competitive
inhibition model, revealing a Ki of 0.23 ± 0.03 mM for NFZ. This is in accordance
with the previous finding that DPQ can displace NFZ during OsPDS-His6
purification (Gemmecker et al., 2015) and quinone-competitive inhibition
reported with cell-free in vitro assays by Breitenbach et al. (2001). Other meta-
trifluoromethylphenyl–containing PDS inhibitors such as fluridone and
diflufenican were also quinone-competitive (Fig. 4-15 C, D) and consequently
appear to also occupy the PQ binding site, as previously hypothesized by
Laber et al. (1999). In contrast, NFZ inhibition was not overcome by increasing
phytoene concentrations (Fig. 4-15 B), indicating that NFZ and phytoene do
Results
81
not compete and supporting either non-competitive or uncompetitive
inhibition by NFZ regarding the carotene substrate. Both inhibition models
described the inhibition kinetics poorly, e.g. revealing a Ki of 0.59 ± 0.09 mM
for non-competitive inhibition. Non-competitive inhibition is supported by the
fact that the crystallized PDS-NFZ complex represents an enzyme-inhibitor
complex formed in the absence of substrate, with uncompetitive inhibitors
only exhibiting affinity for the enzyme-substrate complex (Copeland, 2000).
Fig. 4-15 Mode of OsPDS-His6 inhibition by NFZ, fluridone and diflufenican
(A, B) Inhibition of OsPDS-His6 was investigated under increasing concentrations of
the inhibitor NFZ and of the substrates DPQ (A) or phytoene (B). Data represent
triplicates ± SEM and were fitted with the equations for competitive inhibition (A; R2 =
0.99) and non-competitive inhibition (B; R2 = 0.96). (C, D) Inhibition of OsPDS-His6 was
investigated under increasing concentrations of the substrate DPQ in the presence
of the inhibitors diflufenican (C) or fluridone (D). Data represent duplicates ± SEM and
were fitted with the equations for competitive inhibition (A, R2 = 0.96; B, R2 = 0.98).
DPQ [mM]
v [n
mol
ζ m
in-1
mg-1
]
0 5 10 15 200
1
2
3
4
5
6
0.0 mM0.6 mM1.2 mM2.4 mM
Phytoene [mM]
v[nm
olζ
min
-1m
g-1]
0 10 20 30 40 500
2
4
6
8
0.0 mM1.6 mM3.3 mM
A B
DPQ [mM]
v [n
mol
ζ m
in-1
mg-1
]
0 5 10 15 200
1
2
3
4
5
0.00 mM
0.16 mM
DPQ [mM]
v [n
mol
ζ m
in-1
mg-1
]
0 5 10 15 200
2
4
6
8
0.00 mM
0.27 mM
C D
FluridoneDiflufenican
Results
82
It is noteworthy that this mode of inhibition further corroborates the postulated
ordered ping pong bi bi mechanism of PDS because the observed
competition between NFZ and plastoquinone and the lack of competition
between NFZ and phytoene, all occupying the same substrate cavity, can
only be explained when sequential binding of the two substrates is warranted.
4.3.2 Norflurazon resistance conferred by point mutations
Point mutations of PDS conferring resistance to NFZ have been identified in
cyanobacteria, algae and an aquatic plant (see 1.3.1.3). Protein alignments
reveal that five highly conserved amino acids corresponding to Phe162, Arg300,
Leu421, Val505 and Leu538 in the O. sativa enzyme are affected (Fig. 4-16).
According to the structure of OsPDS-His6 in a complex with NFZ, these residues
are localized in the active center environment (Fig. 4-17).
Fig. 4-16 Protein alignment of PDS mutant enzymes conferring NFZ resistance.
The following residues are highlighted: 1, His159; 2, Phe162; 3, Met188; 4, Met277; 5, Ala280;
6, Arg300; 7, Met310; 8, Leu421; 9, Phe423; 10, Val505; 11, Tyr506; 12, Thr508 13, Leu538. Global
sequence alignment was carried out with the Blosum62 matrix. Identical residues are
green, similar residues greenish or yellow. Position numbering refers to the immature
10 13
8
6
1 3
4 7
11
9
5
2
12
Synechocystis
Oryza
Arabidopsis
Chlorella
Hydrilla
Synechococcus
Synechocystis
Oryza
Arabidopsis
Chlorella
Hydrilla
Synechococcus
Synechocystis
Oryza
Arabidopsis
Chlorella
Hydrilla
Synechococcus
Synechocystis
Oryza
Arabidopsis
Chlorella
Hydrilla
Synechococcus
Synechocystis
Oryza
Arabidopsis
Chlorella
Hydrilla
Synechococcus
Synechocystis
Results
83
protein from O. sativa (Acc. A2XDA1.2) including its N-terminal 87 amino acid transit
peptide. Organisms and accession numbers (from top to bottom): Oryza sativa,
A2XDA1.2; Arabidopsis thaliana, Q07356.1; Chlorella zofingiensis, ABR20878.1; Hydrilla
verticillata, AAT76434.1; Synechococcus elongatus PCC 7942, CAA39004.1;
Synechocystis sp. PCC6803, CAA44452.1.
Fig. 4-17 Conserved residues in OsPDS-His6 conferring NFZ resistance upon mutation
The inner surface of the substrate cavity is depicted. The substrate cavity entry in the
membrane binding domain is indicated by an arrow. The redox cofactor FAD is
given as sticks in orange. Conserved residues whose mutation has been reported to
convey NFZ resistance are given as sticks, color-coded by elements (grey, carbon;
blue, nitrogen; red, oxygen). The numbering relates to the Oryza sativa protein (Acc.
A2XDA1.2) including its N-terminal 87 amino acid transit peptide.
Their mutation might therefore have multiple effects. They might affect size
and general architecture of the active site, alter flavin binding or interfere
more specifically. The latter most likely applies to Arg300. It coordinates NFZ via
a hydrogen bond and – as indicated by competition and structural similarities
with the benzoquinone head group – it is assumed to be involved in the
binding of PQ (Brausemann et al., 2017). In order to investigate the role of
Arg300 in NFZ binding, the mutations Arg300Ser and Arg300Thr that were reported
to confer NFZ resistance (Arias et al., 2006) were introduced into OsPDS-His6.
Ser (C3) and Thr (C4) are several Å shorter than Arg (C7). Consequently, given
Results
84
the average distance of only about 3 Å between donor and acceptor of
hydrogen bonds (Kyte, 2006), Ser and Thr most likely cannot form hydrogen
bonds with NFZ despite their hydroxyl functionalities. Both purified PDS variants
retained ζ-carotene forming activity but at reduced levels with 15 % and 6 %
of the wild type enzyme, respectively. Being more active, Arg300Ser was
chosen for further characterization in comparison with wild type OsPDS-His6.
Flavinylation was not affected with both wild type OsPDS-His6 and Arg300Ser
PDS containing ca. 70 % holoenzyme. There was also no difference in
membrane association (Fig. 4-18 A). GPC analysis revealed that the mutation
did not affect protein solubility and homooligomeric assembly (Fig. 4-19 B).
Therefore, Arg300Ser PDS most likely maintained a native overall fold and
assembly and the loss of activity is likely caused by more subtle changes
affecting enzyme kinetics.
Fig. 4-18 Association with liposomal membranes and oligomeric assembly in solution
of wild type OsPDS-His6 and the Arg300Ser mutant enzyme.
(A) SDS-PAGE analysis (12 %, Coomassie-stained) of liposomal binding assays. Lanes
represent the liposome-bound PDS protein obtained from one PDS assay. WT, wild
type. (B) Elution traces of wild type OsPDS-His6 and the mutant enzyme Arg300Ser
monitored at 280 nm upon GPC (Superose 6 10/300 GL column). The dominant high
mass peak (oligo) represents the flavinylated and active homooligomer, the two
A B
5 10 15 20
5 10 15 200 ml
ml
VE
VE
A2
80
nm
Arg300Ser
OsPDS-His6
kDa
100
70
55
40
35
25
15
10
WT Arg300Ser
oligo
mono
FAD
oligo
mono
FAD
V0
V0
Results
85
lower mass peaks represent the unflavinylated, inactive monomer (mono) and free
FAD that has been released from the enzyme upon sample preparation and GPC.
In order to evaluate this hypothesis, the required kinetic data were gathered.
In fact, quinone-competitive inhibitions kinetics (Fig. 4-19 C) revealed a more
than 6 x higher Ki of the mutant, i.e. increased NFZ resistance relative to wild
type OsPDS-His6 (Table 6), as expected from reports on this mutation in
orthologous enzymes in vivo (see above). The DPQ concentration
dependency (Fig. 4-19 B) showed that the apparent KM for DPQ was strongly
decreased by factor of 3.5 (Table 6) indicating increased DPQ affinity.
Fig. 4-19 Kinetic characterization of Arg300Ser PDS.
(A, B) Concentration dependency of Arg300Ser PDS for phytoene (A) and DPQ (B).
(C) Inhibition of Arg300Ser PDS in a matrix of varying DPQ and NFZ concentrations.
Data points (squares, ζ-carotene; circles, phytofluene) represent the mean of
duplicates ± SEM. The deduced ζ-carotene/phytofluene ratio (dotted line; plotted to
the right Y axis) in A and B and is given as triangles. Data in A (R2 = 0.58) and B (R2 =
0.95) were fitted with the Michaelis-Menten equation and the equation for
Phytoene [mM]
v [n
mol
min
-1 m
g-1] z/pf [nm
ol/nmol]
0 10 20 30 400
1
2
3
4
5
6
0.0
0.2
0.4
0.6
DPQ [mM]
v [n
mol
min
-1 m
g-1] z/pf [nm
ol/nmol]
0.0 0.5 1.0 1.5 2.0 2.50.0
0.5
1.0
1.5
0.0
0.2
0.4
0.6
0.8
DPQ [mM]
v [n
mol
ζ m
in-1
mg-1
]
0.0 0.2 0.4 0.6 0.8 1.0 1.20.0
0.2
0.4
0.6
0.8
1.0
0.00 mM NFZ0.55 mM NFZ1.10 mM NFZ2.20 mM NFZ
A B
C
Results
86
competitive inhibition in C (R2 = 0.94). The ζ-carotene/phytofluene ratios were fitted
with a spline. Assays were incubated for 15 min under standard conditions.
Moreover, the phytoene concentration dependency (Fig. 4-19 A) supported
that KM for phytoene was lowered by a factor of 12 due to the mutation
(Table 6). Concomitantly, a strong decrease in Vmax was observed for both
phytoene and DPQ (Table 6), corroborating the loss of activity of the mutant.
The lowered Ki for NFZ accompanied by a decreased KM for DPQ is not fully
compatible with an equivalent binding mode of the two (see 5.1.6.2).
Table 6 Substrate and inhibitor affinities for wild type OsPDS-His6 and Arg300Ser PDS.
The Michaelis-Menten parameter values deduced from substrate-concentration
dependencies for the substrates 15-cis-phytoene and DPQ are summarized for both
PDS versions. * denotes that 10 mM phytoene instead of 40 mM phytoene were used
during DPQ concentration dependencies. Ki values were determined in quinone-
competitive inhibition kinetics.
Ligand KM or Ki
WT
[mM]
KM or Ki
Arg300Ser
[mM]
Vmax
WT
[nmol min-1 mg-1]
Vmax
Arg300Ser
[nmol min-1 mg-1]
DPQ 1.3 ± 0.2 0.4 ± 0.1 28.1 ± 1.4 1.2 ± 0.1*
Phytoene 53.9 ± 18.1 4.5 ± 2.6 46.3 ± 10.7 1.0 ± 0.2
NFZ 0.2 ± 0.0 1.5 ± 0.4 - -
A main difference in the phytoene and DPQ concentration dependencies is
that phytofluene release was predominant for Arg300Ser PDS (dotted lines in
Fig. 4-19 A, B); this is the opposite with the wild type enzyme (see 4.2.3).
Nevertheless, a similar trend can be noted with both versions: low phytoene
concentrations and high DPQ concentrations favor formation of the end
product ζ-carotene, with the opposite favoring release of the intermediate.
Results
87
In summary, the affinities for all ligands are strongly impaired in Arg300Ser PDS,
supporting multiple effects on the active site and major changes in enzyme
kinetics including the observed loss in enzymatic activity. In an attempt to
pinpoint sub-processes impaired in the mutant (such as altered DPQ
reoxidation), mathematical modelling was applied. However, this did not
allow an unequivocal identification.
Apart from Arg300Ser, other mutations that were reported to confer NFZ
resistance in orthologous PDS enzymes were introduced into OsPDS-His6 by
site-directed mutagenesis – namely Leu538Phe, Leu538Arg and Phe162Val. The
mutant enzymes were all purified for biochemical and kinetic
characterization. Like Arg300Ser, they all exhibited wild type-like flavinylation
and most likely a native overall fold but less than 5 % of the wild type activity.
This residual activity did not allow kinetic characterization.
4.3.3 Identification of non-covalent norflurazon – OsPDS-His6 interactions
Structure-activity correlations for NFZ derivatives were carried out in the 1980s
and 1990s in complex systems. This suggested that lipophilicity and electron-
withdrawing properties of the meta-trifluoromethyl substituent of the phenyl
moiety are crucial for the effectiveness of norflurazon (see 1.3.1.3 and
references therein). With the crystal structure of OsPDS-His6 in complex with
NFZ resolved, non-covalent interactions of the m-CF3 group with residues
could now be deduced from changes in electron density gradients by
quantum mechanical calculations (kindly provided by John Delaney,
Syngenta, Bracknell, UK) in order to characterize interactions that are unique
to this substituent and explain its inhibitory effectiveness.
The m-CF3-phenyl and its contact points and interactions in OsPDS-His6 are
visualized in Fig. 4-20 A and B. m-CF3-phenyl exhibits a large number of weakly
attractive non-covalent interactions rather than relying on a single dominant
one (Fig. 4-20 C). Some interactions occur for any phenyl ring, irrespective of
its substituents, e.g. with the carbonyl of FAD, the sulphur of Met310 or the
Results
88
phenyl ring of Phe162. Weakly attractive interactions that are unique for the
CF3 substituent and could only partially occur for other substituents occur
between the fluorine atoms with Met188, Met277, Ala280 and Phe423. Thus, the
CF3 substituent indeed strongly contributes to the affinity and potency of NFZ
by five weakly attractive interactions with the PQ binding site.
Fig. 4-20 Non-covalent interactions between m-CF3-phenyl in NFZ and OsPDS-His6.
Weakly attractive non-covalent interactions between the m-CF3-phenyl moiety of
NFZ and residues in OsPDS-His6 are given as dashed lines. Residue numbering refers to
O. sativa PDS (Acc. A2XDA1.2) including its N-terminal 87 amino acid transit peptide.
Protein alignments reveal that all of the above identified residues are strictly
conserved (Fig. 4-16), suggesting that the described interactions with m-CF3-
phenyl generally apply to PDS and CrtP enzymes in cyanobacteria, green
algae and plants. Amongst these residues, the mutation corresponding to
Phe162Val was reported to confer resistance to NFZ in Chlamydomonas
reinhardtii (Suarez et al., 2014). This supports the notion that these residues are
essential for the interaction between the target enzyme and its herbicidal
inhibitor and may represent targets in the development of optimized
herbicides and of herbicide resistant PDS enzymes.
CH
HCHH
S
O
H
H
F
F
FH
H
NH
H
S
NO
Cl
NH
F162
M188
F423
A280
M277
M310
FAD
Results
89
4.4 ζ-Carotene desaturase ZDS
4.4.1 Basic biochemical characterization of OsZDS-His6
Having investigated the structure and kinetics of purified PDS, we extended
our investigation to ZDS. PDS and ZDS are paralogs that have evolved through
an ancient gene duplication event. The similarities and differences of these
two desaturases regarding structure and enzyme kinetics are crucial for the
understanding of the poly-cis pathway of carotene desaturation.
4.4.1.1 Establishing native OsZDS-His6 purification and an in vitro assay
Heterologous expression in E. coli and native purification of ZDS-His6 from
Oryza sativa was established. Initially, cloning and purification for OsZDS-His6
was carried out using the procedures for OsPDS-His6 by Gemmecker et al.
(2015) as a guideline. However, the OsZDS-His6 yield per gram E. coli was as
low as 25 µg compared to 750 with OsPDS-His6. Extensive optimization of the
expression conditions, including the use of various E. coli strains, did not result
in much improvement. In the end, codon optimization and expression in the E.
coli strain Rosetta, harboring plasmid-encoded rare tRNAs, allowed obtaining
200 µg OsZDS-His6 g-1. During optimization of the purification, the addition of
0.01 % (w/v) TritonX100 during cell disruption and IMAC resin binding as well as
the addition of 10 mM MgCl2 throughout purification proved to improve ZDS
yields. The optimized procedures allowed obtaining 350 µg OsZDS-His6 g-1.
SDS-PAGE analysis of purified OsZDS-His6 (Fig. 4-21 A) revealed a dominant
protein band with a size of approximately 60 kDa (calculated mass of 60.3
kDa), accompanied by only minor impurities. The IMAC eluates appeared
yellow, suggesting the presence of a flavin. No flavin fluorescence was
detected upon SDS-PAGE indicating non-covalent association. In order to
prove its native state, enzymatic activity was assayed using the biphasic
liposomes-based system established for PDS (Gemmecker et al., 2015). The
hydrophobic ZDS substrate 9,9’-di-cis-ζ-carotene was incorporated into
liposomes and decylplastoquinone, the assumed exchangeable redox
cofactor of ZDS, was allowed to partition into liposomes.
Results
90
Fig. 4-21 SDS-PAGE analysis and in vitro activity assay for purified OsZDS-His6.
(A) SDS-PAGE analysis of purified OsZDS-His6. 25 µg of protein were separated on a 12
% polyacrylamide gel. PageRulerTM Prestained Protein Ladder (ThermoFisher) was
used as size marker. (B) OsZDS-His6 in vitro assays were analyzed by HPLC after
extraction. The UV/VIS spectra of the substrate (9,9’-di-cis-ζ-carotene) and the
formed products (proneurosporene, prolycopene) are given as insets. No products
were detected in the assay with the empty vector control (not shown).
HPLC analysis revealed the formation of the canonical ZDS products
proneurosporene (PN; 7,9,9’-tri-cis-neurosporene) and prolycopene (PL;
7,9,7’,9’-tetra-cis-lycopene). They can unequivocally be identified as the sole
ZDS products due to their unique UV/VIS spectra (Fig. 4-21 B). In accordance
with the procedures for PDS, ZDS remained active and soluble upon storage
at - 20 °C, provided that imidazole was removed by dialysis and replaced by
glycerol. Like with PDS, the presence of detergents after purification showed
to be detrimental to ZDS activity. They were omitted in all buffers subsequent
to enzyme binding to the IMAC resin. Thus, ZDS is similar to PDS as it behaves
as soluble during purification, remaining native in the absence of detergents,
and is capable of spontaneously attaching to liposomal membranes. Thus,
OsZDS-His6 represents a monotopic membrane protein.
A B
400 425 nm
379
1 2 4 5 6 7 8
min
mA
U(4
00
-45
0n
m) 409
432 nm
438 nm
prolycopene
proneurosporene9,9‘-di-cis-ζ-carotene
9
kDa
100
70
55
40
35
25
15
10
Results
91
4.4.1.2 Identification of nucleotide redox cofactors bound to OsZDS-His6
The conserved Rossmann fold of ZDS (Breitenbach et al., 1998) could enable
the binding of FAD and FMN as well as of other mono- or dinucleotides. To
detect these redox cofactors, purified OsZDS-His6 was heat-denatured to
release non-covalently bound enzyme cofactors. The supernatant obtained
upon centrifugation was subjected to LC-MS/MS analysis. Authentic standards
of FAD, FMN, NADH and NADPH were used as references (Fig. 4-22).
Fig. 4-22 Identification of mono- and dinucleotide cofactors bound to OsZDS-His6.
The supernatant of heat-denatured OsZDS-His6 was analyzed by LC-MS/MS and
nucleotide cofactors were identified using FAD, FMN, NADH and NADPH as authentic
standards. (A) Maxplot (280 – 800 nm) of ZDS supernatant and of an FAD – FMN
standard. UV/VIS spectra are given. (B) Extracted ion chromatogram (XIC) for the
A
0
20
40
60
80
100
Rel
ativ
e A
bun
dan
ce 11.41m/z = 457.10275
-457.12103
0
20
40
60
80
100
Rel
ativ
e A
bun
dan
ce 10.57m/z = 786.14869
-786.18013
10.57
11.42
300 350 400 450m/z
Rel
ativ
e A
bund
ance
439.10080348.06989
20
40
60
80
100
300 350 400 450m/z
Rel
ativ
e A
bund
ance
359.13440
396.09491
300 350 400 450m/z
Rel
ativ
e A
bund
ance
359.13449
396.09491
10.49
11.34
B
C
9 10 11 12 13min
mA
U(2
80-8
00n
m)
10.49
11.33
445 nm
FAD standard
FMN standard
FAD + FMN
447 nm447 nm
FMNFAD
ZDS
FAD
FMN
ZDS
FMN
ZDS
FAD
9 10 11 12 13
9 10 11 12 13
min
min
300 350 400 450m/z
Rel
ativ
e A
bund
ance
439.10080348.06989
20
40
60
80
100
20
40
60
80
100
20
40
60
80
100
FAD in ZDS
FMN in ZDS
Results
92
FAD [M+H]+ with a calculated m/z of 786.16441 ± 20 ppm for the OsZDS-His6
supernatant and the FAD standard. The corresponding MS2 spectra are given. (C)
Extracted ion chromatogram (XIC) for the FMN [M+H]+ with a calculated m/z of
457.11689 ± 20 ppm, for the OsZDS-His6 supernatant and the FMN standard. The
corresponding MS2 spectra are given.
As shown in Fig. 4-22 A, OsZDS-His6 mainly contained FAD and only trace
amounts of FMN. Centrifugation of the samples yielded a white ZDS pellet,
confirming non-covalent binding. As both flavins contain an isoalloxazine as
chromophore, the FAD/FMN ratio can be derived from peak areas at 447 nm
and was found to be 96 % FAD and 4 % FMN. The identity of these two
cofactors in OsZDS-His6 is supported by the presence of the expected
quasimolecular ions and by MS2 spectral characteristics in comparison to
authentic standards (Fig. 4-22 B and Fig. 4-22 C). No signals corresponding to
the [M+H]+ of NAD+, NADH, NADP+ or NADPH were detected. In conclusion,
OsZDS-His6 contains FAD as a non-covalently bound redox cofactor that can
occasionally be replaced by FMN.
In order to determine the percentage of flavinylation in OsZDS-His6
preparations, FAD and protein were photometrically quantified. Assuming
flavin binding to ZDS in a 1:1 stochiometry, 35 % of ZDS represented the
holoenzyme whereas 65 % were apoenzyme. Like with PDS (Gemmecker et
al., 2015), the addition of 25 µM FAD to assays did not improve OsZDS-His6
activity. Accordingly, ZDS cannot exchange FAD, at least in vitro. FAD can
therefore be assumed to be permanently bound to carry out multiple
reaction cycles (provided it is reoxidized by PQ) while the apoenzyme is most
likely irreversibly inactivated.
4.4.1.3 Kinetic mechanism of the OsZDS-His6 bi-substrate reaction
As laid out for PDS (4.1.4), the question whether quinone is required for
carrying out the carotene desaturation reaction in ZDS per se is of
mechanistic interest. OsZDS-His6 assays were carried out in the absence of
DPQ. In fact, product formation was observed in the absence of quinones:
Results
93
0.23 nmol of flavinylated ZDS monomers yielded 0.05 nmol PN and 0.04 nmol
PL, corresponding to 0.13 nmol of double bonds formed which is close to
equimolarity. Thus, like with PDS, carotene desaturation and PQ reduction are
separate catalytic events. Each flavinylated OsZDS-His6 monomer can be
assumed to perform one catalytic cycle that is independent of DPQ. The
latter is solely needed kinetically to regenerate oxidized FAD for repeated
catalytic cycles. This supports the prevalence of an ordered ping pong bi bi
mechanism, like with OsPDS-His6 (see 4.1.4).
4.4.2 Structure and reaction mechanism of OsZDS-His6
4.4.2.1 Reaction mechanism of carotene desaturation by OsZDS-His6
As shown in this work, OsPDS-His6 does not employ an acid-base component
in its reaction mechanism for carotene desaturation, as witnessed inter alia by
the lack of deuterium incorporation from heavy water into its products.
Rather, a “flavin only” reaction mechanism based on the redox-active
isoalloxazine of FAD as sole catalyst prevails (for details, see 4.1.3).
In order to test the hypothesis that ZDS does not rely on acid-base catalysis
either, deuterium incorporation into PL formed by OsZDS-His6 in the presence
of D2O was monitored by LC-MS (Fig. 4-23). PL was formed from 9,9’-di-cis-ζ-
carotene in buffers containing either D2O or H2O, as witnessed by the same
UV/VIS spectrum (Fig. 4-23 A), the same [M+H]+ mass of 537.44548 ± 5 ppm
corresponding to C40H57 (Fig. 4-23 B) and the same mass for the M+1 signal that
are due to 13C incorporation (Fig. 4-23 C). Consequently, there is no
deuterium incorporation from an outer source into products formed by OsZDS-
His6. This does not imply acid-base catalysis but supports a “flavin only”
reaction mechanism, as postulated for PDS (see 4.1.3).
Results
94
Fig. 4-23 LC-MS analysis of ζ-carotene formed in buffer containing heavy water.
(A) The formation of PL was detected at 350 - 500 nm upon incubation in reaction
buffers with D2O and H2O. The UV/VIS spectrum of the PL formed is given as inset. (B)
Extracted ion chromatogram (XIC) for [M+H]+ of PL with a calculated m/z ratio of
537.44548 ± 5 ppm, verifying its formation in the absence and the presence of D2O.
(C) The corresponding MS1 spectra of PL formed with H2O (left) and with D2O (right) in
reaction buffers reveal identical [M+H]+ and M+1 signals.
4.4.2.2 Homology modeling of OsZDS-His6 and analysis of the active site
To further investigate structural and functional differences between PDS and
ZDS, X-ray protein crystallography for OsZDS-His6 was anticipated. However, all
attempts during this thesis failed despite much variation of the protocols. We
therefore resorted to homology modeling using its paralog OsPDS-His6 (33 %
sequence identity) as modeling template. In silico docking of riboflavin into
OsZDS-His6 was performed in order to define the active center.
According to this, the structure of the paralogous carotene desaturases
OsPDS and OsZDS is strongly conserved, with ZDS also containing a conserved
Rossman fold, a HotDog domain and a membrane binding domain (Fig. 4-24
A). One long, hydrophobic substrate cavity originates from the membrane
binding domain surface (Fig. 4-24 A), providing access to the FAD-containing
436 nm
11 12 13min
12.3812.39
D2O
H2O
C40H57 (prolycopene)
m/z = 537.44441-541.44655
Re
l. ab
und
ance
A B
C
11 12 13min
12.34
D2OH2O
mA
U(3
50-
500
nm) 13.05
prolycopene
proneurosporene
536 538 540 542 544m/z
0102030405060708090
10012.29-12.45 min
ZDS + H2O537.44589
538.44924
[M+H
]+
M+
1
536 538 540 542 544
m/z
0102030405060708090
100537.44588
538.44958
12.29-12.45 minZDS + D2O
[M+H
]+
M+
1
Results
95
active center for the lipophilic, membrane-soluble carotene substrates and
PQ. Like with OsPDS-His6, the existence of only one substrate cavity supports
an ordered ping pong bi bi mechanism. This is corroborated by the fact that
carotene desaturation by OsZDS-His6 occurred in the absence of PQ (see
4.4.1.3). As expected, the isoalloxazine is predicted to reside within the
substrate cavity whereas the D-ribitol moiety is accommodated in a cavity of
the FAD-binding domain (Fig. 4-24 A) with the Gly-Ala-Gly (GAG) motif of the
Rossman fold coordinating the phosphates in FAD (Hanukoglu, 2015). Like in
PDS, the isoalloxazine position in fact is likely to be shifted into the side cavity
(Fig. 4-24 A and B). The isoalloxazine environment defines the active center.
Accordingly, the redox-active benzoquinone moiety of DPQ was docked into
the active site of OsZDS-His6 apoenzyme (not shown). Interestingly, the
inhomologous bacterial phytoene desaturase CrtI possesses a similar tertiary
structure (Fig. 4-24 A).
Fig. 4-24 Prediction of the OsZDS structure by homology modeling.
(A) Structural comparison of monomeric Oryza sativa PDS, Oryza sativa ZDS and CrtI
from Pantoea ananatis. The structure of OsZDS was predicted by homology
Asp149
Arg148
Arg152
Asp489
Glu492
His115
His86
Glu451
His159
Arg300
Glu542
Lys142
OsPDS OsZDSA
B
FAD binding
domainMembrane
binding domain
HotDog domainCrtI
OsPDS CrtIOsZDS
Results
96
modeling using the OsPDS structure as modeling template. The riboflavin position
results from in silico docking. The structures are depicted as cartoon, with FAD (PDS),
riboflavin (ZDS) and isoalloxazine (CrtI) represented by orange sticks and the inner
surface of the hydrophobic substrate cavity given in grey. The assumed entry to the
substrate cavity in the membrane binding domain is indicated by an arrow. (B)
Active center of the OsPDS, OsZDS and CrtI. All basic and acidic amino acid residues
within a 8 Å radius around the redox-reactive isoalloxazine (orange sticks) are given
as sticks, color coded by elements (blue, nitrogen; red, oxygen; grey, carbon). The
GAG motif of the Rossmann fold is given as dark grey sticks (right bottom).
Numbering of residues in OsZDS refers to the mature OsZDS protein (Acc.
XP_015646524.1) including the addition of a N-terminal methionine. Numbering in
OsPDS relates to the immature protein including its N-terminal 87 amino acid transit
peptide (Acc. A2XDA1.2). Numbering in CrtI is as given in Schaub et al. (2012).
The OsZDS active center environment (defined as 8 Å radius around the
isoalloxazine) shows only few basic or acidic amino acids – namely His86, His115,
Glu492 and Asp489 (Fig. 4-24 B) which are conserved in cyanobacterial CrtQb
and plant ZDS enzymes (not shown) and might initiate carotene desaturation
by acid-base catalysis. However, as with OsPDS-His6 (see 4.1.3), the lack of
deuterium incorporation during carotene desaturation by OsZDS-His6 (Fig. 4-
23) suggests that no acid-base catalysis is employed. This is in accordance
with the acidic and basic residues being too distant from the carotene
substrate cavity for direct interaction with the carotene reaction site (Fig. 4-24
B). To further illustrate this, the active center of CrtI, employing acid-base
catalysis (Schaub et al., 2012) is depicted (Fig. 4-24 B). It drastically differs from
OsPDS and OsZDS as it contains two arginines and one aspartate as catalytic
triad in less than 5 Å distance of the isoalloxazine and the carotene binding
site (Schaub et al., 2012). Conclusively, these findings imply that ZDS, like PDS,
employs a “flavin only” reaction mechanism with FAD acting as sole catalyst
(see 4.1.3; Brausemann et al., 2017).
Results
97
4.4.2.3 Homooligomerization of OsZDS-His6 in solution
OsPDS-His6 is only active when assembled as a homotetramer containing one
FAD per subunit whereas monomers are unflavinylated and inactive
(Gemmecker et al., 2015, see 4.1.1.2). This prompted us to revisit the results of
Albrecht et al. (1995) who suggested ZDS from Capsicum anuum to be active
in monomeric form.
Fig. 4-25: Analysis of purified OsZDS-His6 on size standard-calibrated GPC columns.
(A, B) GPC profile of OsZDS-His6 on a Superose 6 10/300 GL column, when purified
and analyzed in the absence (A) or in the presence of TCEP (B). Protein absorption
was monitored at 280 nm, FAD fluorescence at 530 nm upon excitation at 450 nm.
Two OsZDS-His6 populations of different molecular mass were detected (I and II). (C)
The partition coefficient KAV was determined for size standard proteins and OsZDS-His6
samples (the latter given in red) on three GPC columns differing in fractionation
ranges and plotted against the logarithm of the molecular weight logMW [kDa]. Size
marker proteins ranged from 12.4 kDa to 440 kDa. Analysis of the OsZDS-His6
indicated that I corresponds to a monomer (60.3 kD) and II to a dimer (120.6 kDa).
Purified OsZDS-His6 was subjected to GPC analysis. In accordance with the
results obtained with PDS, imidazole was essential to prevent OsZDS-His6 from
aggregation and adsorption to the column resin. GPC analysis on a Superose
6 10/300 GL column revealed two major populations when TCEP was omitted
10 100 1000
0.2
0.4
0.6
0.8HiLoad 16/60
Superdex 75
Superose 6
0 mM TCEP
1 mM TCEP
Em530nm
A280nm
A280nm
A
B
5 10 15 20
5 10 15 200 ml
ml
VE
VE
C
logMW [kDa]
KA
V
I
I: 60.3 kDa
II: 120.6 kDa
II I
I
free FAD
mA
Um
AU
0
Results
98
during purification and GPC (I and II in Fig. 4-25 A). Additionally, the higher
mass population II showed a leading peak indicating higher order OsZDS-His6
associates. When TCEP was present throughout purification and GPC or when
OsZDS-His6 was incubated with 1 mM TCEP for 5 min after purification, only the
lower mass population I was observed (Fig. 4-25 B). The determination of the
partition coefficient KAV on calibrated columns revealed that the low mass
population I corresponded to the monomer (60.3 kDa) while the high mass
population II corresponded to the dimer (120.6 kDa) of OsZDS-His6 (Fig. 4-25
C). Dimerization and higher order oligomerization under oxidizing conditions
suggested the participation of intermolecular disulfide bonds. However, SDS-
PAGE under oxidizing conditions yielded only the monomer band of 60 kDa
(not shown), indicating oligomerization to rely on non-covalent interactions.
GPC analysis revealed that the OsZDS-His6 monomer contained FAD as
witnessed by flavin fluorescence (Fig. 4-25 B, bottom panel), suggesting that
OsZDS-His6 might in fact be active as monomer. Two experimental
approaches were chosen to further investigate the dependence of ZDS
activity on homooligomerization. First, OsZDS-His6 was purified in the presence
and absence of TCEP, yielding a purely enzyme samples of different
oligomerization (Fig. 4-25 A). Both showed identical flavinylation percentage
(35 %) and similar specific activity (0 mM TCEP: 311 pmol PL and 147 pmol PN
min-1 mg-1; 1mM TCEP: 275 pmol PL and 166 pmol PN min-1 mg-1). Second, the
specific activity of the isolated dimeric and monomeric GPC fractions (Fig. 4-
25 A) were determined individually, revealing that the dimer was 5 x more
active than the monomer (monomer: 19 pmol PL and 10 pmol PN min-1 mg-1;
dimer: 94 pmol PL and 33 pmol PN min-1 mg-1).
In conclusion, OsZDS-His6 can be enzymatically active as a monomer with the
dimer potentially fostering activity. In contrast, the homotetramer represents
the minimal oligomer required for catalytic activity in OsPDS-His6, while
monomers are inactive (Gemmecker et al., 2015).
Results
99
4.4.3 Kinetic characterization of OsZDS-His6
4.4.3.1 Basic characterization and optimization of reaction parameters
The OsZDS-His6 assay conditions were optimized regarding the added amount
of enzyme, temperature and pH (Fig. 4-26). As a starting point, assays
contained 5 mM 9,9’-di-cis-ζ-carotene and 19.25 mM DPQ and were
incubated for 30 min.
Fig. 4-26 Basic characterization of the OsZDS-His6 reaction.
(A) protein, (B) pH and (C) temperature dependency of the OsZDS-His6 reaction.
Circles, PL; squares, proneurosporene. Each experiment was carried out using the
optimum value of the respective non-variable parameter – i.e. 36 °C and pH 6.5 (A),
pH 6.5 and 25 µg ZDS (B) and 36°C and 25 µg ZDS (C). Incubation time was 30 min.
Data in (B) and (C) represent the mean of triplicates ± SEM. Measurements in (A)
were carried out once. Data were fitted with a spline.
Protein linearity for PL formation was observed up to ca. 100 µg OsZDS-His6 per
assay and up to 50 µg for the intermediate PN (Fig. 4-26 A). Thus, as observed
with OsPDS-His6, increasing protein concentrations favored end product
ZDS [µg]
v [p
mol
min
-1]
0 25 50 75 1000
5
10
15
temperature [°C]
v [p
mol
min
-1 m
g-1
]
24 28 32 36 400
200
400
600
800
pH
v [p
mol
min
-1 m
g-1
]
3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 7.50
250
500
750
1000
A B
C
Results
100
formation. Regarding temperature, PN and PL formation responded similarly
with the reaction velocity increasing up to 40 °C (Fig. 4-26 B). PN formation
showed a broad pH optimum around pH 5.5, whereas the optimum of PL
formation was shifted towards pH 6.5 – pH 7.0. Thus, the velocity of PL end
product formation dominated at pH values above 6.0 (Fig. 4-26 C). These
data define the standard conditions for OsZDS-His6 assays: 25 µg ZDS per assay
(35 µg ml-1), pH 6.5, 36 °C, 5 mM ζ-carotene and 19.25 mM DPQ (the latter in
analogy to PDS). The incubation time was 30 min.
4.4.3.2 Reaction time course of ζ-carotene conversion by OsZDS-His6
The conversion of 9,9’-di-cis-ζ-carotene into the products PN and PL was
monitored by HPLC (Fig. 4-27). The disappearance of the substrate
proceeded over 90 min (Fig. 4-27 B) and ceased after 360 min. Notably, 9-cis-
ζ-carotene was present in liposomes due to non-enzymatic isomerization and
was barely converted (Fig. 4-27 B). The formation of the intermediate PN
preceded the formation of the end product PL during the first 5 minutes (Fig.
4-27 A). Towards longer incubation than 90 min, the intermediate
approached a steady state situation while PL accumulated steadily. As for
PDS (see 4.2.1), this is typical of two-step reactions catalyzed by two enzymes
or bifunctional enzymes like OsZDS-His6 (McClure et al., 1969).
Fig. 4-27 Reaction time course of proneurosporene and prolycopene formation from
ζ–carotene by OsZDS-His6.
(A) Reaction time course of product formation and (B) reaction time course of
substrate decrease. The OsZDS-His6 reaction was conducted under standard
time [min]
caro
tene
[mM
]
0 20 40 60 800.0
0.1
0.2
0.3
0.4
time [min]
caro
tene
[mM
]
0 20 40 60 801
2
3
4
5A B
Results
101
conditions. Filled circles, PL; filled squares, proneurosporene; open circles, 9-cis-ζ-
carotene; open squares, 9,9’-di-cis-ζ-carotene. Data represent the mean of
triplicates ± SEM and were fitted with a spline.
Like with OsPDS-His6 (see 4.2.1), OsZDS-His6 activity ceased after 360 min due
to enzyme inactivation. 83 % end product formation (PL and cis-lycopenes
originating from unspecific isomerization) could be attained upon repeated
addition of fresh OsZDS-His6, and long-time incubation, with only 11 % of PN
and 6 % of the substrate 9,9’-di-cis-ζ-carotene not being converted., Thus, the
equilibrium of ζ-carotene desaturation by OsZDS-His6 is far on the product
side, as with OsPDS-His6 (see 4.2.1)
4.4.3.3 Substrate concentration dependency of the OsZDS-His6 reaction
The concentration dependency on 9,9’-di-cis-ζ-carotene and
proneurosporene was examined under DPQ saturation (19.25 mM ≈ 100 KM;
Fig. 4-28). With 9,9’-di-cis-ζ-carotene as substrate, the characteristics of
intermediate and end product formation differed substantially (Fig. 4-28 A).
Fitting with the Michaelis-Menten equation for PL formation revealed an
apparent KM of 5.6 ± 0.7 mM 9,9’-di-cis-ζ-carotene and a Vmax of 609 ± 23
pmol min-1 mg-1 PL. Saturation was reached at low ζ-carotene
concentrations. In contrast, the PN formation steadily increased so that KM
and Vmax could not be determined. This inequivalent kinetic behavior of PN
and PL formation favored intermediate release at high substrate
concentrations, i.e. the PL/PN ratio decreased from 1.5:1 to 0.4:1 with
increasing concentrations of ζ-carotene (Fig. 4-28 A). This is in accordance
with the findings with OsPDS-His6 (see 4.2.3). With PN as substrate, fitting the
formation of PL with the Michaelis-Menten equation yielded an apparent KM
of 14 ± 3 mM PN and a Vmax of 6319 ± 662 pmol min-1 mg-1 PL (Fig. 4-28 B).
Lastly, the dependency of the OsZDS-His6 reaction rate on DPQ concentration
was examined under ζ-carotene saturation (10 mM ≈ 2 KM). Again, there was
kinetic inequivalence in the formation of PL and PN (Fig. 4-28 C). PL formation
can be fitted with the Michaelis-Menten equation revealing a KM of 0.3 ± 0.1
Results
102
mM and a Vmax of 813 ± 32 pmol min-1 mg-1 PL whereas the formation of the
intermediate PN, being in steady state, barely follows Michaelis-Menten
kinetics. While PN formation dominates at low DPQ concentrations, high DPQ
supply favors end product formation with a maximum PL/PN ratio of 1:1.
Moreover, this supports that the standard DPQ concentration used (19.25
mM) is by far saturating.
In summary, high DPQ concentrations and low ζ-carotene fluxes through ZDS,
i.e. low ζ-carotene concentrations, are needed to favor the formation of the
end product PL over the intermediate PN. This is in accordance with the
findings with OsPDS-His6 (see 4.2.3).
Fig. 4-28 Substrate concentration dependencies of the OsZDS-His6 reaction rates.
(A – B) Dependency of OsZDS-His6 on the concentration of ζ-carotene (A) and
proneurosporene (B), conducted at a fixed DPQ concentration (19.25 mM; ≈ 100 x
KM). (C) Dependency of OsZDS-His6 on the DPQ concentration, conducted at a fixed
ζ-carotene concentration (10 mM; ≈ 2 x KM). Circles, PL; squares, proneurosporene;
triangles, PL/PN ratio. Data represent the mean of triplicates ± SEM. The PL:PN ratios in
9,9'-di- cis-ζζζζ-carotene [mM]
v [p
mol
min
-1 m
g-1
]
PL / P
N ratio [m
ol/mol]
0 5 10 15 20 250
400
800
1200
0
2
4
6
proneurosporene [mM]
v [p
mol
min
-1 m
g-1
]
0.0 2.5 5.0 7.5 10.0 12.5 15.00
1000
2000
3000A B
DPQ [mM]
v [p
mol
min
-1 m
g-1
]P
L / PN
ratio [mol/m
ol]
0.0 0.5 1.0 1.5 2.0 2.50
250
500
750
0.0
0.5
1.0
1.5C
Results
103
A and C (dotted lines) are plotted to the right y-axis. The data were fitted with the
Michaelis-Menten equation (goodness of fit for PL formation: A, R2 = 0.99; B, R2 = 0.99;
C, R2 = 0.97). PL/PN ratios were fitted with a spline.
4.5 ζ-Carotene isomerase ZISO
4.5.1 Substrate specificity of OsZISO-His6 in E. coli
As laid out in 1.3.2, ZISO is the most recently identified and least examined
enzyme involved in the poly-cis pathway of carotene desaturation. It is the
only integral membrane protein in the pathway and shares no homology with
other plant enzymes (Chen et al., 2010). ZISO catalyzes the isomerization of
the PDS product 9,15,9’-tri-cis-ζ-carotene to form the ZDS substrate 9,9’-di-cis-
ζ-carotene when co-expressed with PDS in E. coli (Li et al., 2007; Chen et al.,
2010). Interestingly, PDS is an isomerase itself. Concomitant with desaturation,
PDS isomerizes the C9-C10 double bond from trans to cis, yielding 9,15,9’-tri-
cis-ζ-carotene from 15-cis-phytoene (Fig. 4-29). Considering this, we reasoned
whether ZISO is really an independent, bona fide enzyme. Alternatively, ZISO
might represent a membrane-integral scaffolding protein that interacts with
PDS, thereby enabling PDS to isomerize the C15-C15’ double bond. Thus, the
in vivo assay of Chen et al. (2010) is not sufficient for a definite
characterization of ZISO as enzyme. In order to address this question, we
aimed at establishing expression of OsZISO-His6 in E. coli and an in vitro assay
for ζ-carotene isomerization in the presence of OsPDS and in its absence.
First attempts of functional ZISO expression in ζ-carotene producing E. coli
failed because no isomerization of tri-cis-ζ-carotene to di-cis-ζ-carotene was
observed (“ζ-carotene + control / ZISO” in Fig. 4-29 A). Since ZISO is a
predicted transmembrane protein, it might not have integrated into
membranes in the absence of an appropriate signal peptide. Consequently,
the Mistic protein from Bacillus subtilis, a membrane insertion facilitator
(Roosild et al., 2005), was fused to the N-terminus of OsZISO-His6 via a flexible
peptide linker. In fact, Mistic-OsZISO-His6 proved to be functional in E. coli and
Results
104
9,15,9’-tri-cis-ζ-carotene was almost completely isomerized to 9,9’-di-cis-ζ-
carotene (“ζ-carotene + Mistic-ZISO” in Fig. 4-29 A).
Fig. 4-29 Cis-to-trans isomerization of the 15-cis double bond in ζ-carotene,
phytofluene and phytoene in E. coli upon coexpression of PDS and ZISO.
(A) Isomerization of 9,15,9’-ζ-carotene to 9,9‘-di-cis-ζ-carotene and (B) of 9,15-di-cis-
phytofluene to 9-cis-phytofluene upon co-expression of PDS and Mistic-OsZISO-His6.
(C) Isomerization of 15-cis-phytoene to all-trans-phytoene upon expression of Mistic-
A
min
min
mA
U40
0nm
0 1 2 3 4 5 6 7 8 9
9,9‘-di- cis-ζ-carotene
9,15,9‘-tri- cis-ζ-carotene
ζ-carotene + Mistic-ZISO
ζ-carotene + control / ZISO
398 nm422
377
295
9,15,9‘-tri- cis-ζ-carotene
400 nm424
379
0 1 2 3 4 5 6 7 8 9
mA
U33
1nm
phytofluene + Mistic-ZISO
phytofluene + control / ZISO9,15,9‘-tri-cis-ζ-carotene
9,9‘-di-cis-ζ-carotene
348 nm366
331
9-cis-phytofluene
347 nm366
331
254
9,15-di- cis-phytoflueneB
285 nm
15-cis-phytone
0 1 2 3 4 5 6 7 8 9min
mA
U28
5nm
15-cis-phytoene /all- trans-phytoene
phytoene + Mistic-ZISO
phytoene + control / ZISO
285 nm
all- trans-phytoeneC
9,9‘-di- cis-ζ-carotene
Results
105
OsZISO-His6. The UV/VIS spectra of the substrates and products are given as insets.
“Mistic-ZISO” denotes the expression of Mistic-OsZISO-His6 in E. coli, “control / ZISO
“denotes the expression of the empty vector or of unfunctional OsZISO-His6 in E. coli.
9,15,9‘-tri-cis-ζ-carotene was obtained from PDS assays, 9,9‘-di-cis-ζ-carotene from
tangerine tomato fruit. The 15-cis-/all-trans-phytoene mixture was obtained by
exposing purified 15-cis-phytoene to light. HPLC system 1 was used for separation.
Interestingly, also 9,15-di-cis-phytofluene that accumulated as a precursor of
tri-cis-ζ-carotene, was isomerized to presumably 9-cis-phytofluene (Fig. 4-29 B).
In contrast, expressing ZISO in 15-cis-phytoene-producing E. coli did not result
in detectable isomerization activity.
4.5.2 Reconstitution of the poly-cis pathway of carotene desaturation
The functional expression of ZISO allows revisiting the results of Bartley et al.
(1999). The partial reconstitution of the poly-cis pathway of carotene
desaturation achieved by expressing AtPDS and AtZDS in phytoene-
producing E. coli revealed photoisomerization of ζ-carotene as a rate limiting
step existing between the PDS and ZDS reaction. At the time, the authors
hypothesized that efficient carotenogenesis required the existence of a ζ-
carotene isomerase – now probably identified as ZISO by Li et al. (2007). To
evaluate whether photoisomerization of the photolabile 15-cis double bond in
9,15,9`-ζ-carotene would be as effective as ZISO in driving the pathway flux
through PDS and ZDS towards completion, i.e. PL formation, ζ-carotene isomer
composition in E. coli was assessed in the presence of either ZISO, in the dark
or under continuous light during growth (Fig. 4-30). Analysis of the carotene
patterns revealed that OsPDS and OsZDS in the dark led to the predominant
accumulation of 9,15,9’-tri-cis-ζ-carotene and 9,15-di-cis-phytofluene (Fig. 4-
30 “control”). Only minor amounts of the ZDS substrate 9,9’-di-cis-ζ-carotene
and of PL were formed. Upon strong light exposure, the significant amounts of
9,9’-di-cis-ζ-carotene formed by photoisomerization allowed substantial
formation of PL by OsZDS. Furthermore, strong unspecific isomerization of 9,15-
di-cis-phytofluene to presumably 9-cis-phytofluene and of PL to several
Results
106
unspecific cis-lycopene isomers was observed. In the presence of Mistic-
OsZISO, only a small proportion of tri-cis-ζ-carotene was left in the dark and
9,9’-di-cis-ζ-carotene was converted to PL by OsZDS even more effectively
than upon photoisomerization (compare ratio of PL/9,9’-di-cis-ζ-carotene for
“light” and “Mistic-ZISO” in Fig. 4-30). Moreover, almost no unspecific
isomerization of PL and phytofluene was observed.
Fig. 4-30 Pathway flux from 15-cis-phytoene to prolycopene in E. coli upon co-
expression of OsPDS, OsZDS and Mistic-OsZISO and in dependency on light.
Control, OsPDS and OsZDS were co-expressed and E. coli was grown in the dark;
Light, OsPDS and OsZDS were co-expressed and E. coli was grown under continuous
white light (800 µmol photons m-2 sec-1); Mistic-OsZISO, OsPDS, OsZDS and Mistic-
OsZISO were coexpressed and E. coli was grown in the dark. 1, lycopene isomers; 2,
prolycopene; 3, proneurosporene; 4, 9,15,9‘-tri-cis-ζ-carotene; 5, 9,9‘-di-cis-ζ-
carotene; 6, 9,15-di-cis-phytofluene; 7, 9-cis-phytofluene. Carotenes were identified
based on their UV/VIS spectra, given in Fig. 4-32 and Fig. 4-33. HPLC system 3 was
used for separation.
4.5.3 Isomerization of 9,15,9’-tri-cis-ζ-carotene by ZISO in vitro
As laid out in 4.5.1, ZISO can only be postulated as a bona fide enzyme if it
isomerizes ζ-carotene in vitro, in the absence of PDS and all other
carotenogenic enzymes. Therefore, having achieved functional ZISO
15P
control
Mistic-ZISO
light
5 6 7 8 9 10 11 12 13
mA
U30
0-50
0 nm
min
1 2 3 4 5 6 7
Results
107
expression in E. coli, a liposomal ZISO in vitro assay was established using
Mistic-ZISO-containing cell lysate as enzyme source.
First, Mistic-ZISO was added to PDS assays to show that Mistic-ZISO remains
active after cell disruption. Accordingly, as given in Fig. 4-31, the tri-cis-ζ-
carotene produced by PDS was readily and specifically isomerized to the di-
cis isomer (see “PDS assay” and PDS assay + Mistic-ZISO” in Fig. 4-31). When
omitting PDS and directly incorporating the ZISO substrate 9,15,9’-tri-cis-ζ-
carotene into liposomes, isomerization of the 15-cis double bond to trans
occurred as well – although to a smaller extent than in the presence of PDS
(Fig. 4-31). This observation unequivocally shows that ZISO is an isomerase.
Fig. 4-31 Cis-to-trans isomerization of the 15-cis double bond of 9,15,9’-tri-cis-ζ-
carotene by Mistic-OsZISO-His6 in vitro.
The isomerization of 9,15,9’-tri-cis-ζ-carotene was assessed by HPLC under the
following conditions: PDS, PDS in vitro assay yielding 9,15,9’-tri-cis-ζ-carotene from 15-
cis-phytoene; PDS assay + Mistic-ZISO, PDS in vitro assay upon the initial addition of
Mistic-OsZISO-His6-containing cell lysate;. 9,15,9’-tri-cis-ζ-carotene, incubation of
liposomes containing 9,15,9’-tri-cis-ζ-carotene; 9,15,9’-tri-cis-ζ-carotene + Mistic-ZISO,
incubation of liposomes containing 9,15,9’-tri-cis-ζ-carotene upon the addition of
Mistic-OsZISO-His6-containing cell lysate. The UV/VIS spectra of the substrate and
product are given as insets. HPLC system 1 was used for separation.
0 1 2 3 4 5 6 7 8 9
mA
U400nm
PDS assay
400 nm424
379
398 nm422
377
295
PDS assay + Mistic-ZISO
9,15,9‘-tri- cis-ζ-carotene
9,15,9‘-tri- cis-ζ-carotene + Mistic- ZISO
min
9,15,9‘-tri- cis-ζ-carotene9,9‘-di- cis-ζ-carotene
Results
108
At the time of obtaining these results, Beltrán et al. (2015) reported on the
native purification of ZISO, its independent enzymatic activity, its cofactor
requirements and postulated a reaction mechanism for heme b – dependent
isomerization. Given this situation, further research on ZISO in the framework of
this thesis was discontinued.
4.6 Apocarotenoids derived from the poly-cis pathway of carotene
desaturation
Acyclic apocarotenoids that might originate from carotenoid cleavage
dioxygenase (CCD)-mediated cleavage of poly-cis-configured carotene
desaturation intermediates are thought to be involved in the regulation of
carotenogenesis (Kachanovsky et al., 2012) and plant development
(Avendaño-Vázquez et al., 2014). If true, this might shed light on the
conundrum as to why plants have evolved a complex poly-cis pathway of
carotene desaturation (see 1.3). However, both of these studies are based on
observations made in plant mutants and lack the biochemical evidence for
the existence, let alone the identity of regulatory acyclic apocarotenoids.
Moreover, the cleavage specificity of CCDs for poly-cis-configured acyclic
carotenes has not been investigated.
Having established in vitro assays in our laboratory for all canonical CCDs from
Arabidopsis – namely AtCCD1, 4, 7 and 8 – we aimed at establishing the
purification of all plant-specific canonical cis-configured carotene
desaturation intermediates (see 1.3 and Fig. 1-2) and of some non-canonical
isomers in order to assay their CCD-mediated cleavage in vitro. This should
allow identifying yet unknown acylic apocarotenoids, representing potential
signaling molecules (or their precursors) whose existence has been postulated
(Kachanovsky et al., 2012; Avendaño-Vázquez et al., 2014). Carotene
desaturation intermediates are water-insoluble, plastid-localized C40
carotenes. Consequently, a CCD catalyzing the primary carotenoid
Results
109
cleavage en route to the postulated regulatory apocarotenoid is expected
to reside in plastids and to be capable of converting C40 carotenes. AtCCD4
and AtCCD7 fulfill both prerequisites (Bruno et al., 2016; Bruno et al., 2014) and
were therefore investigated as candidates for primary cleavage of acyclic
poly-cis carotenes (see 4.2.1 and 4.2.2). In contrast, AtCCD1 and AtCCD8 are
not candidates and were not investigated: AtCCD1 resides in the cytosol
(Walter and Strack, 2011) and AtCCD8 is highly specific for 9-cis-β-apo-10’-
carotenal, the substrate for strigolactone biosynthesis (Alder et al., 2012).
4.6.1 AtCCD4-mediated cleavage of acyclic poly-cis carotenes
Mutant analysis and phenotypic observations by Avendaño-Vázquez et al.
(2014) suggest that cis-ζ-carotene or cis-phytofluene is cleaved by AtCCD4 in
Arabidopsis. Thus, AtCCD4 cleavage activity was first tested using four ζ-
carotene isomers as substrates (Fig 1 A). These were the canonical PDS
product 9,15,9’-tri-cis-ζ-carotene and 9,9’-di-cis-ζ-carotene formed in planta
by ZISO. Furthermore, 9-cis-ζ-carotene was used since other 9-cis-configured
carotenoids give rise to signaling molecules such as ABA and strigolactones
(see 1.2.3) and all-trans-ζ-carotene was assayed as well. However, none of
these substrates was cleaved (Fig. 4-32 A), in contrast to the positive control
that relied on the well documented cleavage of β-apo-8-carotenal (Bruno et
al., 2016; not shown). Likewise, the four phytofluene isomers used were not
converted by AtCCD4: the canonical PDS intermediate 9,15-di-cis-
phytofluene, 9-cis-, 15-cis- and all-trans-phytofluene (Fig. 4-32 B).
Consequently, these in vitro data do not support the notion of Avendaño-
Vázquez et al. (2014) that a regulatory apocarotenoid originates from these
carotenes by CCD4-mediated primary cleavage.
Results
110
0 5 10 15 20 25 30 35 40
con
all-trans-ζ-carotene
AtCCD4
mA
U 4
00-4
50 n
m
5 10 15 20 25 30 35 40
con
9-cis-ζ-carotene
AtCCD4
5 10 15 20 25 30 35 40
con
9,9‘-di-cis-ζ-carotene
AtCCD4
A
con
9,15,9‘- tri-cis-ζ-carotene
5 10 15 20 25 30 35 40
AtCCD4
400 nm424
379
400 nm424
379
400 nm424
379
398 nm422
377
295286
0 5 10 15 20 25 30 35min
mA
U 3
50 n
m
con
9,15-di-cis-phytofluene
AtCCD4
con
AtCCD4
9-cis-phytofluene
conAtCCD4
all-trans-phytofluene
B 347 nm
366331
254
348 nm366
3315 10 15 20 25 30 35
5 10 15 20 25 30 35
min
Results
111
Fig. 4-32 HPLC analysis of AtCCD4 activity with carotene desaturation intermediates.
(A) Cleavage of (A) ζ-carotene isomers, (B) phytofluene isomers, (C)
proneurosporene, (D) prolycopene and (E) 9’-cis-neurosporene by AtCCD4. The
UV/VIS spectra of the substrates are given as insets. β-apo-8-carotenal served as a
positive control for AtCCD4 activity and was readily cleaved (not shown). HPLC
system 7 was used for A – D, HPLC system 9 was sued for E. For structures of substrates,
see Fig. 4-37.
Taking also into account that Kachanovsky et al. (2012) suggested a cis-
neurosporene- or cis-lycopene-derived signal, AtCCD4 activity with the
canonical ZDS products 7,9,9’-tri-cis-neurosporene (proneurosporene) and
7,9,7’,9’-tetra-cis-lycopene (prolycopene) was investigated. Moreover, 9’-cis-
neurosporene – produced as a byproduct from proneurosporene by CRTISO
(Isaacson et al., 2004; Yu et al., 2011) – was assayed. However, the enzyme
did not cleave any of these substrates (Fig. 4-32 C-E). Thus, our data speak
against cis-neurosporene or cis- lycopene cleavage by CCD4 as the origin of
an unidentified signaling molecule.
C
5 10 15 20 25 30 35 40
con
AtCCD4
proneurosporene 430 nm407
437 nmD
0 5 10 15 20 25 30 35 40
con
prolycopene
AtCCD4
mA
U 4
00 n
m
E
0 5 10 15 20 25
mA
U 4
50-5
00 n
m 9‘-cis-neurosporene
conAtCCD4
440 nm
469
416
min
min
Results
112
4.6.2 AtCCD7-mediated cleavage of acyclic poly-cis carotenes
AtCCD7 is well known to be specific for 9-cis-β-carotene cleaving at C9=C10.
This represents the initial step of strigolactone (SL) biosynthesis (Al-Babili and
Bouwmeester, 2015). The enzyme shows only minor activity with all-trans-β-
carotene and xanthophylls (Bruno et al., 2014). Its specificity towards acyclic
carotenes has not yet been investigated. Given the recurrent motif of 9-cis-
carotenoids being phytohormone precursors such as SLs and ABA (see above
and 1.2.3), AtCCD7 appears to be a prime candidate for the cleavage of
acyclic cis-carotenes of the desaturation pathway since all carry 9-cis-
configured double bonds (Fig. 4-33).
Consequently, we first assayed AtCCD7 with the four ζ-carotene isomers, with
9-cis-ζ-carotene amongst them (Fig. 4-33 A). Strikingly, 9-cis-ζ-carotene was
efficiently cleaved by AtCCD7 yielding the product P1 (Fig. 4-33 A)
accompanied by small amounts of additional products with
chromatographic and spectral similarity with P1 (Fig. 4-33 A, asterisks). Most
likely, they arise from P1 by non-enzymatic cis-trans isomerization upon sample
processing. In contrast, AtCCD7 did not convert any of the canonical
carotene desaturation intermediates 9,15,9’-tri-cis-, 9,9’-di-cis- and all-trans-ζ-
carotene (Fig. 4-33 A). Traces of product P1 upon incubation with these
isomers were most likely due to cross contamination with certain amounts of
the 9-cis isomer (Fig. 4-33 A, Ϯ). The sole exception is minor cleavage of all-
trans-ζ-carotene yielding product P1*, most likely the trans-isomer of P1.
Results
113
D
5 10 15 20 25 30
con
all-trans-lycopene
AtCCD7
10 20 30 40
con
9,9‘-di-cis-ζ-carotene
AtCCD7
P1Ϯ
con
9,15,9‘-tri-cis-ζ-carotene
AtCCD7
P1Ϯ
mA
U 4
00-7
00 n
m
con
9‘-cis-neurosporene
AtCCD7
P1
440 nm
469
416
B
5 10 15 20 25 30
mA
U 4
00-4
50 n
m
C
5 10 15 20 25 30
min
con
9-cis-lycopene
AtCCD7
P2P3
460 nm455 nm 466 nm
496440
360Ϯ
A
10 20 30 40
con
9-cis-ζ-carotene
AtCCD7
P1
* * *
428 nm
P1
0 10 20 30 40
min
10 20 30 40
P1 P1*con
all-trans-ζ-carotene
AtCCD7
0
400 nm424
379
398 nm
422377
295
400 nm
424
379
400 nm
424
379
471 nm
502445
Results
114
Fig. 4-33 HPLC analysis of AtCCD7 activity with canonical carotene desaturation
intermediates and 9-cis-isomers.
(A) Cleavage of ζ-carotene isomers by AtCCD7. Ϯ indicates 9-cis-ζ-carotene cross
contaminations. * indicates non-enzymatic isomerisation products of P1, including
P1*. (B – D) Cleavage of 9’-cis-neurosporene, 9-cis-lycopene and all-trans-lycopene
by AtCCD7, respectively. Ϯ in C indicates the appearance of the all-trans-isomer of
lycopene by spontaneous cis-to-trans isomerization. (E – G) Cleavage of phytofluene
isomers, proneurosporene and prolycopene by AtCCD7. UV/VIS spectra of the
substrates are given as insets or in Fig. 4-32. UV/VIS spectra of the products P1, P2 and
AtCCD7
AtCCD7
AtCCD7
mA
U35
0 nm
con
con
9-cis-phytofluene
9,15-di-cis-phytofluene
min0 10 20 30
all-trans-phytofluene
con
10 20 30
10 20 30
E
0 10 20 30 40
min
mA
U40
0-50
0 nm
prolycopene
con
AtCCD7
con
AtCCD7
proneurosporene
10 20 30 40
F
G
Results
115
P3 are given as insets. Note the relatively small product peaks in relation to substrate
decrease, caused by drastically lower extinction coefficients for the products
compared to the carotene substrates. HPLC system 9 was used for B, HPLC system 8
for C and D and HPLC system 7 was used for A, E, F and G. For structures of the
substrates, see Fig. 4-7.
This observation prompted us to assay other non-canonical 9-cis-configured
linear carotenes. Indeed, minor cleavage of 9’-cis-neurosporene, produced
from proneurosporene (7,9,9´-tri-cis-neurosporene) by CRTISO (Isaacson et al.,
2004; Yu et al., 2011) yielded product P1 (Fig. 4-33 B). Moreover, 9-cis-
lycopene was converted and products P2 and P3 were formed. They
displayed similar chromatographic and spectral characteristics and
presumably represent geometric isomers of each other arising from non-
enzymatic cis-trans isomerization (Fig. 4-33 C). Consistently, all-trans-lycopene
was not cleaved (Fig. 4-33 C) so that 9-cis specificity of AtCCD7 indeed
persists for linear carotenes. As observed for the canonical, poly-cis-
configured ζ-carotene isomers, AtCCD7 did not convert proneurosporene
(Fig. 4-33 F), prolycopene (7,9,7’,9’-tetra-cis-lycopene; Fig. 4-33 G) and 9,15-
di-cis-phytofluene as canonical carotene desaturation intermediates. In
addition, the non-canonical 9-cis-, 15-cis- and all-trans-isomer of phytofluene
were not recognized as substrates (Fig. 4-33 E).
In summary, AtCCD7 readily cleaves the non-canonical 9-cis isomers of ζ-
carotene and to a smaller extent of neurosporene and lycopene – whereas
the all-trans-species and the enzymatically formed poly-cis-configured
species of these carotenes are not cleaved.
4.6.3 Identification of apocarotenoids originating from acyclic 9-cis-
carotenes by AtCCD7 cleavage
The products derived from 9-cis-ζ-carotene (P1) and 9-cis-lycopene (P2, P3)
were collected from HPLC and subjected to LC-MS analysis for identification
Results
116
based on molecular masses and assuming that a canonical oxygenase
cleavage had occurred, leading to apocarotenoids with one incorporated
oxygen atom.
Fig. 4-34 Identification of the 9-cis-ζ-carotene cleavage product formed by AtCCD7
using LC-MS and GC-MS.
(A) LC-MS analysis of the HPLC-purified 9-cis-ζ-carotene cleavage product P1
including minor byproducts (see Fig. 4-33 A, asterisks). UV/VIS spectra are depicted in
insets. (B) GC-MS head space analysis of AtCCD7 assays with 9-cis-ζ-carotene and
an authentic geranylacetone standard. Spectral comparison was carried out with
the NIST 2.0 database. (C) Cleavage pattern of 9-cis-ζ-carotene by AtCCD7 and
structure of the cleavage products. For structures of the substrates, see Fig. 4-7.
O
geranylacetone
A
C
C9‘
9-cis-ζ-carotene
C10‘
B
6 8 10 12 14
min
Rel
ativ
e in
tens
ity 10.69
geranylacetone STD
10.67 m/z 69; 194
AtCCD7control
RT: 7.91
360 380 400
m/z
Rel
ativ
e A
bund
ance
C27H39O
379.2994RT: 7.86
360 380 400
m/z
Rel
ativ
e A
bund
ance
379.2993C27H39O
m/z 379.29954 (± 5 ppm)
7.6 7.8 8.0 8.2 8.4min
Rel
ativ
e A
bund
ance
7.91
7.86
419 nm412 nm
RT: 7.86 RT: 7.91
O
P1: 9-cis-ζ-apo-10‘-carotenal
C9
C10
C27H38O; m/z 378.29227
C13H22O; m/z 194.16707
60 80 100 120 140 160 180 200
m/z
69.11
151.13107.15 136.18
93.10 125.1683.1153.07
161.19 176.24194.28
Rel
ativ
e in
tens
ity
O
geranylacetone
C13H22O
AtCCD7
Results
117
Product P1 originating from 9-cis-ζ-carotene (Fig. 4-33 A) was analyzed. Two
product peaks with very similar chromatographic and spectral characteristics
as well as isobaric masses were detected by LC-MS suggesting their
spontaneous cis-trans interconversion upon sample processing (Fig. 4-34 A).
The molecular mass corresponded to C27H38O and P1 was therefore identified
as ζ-apo-10-carotenal (Fig. 4-34 A). Given the cleavage specificity of AtCCD7
for the C9-C10 double bond localized in the trans half-side of its 9-cis-
configured substrate (Bruno et al., 2014), the product P1 was identified as 9-
cis-ζ-apo-10’-carotenal (Fig. 4-34 C). Accordingly, P1* originating from minor
all-trans-ζ-carotene cleavage (Fig. 4-33 A) most likely represents the all-trans
species. To further corroborate these findings, we analyzed the head space of
AtCCD7 assays with 9-cis-ζ-carotene by GC-MS. As expected, we detected
and identified the second, volatile product arising from C9-C10 cleavage,
namely geranylacetone (Fig. 4-34 B). Taken together, AtCCD7 cleaved 9-cis-
ζ-carotene at C9-C10 to yield 9-cis-ζ-apo-10’-carotenal and geranylacetone
(Fig. 4-34 C). Accordingly, the minor cleavage activity with 9’-cis-
neurosporene yielded 9-cis-ζ-apo-10’-carotenal as well (Fig. 4-33 B).
Using the same experimental approach, the products P2 and P3 obtained
upon incubation of AtCDD7 with 9-cis-lycopene were identified. Product P2
was shown to co-elute with authentic all-trans-apo-10-lycopenal (Fig. 4-35 A).
The two products possessed isobaric masses corresponding to C27H36O,
confirming both cleavage products as apo-10-lycopenal (Fig. 4-35 B). Given
the cleavage specificity of AtCCD7 (Bruno et al., 2014), P3 was identified as 9-
cis-apo-10’-lycopenal. This is assumed to represent the main cleavage
product of AtCCD7 that readily isomerizes non-enzymatically to all-trans-apo-
10’-lycopenal (P2) under assay conditions and during sample processing. This
is corroborated by the observation that the 9-cis double bond in lycopene
readily isomerized to trans (Fig. 4-35 A, Fig. 4-33 C).
Results
118
Fig. 4-35 Identification of the 9-cis-lycopene cleavage product formed by AtCCD7
using LC-MS.
(A) The chromatographic behavior of the 9-cis-lycopene cleavage products P2 and
P3 (see Fig. 4-33 C for UV/VIS spectra) was compared to authentic all-trans-apo-10’-
lycopenal. HPLC system 8 was used for separation. (B) LC-MS analysis of HPLC-
purified P2 and P3. (C) Cleavage pattern of 9-cis-ζ-carotene by AtCCD7 and
structure of the cleavage products. For structures of the substrates, see Fig. 4-7.
Taken together, the results support that AtCCD7 cleaves 9-cis-lycopene at
C9-C10 yielding 9-cis-apo-10’-lycopenal and the volatile pseudoionone (Fig.
AtCCD7
min0 10 20 30
P2P3
9-cis-lycopene m
AU
400-
500n
m
all-trans-apo-10-
lycopenal
P2
P3
mA
U40
0-50
0nm
7 8 9 10min
376.5 377.0 377.5 378.0
m/z
Rel
ativ
e A
bund
ance
377.3531377.2839C27H37O
377.3530
apo-10-lycopenal STD
P2
P3
377.2835C27H37O
377.2836C27H37O
m/z 377.28389
A B
pseudoiononeC9‘
9-cis-lycopene
C10‘
P3: 9-cis-apo-10‘-lycopenal
C9
C10
C27H36O; m/z 376.27662
C13H20O; m/z 192.15142
[M+H]+
C
C9
C10
Results
119
4-35 C), although the latter could not be detected by GC-MS. This is in
accordance with C9-C10 cleavage of 9-cis-ζ-carotene and 9’-cis-
neurosporene as given above. Consequently, AtCCD7 maintained its regio-
specificity of cleavage and its 9-cis-specificity (Bruno et al., 2014) when
incubated with acyclic carotenes. Nevertheless, it needs to be emphasized
that cleavage of the 9’-cis-neurosporene and -lycopene was very weak
compared to 9-cis-ζ-carotene. The newly identified 9-cis-ζ-apo-10’-carotenal
and -lycopenal formed by AtCCD7 can be considered as potential
precursors of the postulated regulatory apocarotenoid(s) (Kachanovsky et al.,
2012; Avendaño-Vázquez et al., 2014).
4.6.4 Secondary cleavage of 9-cis-ζ-apo-10’-carotenal by AtCCDs
In order to exert signaling function, apocarotenoids need to attain increased
polarity to move between aqueous cell compartments. Since C27
apocarotenoids such as 9-cis-ζ-apo-10’-carotenal and 9-cis-apo-10’-
lycopenal are very hydrophopobic, further modification, e.g. cleavage by
CCDs, is required to give rise to a signaling molecule. This is exemplified by the
biosynthesis of strigolactones (see 1.2.3). The initial cleavage of 9-cis-β-
carotene by AtCCD7 to form 9-cis-β-apo-10’-carotenal is followed by further
cleavage, cyclization and oxygenation by AtCCD8 form carlactone, the
universal strigolactone precursor capable of leaving the plastid (Alder et al.,
2012) It is conceivable that 9-cis-ζ-apo-10’-carotenal and 9-cis-apo-10’-
lycopenal follow the same track being converted by AtCCD8 into
strigolactone-like compounds. Consequently, 9-cis-ζ-apo-10’-carotenal was
HPLC-purified from AtCCD7 assays and then subjected to AtCCD8 assays (Fig.
4-36). However, despite repeated approaches no conversion was achieved
(Fig. 4-36), whereas the strigolactone precursor 9-cis-β-apo-10’-carotenal in
the positive control was readily converted into carlactone (not shown).
Alternatively, further cleavage by AtCCD1 and AtCCD4, both known for their
ability to convert apocarotenoids, was taken into consideration. Amongst the
Results
120
two CCDs, only AtCCD1 cleaved the substrate as witnessed by the
disappearance of the substrate (Fig. 4-36). However, no obvious cleavage
product with an absorption in the wavelength range of 250 – 400 nm
appeared upon HPLC analysis. This is attributed to the known fact that CCD1
has broad substrate and regio-specificity regarding cleavage, leading to
complete substrate degradation (Walter and Strack, 2011).
Fig. 4-36 Cleavage of 9-cis-ζ-apo-10’-carotenal by AtCCD 1, 4 and 8.
The UV/VIS spectrum of the substrate is given as inset, for its structure see Fig. 4-34 C.
HPLC system 7 was used for separation and for purification of the apocarotenal.
The same approach was used with 9-cis-apo-10’-lycopenal. Given the minor
cleavage activity of AtCCD7 with 9-cis-lycopene, the yield of the
apolycopenal first needed to be optimized. Unfortunately – despite much
experimental variation – the yields remained too low for assaying the
apocarotenoids conversion by AtCCDs.
5 10 15 20 25 30 350 40
mA
U42
8 n
m
con
AtCCD1AtCCD4
AtCCD8
9-cis-ζ-apo-10‘-carotenal
428 nm
min
Results
121
Fig. 4-37 Structures of acyclic carotene substrates tested for AtCCD4 and AtCCD7.
(I), 9,15-di-cis-phytofluene, (II) 9-cis-phytofluene, (III) all-trans-phytofluene, (IV) 9,15,9’-
tri-cis-ζ-carotene, (V) 9,9’-di-cis-ζ-carotene, (VI) 9-cis-ζ-carotene, (VII) all-trans-ζ-
carotene, (VIII) 7,9,9’-tri-cis-neurosporene, (IX) 9’-cis-neurosporene, (X) 7,9,7’,9’-tetra-
cis-lycopene, (XI) all-trans-lycopene, (XII) 9-cis-lycopene. Scissors indicate cleavage
positions at the C9-10 or C9’-10’ double bonds for AtCCD7, scissors in light grey
indicate minor cleavage activity of AtCCD7. AtCCD4 did not cleave any of the
substrates.
II
9
10
VII
10‘IV
9‘
15 15‘
9 10
V
9‘
10‘910
VIII
910 9‘
10‘
78
XI
9
10
XII
X 7‘
99‘
7
VI
910
CCD7
CCD7
I
910
1515‘
III
9‘IX
10‘CCD7
Discussion
122
5 Discussion
5.1 Phytoene desaturase PDS: evaluation of implications deduced
from the OsPDS-His6 structure
The crystal structure of OsPDS-His6 has been resolved at a 2.77 Å resolution (in
collaboration with the team of Prof. Dr. Einsle, Department of Chemistry,
University of Freiburg) and was published recently (Brausemann et al., 2017).
However, resolved structures often raise questions on function which can only
be addressed by drawing educated conclusions in the absence of functional
investigations. It is one incentive of this thesis to complement the implications
made by providing experimental data.
5.1.1 OsPDS-His6 is a monotopic membrane protein
The OsPDS-His6 structure revealed a membrane binding domain consisting of
an uncharged surface area around the substrate cavity entrance,
surrounded by a ring of positively charged residues compensating for the
negative charge of phospholipids. These features are typical of monotopic
membrane proteins (Brausemann et al., 2017 and references therein). In line
with this, OsPDS-His6 could be purified as soluble in the absence of detergents
but it attached spontaneously to phosphatidylcholine liposomes. This was
found to be independent of the presence of the membrane-soluble
substrates phytoene and DPQ (Fig. 4-1). OsPDS-His6 could not be detached
from the proteoliposomes by high salt treatment (Fig. 4-1); membrane
solubilization by detergents was required for this purpose. Thus, the uncharged
surface area interacts hydrophobically with the membrane core. Freeze
fracture electron microscopy of proteoliposomes revealed no sign of
membrane spans (Fig. 4-2); their absence is also supported by hydropathy
plots. The protein is attached to the membrane surface, interacting with only
one lipid layer.
Discussion
123
5.1.2 OsPDS-His6 employs an unprecedented “flavin only” reaction
mechanism during carotene desaturation
The active site of OsPDS-His6, i.e. the portion of the substrate cavity that
surrounds the redox-active isoalloxazine moiety of FAD in a 8 Å radius,
contains only few charged residues (Fig. 4-5 A). Only Arg300 might be in an
appropriate distance (~ 4 Å) to potentially make a functional contribution.
This lack of charged residues is unprecedented in flavin dehydrogenases
implying that PDS, unlike the inhomologous bacterial phytoene desaturase
CrtI (Schaub et al., 2012), does not employ an acid-base component in its
carotene desaturation reaction mechanism. Accordingly, and in contrast to
CrtI, no deuterium incorporation into carotene desaturation products could
be observed in a D2O environment (Fig. 4-6; Schaub et al., 2012). Moreover,
Arg300 to Ser mutagenesis demonstrated that the enzyme retained enzymatic
activity at lowered levels. This shows that Arg300 is not catalytically essential.
Accordingly, Hydrilla PDS maintains substantial activity when the Arg300
homolog is substituted by virtually any other proteinogenous amino acid
(Arias et al., 2006). The reduced activity of the mutant might however
indicate an ancillary function of Arg300 such as polarizing the carotene π
electron system, thereby facilitating desaturation of the adjacent C11-C12
site. Thus, two “flavin only” reaction mechanisms in which the redox-reactive
N1-N5 functionalities of the isoalloxazine act as sole catalysts conceivably
carry out the trans-desaturation of phytoene at position C11-C12 and trans-
to-cis isomerization at position C9-C10 (Fig. 4-5; Brausemann et al., 2017).
5.1.3 OsPDS-His6 follows an ordered ping pong bi bi mechanism
OsPDS-His6 is equipped with a single exceptionally long hydrophobic substrate
cavity (~ 43 Å). Modeling suggests (Fig. 4-3) that it can entirely accommodate
the carotene substrates as well as the co-substrate PQ, but it cannot bind
them simultaneously. This implies an ordered ping pong bi bi mechanism: PDS
desaturates phytoene, expels phytofluene and then accommodate the PQ
Discussion
124
required for reoxidation of the FADred formed. The PQH2 formed leaves the
cavity to allow another round of carotene desaturation.
The findings presented are compatible with this notion. First, one round of
phytoene desaturation occurred in the absence of PQ indicating that
simultaneous binding of both substrates is not required (see 4.1.4).
Phosphatidylcholine from a natural source (soybean) was used in this
experiment so that quinone impurities cannot be excluded. However, using
TritonX100 for substrate solubilization instead of the lipid gave the same result.
Second, the intermediate phytofluene is detectable and, thus, in fact
released from OsPDS-His6 into liposomal membranes. The third indication
comes from NFZ inhibition. NFZ presumably occupies the PQ binding site within
the substrate cavity that accommodates phytoene as well. Nevertheless, NFZ
was found to only compete with DPQ but not with phytoene (Fig. 4-19), an
observation that is explicable by the sequential binding of the two substrates.
Given an ordered ping pong bi bi mechanism, the thermodynamics of
carotene desaturation and PQ reduction come into question. The findings
presented support that PQ is only required for FADred reoxidation to allow
repeated desaturation cycles. The independence of both partial reactions,
namely carotene desaturation and PQ reduction, demonstrates that both
represent exergonic processes. This contradicts the long standing hypothesis
that the endergonic process of phytoene desaturation requires coupling to
the photosynthetic redox chain in chloroplasts or to a respiratory redox chain
in chromoplasts as exergonic processes involving PQ (see 1.3.1.1). The
exergonic character of the “flavin only” mechanism is corroborated by the
observations that the equilibrium of the OsPDS-His6 reaction is far on the side
of the end product ζ-carotene (see 4.2.1). Thus, the dependence of PDS
activity on the plastid PQ redox state (Nievelstein et al., 1995) should rather be
viewed in the context of a kinetic control PQ exerts on FADred reoxidation that
is required for the progression of the overall reaction.
Discussion
125
It remains to be elucidated how the ordered ping pong bi bi mechanism is
achieved, i.e. how preferential carotene substrate binding prior to PQ binding
is orchestrated. It is conceivable that the FAD redox state acts as a switch
triggering conformational changes between a fold that is prone to carotene
binding (FADox) and one that preferentially binds PQ (FADred). If true, the
structure of OsPDS-His6 in complex with NFZ would represent the reduced
enzyme state because this redox-inactive inhibitor prevents FADred
reoxidation, in contrast to its structural analogue PQ (Gemmecker et al.,
2015), Testing this hypothesis would require resolving the structure of oxidized
OsPDS-His6. However, this proved to be impossible since NFZ acted as an
indispensable protein stabilizing agent (Gemmecker et al., 2015).
It is worth noting that the bacterial phytoene desaturase CrtI most likely differs
from PDS regarding the ordered ping pong bi bi mechanism. CrtI introduces
four double bonds into 15-cis-phytoene, two on each half side. During the 4-
step carotene desaturation, FADred reoxidation is mediated by reduction of
oxygen that is readily accessible to the active center while the carotene is still
bound (Schaub et al., 2012). Thus, there is no large lipophilic co-substrate
requiring displacement. Moreover, contrary to expectation for an ordered
ping pong bi bi mechanism, CrtI barely releases intermediates (Schaub et al.,
2012). CrtI cannot desaturate carotenes in the absence of oxygen (Schaub et
al., 2012). Therefore, it is likely that oxygen is required in the active site during
carotene desaturation to provide the necessary change in free energy.
5.1.4 Substrate and regio-specificity of PDS: role of the 15-cis-configuration
PDS exhibits high regio-specificity as witnessed by the fact that no carotene
desaturation at a position other than C11-C12 and C11’-C12’ or isomerization
at a position other than C9-C10 and C9’-C10’ has ever been reported.
Accordingly, 9,15-di-cis-phytofluene and 9,15,9‘-tri-cis-ζ-carotene are the sole
products. The 15-cis-isomer of phytoene is long known as the PDS substrate. It
was shown to be converted 10 x faster than the all-trans isomer (Breitenbach
Discussion
126
et al., 2005). Notably, desaturation of all-trans-phytoene yielded other ζ-
carotene isomers than the tri-cis isomer. This implies a relevance of 15-cis-
configuration in terms of substrate recognition and regio-specificity.
Regio-specificity relies on the correct positioning of the correct carotene
single bond relative to the catalytic isoalloxazine of FAD. It is an interesting
note in this context that a 9-cis-configured double bond arrests the
xanthophyll substrate in the 9-cis-epoxy-carotenoid cleavage dioxygenase
VP14 in the correct position (Messing et al., 2010). The 15-cis double bond of
phytoene might function analogously in PDS. Alternatively, the carotenoid
substrate might be introduced until reaching the cavity end, i.e. it is the
substrate length that might mediate substrate positioning. The modeling of 15-
cis-phytoene in its extended conformation into the substrate cavity of OsPDS-
His6 (Brausemann et al., 2017) does not allow distinguishing between these
alternatives. The kinked structure of the cavity appears suitable to
accommodate the kinked central C15-C15’ double bond but the
contribution of the substrate length appears just as likely (Fig. 4-3; see 4.1.2).
To disentangle these alternatives, a C5-truncated variant of 15-cis-phytoene,
15-cis-1’,2’,3’,16’,17’-penta-nor-phytoene (hereafter 15-cis-nor-phytoene; Fig.
4-4 A) was used as substrate. With this asymmetrically shortened substrate,
regio-specificity would be maintained at C11-C12 and C11’-C12’ if the 15-cis
double bond rather than molecule length was decisive (see 4.1.2). In fact, LC-
MS analysis revealed that 15-cis-nor-phytoene was desaturated twice to yield
an end product with a UV/VIS spectrum resembling the one of 9,15,9-tri-cis-ζ-
carotene suggesting that desaturation and isomerization had occurred at the
correct sites (Fig. 4-4 B). Thus, the 15-cis double bond in phytoene, and
potentially the entire triene chromophore region of which it forms part,
mediates regio-specificity. This is supported by the fact that elongation of the
cavity back end by site-directed mutagenesis, i.e. by the mutations Tyr506Phe
and Thr508Val, did not affect regio-specificity (see 4.1.2.2).
Discussion
127
With 15-cis-nor-phytoene, the intermediate – being desaturated only once (at
one end) – predominated quantitatively (Fig. 4-4 B). Conceivably, the
truncated half side of 15-cis-nor-phytoene is bound less efficiently by the
enzyme, i.e. the length of the molecule half sides might be decisive for
binding without affecting regio-specificity. Thus, although PDS
accommodates its C40 substrate entirely within the cavity, there appears to
be a sidedness of recognition (“half side recognition”) of the symmetric 15-cis-
phytoene that also applies to an asymmetric, truncated carotene. In line with
this, 9,15-di-cis-phytofluene – of which one half side is identical to a phytoene
half side – is as readily converted as 15-cis-phytoene (see 5.1.5).
The triene chromophore in phytoene might contribute substantially to attain
regio-specificity. Its role should be further investigated by assessing whether
regio-specificity is maintained with a synthetic 15-cis-phytoene derivative
lacking the double bonds at C13-C14 and C13’-C14’ or with synthetic 15-cis-
phytofluene. Moreover, non-covalent interactions between the chromophore
region and PDS residues could be deduced from computation according to
the density functional theory (Johnson et al., 2010), provided in silico docking
of 15-cis-phytoene (or truncations thereof) turns out to be feasible.
It is worth noting that PDS and the inhomologous bacterial phytoene
desaturase CrtI differ regarding substrate cavity topology, mechanisms of
substrate recognition and regio-specificity, despite similar tertiary structures
(Fig. 4-24). In silico docking carried out with the CrtI apoprotein revealed that
the cavity only accommodates C18 – C20 truncations of carotenes, i.e.
carotene half sides (Schaub et al., 2012). This implies dynamic CrtI
dimerization upon binding of a phytoene half side, with the dimer sequentially
introducing all four double bonds, minimizing intermediate release. Notably,
as with PDS, substrate molecule length is not decisive for regio-specificity of
carotene desaturation. It was maintained with C30 15-cis-
(1,2,3,16,17,1’,2’,3’,16’,17’)-deca-nor-phytoene, corresponding to phytoene
truncated by C5 on each end (Raisig and Sandmann, 2001).
Discussion
128
5.1.5 Kinetic characterization and mathematical modeling of OsPDS-His6
5.1.5.1 Modeling supports substrate channeling in OsPDS-His6 homotetramers
GPC, negative staining electron microscopy and protein crystallography of
soluble OsPDS-His6 suggested the enzyme to be flavinylated and active as
homotetramer (Fig. 1-3 B); monomers were found to be deflavinylated and
irreversibly inactivated (Gemmecker et al., 2015). During this thesis, freeze
fracture electron microscopy with OsPDS-His6 proteoliposomes revealed a PDS
particle size that supports the homotetramer as the enzyme’s active state at
membrane surfaces (Fig. 4-2). The ordered ping pong bi mechanism supports
that each subunit within the homotetramer can act independently (see 4.1.4
and 5.1.3). This raises questions on the mechanistic relevance of
homooligomerization.
In a consequence of the ordered ping pong bi bi mechanism, PDS represents
a bifunctional phytoene-phytofluene desaturase catalyzing a two-step
enzyme cascade (McClure et al., 1969). Each phytofluene formed from
phytoene must be released and both carotene substrates compete for
binding. Depending on the relative concentrations of substrate and
intermediate, this mechanistic requirement inherently counteracts formation
of the end product ζ-carotene – if no mechanistic “countermeasures” are
present to favor rebinding of phytofluene over phytoene binding.
Homooligomerization can represent such a “countermeasure” paving the
way for cooperativity in substrate binding or channeling of the intermediate
between subunits. Enhanced affinity for carotenes or restricted intermediate
diffusion, respectively, would facilitate phytofluene rebinding and conversion
by a different PDS subunit containing oxidized FAD. However, substrate
concentration dependencies for phytoene or phytofluene did not reveal
sigmoidality (Fig. 4-14), a hallmark of cooperativity (Copeland, 2000).
Substrate channeling has predominantly been reported for heterooligomeric
complexes (Lee et al., 2012) but its occurrence in PDS homotetramers
Discussion
129
appears likely, given the extraordinary situation with a symmetric substrate
undergoing two formally identical reactions at half sides (Fig. 1-3).
Substrate channeling between a “source” enzyme and a “sink” enzyme
requires substrate cavity entrances to be within less than 10 Å distance and
limited intermediate diffusion to attain locally enhanced intermediate
concentrations (Wheeldon et al., 2016; Lee et al., 2012). Both prerequisites
appear to be met by the PDS homotetramer, with its subunits representing the
“source” as well as the “sink” for the intermediate. Four cavity entrances point
towards each other (Fig. 1-3 B) and it appears likely that the monotopic
interaction with lipids creates a membrane microdomain restricting diffusion
thereby favoring the enrichment of nascent phytofluene in proximity to the
PDS homotetramer (Lee et al., 2012). In this regard, higher order
oligomerization may provide a larger “sink” than dimerization, the minimal
association required for channeling.
Being inaccessible to direct observation, we resorted to dynamic
mathematical modeling in order to investigate the occurrence of substrate
channeling. All models examined encompassed phytoene desaturation,
phytofluene desaturation and PQ reduction (for details, see 4.2). Briefly, the
“monomeric model” (Fig. 4-8 A) that is based on independently acting
subunits within homotetramers could not describe PDS behavior, in contrast to
the “substrate channeling model” (Fig. 4-8 B) that implements substrate
channeling in homotetramers. This means that substrate channeling is a
necessary process to describe the PDS behavior. This model supports two
kinetically inequivalent fates of phytofluene. The nascent intermediate is
released into a membrane microdomain that limits its diffusion. It is then either
channeled into a different oxidized subunit of the same homotetramer for
rapid conversion or diffuses into the membrane space. Here, it can diffuse
without any limitation to eventually be taken up and converted to ζ-carotene
by any oxidized subunit. The rate constants deduced from the model (Table
4) support this hypothesis suggesting channeled phytofluene to be converted
Discussion
130
5 x faster than phytofluene that diffuses without limitation within the
membrane. Computation of the carotene fluxes revealed that nascent
phytofluene has a relatively low probability of leaving the microdomain,
indicating efficient limitation of diffusion.
However, substrate channeling is not perfect. It is susceptible to disturbances,
because such microdomains are in equilibrium with the membrane. A first
indication is provided by the considerable delay between the inset of
phytofluene and ζ-carotene formation during PDS reaction time courses and
the considerable level of released phytofluene (Fig. 4-7 D; Wheeldon et al.,
2016). A second indication comes from the observation that excess phytoene
supply favors phytofluene formation relative to ζ-carotene formation (Fig. 4-
14) because phytoene progressively outcompetes (nascent) phytofluene in
microdomains in terms of enzyme binding. Accordingly, modeling supports
that excess phytoene supply, i.e. high carotene flux through PDS, impedes the
formation of the end product ζ-carotene.
5.1.5.2 Rate-limiting steps in OsPDS-His6
The substrate concentration-dependent behavior of OsPDS-His6 was
investigated both experimentally to elucidate Michaelis-Menten parameters
and by simulation using the established mathematical model (see 4.2.3).
It is to be mentioned that the Michaelis-Menten parameters determined need
to be treated with some caution for the two-step reactions of PDS and ZDS.
The two carotene desaturation steps represent separate events with the
velocity of intermediate (phytofluene and neurosporene, respectively)
desaturation depending on the velocity of substrate (phytoene and ζ-
carotene, respectively) desaturation. Thus, the Michaelis-Menten parameters
deduced from the velocity of the overall reaction (Table 5) – i.e. formation of
the end product from the initial substrate – represent composite, “apparent”
values encompassing the velocities of both partial reactions. This is not the
case when the intermediate (phytofluene and neurosporene, respectively)
serve as substrates. Thus, in order to obtain an appropriate measure of affinity
Discussion
131
for the initial substrate (phytoene in PDS, ζ-carotene in ZDS), Michaelis-Menten
parameters should be deduced from the velocity of intermediate formation
rather than deducing the parameters from the overall 2-step reaction.
Accordingly, phytofluene formation from phytoene could not be saturated
and no KM could be determined (Fig. 4-14 B). In contrast, a KM of 66.8 ± 20.7
mM was determined for phytofluene as substrate. Consequently, the KM for
phytoene is far higher than for phytofluene. Interpreting KM in terms of affinity,
the intermediate is preferred over the substrate. This is reflected by the rate
constants determined by mathematical modeling, implying that phytofluene
deposited in liposomes is converted twice as fast as phytoene deposited in
liposomes (Table 4). This would in fact reflect different affinities because the
desaturation process is formally identical for phytoene and phytofluene. Thus,
higher affinity for the intermediate than for the initial substrate appears as
another feature to favor end product formation over intermediate release.
Applying the same rationale, OsPDS-His6 exhibits a by far higher affinity for
DPQ than for any of the carotene substrates with a KM of only 1.3 ± 0.2 mM. In
line with this, the mathematical model indicates that FADred reoxidation by
DPQ is much faster than any carotene desaturation process (Table 4, Fig. 4-12
E), ensuring that OsPDS-His6 is rapidly reoxidized (Fig. 4-12 D). This suggests that
FADred reoxidation is not rate-limiting for carotene fluxes through PDS, as long
as sufficient oxidized PQ is supplied (experiments were carried out under DPQ
saturation). When present in limiting amounts (Fig. 4-14 A), repeated carotene
desaturation cycles and carotene flux from phytoene via phytofluene to ζ-
carotene are hindered. Since ζ-carotene formation depends on previous
phytofluene formation, PQ deficiency favors intermediate formation relative
to end product formation (Fig. 4-14 A). Thus, higher affinity for PQ than for
carotene substrates can be considered as a third mechanism in PDS to favor
end product formation. It is conceivable that rapid reoxidation of the subunits
within homotetramers assists substrate channeling of the nascent phytofluene
that still resides within the PDS microdomain.
Discussion
132
The substrate channeling model and the rate constants deduced from
reaction time courses could in principle simulate and reflect the observed
substrate concentration-dependent relations of intermediate and end
product formation by OsPDS-His6 (Fig. 4-14). This supports the validity of the
model. It needs to be stated that it also systematically overestimates
Michaelis-Menten parameters, used as a quantitative measure to allow
comparisons, by factors of 1.1 to 4.1 (Table 5). The error is likely due to gradual
alterations of the structure and physicochemical properties of liposomal
membranes when increasing concentrations of the hydrocarbon substrates
are incorporated that conceivably impair OsPDS-His6 activity (Sikkema et al.,
1993). The model was established at low substrate concentrations and cannot
consider this structural circumstance upon extrapolation. Moreover, the
production of enzyme and liposomes batches with identical specific activities
showed to be notoriously difficult. The preparations used in reaction time
course experiments to develop the model were different from the ones used
to investigate substrate concentration dependencies. This contributes to the
quantitative deviations from the model despite qualitative similarities, too.
5.1.6 Characterization of norflurazon - OsPDS-His6 interactions
5.1.6.1 Quinone-competitive inhibition by norflurazon is mediated by several
non-covalent interactions
Phytoene desaturase is a prominent target for a structurally heterogeneous
group of bleaching herbicides such as norflurazon (NFZ), fluridone and
diflufenican sharing a meta-trifluoromethylphenyl (m-CF3-phenyl) moiety often
fused to a second (heterocyclic) carbonyl-substituted ring structure (see
1.3.1.3). The lack of structural information has long hampered a detailed
molecular characterization of the inhibitory mode of these herbicidal
compounds. With emerging resistances of weeds against commonly used
herbicides, knowledge of structure-function relationship can pave the way
towards the rational design of optimized herbicides and the development of
herbicide resistant PDS versions in crops. The importance of such investigations
Discussion
133
is reflected by the fact that they have met the interest of the agrochemical
company Syngenta and collaboration has been initiated. In accordance
with the corresponding confidentiality agreement, not all results can be
presented at this point. The refinement of the OsPDS-His6 structure in a
complex with NFZ was key to the investigations concerning PDS-targeting
herbicides (Brausemann et al., 2017).
The data presented reveal that NFZ exhibits competitive inhibition towards PQ
(Fig. 4-15) which is in accordance with results obtained with complex cell-free
assay systems (Breitenbach et al., 2001). Moreover, as shown in a preceding
publication (Gemmecker et al., 2015), NFZ is tightly bound to OsPDS-His6
during enzyme purification but can be displaced by DPQ. This suits the
structure-derived notion that PQ and NFZ share the same binding site. In
contrast, NFZ exhibits either uncompetitive or non-competitive inhibition
towards phytoene (Fig. 4-15), occupying the same substrate cavity. Non-
competitive inhibition is supported by the fact that the crystallized PDS-NFZ
complex represents an enzyme-inhibitor complex (Brausemann et al., 2017)
with no substrate bound. This situation can only occur for competitive or non-
competitive inhibitors whereas uncompetitive inhibitors sensu stricto require
the presence of the enzyme-substrate complex (Copeland, 2000). Moreover,
non-competitive inhibition towards phytoene has been suggested earlier
(Sandmann et al., 1989; Mayer et al., 1989).
This differential inhibition mode regarding the two substrates further supports
the prevalence of an ordered ping pong bi bi mechanism (see 5.1.3), with
phytoene or phytofluene binding to the FADox state of the enzyme and DPQ
and NFZ binding to the FADred state. In line with this, Gemmecker et al. (2015)
reported that NFZ binds and – being redox-inactive - stabilizes the reduced
enzyme state after carotene desaturation.
NFZ as quinone-competitive inhibitor lowers the apparent PQ availability,
thereby preventing FADred reoxidation and the execution of continuous
desaturation cycles (see 5.1.5.2). Thus, NFZ inhibition diminishes enzymatic
Discussion
134
activity, i.e. carotene flux from phytoene via phytofluene to ζ-carotene. This
favors phytofluene formation relative to ζ-carotene formation, as the latter
depends on the former in this two-step reaction. This fits with the observation
that low PQ supply increases the phytofluene proportion (Fig. 4-14). Previously,
this circumstance has been misinterpreted in terms of a differential NFZ
susceptibility of the two desaturation reactions.
Despite significant structural differences compared to NFZ, the m-CF3-phenyl
containing herbicides diflufenican and fluridone compete with PQ binding, as
shown here (Fig. 4-15) and as hypothesized earlier (Laber et al., 1999). This
emphasizes the importance of the common structural features, namely the
m-CF3-phenyl moiety and the presence of a carbonyl group in a second
rather hydrophobic ring structure. However, in silico docking of diflufenican
and fluridone into the PQ binding site was not successful, suggesting an
induced fit upon inhibitor binding. Further investigation would require
crystallography of OsPDS-His6 containing complexed diflufenican or fluridone.
These structures would provide valuable models for the calculation and
prediction of non-covalent interactions between PDS and inhibitors using the
density functional theory-based method of Johnson et al. (2010).
Such calculations were used during this thesis to elucidate the molecular basis
of the long-known importance of the m-CF3 substituent in NFZ (Mayer et al.,
1989; Sandmann et al., 1989; Sandmann and Böger, 1982), fluridone
(Sandmann et al., 1992) and diflufenican (Cramp et al., 1987). The role of this
functionality has mainly been attributed to its lipophilicity and
electronegativity so far. The quantum mechanical calculations presented
reveal that the m-CF3 substituent provides five weakly attractive non-covalent
interactions with hydrogen or sulphur atoms of Met188, Met277, Ala280 and
Phe423 (Fig. 4-16), all representing conserved PDS residues of the PQ binding
site (Fig. 4-20). Far less attractive interactions are expected when CF3 is
replaced by CH3, Cl or H and thus, the “magic” of CF3 indeed involves a
combination of lipophilicity, electronegativity and fluorine effects rather than
Discussion
135
a single “all-or-none” interaction. Such computational approaches when
applied to additional compounds could substantially facilitate the rational
design of new PDS-targeting herbicides – as opposed to cumbersome
combinatorial chemistry approaches.
Interestingly, despite the lack of structural information, early studies have led
to a fairly accurate prediction of the binding site of m-CF3-phenyl herbicides
by Laber et al. (1999). Indeed, the m-CF3-phenyl moiety is surrounded by a
conserved pocket of lipophilic residues such as Met188, Met277, Ala280, Phe423,
Phe162 and Met310 (Fig. 4-16). The conserved Arg300 represents the postulated
residue for hydrogen bonding of the oxygen functionality in vicinity to the m-
CF3-phenyl group.
5.1.6.2 Site-directed mutagenesis confers norflurazon resistance at the
expense of catalytic activity
The effective use of PDS-targeting herbicides in agriculture would benefit from
resistant crops. This can nowadays be achieved by applying state of the art
genome-editing methods since PDS mutations conferring resistance to NFZ
and fluridone have been identified in cyanobacteria, algae and in one plant
(see 1.3.1.3). However, it remained elusive how these mutations confer
resistance and in which way enzyme characteristics might be affected.
In order to address these questions, such PDS mutant enzymes were
generated and biochemically characterized (see 4.3.2). In summary,
individual mutation of the residues Phe162, Arg300 and Leu538 resulted in
enzymes that suffered a substantial loss of enzymatic activity in vitro
compared to the wild type enzyme, despite retaining a native-like tertiary
structure. In depth analysis of the most active mutant enzyme, Arg300Ser PDS,
revealed that homooligomerization was not affected either (Fig. 4-18).
However, the kinetic parameters were drastically altered (Table 6) as
witnessed by higher affinity for DPQ (KM lower by factor 3) and phytoene (KM
lower by factor 12) and lower Vmax regarding both substrates, the latter
reflecting the enzyme’s loss of activity. Moreover, as expected from reports
Discussion
136
about this mutation (Arias et al., 2006; Martinez-Férez et al., 1994), the affinity
for NFZ was found to be lowered as witnessed by a 7 fold higher Ki (Table 6).
Thus, the point mutation Arg300Ser led to global kinetic changes.
Removing a formal charge from an active center as in Arg300Ser PDS
represents a major change with possible long-range conformational changes
exerting multiple effects. More specifically, the increased active center
lipophilicity in the mutant might result in enhanced affinity for the lipophilic
substrates phytoene and DPQ (lower KM for both) and the decreased affinity
for the smaller, more hydrophilic inhibitor NFZ (higher Ki). These parameter
changes contradict the notion of a simple analogy in NFZ and DPQ binding
via hydrogen bonding of their keto functions (see 5.1.6.1) but plead for a
contribution of the hydrocarbon moiety in the case of PQ. Interpreting
lowered KM in terms of affinities, the increased affinity for substrates might as
well be accompanied by increased affinity for the similarly lipophilic products.
It may therefore be conceivable that product release and the rapid
sequential order of carotene and PQ binding are hindered in the mutant,
leading to diminished catalytic activity. In terms of herbicide resistance, the
relative affinities for DPQ and the quinone-competitive NFZ need to be
considered. Despite increased DPQ affinity, the enzyme exhibits increased
NFZ resistance (higher Ki). This emphasizes the importance of hydrogen
bonding of NFZ by Arg300 – besides other non-covalent interactions, e.g. with
the m-CF3-phenyl moiety (see 4.3.3). This supports the above given notion that
affinity for the more hydrophobic PQ does not solely rely on hydrogen
bonding of its keto function but strongly relies on additional non-covalent
interactions with its hydrocarbon moiety.
Substrate concentration dependencies for Arg300Ser PDS showed that
increasing phytoene concentrations favored the formation of the
intermediate phytofluene in relation to the end product ζ-carotene, like with
wild type OsPDS-His6 (compare Fig. 4-19 and Fig. 4-14). However, the mutant
preferentially released phytofluene and not ζ-carotene at any given
Discussion
137
phytoene concentration – in contrast to the wild type enzyme (compare Fig.
4-19 and Fig. 4-14). This was mainly due to strongly impaired ζ-carotene
formation, while phytofluene was present in wild type-like quantities. In the
light of the mathematical model for OsPDS-His6, the simplest explanation
would be that the lowered enzymatic activity and carotene flux through the
mutant enzyme mainly diminishes ζ-carotene formation as it additionally
depends on previous phytofluene synthesis. Mathematical modeling of
reaction time courses with Arg300Ser PDS was tried but did not allow further
disentangling the sub-processes affected in the mutant. Impaired substrate
channeling appears unlikely as a cause since homooligomerization as the
prerequisite remained unaffected (Fig. 4-18).
As a conclusion, all PDS mutant enzymes generated to confer NFZ resistance
(Arg300Ser, Arg300Thr, Leu538Phe, Leu538Arg and Phe162Val) in principle allowed
for ζ-carotene formation in E. coli, engineered to produce 15-cis-phytoene,
and in vitro – but at much lower rates than the wild type enzyme. In
consideration of the results obtained for Arg300Ser PDS, engineering NFZ
resistance trades-in lowered catalytic activity of the enzyme. However, this
might suffice for carotenogenesis in vivo, as witnessed by the wild type-like
carotenoid levels of NFZ-resistant mutants (see 1.3.1.3). It is conceivable that
the loss of activity is compensated by regulatory mechanisms in planta.
Genome editing would be the method of choice to investigate whether
engineering of PDS can produce agriculturally useful herbicide-tolerant plants
with uncompromised performance.
Discussion
138
5.2 ζ-carotene desaturase ZDS: a comparison to PDS
5.2.1 OsZDS-His6 utilizes an ordered ping pong bi bi mechanism and a
“flavin only” mechanism
In recent years and during this thesis, substantial progress has been made in
the understanding of PDS (Gemmecker et al., 2015; Brausemann et al., 2017;
see 4.1, 4.2, 4.3, 5.1). Little is known about ZDS, although many similarities are
anticipated because of homology and a similar function. Thus, investigations
on ZDS were initiated as this enzyme is crucial to an understanding of the
poly-cis pathway of carotene desaturation (for details, see 4.4).
OsZDS-His6 was natively purified in the absence of detergents to near
homogeneity as a yellow enzyme. LC-MS analysis revealed FAD as sole
cofactor bound by a conserved Rossman fold (Fig. 4-22). OsZDS-His6 rapidly
attached to substrate containing liposomes and is active in the absence of
supplemented FAD, yielding proneurosporene (PN) and prolycopene (PL)
from 9,9’-di-cis-ζ-carotene and exhibiting high regio-specificity (Fig. 4-21). Thus,
it represents a monotopic membrane flavoprotein. Its redox cofactor FAD
requires reoxidation by PQ, the latter serving as diffusible, terminal electron
acceptor. The occurrence of carotene desaturation in the absence of PQ
and the observed release of the intermediate from the enzyme revealed that
both carotene desaturation reactions and PQ reduction are per se
independent of each other (see 4.4.1.3). Consequently, OsZDS-His6 is
expected to follow an ordered ping pong bi bi mechanism and represents a
bifunctional ζ-carotene – neurosporene desaturase, catalyzing a two step-
desaturation cascade with formally identical reactions on the substrate half
sides. PQ is only required for FADred reoxidation to allow repeated reaction
cycles and exerts kinetic control over the overall reaction towards
prolycopene. Thus, regarding these basic mechanisms, similarities with PDS
are very significant.
In line with this, homology modeling (carried out because crystallization
attempts failed) revealed high structural similarity with OsPDS (Fig. 4-24). A
Discussion
139
single hydrophobic substrate cavity was present, capable of entirely
accommodating both carotene substrates and PQ but not simultaneously.
The FAD-containing active center of OsZDS was found to lack acidic and
basic amino acids that could mediate acid-base catalysis of carotene
desaturation. Thus, ZDS seems to employ a “flavin only” mechanism with the
isoalloxazine as the sole catalyst, similar to the reaction mechanism proposed
for PDS (for details, see 4.4.2).
Characterization of the substrate concentration-dependent kinetics of OsZDS-
His6 revealed high similarities with OsPDS-His6, supporting that ZDS utilizes similar
mechanisms to favor end product formation in its two-step carotene
desaturation. First, OSZDS-His6 exhibits higher affinity for the intermediate PN
than for the initial substrate ζ-carotene. The KM for PN is 13.9 ± 2.5 mM and,
following the rationale detailed for PDS that KM for the substrate should be
determined via formation of the intermediate (see 5.1.5.2), KM could not be
determined experimentally for ζ-carotene and is higher than 50 mM (see
4.4.3.3). Accordingly, increasing concentrations of the initial substrate ζ-
carotene favored formation of the intermediate over the end product, as it
competes with PN (Fig. 4-28 A). Thus, low carotene fluxes through ZDS are
essential to favor end product formation. Second, OSZDS-His6 exhibits higher
affinity for PQ than for its carotene substrates with a KM of only 0.3 ± 0.1 mM for
DPQ. This ensures rapid enzyme reoxidation for repeated carotene
desaturation cycles and conceivably facilitates rapid conversion of the
recently expelled intermediate PN to PL. In line with this, high PQ supply
favored end product formation in relation to intermediate formation (Fig. 4-28
C). Thus, similarities with PDS are significant in terms of kinetic properties.
5.2.2 OsZDS-His6 might not employ homooligomerization and substrate
channeling
A difference between OsZDS-His6 and OsPDS-His6 came to light upon GPC
analysis. OsZDS-His6 remained flavinylated and is most likely active as
monomer (see 4.4.2.3) whereas OsPDS-His6 is only flavinylated and active as
Discussion
140
homotetramer (see 4.2.2 and 5.1.5). It remains to be investigated whether
OsZDS-His6 forms homooligomers at membrane surfaces to employ substrate
channeling of its intermediate PN. In analogy to OsPDS-His6, the size and
oligomeric state of OsZDS-His6 in its active state on liposomal surfaces could
be determined by cryo scanning electron microscopy. Notably, certain
amounts of higher-order oligomers observed during GPC only under non-
reducing conditions might point towards unstable homooligomerization (see
4.4.2.3). Breitenbach et al. (1999) observed homodimerization for Capsicum
ZDS, stating that this might be due to hydrophobic aggregation.
Mathematical modeling of OsZDS-His6 reaction time courses could be applied
to further investigate oligomerization and substrate channeling. Given the
strong similarity of PDS and ZDS, the “monomeric model” and “substrate
channeling model” for OsPDS-His6 might be applicable to OsZDS-His6.
Should OsZDS-His6 not assemble as homooligomer, the question arises whether
ZDS is rather a constituent of a heterooligomeric metabolon, e.g. with CRTISO
that is located downstream of ZDS, as suggested by Lundqvist et al. (2017).
Native expression of OsZDS and LeCRTISO (Yu et al., 2011) in E. coli has
already been achieved and bimolecular fluorescence complementation
(BiFC) assays could help revealing structural interactions. Alternatively, a
different organization might facilitate intermediate release from ZDS to serve
other functions. It has been proposed that a cis-neurosporene might serve as
precursor for a signaling compound involved in the feedback regulation of
carotenogenesis (Kachanovsky et al., 2012). In fact, as will be discussed in
5.4, 9-cis-neurosporene that is formed by CRTISO from proneurosporene (Yu et
al., 2011) can be converted by AtCCD7 to yield 9-cis-ζ-apo-10’-carotenal as
a potential signal precursor.
Discussion
141
5.3 ζ-Carotene Isomerase ZISO: a bona fide enzyme with the
potential for additional functions
In the framework of this thesis, functional expression in E. coli and a liposomal
in vitro assay were established for OsZISO-His6 (see 4.5.1). N-terminal fusion of
the Mistic protein from Bacillus subtilis, a fusion partner mediating membrane
targeting and insertion in E. coli (Roosild et al., 2005), was crucial for obtaining
active OsZISO-His6. This is in accordance with ZISO being a transmembrane
protein, as predicted (Chen et al., 2010). Cell lysates containing Mistic-OsZISO-
His6 isomerized 9,15,9‘-tri-cis-ζ-carotene to 9,9‘-di-cis-ζ-carotene in the
absence of all other carotenogenic enzymes (Fig. 4-31) showing that ZISO is
indeed an enzyme rather than a modifier of PDS specificity, the latter being
capable of isomerizing the C9-C10 double bond during phytoene
desaturation (Fig. 1-3 A). Enzyme function was then shown by Beltrán et al.
(2015) who reported its first native purification and in vitro isomerization of tri-
cis-ζ-carotene shortly afterwards. Beltran et al. (2015) furthermore reported on
the cofactor requirements and mechanistics of ZISO, involving a ferrous heme
b cofactor. Their findings are not further detailed here and prompted a
discontinuation of OsZISO-His6 purification attempts during this thesis.
Nevertheless, the data presented here allow first insights into substrate
recognition by ZISO. Apart from 9,15,9‘-tri-cis-ζ-carotene, 9,15-di-cis-
phytofluene was shown to be readily isomerized by Mistic-OsZISO-His6, in
contrast to 15-cis-phytoene (see 4.5.1). It can be concluded that a petaene
and a 9,15-di-cis configuration are the minimal substrate requirements. This
would correspond to recognition of only one half side of the symmetric,
canonical substrate 9,15,9’-tri-cis-ζ-carotene. But further experimentation is
needed. Carotene isomerization can be reversible as shown for the cis-trans-
ß-carotene isomerase D27 (Bruno and Al-Babili, 2016). Reversibility from 9,9’-di-
cis- to 9,15,9’-tri-cis-ζ-carotene would inter alia imply that 9-cis configuration
suffices for recognition by ZISO. Accordingly, 9-cis-isomers of other linear
carotenes (ζ-carotene, neurosporene and lycopene) could be potential ZISO
Discussion
142
substrates as well, depending on the contribution of the polyene system to
ZISO substrate specificity. These questions surely need to be addressed in vitro.
Future research should focus on ZISO topology and protein-protein
interactions in the light of suggestions in favor of a carotenogenic
supercomplex achieving metabolite channeling (Cunningham and Gantt,
1998; Shumskaya et al., 2013; Nisar et al., 2015). ZISO is the only
transmembrane protein of the poly-cis carotene desaturation pathway while
all other enzymes interact monotopically with membranes (Gemmecker et
al., 2015; Albrecht et al., 1995; Yu et al., 2011; Yu and Beyer, 2012). ZISO would
be a predestined adaptor to organize the metabolon by protein-protein
interaction. Such a role was for instance found for the transmembrane protein
Erg28P in sterol biosynthesis (Mo and Bard, 2005). First observations may point
towards such a role: Lundqvist et al. (2017) used a BN-PAGE – mass
spectrometry approach and reported that ZISO and PDS as well as CRTISO
and ZDS might be arranged in two heterocomplexes in Arabidopsis.
Additionally, the data presented point towards substrate channeling
between PDS and ZISO in vitro (see 4.5.3). In the absence of OsPDS-His6, when
9,15,9’-tri-cis-ζ-carotene was deposited in liposomes as substrate, Mistic-
OsZISO-His6 activity was low. In contrast, the identical amount of enzyme
mediated much more isomerization (on a relative and absolute scale) when
the substrate was simultaneously produced by OsPDS-His6. This suggests that
ZISO gains more readily access to its substrate in the presence of OsPDS-His6,
conceivably due to substrate channeling. Mass spectrometry approaches
represent a viable option for the identification and characterization of the
suggested membrane-bound carotenogenic metabolon, as demonstrated
for the peroxisomal importomer (Oeljeklaus et al., 2012).
Discussion
143
5.4 The poly-cis pathway of carotene desaturation and retrograde
signaling
5.4.1 AtCCD7 forms linear 9-cis-apocarotenoids as potential signaling
molecule precursors
In recent years, apocarotenoids originating from CCD-mediated cleavage of
poly-cis-configured linear carotenes have been suggested to serve regulatory
functions in plants (see 1.4). Such ideas are of special interest in the light of a
significant conundrum in carotenoid research: why has the highly intricate
poly-cis pathway of carotene desaturation evolved in plants although its
overall reaction can be achieved with only one enzyme, as in bacteria and
fungi (Fig. 1-2)? Sensing desaturation intermediate levels and translating these
into regulatory functions could provide a clue. These lines of thinking have
been fostered by the discovery that strigolactones and abscisic acid, both
important phytohormones, are derived from the cleavage of cis-configured
carotenoids. Avendaño-Vázquez et al. (2014) postulated cis-ζ-carotene or cis-
phytofluene to be cleaved by CCD4 to yield an apocarotenoid participating
in plastid retrograde signaling that regulates seedling development in
Arabidopsis. Kachanovsky et al. (2012) suggested prolycopene,
proneurosporene or a cis-neurosporene to give rise to an apocarotenoid
mediating feedback regulation of fruit-specific PSY1 in tomato.
The lack of evidence for the existence of such linear apocarotenoids,
prompted the here presented research on CCD-mediated cleavage of
canonical intermediates of the poly-cis pathway of carotene desaturation
and non-canonical isomers derived thereof (see 4.6). The carotenoid
cleavage dioxygenases AtCCD4 and AtCCD7 were investigated for primary
cleavage since they are plastid localized (the site of carotene desaturation)
and they are known to cleave cyclic C40 carotenes (Bruno et al., 2016; Bruno
et al., 2014). In contrast, CCD8 does not cleave C40 carotenoids (Alder et al.,
2012) and CCD1 is localized in the cytosol (Floss and Walter, 2009).
Discussion
144
Contrary to expectation (Avendaño-Vázquez et al., 2014), AtCCD4, did not
cleave of any cis- or trans-configured linear carotene (see 4.6.1). This is in
accordance with the reported specificity of AtCCD4 for trans-configured
cyclic carotenoids (Bruno et al., 2016). Thus, AtCCD4 seems to require the
cyclic ionone moieties for substrate recognition. The data presented in this
work rule out that AtCCD4 cleaves cis-ζ-carotenes. The only possibility for
AtCCD4 involvement would therefore relate to a secondary cleavage of an
apocarotenoid originating from a desaturation intermediate.
In contrast, AtCCD7 was found to specifically cleave the trans-configured C9-
C10 double bond in 9-cis-ζ-carotene, 9’-cis-neurosporene and 9-cis-lycopene
whereas poly-cis- and all-trans-configured species were not converted (see
4.6.2). This is in accordance with the 9-cis-specificity of AtCCD7 for bicyclic
carotenoids (Bruno et al., 2014) that appears to persist with acyclic carotenes.
The apocarotenoids formed by AtCCD7 were identified as 9-cis-ζ-apo-10’-
carotenal (from ζ-carotene and neurosporene) and 9-cis-apo-10’-lycopenal
(from lycopene) by LC-MS and the stereo-configuration of the lycopenal was
verified by its chromatographic behavior differing from authentic all-trans-
apo-10’-lycopenal. Cleavage of the 9-cis isomers of neurosporene and
lycopene was comparably weaker than cleavage of 9-cis-ζ-carotene. This is
somewhat surprising considering the fact that they resemble the canonical
CCD7 substrate 9-cis-β-carotene much more with respect to the number of
double bonds present. The explanation might be that chromophore
elongation hinders single bond rotation within the polyene. The resulting
enhanced rigidity is known to cause problems upon solubilization with
detergents so that more desaturated substrates like neurosporene and
lycopene are not optimally presented to the CCD enzymes.
The findings of this work are reminiscent of SL biosynthesis where CCD7
cleaves 9-cis-β-carotene at the trans-configured C9-C10 double bond to
yield a 9-cis-C27-apocarotenoid (9-cis-β-apo-10’-carotenal) (Al-Babili and
Bouwmeester, 2015). Moreover, ABA as the second carotenoid-derived
Discussion
145
phytohormone has a 9-cis-carotenoid precursor, too (Marion-Poll and
Nambara, 2005). There seems to be the recurrent motif of a 9-cis-configured
carotenoid representing precursors of regulatory molecules. Following this
idea, the data presented in this work support an involvement of AtCCD7 in
the biosynthesis of regulatory molecule derived directly or indirectly from the
poly-cis pathway of carotene desaturation.
Interestingly, 9-cis configuration is widespread amongst carotenes of the poly-
cis pathway: 9-cis double bonds are introduced at both C9-C10 and C9’-C10’
by PDS (Fig. 1-3 A) and persist throughout the desaturation pathway
intermediates until being isomerized to trans by CRTISO (see Fig. 1-2). Thus, all
of the poly-cis pathway intermediates might be predestined as precursors of
regulatory molecules. Moreover, 9-mono-cis-isomers of linear carotenes might
indeed be formed in planta. 9’-cis-neurosporene and 9-cis-lycopene can be
enzymatically formed in vitro by the carotene isomerase CRTISO (Isaacson et
al., 2004; Yu et al., 2011), a property that has been exploited in this work to
generate 9’-cis-neurosporene as substrate. In contrast, the potential origin of
9-cis-ζ-carotene in planta remains elusive. Taking the resemblance with SL
biosynthesis into account, the canonical 9,9’-di-cis-ζ-carotene should be
assayed in vitro as substrate with the 9-cis-β-carotene isomerase D27. Further
candidates could be the yet uncharacterized CRTISO-like enzymes (Fantini et
al., 2013) that might represent carotene isomerases with the required
specificity. Moreover, thermo- and photoisomerization should be considered.
9-cis-ζ-carotene and other isomers were regularly found in E. coli (see 4.5.1), in
the absence of specific carotene isomerases.
5.4.2 Linear 9-cis-apocarotenoids are not converted into strigolactone-like
metabolites by AtCCD8
Signaling molecules need to move between aqueous cell compartments in
order to exert their functions, a feature that does not apply to the rather
hydrophobic C27 apocarotenoids 9-cis-ζ-apo-10’-carotenal and 9-cis-apo-10’-
lycopenal. Further modification or cleavage by CCDs should be considered.
Discussion
146
Given a potential resemblance to SL biosynthesis, CCD8 would be the prime
candidate to potentially yield strigolactone-like compounds from the linear
apocarotenoids (Alder et al., 2012). However, no conversion was observed
(Fig. 4-36) which is somewhat surprising: The postulated CCD8 reaction
mechanism for carlactone formation from 9-cis-β-apo-10’-carotenal (Alder et
al., 2012) involves only C11=C12 and C13=C14 to participate directly in the
intramolecular rearrangement being surrounded by C15=C15’ and C9=C10.
All of these double bonds as well as 9-cis-configuration are present in 9-cis-ζ-
apo-10’-carotenal and 9-cis-apo-10’-lycopenal, the latter being equipped
with a polyene that strongly resembles β-apo-10-carotenal. It remains to be
assayed whether the lycopenal can be converted by AtCCD8. However, the
absence of the ionone moiety might hinder recognition by AtCCD8.
Consequently, the newly identified apocarotenoids 9-cis-ζ-apo-10’-carotenal
and 9-cis-apo-10’-lycopenal might rather undergo modification by hitherto
unknown enzyme activities. Accordingly, conversion of 9-cis-ζ-apo-10’-
carotenal and 9-cis-apo-10’-lycopenal by AtCCD1 and AtCCD4, both known
to convert apocarotenoids (Bruno et al., 2016; Floss and Walter, 2009) should
be considered. However, AtCCD4 did not cleave the ζ-carotenal and
cleavage by AtCCD1 did not yield a cleavage product that was visible in the
UV/VIS wavelength range from 250 nm to 400 nm (Fig. 4-36). Considering the
broad cleavage site specificity of CCD1 enzymes yielding diverse products
from one substrate (Floss and Walter, 2009), it seems unlikely that a CCD1-
mediated reaction might yield a regulatory molecule.
The history of low molecular mass signaling molecule identification shows that
plant mutant characterization might help to further elucidate the fate of
these two apocarotenoids. Alternatively, the classic approach of synthesizing
radioactivity-labeled apocarotenoids, track their fates upon application to
plant cells and identify their derivatives by LC-MS and NMR analyses remains
a viable option.
Summary
147
6 Summary
Plant carotenoid biosynthesis in plastid membranes proceeds via the so-
called poly-cis pathway of carotene desaturation, converting 15-cis-
phytoene into all-trans-lycopene via poly-cis-configured intermediates. Its four
constituent enzymes are poorly understood in terms of mechanisms and
structure. In addition, the reason for the prevalence of these intricate
reactions remains enigmatic considering that the bacterial carotene
desaturation pathway requires only one enzyme.
In this work, the crystal structure of phytoene desaturase (PDS) from O. sativa,
the first desaturation pathway enzyme, in complex with its inhibitor norflurazon
(NFZ) was refined and structural implications were functionally evaluated by a
kinetic characterization. The kinetics of the downstream ζ-carotene
desaturase (ZDS), representing a PDS homolog, were investigated for
comparison and revealed pronounced similarities. The data presented
support an ordered ping pong bi bi kinetic mechanism for PDS and ZDS.
Desaturation of their substrates occurs via two formally identical,
mechanistically independent reactions on half sides of the symmetric
substrate. The intermediate is released into the membrane after the first
desaturation. The enzyme-bound FADred produced by carotene desaturation
is reoxidized by plastoquinone (PQ) to allow repeated rounds of catalysis. As
inferred from the active site structure, data support an unprecedented “flavin
only” mechanism characterized by FADox as sole catalyst of carotene
desaturation. PDS and ZDS interact monotopically with membranes to access
their substrates. Mathematical modelling implies substrate channeling
between subunits within PDS homotetramers whereas ZDS is active as
monomer. Notably, PDS does not produce ζ-carotene in the
stereoconfiguration required by ZDS. In this work, a cell-free activity assay
demonstrated that the membrane-integral ζ-carotene isomerase (ZISO) is a
bona fide isomerase representing the link between PDS and ZDS.
Summary
148
An additional aspect of this work relates to the mode of action of bleaching
herbicides targeting PDS and containing meta-CF3-phenyl moieties, such as
NFZ. It is demonstrated that they compete with PQ and NFZ, occupying the
PQ binding site as suggested in crystallo. The meta-CF3 substituent provides
unique non-covalent interactions with conserved residues and is crucial for
inhibitory effectiveness. Mutagenesis of the conserved Arg300, forming a
hydrogen bond with NFZ, allows engineering NFZ-resistant PDS but at the
expense of altered enzyme kinetics and partial loss of enzymatic activity.
Evidence has been presented that carotenoid cleavage dioxygenases
(CCDs) might form retrograde signals from cis-configured carotene
desaturation intermediates, regulating plastid development and carotenoid
biosynthesis. Investigating intermediate cleavage by CCDs, Arabidopsis CCD7
was found to cleave 9-cis-ζ-carotene yielding 9-cis-ζ-apo-10’-carotenal (C27)
which, in contrast to strigolactone biosynthesis, is not converted by AtCCD8.
These data suggest this apocarotenoid as a candidate signal precursor
requiring further modification by hitherto unidentified enzyme activities.
References
149
7 References
Al-Babili S, Hugueney P, Schledz M, Welsch R, Frohnmeyer H, Laule O, Beyer P (2000)
Identification of a novel gene coding for neoxanthin synthase from Solanum tuberosum. FEBS
Lett 485: 168–72
Al-Babili S, von Lintig J, Haubruck H, Beyer P (1996) A novel, soluble form of phytoene
desaturase from Narcissus pseudonarcissus chromoplasts is Hsp70-complexed and
competent for flavinylation, membrane association and enzymatic activation. Plant J 9: 601–
612
Albrecht M, Klein A, Hugueney P, Sandmann G, Kuntz M (1995) Molecular cloning and
functional expression in E. coli of a novel plant enzyme mediating ζ-carotene desaturation.
FEBS Lett 372: 199–202
Alder A, Jamil M, Marzorati M, Bruno M, Vermathen M, Bigler P, Ghisla S, Bouwmeester H, Beyer P, Al-Babili S (2012) The Path from β-carotene to Carlactone, a Strigolactone-Like Plant
Hormone. Science 335: 1348–1351
Álvarez D, Voß B, Maass D, Wüst F, Schaub P, Beyer P, Welsch R (2016) Carotenogenesis Is
Regulated by 5′UTR-Mediated Translation of Phytoene Synthase Splice Variants. Plant Physiol.
172: 2314-2326
Arango J, Jourdan M, Geoffriau E, Beyer P, Welsch R (2014) Carotene Hydroxylase Activity
Determines the Levels of Both β-Carotene and Total Carotenoids in Orange Carrots. Plant Cell
26: 2223–2233
Arias RS, Dayan FE, Michel A, Howell J, Scheffler BE (2006) Characterization of a higher plant
herbicide-resistant phytoene desaturase and its use as a selectable marker. Plant Biotechnol
J 4: 263–273
Arnoux P, Morosinotto T, Saga G, Bassi R, Pignol D (2009) A structural basis for the pH-
dependent xanthophyll cycle in Arabidopsis thaliana. Plant Cell 21: 2036–2044
Avendaño-Vázquez A-O, Cordoba E, Llamas E, San Román C, Nisar N, De la Torre S, Ramos-Vega M, Gutiérrez-Nava MDLL, Cazzonelli CI, Pogson BJ, León P (2014) An Uncharacterized
Apocarotenoid-Derived Signal Generated in ζ-Carotene Desaturase Mutants Regulates Leaf
Development and the Expression of Chloroplast and Nuclear Genes in Arabidopsis. Plant Cell
26: 2524–2537
Babczinski P, Sandmann G, Schmidt RR, Shiokawa K, Yasui K (1995) Substituted
Tetrahydropyrimidinones: A New Herbicidal Class of Compounds Inducing Chlorosis by
Inhibition of Phytoene Desaturation. Pestic Biochem Physiol 52: 33–44
Bai L, Kim E-H, DellaPenna D, Brutnell TP (2009) Novel lycopene ε-cyclase activities in maize
revealed through perturbation of carotenoid biosynthesis. Plant J 59: 588–599
Bartley GE, Scolnik PA, Beyer P (1999) Two Arabidopsis thaliana carotene desaturases,
phytoene desaturase and ζ-carotene desaturase, expressed in Escherichia coli, catalyze a
poly-cis pathway to yield pro-lycopene. Eur J Biochem 259: 396–403
Bartnikas TB, Tosques IE, Laratta WP, Shi J, Shapleigh JP (1997) Characterization of the nitric
oxide reductase-encoding region in Rhodobacter sphaeroides 2.4.3. J Bacteriol 179: 3534–
3540
Beltrán J, Kloss B, Hosler JP, Geng J, Liu A, Modi A, Dawson JH, Sono M, Shumskaya M, Ampomah-Dwamena C, Love JD, Wurtzel ET (2015) Control of carotenoid biosynthesis through
a heme-based cis-trans isomerase. Nat Chem Biol 11: 598–605
Beyer P, Al-Babili S, Ye X, Lucca P, Schaub P, Welsch R, Potrykus I (2002) Golden Rice:
introducing the β-carotene biosynthesis pathway into rice endosperm by genetic engineering
to defeat vitamin A deficiency. J Nutr 132: 506S–510S
References
150
Beyer P, Mayer M, Kleinig H (1989) Molecular oxygen and the state of geometric isomerism of
intermediates are essential in the carotene desaturation and cyclization reactions in daffodil
chromoplasts. Eur J Biochem 184: 141–150
Bonk M, Hoffmann B, Lintig J, Schledz M, Al-Babili S, Hobeika E, Kleinig H, Beyer P (1997)
Chloroplast Import of Four Carotenoid Biosynthetic Enzymes In Vitro Reveals Differential Fates
Prior to Membrane Binding and Oligomeric Assembly. Eur J Biochem 247: 942–950
Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O (2004) MAX3/CCD7 Is a
Carotenoid Cleavage Dioxygenase Required for the Synthesis of a Novel Plant Signaling
Molecule. Curr Biol 14: 1232–1238
Bouvier F, D’Harlingue A, Backhaus RA, Kumagai MH, Camara B (2000) Identification of
neoxanthin synthase as a carotenoid cyclase paralog. Eur J Biochem 267: 6346–6352
Bouvier F, D’Harlingue A, Hugueney P, Marin E, Marion-Poll A, Camara B (1996) Xanthophyll
Biosynthesis. J Biol Chem 271: 28861–28867
Bramley PM (2002) Regulation of carotenoid formation during tomato fruit ripening and
development. J Exp Bot 53: 2107–2113
Brausemann A, Gemmecker S, Koschmieder J, Ghisla S, Beyer P, Einsle O (2017) Structure of
Rice (O. sativa) Phytoene Desaturase Provides Insights Into Herbicide Binding and Reaction
Mechanisms Involved In Carotene Desaturation, Structure, in press
Breitenbach J, Bruns M, Sandmann G (2013) Contribution of two ζ-carotene desaturases to
the poly-cis desaturation pathway in the cyanobacterium Nostoc PCC 7120. Arch Microbiol
195: 491–498
Breitenbach J, Fernández-González B, Vioque A, Sandmann G (1998) A higher-plant type ζ-
carotene desaturase in the cyanobacterium Synechocystis PCC6803. Plant Mol Biol 36: 725–
732
Breitenbach J, Kuntz M, Takaichi S, Sandmann G (1999) Catalytic properties of an expressed
and purified higher plant type ζ-carotene desaturase from Capsicum annuum. Eur J Biochem
265: 376–383
Breitenbach J, Sandmann G (2005) ζ-Carotene cis isomers as products and substrates in the
plant poly-cis carotenoid biosynthetic pathway to lycopene. Planta 220: 785–793
Breitenbach J, Zhu C, Sandmann G (2001) Bleaching herbicide norflurazon inhibits phytoene
desaturase by competition with the cofactors. J Agric Food Chem 49: 5270–5272
Britton G, Liaaen-Jensen S, Pfander H (2004) Carotenoids - Handbook. 1st ed., Birkhäuser, Basel
Britton G, Liaaen-Jensen S, Pfander H (2004) Carotenoids - Volume 1 B: Spectroscopy, 1st ed.,
Birkhäuser, Basel
Bruno M, Al-Babili S (2016) On the substrate specificity of the rice strigolactone biosynthesis
enzyme DWARF27. Planta 243: 1429–1440
Bruno M, Hofmann M, Vermathen M, Alder A, Beyer P, Al-Babili S (2014) On the substrate- and
stereospecificity of the plant carotenoid cleavage dioxygenase 7. FEBS Lett 588: 1802–1807
Bruno M, Koschmieder J, Wüst F, Schaub P, Fehling-Kaschek M, Timmer J, Beyer P, Al-Babili S
(2016) Enzymatic study on AtCCD4 and AtCCD7 and their potential to form acyclic
regulatory metabolites. J Exp Bot 67: 5993–6005
Bruno M, Vermathen M, Alder A, Wüst F, Schaub P, van der Steen R, Beyer P, Ghisla S, Al-Babili S (2017) Insights into the formation of carlactone from in-depth analysis of the CCD8-
catalyzed reactions. FEBS Lett 591: 792–800
Bugos RC, Hieber AD, Yamamoto HY (1998) Xanthophyll cycle enzymes are members of the
lipocalin family, the first identified from plants. J Biol Chem 273: 15321–15324
Carol P, Kuntz M (2001) A plastid terminal oxidase comes to light: Implications for carotenoid
References
151
biosynthesis and chlororespiration. Trends Plant Sci 6: 31–36
Cazzonelli CI (2011) Carotenoids in nature: Insights from plants and beyond. Funct Plant Biol
38: 833–847
Cazzonelli CI, Pogson BJ (2010) Source to sink: regulation of carotenoid biosynthesis in plants.
Trends Plant Sci 15: 266–274
Chamovitz D, Sandmann G, Hirschberg J (1993) Molecular and biochemical characterization
of herbicide-resistant mutants of cyanobacteria reveals that phytoene desaturation is a rate-
limiting step in carotenoid biosynthesis. J Biol Chem 268: 17348–17353
Chen Y, Li F, Wurtzel ET (2010) Isolation and characterization of the Z-ISO gene encoding a
missing component of carotenoid biosynthesis in plants. Plant Physiol 153: 66–79
Clough JM, Pattenden G (1979) Naturally occurring poly-cis carotenoids. Stereochemistry of
poly-cis lycopene and its congeners in “Tangerine” tomato fruits. J Chem Soc, Chem
Commun 616–619
Copeland RA (2000), Enzymes: a practical introduction to structure, mechanism and data
analysis, 1st ed., Wiley-VCH, Weinheim
Cramp MC, Gilmour J, Hatton LR, Hewett RH, Nolan CJ, Parnell EW (1987) Design and Synthesis
of N-(2,4-difluorophenyl)-2-(3-trifluoromethylphenoxy)-3-pyridinecarboxamide (diflufenican), a
Novel Pre- and Early Post-emergence Herbicide for Use in Winter Cereals. Pestic Sci 18: 15–28
Cunningham FX, Gantt E (1998) Genes and Enzymes of Carotenoid Biosynthesis in Plants. Annu
Rev Plant Physiol Plant Mol Biol 49: 557–583
Cunningham FX, Pogson B, Sun Z, McDonald K a, DellaPenna D, Gantt E (1996) Functional
Analysis of the β and ε Lycopene Cyclase Enzymes of Arabidopsis Reveals a Mechanism for
Control of Cyclic Carotenoid Formation. Plant Cell 8: 1613–1626
Cuttriss AJ, Chubb AC, Alawady A, Grimm B, Pogson BJ (2007) Regulation of lutein
biosynthesis and prolamellar body formation in Arabidopsis. Funct Plant Biol 34: 663–672
Degli Esposti M, Bertoli E, Parenti-Castelli G, Fato R, Mascarello S, Lenaz G (1981) Incorporation
of Ubiquinone Homologs into Lipid Vesicles and Mitochondrial Membranes. Arch Biochem
Biophys 210: 21–32
Demmig-Adams B, Gilmore AM, Adams WW (1996) In vivo functions of carotenoids in higher
plants. Faseb 10: 403–412
Diretto G, Tavazza R, Welsch R, Pizzichini D, Mourgues F, Papacchioli V, Beyer P, Giuliano G
(2006) Metabolic engineering of potato tuber carotenoids through tuber-specific silencing of
lycopene ε-cyclase. BMC Plant Biol 6: 13
Dogbo O, Laferriere A, d’Harlingue A, Camara B (1988) Carotenoid Biosynthesis: Isolation and
Characterization of a Bifunctional Enzyme Catalyzing the Synthesis of Phytoene. Proc Natl
Acad Sci USA 85: 7054–7058
Dong H, Deng Y, Mu J, Lu Q, Wang Y, Xu Y, Chu C, Chong K, Lu C, Zuo J (2007) The Arabidopsis
Spontaneous Cell Death1 gene, encoding a ζ-carotene desaturase essential for carotenoid
biosynthesis, is involved in chloroplast development, photoprotection and retrograde
signalling. Cell Res 17: 458–470
Ernst S, Sandmann G (1988) Poly-cis carotene pathway in the Scenedesmus mutant C-6D.
Arch Microbiol 150: 590–594
Fantini E, Falcone G, Frusciante S, Giliberto L, Giuliano G (2013) Dissection of Tomato
Lycopene Biosynthesis through Virus-Induced Gene Silencing. Plant Physiol 163: 986–998
Floss DS, Walter MH (2009) Role of carotenoid cleavage dioxygenase 1 (CCD1) in
apocarotenoid biogenesis revisited. Plant Signal Behav 4: 172–175
Fraser PD, Misawa N, Linden H, Yamano S, Kobayashi K, Sandmann G (1992) Expression in
References
152
Escherichia coli, purification, and reactivation of the recombinant Erwinia uredovora
phytoene desaturase. J Biol Chem 267: 19891–19895
Fufezan C, Simionato D, Morosinotto T (2012) Identification of key residues for pH dependent
activation of violaxanthin de-epoxidase from Arabidopsis thaliana. PLoS One 7: e35669
Gemmecker S, Schaub P, Koschmieder J, Brausemann A, Drepper F, Rodriguez-Franco M, Ghisla S, Warscheid B, Einsle O, Beyer P (2015) Phytoene Desaturase from Oryza sativa:
Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis. PLoS One 10:
e0131717
Gemmecker S (2015) Biochemische und strukturelle Charaktierisierung der Phytoen-
Desaturasen aus Pantoea ananatis und Oryza sativa. University of Freiburg, Germany
Gibson DG, Young L, Chuang R-Y, Venter JC, Hutchison CA, Smith HO (2009) Enzymatic
assembly of DNA molecules up to several hundred kilobases. Nat Methods 6: 343–345
Giuliano G, Bartley GE, Scolnik PA (1993) Regulation of Carotenoid Biosynthesis during Tomato
Development. Plant Cell 5: 379–387
Greenwood AI, Tristram-Nagle S, Nagle JF (2006) Partial molecular volumes of lipids and
cholesterol. Chem Phys Lipids 143: 1–10
Gruszecki WI, Strzalka K (2005) Carotenoids as modulators of lipid membrane physical
properties. Biochim Biophys Acta - Mol Basis Dis 1740: 108–115
Hagemann GE, Sturgis JN, Wagner E, Robert B, Beyer P, Tadros MH (1996) The effects of the
detergent LDAO on the carotenoid metabolism and growth of Rhodovulum sulfidophilum.
Microbiol Res 151: 421–426
Hanukoglu I (2015) Rossmann fold: A β-α-βfold at dinucleotide binding sites. Biochem Mol Biol
Educ 43: 206–209
Havaux M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci 3: 147–
151
Havaux M (2014) Carotenoid oxidation products as stress signals in plants. Plant J 79: 597–606
Heckman KL, Pease LR (2007) Gene splicing and mutagenesis by PCR-driven overlap
extension. Nat Protoc 2: 924–932
Hengartner U, Bernhard K, Meyer K, Englert G, Glinz E (1992) Synthesis, Isolation, and NMR-
Spectroscopic Characterization of Fourteen (Z)-Isomers of Lycopene and of Some Acetylenic
Didehydro- and Tetradehydrolycopenes. Helv Chim Acta 75: 1848–1865
Hou X, Rivers J, León P, McQuinn RP, Pogson BJ (2016) Synthesis and Function of
Apocarotenoid Signals in Plants. Trends Plant Sci 21: 792–803
Huang FC, Molnár P, Schwab W (2009) Cloning and functional characterization of carotenoid
cleavage dioxygenase 4 genes. J Exp Bot 60: 3011–3022
Huang J, Liu J, Li Y, Chen F (2008) Isolation and characterization of the phytoene desaturase
gene as a potential selective marker for genetic engineering of the astaxanthin-producing
green alga Chlorella zofingiensis (Chlorophyta). J Phycol 44: 684–690
Hugueney P, Römer S, Kuntz M, Camara B (1992) Characterization and molecular cloning of a
flavoprotein catalyzing the synthesis of phytofluene and ζ-carotene in Capsicum
chromoplasts. Eur J Biochem 209: 399–407
Isaacson T, Ohad I, Beyer P, Hirschberg J (2004) Analysis in vitro of the enzyme CRTISO
establishes a poly-cis-carotenoid biosynthesis pathway in plants. Plant Physiol 136: 4246–4255
Isaacson T, Ronen G, Zamir D, Hirschberg J (2002) Cloning of tangerine from tomato reveals a
carotenoid isomerase essential for the production of β-carotene and xanthophylls in plants.
Plant Cell 14: 333–342
References
153
Johnson ER, Keinan S, Mori-Sánchez P, Contreras-García J, Cohen AJ, Yang W (2010)
Revealing noncovalent interactions. J Am Chem Soc 132: 6498–6506
Josse EM, Alcaraz JP, Labouré AM, Kuntz M (2003) In vitro characterization of a plastid
terminal oxidase (PTOX). Eur J Biochem 270: 3787–3794
Joyard J, Ferro M, Masselon C, Seigneurin-Berny D, Salvi D, Garin J, Rolland N (2009)
Chloroplast proteomics and the compartmentation of plastidial isoprenoid biosynthetic
pathways. Mol Plant 2: 1154–1180
Kachanovsky DE, Filler S, Isaacson T, Hirschberg J (2012) Epistasis in tomato color mutations
involves regulation of phytoene synthase 1 expression by cis-carotenoids. Proc Natl Acad Sci
109: 19021–19026
Kaschek D, Mader W, Fehling-Kaschek M, Rosenblatt M, Timmer J (2016) Dynamic Modeling,
Parameter Estimation and Uncertainty Analysis in R. bioRxiv
Kim J, Smith JJ, Tian L, DellaPenna D (2009) The evolution and function of carotenoid
hydroxylases in Arabidopsis. Plant Cell Physiol 50: 463–479
Kowalczyk-Schröder, Susanne; Sandmann G (1992) Interference of Fluridone with the
Desaturation of Phytoene by Membranes of the Cyanobacterium Aphanocapsa. Pestic
Biochem Physiol 42: 7–12
Laber B, Usunow G, Wiecko E, Franke W, Franke H (1999) Inhibition of Narcissus
pseudonarcissus Phytoene Desaturase by Herbicidal 3-Trifluoromethyl-1,1-biphenyl Derivatives.
184: 173–184
Lee H, Deloache WC, Dueber JE (2012) Spatial organization of enzymes for metabolic
engineering. Metab Eng 14: 242–251
Li F, Murillo C, Wurtzel ET (2007) Maize Y9 encodes a product essential for 15-cis-ζ-carotene
isomerization. Plant Physiol 144: 1181–1189
Linden H (1993) Isolation of a carotenoid biosynthesis gene coding for ζ-carotene desaturase
from Anabaena PCC 7120 by heterologous complementation. FEMS Microbiol Lett 106: 99–
103
Linden H, Misawa N, Chamovitz D, Pecker I, Hirschberg J, Sandmann G (1991) Functional
Complementation in Escherichia coli of Different Phytoene Desaturase Genes and Analysis of
Accumulated Carotenes. Z Naturforsch 46 c: 1045–1051
Liu J, Gerken H, Huang J, Chen F (2013) Engineering of an endogenous phytoene desaturase
gene as a dominant selectable marker for Chlamydomonas reinhardtii transformation and
enhanced biosynthesis of carotenoids. Process Biochem 48: 788–795
Liu J, Zhong Y, Sun Z, Huang J, Sandmann G, Chen F (2010) One amino acid substitution in
phytoene desaturase makes Chlorella zofingiensis resistant to norflurazon and enhances the
biosynthesis of astaxanthin. Planta 232: 61–67
Lopez AB, Yang Y, Thannhauser TW, Li L (2008) Phytoene desaturase is present in a large
protein complex in the plastid membrane. Physiol Plant 133: 190–198
Lundquist PK, Mantegazza O, Stefanski A, Stühler K, Weber APM (2017) Surveying the
Oligomeric State of Arabidopsis thaliana Chloroplasts. Mol Plant 10: 197–211
Martinez-Férez I, Vioque A, Sandmann G (1994) Mutagenesis of an Amino Acid Responsible in
Phytoene Desaturase from Synechocystis for Binding of the Bleaching Herbicide Norflurazon.
Pestic Biochem Physiol 48: 185–190
Mayer MP, Bartlett DL, Beyer P, Kleinig H (1989) The in vitro mode of action of bleaching
herbicides on the desaturation of 15-cis-phytoene and cis-ζ-carotene in isolated daffodil
chromoplasts. Pestic Biochem Physiol 34: 111–117
Mayer MP, Beyer P, Kleinig H (1990) Quinone compounds are able to replace molecular
References
154
oxygen as terminal electron acceptor in phytoene desaturation in chromoplasts of Narcissus
pseudonarcissus L. Eur J Biochem 191: 359–363
McDonald AE, Ivanov AG, Bode R, Maxwell DP, Rodermel SR, Hüner NPA (2011) Flexibility in
photosynthetic electron transport: The physiological role of plastoquinol terminal oxidase
(PTOX). Biochim Biophys Acta 1807: 954–967
Misawa N, Masamoto K, Hori T, Ohtani T, Böger P, Sandmann G (1994) Expression of an Erwinia
phytoene desaturase gene not only confers multiple resistance to herbicides interfering with
carotenoid biosynthesis but also alters xanthophyll metabolism in transgenic plants. Plant J 6:
481–489
Mo C, Bard M (2005) Erg28p is a key protein in the yeast sterol biosynthetic enzyme complex. J
Lipid Res 46: 1991–1998
Nambara E, Marion-Poll A (2005) Abscisic acid biosynthesis and catabolism. Annu Rev Plant
Biol 56: 165–185
Nievelstein V, Vandekerchove J, Tadros MH, Lintig J V, Nitschke W, Beyer P (1995) Carotene
desaturation is linked to a respiratory redox pathway in Narcissus pseudonarcissus
chromoplast membranes. Involvement of a 23-kDa oxygen-evolving-complex-like protein. Eur
J Biochem 233: 864–872
Nisar N, Li L, Lu S, Khin NC, Pogson BJ (2015) Carotenoid metabolism in plants. Mol Plant 8: 68–
82
Nocedal J, Wright S (1999) Numerical optimization, 1st ed., Springer Science+Business Media,
Berlin
Nogueira M, Mora L, Enfissi EMA, Bramley PM, Fraser PD (2013) Subchromoplast sequestration
of carotenoids affects regulatory mechanisms in tomato lines expressing different carotenoid
gene combinations. Plant Cell 25: 4560–79
Norris SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesis in
Arabidopsis defines plastoquinone as an essential component of phytoene desaturation.
Plant Cell 7: 2139–2149
North HM, Almeida AD, Boutin JP, Frey A, To A, Botran L, Sotta B, Marion-Poll A (2007) The
Arabidopsis ABA-deficient mutant aba4 demonstrates that the major route for stress-induced
ABA accumulation is via neoxanthin isomers. Plant J 50: 810–824
Ohki S, Miller-Sulger R, Wakabayashi K, Pfleiderer W, Böger P (2003) Phytoene Desaturase
Inhibition by O-(2-Phenoxy)ethyl- N -aralkylcarbamates. J Agric Food Chem 51: 3049–3055
Oeljeklaus S, Reinartz BS, Wolf J, Wiese S, Tonillo J, Podwojski K, Kuhlmann K, Stephan C, Meyer HE, Schliebs W, Brocard C, Erdmann R, Warscheid B (2012) Identification of core
components and transient interactors of the peroxisomal importomer by dual-track stable
isotope labeling with amino acids in cell culture analysis. J Proteome Res 11: 2567–2580
Park H, Kreunen SS, Cuttriss AJ, DellaPenna D, Pogson BJ (2002) Identification of the
carotenoid isomerase provides insight into carotenoid biosynthesis, prolamellar body
formation, and photomorphogenesis. Plant Cell 14: 321–332
Pecker I, Chamovitz D, Linden H, Sandmann G, Hirschberg J (1992) A single polypeptide
catalyzing the conversion of phytoene to ζ-carotene is transcriptionally regulated during
tomato fruit ripening. Proc Natl Acad Sci U S A 89: 4962–4966
Plumley FG, Schmidt GW (1987) Reconstitution of chlorophyll a/b light-harvesting complexes:
Xanthophyll-dependent assembly and energy transfer. Proc Natl Acad Sci U S A 84: 146–150
Qureshi AA, Kim M, Qureshi N, Porter JW (1974) The enzymatic conversion of cis-
(14C)phytofluene, trans-(14C)phytofluene, and trans-ζ-(14C)carotene to poly-cis-acyclic
carotenes by a cell-free preparation of tangerine tomato fruit plastids. Arch Biochem Biophys
162: 108–116
References
155
Raisig A, Sandmann G (2001) Functional properties of diapophytoene and related
desaturases of C30 and C40 carotenoid biosynthetic pathways. Biochim Biophys Acta - Mol
Cell Biol Lipids 1533: 164–170
Ramel F, Birtic S, Ginies C, Soubigou-Taconnat L, Triantaphylides C, Havaux M (2012)
Carotenoid oxidation products are stress signals that mediate gene responses to singlet
oxygen in plants. Proc Natl Acad Sci 109: 5535–5540
Raue A, Kreutz C, Maiwald T, Bachmann J, Schilling M, Klingmüller U, Timmer J (2009)
Structural and practical identifiability analysis of partially observed dynamical models by
exploiting the profile likelihood. Bioinformatics 25: 1923–1929
Rodriguez-Concepción M, Boronat A (2002) Elucidation of the Methylerythritol Phosphate
Pathway for Isoprenoid Biosynthesis in Bacteria and Plastids. A Metabolic Milestone Achieved
through Genomics. Plant Physiol 130: 1079–1089
Römer S, Fraser PD, Kiano JW, Shipton CA, Misawa N, Schuch W, Bramley PM (2000) Elevation
of the provitamin A content of transgenic tomato plants. Nat Biotechnol 18: 666–669
Römer S, Lübeck J, Kauder F, Steiger S, Adomat C, Sandmann G (2002) Genetic engineering
of a zeaxanthin-rich potato by antisense inactivation and co-suppression of carotenoid
epoxidation. Metab Eng 4: 263–272
Ronen G, Carmel-Goren L, Zamir D, Hirschberg J (2000) An alternative pathway to β-carotene
formation in plant chromoplasts discovered by map-based cloning of Beta and old-gold
color mutations in tomato. Proc Natl Acad Sci 97: 11102–11107
Roosild TP (2005) NMR Structure of Mistic, a Membrane-Integrating Protein for Membrane
Protein Expression. Science (80- ) 307: 1317–1321
Ruyter-Spira C, Al-Babili S, van der Krol S, Bouwmeester H (2013) The biology of strigolactones.
Trends Plant Sci 18: 72–83
Sandmann G (2009) Evolution of carotene desaturation: The complication of a simple
pathway. Arch Biochem Biophys 483: 169–174
Sandmann G, Böger P (1982) Bleaching Activity of New 2-Phenylpyridazinones : Structure-
Activity Relationship. Z Naturforsch 37 c: 1092- 1094
Sandmann G, Böger, P (1997) Phytoene desaturase as target for bleaching herbicides. In:
Toxicolody, Biochemistry and Molecular Biology of Herbicide Activity (Roe RM, Burton JD,
Kuhr, RJ), IOS Press, Amsterdam, 1-10
Sandmann G, Kowalczyk-Schröder S, Taylor HM, Böger P (1992) Quantitative structure-activity
relationship of fluridone derivatives with phytoene desaturase. Pestic Biochem Physiol 42: 1–6
Sandmann G, Linden H, Böger P (1989) Enzyme-Kinetic Studies on the Interaction of
Norflurazon with Phytoene Desaturase. Z Naturforsch 44 c: 787–790
Sandmann G, Mitchell G (2001) In vitro inhibition studies of phytoene desaturase by bleaching
ketomorpholine derivatives. J Agric Food Chem 49: 138–141
Sandmann G, Schmidt A, Linden H, Böger P (1991) Phytoene desaturase, the essential target
for bleaching herbicides. Source Weed Sci 39: 474–479
Sandmann G, Ward CE, Lo WC, Nagy JO, Böger P (1990) Bleaching herbicide flurtamone
interferes with phytoene desaturase. Plant Physiol 94: 476–478
Santabarbara S, Casazza AP, Ali K, Economou CK, Wannathong T, Zito F, Redding KE, Rappaport F, Purton S (2013) The requirement for carotenoids in the assembly and function of
the photosynthetic complexes in Chlamydomonas reinhardtii. Plant Physiol 161: 535–546
Schaub P, Yu Q, Gemmecker S, Poussin-Courmontagne P, Mailliot J, McEwen AG, Ghisla S, Al-Babili S, Cavarelli J, Beyer P (2012) On the structure and function of the phytoene desaturase
CRTI from Pantoea ananatis, a membrane-peripheral and FAD-dependent
References
156
oxidase/isomerase. PLoS One (7): e39550
Schledz M, Al-Babili S, Lintig J v., Haubruck H, Rabbani S, Kleinig H, Beyer P (1996) Phytoene
synthase from Narcissus pseudonarcissus: functional expression, galactolipid requirement,
topological distribution in chromoplasts and induction during flowering. Plant J 10: 781–792
Serganov A, Nudler E (2013) A Decade of Riboswitches. Cell 152: 17–24
Shumskaya M, Wurtzel ET (2013) The carotenoid biosynthetic pathway: Thinking in all
dimensions. Plant Sci 208: 58–63
Sikkema J, De Bont JAM, Poolman B (1994) Interactions of cyclic hydrocarbons with biological
membranes. J Biol Chem 269: 8022–8028
Soetaert K, Petzoldt T, Setzer RW (2010) Solving Differential Equations in R: Package deSolve. J.
Stat. Softw. 33: 1–25
Steinbrenner J, Sandmann G (2006) Transformation of the green alga Haematococcus
pluvialis with a phytoene desaturase for accelerated astaxanthin biosynthesis. Appl Environ
Microbiol 72: 7477–7484
Suarez J V., Banks S, Thomas PG, Day A (2014) A new F131V mutation in Chlamydomonas
phytoene desaturase locates a cluster of norflurazon resistance mutations near the FAD-
binding site in 3D protein models. PLoS One 9: e99894
Takabayashi A, Kadoya R, Kuwano M, Kurihara K, Ito H, Tanaka R, Tanaka A (2013) Protein co-
migration database (PCoM-DB) for Arabidopsis thylakoids and Synechocystis cells.
Springerplus 2: 148
Tian L (2015) Recent advances in understanding carotenoid-derived signaling molecules in
regulating plant growth and development. Front Plant Sci 6: 1–4
Tian L, Dellapenna D (2004) Progress in understanding the origin and functions of carotenoid
hydroxylases in plants. Arch Biochem Biophys 430: 22–29
Wagner T, Windhövel U, Römer S (2002) Transformation of tobacco with a mutated
cyanobacterial phytoene desaturase gene confers resistance to bleaching herbicides. Z
Naturforsch 57c: 671-679
Walter MH, Strack D (2011) Carotenoids and their cleavage products: biosynthesis and
functions. Nat Prod Rep 28: 663–692
Welsch R, Beyer P, Hugueney P, Kleinig H, von Lintig J (2000) Regulation and activation of
phytoene synthase, a key enzyme in carotenoid biosynthesis, during photomorphogenesis.
Planta 211: 846–854
Wessel D, Flügge UI (1984) A Method for the Quantitaive Recovery of Protein in Dilute Solution
in the Presence of Detergents and Lipds. Anal Biochem 138: 141–143
Wheeldon I, Minteer SD, Banta S, Barton SC, Atanassov P, Sigman M (2016) Substrate
channelling as an approach to cascade reactions. Nat Chem 8: 299–309
Yu Q, Beyer P (2012) Reaction specificities of the ε-ionone-forming lycopene cyclase from rice
(Oryza sativa) elucidated in vitro. FEBS Lett 586: 3415–3420
Yu Q, Ghisla S, Hirschberg J, Mann V, Beyer P (2011) Plant carotene cis-trans isomerase
CRTISO: A new member of the FADred-dependent flavoproteins catalyzing non-redox
reactions. J Biol Chem 286: 8666–8676
Yu Q, Schaub P, Ghisla S, Al-Babili S, Krieger-Liszkay A, Beyer P (2010) The lycopene cyclase
CrtY from Pantoea ananatis (formerly Erwinia uredovora) catalyzes an FADred-dependent
non-redox reaction. J Biol Chem 285: 12109–12120
Acknowledgements
157
8 Acknowledgements
I would like to thank Prof. Dr. Peter Beyer for supervising my dissertation,
offering guidance and encouraging me to work and think independently.
I’m indebted to Dr. Patrick Schaub, Dr. Ralf Welsch and Dr. Florian Wüst, for
teaching me the knowledge and skills that were crucial for the success of this
work and for their technical assistance and useful advice.
I’m glad to have conducted this dissertation alongside Dr. Mark Bruno and Dr.
Daniel Álvarez and would like to thank them for their constant support. Having
spent a lot of time together, inside and outside the laboratory, I consider you
not only colleagues but good friends.
I would like to thank Carmen Schubert for her help whenever it was needed.
Thank you to Prof. Dr. Sandro Ghisla for helpful advice and providing a better
understanding of enzyme kinetics and mechanisms over the past years.
I would like to show appreciation for the work of my cooperation partners
Anton Brausemann and Dr. Mirjam Fehling-Kaschek who provided invaluable
structural and functional insight into phytoene desaturase.
A big thanks goes to Domi, Frede and Steve for sharing my passion for sports
on all our skiing and biking trips and for giving me an understanding of a new
take on things that helped me during this thesis.
Lastly but most importantly, I would like to express my deep gratitude to my
parents, my sister and my grandparents. I know you won’t agree but all I am
and have achieved, I owe to you. Thank you for always being there!
Recommended