View
6
Download
0
Category
Preview:
Citation preview
THE IMPACT OF VEPH1 ON OVARIAN CANCER TUMOUR
PROGRESSION IN A XENOGRAFT MOUSE MODEL
by
THOMASINA SPYBEY
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Physiology
University of Toronto
© Copyright by Thomasina Spybey 2013
ii
THE IMPACT OF VEPH1 ON OVARIAN CANCER TUMOUR
PROGRESSION IN A XENOGRAFT MOUSE MODEL
Thomasina Spybey, Master of Science
Graduate Department of Physiology, University of Toronto
Toronto, Ontario, Canada
2013
ABSTRACT
Epithelial ovarian cancer has the greatest death to incidence ratio of all gynecological cancers in
Canada. The FoxO, TGF-β, and Hippo signalling pathways are implicated in ovarian
tumourigenesis; ventricular zone-expressed PH domain protein (Veph1) may be a novel
modulator of these pathways. This thesis addresses the objectives of determining the
physiological murine tissue expression of Veph1A/B isoforms, and establishing the effect of
Veph1 expression on ovarian tumourigenesis. Veph1A and Veph1B transcripts were identified in
whole embryos; whereas, only Veph1A transcripts were present in adult tissues. Veph1
expression significantly reduced tumour growth rate in a xenograft mouse model. This was
associated with reduced microvessel density and increased necrotic tumour area with no effect
on proliferation index. This study suggests that Veph1 may be involved in angiogenesis. Future
investigation regarding the effect of Veph1 expression on metastases and ascites formation will
be necessary to establish its role in ovarian tumourigenesis and survival.
iii
ACKNOWLEDGEMENTS
The completion of this program and thesis would not have been possible without the help
of so many people along the way.
I would first like to express my sincere appreciation for the guidance and support my
advisor Dr. Ted Brown has provided me with throughout these two years. His dedication and
genuine interest in science is admirable. I am grateful to have had a well-rounded supervisor who
is both intelligent and compassionate. Dr. Brown, I am very appreciative to have been a student
in your lab; thank you.
I would next like to thank Dr. Alexandra Kollara. I truly believe that I would not have
been able to successfully complete this program and thesis without her support. She has seen me
express happiness, sadness, annoyance (yeast), joy, success, and every emotion in between
throughout my time in the lab. Alex, I am very grateful for the contributions you have made to
this project and for being my lab mum.
Thank you to Drs. Harry Elsholtz, Norman Rosenblum, and Maurice Ringuette of my
committee for the collective advice they have contributed throughout this program. Further, I
would like to thank Dr. Elsholtz for his involvement in my final defense, along with Drs. Denise
Belsham, Ashley Bruce, and Ian Rogers.
I would also like to thank Dr. Blaise Clarke for his assistance with data analyses and
contributions to this thesis. The many hours we spent counting blood vessels was a daunting task
and I appreciate his patience and enthusiasm.
I would like to thank the past and present students of the Brown Lab including Prem,
Angela, Crystal, and Soyeon. I am grateful for the conversations, support, and memories we have
shared. A special thank you goes to Prem as she has helped me tremendously with the many
questions I have asked her on a daily basis. I am appreciative of the new friendships I have
formed with several past and present students on the 6th
floor, including Tania, Abhi, Bojana,
Taline, Sarah, Nicole, and all others. Knowing that we were all tackling the same challenge was
very comforting and the memories I have with each of you are unforgettable.
iv
I would like to further thank Dragana Vukasovic for patiently welcoming me to
constantly ask her for room availability; the staff at the Centre for Cellular and Biomolecular
Research Animal Facility for their training and advice throughout the mouse project; and the
staff at Pathology Services of the Toronto Centre for Phenogenomics for their valuable advice
and answers to my many questions.
I would like to express a special thank you to Anna, Tania, and Gabriel. You have each
been instrumental in maintaining my sanity throughout this program and I will always appreciate
your support. Further I would like to thank my second family (Cathie, Bailey, Shannon, and
Jarred) for believing in me always. I would also like to thank my mum and Craig for their
support and for listening to me complain and rejoice for hours on Skype about science.
Lastly, I want to acknowledge the mice that were involved in my project that have
contributed towards developing our knowledge regarding Veph1. I do not know what the future
of this protein holds, but I am grateful to be a part of uncovering its role and hopeful clinical
application.
v
2.1. DEDIC
I dedicate this thesis to my beautiful mum. Mum, you are very special to me and I
appreciate the strength and unconditional love you have always provided me with.
DEDICATION
vi
TABLE OF CONTENTS
ABSTRACT ................................................................................................................................... ii
ACKNOWLEDGEMENTS ........................................................................................................ iii
DEDICATION................................................................................................................................v
TABLE OF CONTENTS ............................................................................................................ vi
LIST OF TABLES ..................................................................................................................... viii
LIST OF FIGURES ..................................................................................................................... ix
ABBREVIATIONS ...................................................................................................................... xi
Chapter 1 LITERATURE REVIEW ...........................................................................................1
1.1 Overview .............................................................................................................................1
1.2 Epithelial Ovarian Cancer ................................................................................................2
1.2.1 Epidemiology and Stage-Dependent Survival .......................................................... 2
1.2.2 Heterogeneity of Epithelial Ovarian Cancer ............................................................. 3
1.2.3 Ovarian Tumour Progression .................................................................................... 6
1.2.4 Theory of High-Grade Serous Carcinoma Pathogenesis .......................................... 8
1.2.5 Theory of Clear Cell Carcinoma Pathogenesis ....................................................... 12
1.3 Veph1 ................................................................................................................................14
1.3.1 Discovery, Structure, Function ............................................................................... 14
1.3.2 Veph1 Involvement in FoxO Signalling ................................................................. 17
1.3.3 Veph1 Involvement in TGF-β Signalling ............................................................... 22
1.3.4 Veph1 Involvement in Hippo Signalling ................................................................ 25
1.3.5 Veph1 Expression in Epithelial Ovarian Cancer .................................................... 26
1.4 Thesis Hypothesis and Objectives ..................................................................................27
Chapter 2 MATERIALS AND METHODS ..............................................................................29
2.1 Tissue Culture ....................................................................................................................29
2.2 Tissue Specimen Collection ...............................................................................................29
2.3 Animals ..............................................................................................................................29
2.4 Tumour Model ...................................................................................................................31
2.5 RNA Extraction and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) .......32
2.6 Protein Extraction and Western Blot Analysis ..................................................................32
2.7 Immunohistochemistry ......................................................................................................37
2.8 Double Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL)
and Cleaved Caspase-3 Staining ........................................................................................39
2.9 Immunohistochemistry Imaging and Quantitation ............................................................40
2.10 SOD2 Activity Assay .........................................................................................................41
2.11 Statistical Analyses ............................................................................................................42
vii
Chapter 3 RESULTS ...................................................................................................................43
3.1 Veph1 Expression in Murine Embryos and Adult Tissues ..........................................43
3.1.1 Veph1A and Veph1B mRNA expression in murine whole embryos and adult
tissues……………................................................................................................................. 43
3.1.2 Veph1A protein expression and distribution in murine adult tissues ................... ..43
3.2 Veph1 Expression Effect on Ovarian Tumour Progression ........................................48
3.2.1 Veph1 effect on tumour formation ......................................................................... 48
3.2.2 Veph1 effect on tumour growth rate and survival .................................................. 62
3.2.3 Veph1 effect on proliferative index ........................................................................ 62
3.2.4 Veph1 effect on necrotic tumour area ..................................................................... 70
3.2.5 Veph1 effect on microvessel density ...................................................................... 70
3.2.6 Veph1 effect on SOD2 protein expression and activity .......................................... 75
Chapter 4 DISCUSSION .............................................................................................................82
4.1 Summary of Findings .........................................................................................................82
4.2 Widespread Physiological Murine Expression of Veph1 ..................................................82
4.3 Veph1 Impedes SKOV3 Primary Tumour Growth ...........................................................86
4.4 Future Directions ...............................................................................................................91
Chapter 5 REFERENCES ..........................................................................................................93
viii
LIST OF TABLES
Table 1 - Primers used for RT-PCR analyses of Veph1A, Veph1B, and ACTB. 33
Table 2 - Antibodies used for Western blot analyses. 36
Table 3 - Antibodies used for immunohistochemical staining. 38
Table 4 - Summary of Veph1A mRNA and protein expression, and protein
localization, in murine adult male and female reproductive tissues. 56
Table 5 - Summary of Veph1A mRNA and protein expression, and protein localization
in murine adult non-reproductive tissues. 57
ix
LIST OF FIGURES
Figure 1 - Schematic representation of human and murine Veph1 protein isoforms. 15
Figure 2 - Schematic illustrating proposed mechanisms by which Veph1 modulates
FoxO, TGF-β, and Hippo signalling. 19-20
Figure 3- Illustration of the pMEP5-3xFlag-Veph1 expression vector. 30
Figure 4 - Schematic illustrating RT-PCR primer location within Veph1A and Veph1B
transcripts. 34
Figure 5 - Veph1A and Veph1B transcript expression in murine whole embryos. 44
Figure 6 - Veph1A and Veph1B transcript expression in murine adult reproductive and
non-reproductive tissues. 45
Figure 7 - Homology between murine and human Veph1 protein sequences and
summary of epitopes of the human Veph1 protein targeted by commercially available
antibodies. 46-47
Figure 8 - Veph1A localization in murine adult female reproductive tissues. 49
Figure 9 - Veph1A localization in murine adult male reproductive tissues. 50-51
Figure 10 - Veph1A localization in murine adult non-reproductive tissues. 52-53
Figure 11 - Veph1A localization in murine adult non-reproductive tissues. 54-55
Figure 12 - Veph1A protein expression in murine adult male and female reproductive
tissues, as determined by Western blot analyses. 58-59
Figure 13 - Veph1A protein expression in murine adult non-reproductive tissues, as
determined by Western blot analyses. 60-61
Figure 14 - SKOV3-M and SKOV3-Ve tumour formation. 63
Figure 15 - ZnSO4-supplemented drinking water induction of Flag-Veph1. 64-65
Figure 16 - SKOV3-M and SKOV3-Ve tumour growth rate and survival. 66-67
Figure 17 - SKOV3-M and SKOV3-Ve tumour nuclear Ki-67 proliferative labeling
index. 68
Figure 18 - SKOV3-M and SKOV3-Ve tumour nuclear PCNA proliferative labeling
index. 69
Figure 19 - SKOV3-M and SKOV3-Ve tumour necrotic area and liquid accumulation. 71
Figure 20 - SKOV3-M and SKOV3-Ve tumour double TUNEL and cleaved caspase-3
staining. 72-73
Figure 21 - SKOV3-M and SKOV3-Ve tumour microvessel density as determined by
CD34 staining. 74
Figure 22 - SKOV3-M and SKOV3-Ve tumour microvessel density as determined by
CD31 staining. 76
Figure 23 - SKOV3-M and SKOV3-Ve SOD2 expression and activity in vitro. 77-78
Figure 24 - SOD2 protein expression in SKOV3-M and SKOV3-Ve tumours, as
determined by Western blot analysis. 79-80
x
Figure 25 - SOD2 protein expression in SKOV3-M and SKOV3-Ve tumours, as
determined by immunohistochemical analysis. 81
Figure 26 - Survival of serous ovarian cancer patients with and without VEPH1
alterations. 90
xi
ABBREVIATIONS
3-D 3-Dimensional
ACTB β-actin
AEC 3-amino-9-ethylcarbazole
Akt V-akt murine thymoma viral oncogene homolog 1
ALK Activin receptor-like kinase
ANOVA Analysis of variance
AP-1 Activator protein 1
ARID1A AT-rich interactive domain-containing protein 1A
BALB/c Bagg Albino/c
BAMBI BMP and activin membrane-bound inhibitor homolog
BCA Bicinchoninic acid
Bcl B-cell lymphoma
Bim Bcl2-like protein 11
BMP Bone morphogenetic protein
BRCA1/2 Breast cancer type 1 susceptibility protein 1/2
CA-125 Cancer antigen-125
CAFs Cancer-associated fibroblasts
CD31/34 Cluster of differentiation 31/34
CdCl2 Cadmium chloride
CDH1 E-cadherin
c-Myc Myelocytomatosis oncogene
CTGF Connective tissue growth factor
DAB 3,3-diaminobenzidine
DAB2 Disabled homolog 2
DACH1 Dachshund homolog 1
DDW Double distilled water
DICER Dicer I ribonuclease type III
ECL Enhanced chemiluminescence
EGTA Ethylene glycol tetraacetic acid
EndMT Endothelial-mesenchymal transition
EMT Epithelial-mesenchymal transition
EOC Epithelial ovarian cancer
Ets-1 v-ets erythroblastosis virus E26 oncogene homolog 1
EZH2 Zeste homolog 2
xii
FBS Fetal bovine serum
FoxN1 Forkhead box N1
FoxO Forkhead box sub-group O
FTE Fallopian tube epithelium
G418 Geneticin
GAPDH Glyceraldehyde 3-phosphate dehydrogenase
GFP Green fluorescent protein
H2O2 Hydrogen peroxide
HEPES 4-2-hydroxyethyl-1-piperazineethanesulfonic acid
HGSC High-grade serous carcinoma
HIF1α Hypoxia-inducible factor 1
H-Ras v-Ha-ras Harvey rat sarcoma viral oncogene homolog
HRP Horseradish peroxidase
IHC Immunohistochemical
JNK c-Jun N-terminal kinases
Ki-67 Ki-67 antigen
KRAS V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
LATS Large tumour suppressor
LEF1 Lymphoid enhancer-binding factor 1
MMP Matrix metalloproteinase
MST Mammalian STE-20-like kinase
MT1-MMP Membrane-type I matrix metalloproteinase
mTOR Mammalian target of rapamycin
MV Microvessels
MVD Microvessel density
NADPH Nicotinamide adenine dinucleotide phosphate-oxidase
NOS3 Nitric oxide synthase
OSE Ovarian surface epithelium
PAGE Polyacrylamide gel electrophoresis
PBS Phosphate buffered saline
PCNA Proliferative cell nuclear antigen
PH Pleckstrin homology
PI3K Phosphatidylinositide 3-kinase
PIK3CA Phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic
subunit alpha
PTEN Phosphatase and tensin homolog
Puma Bcl2 binding component 3
xiii
PVDF Polyvinylidene fluoride
RB1 Retinoblastoma 1
RIPA Radioimmunoprecipitation assay
ROS Reactive oxygen species
RT-PCR Reverse transcriptase-polymerase chain reaction
SC-Goat-PC Santa Cruz goat polyclonal
SC-Rab-PC Santa Cruz rabbit polyclonal
SDS Sodium dodecyl sulfate
SEM Standard error of mean
Sigma-Rab-PC Sigma rabbit polyclonal
SMAD Mothers against decapentaplegic homolog 2/3
SNK Student-Newman-Keuls
SOD Superoxide dismutase
Ta Annealing temperature
TAZ Transcriptional coactivator with PDZ-binding motif
TβRI TGF-β receptor 1
TCF4 Transcription factor 4
TGF-β Transforming growth factor β
TGFBR3 Betaglycan
TMEPAI Transmembrane prostate androgen-induced protein
TP53 Tumour protein 53
Trp53 Transformation-related protein 53
Tsc1/2 Tuberous sclerosis 1/2
TUNEL Double terminal deoxynucleotidyl transferase dUTP nick end
labeling
TVS Transvaginal ultrasound
uPA Urokinase plasminogen activator
VEGF Vascular endothelial growth factor
Veph1 Ventricular zone expressed PH domain protein 1
Wnt Wingless-type
Wts Warts
YAP Yes-associated protein
ZnSO4 Zinc sulfate
1
Chapter 1 LITERATURE REVIEW
1.1 Overview
In Canada there were approximately 2,600 new cases of epithelial ovarian cancer (EOC)
diagnosed and 1,750 ovarian cancer-related deaths reported in 2012 [1]. This disease is often
diagnosed at an advanced stage (III/IV) due to a lack of specific symptoms and biomarkers of
early stage disease. While late stage EOC has a 5-year survival rate of less than 30%, Stage I
EOC has a 5-year survival rate of greater than 90%, underscoring the need for strategies to
increase the occurrence of early diagnosis [2, 3]. An improved understanding of signalling events
underlying ovarian tumourigenesis is required to improve overall survival.
Veph1 (ventricular zone expressed PH domain protein 1) may be a novel protein
involved in ovarian tumourigenesis. A role for Veph1 in EOC is strongly implicated by a recent
genome wide analysis of copy number in 68 primary human EOCs; VEPH1 copy number and
mRNA expression were significantly increased in >40% of these samples [4]. An independent
study examining 12 human ovarian clear cell carcinoma cell lines identified an increased copy
number of VEPH1 in 7 of these cell lines [5]. Furthermore, ovarian cancer cell lines ES2, HEY,
and OVCA429, which are highly motile and exhibit invasive properties [6, 7], have high levels
of Veph1 protein, as compared to SKOV3 and OVCAR3 ovarian cancer cell lines that have non-
detectable Veph1 levels and a less invasive phenotype [6, 7]. Our lab has recently generated
microarray data indicating Veph1 expression alters genes that are partially regulated by the
Forkhead box sub-group O (FoxO), Hippo, and transforming growth factor-β (TGF-β) signalling
pathways, which have both ovarian tumour suppressing and promoting functions. This is
supported by Teleman et al. [8] who have shown that Melted, the Drosophila homolog of Veph1,
impairs FoxO activity [8]. Further studies in Drosophila indicate that Melted inhibits the
expression of tumour suppressing Hippo signalling mediator warts (wts; large tumour
suppressor 1/2 (LATS1/2) homolog) in photoreceptors [9-11]. In addition, studies in our lab
indicate Veph1 inhibits canonical TGF-β SMAD2/3-dependent (mothers against decapentaplegic
homolog 2/3; SMAD2/3) signalling (Shathasivam et al., in preparation). As Veph1 may be a
modulator of several signalling pathways that have tumour suppressing and promoting functions,
determination of the net effect of Veph1 on ovarian tumourigenesis is warranted.
2
The studies presented in this thesis begin by addressing the physiological murine
expression of Veph1 mRNA and protein in whole embryos and select adult tissues. Furthermore,
I examined the effect of Veph1 on ovarian tumour formation and progression using a xenograft
mouse model. In this thesis, I present evidence that Veph1 mRNA expression in adult murine
tissues is more widespread than previously indicated in the literature [12] and that evaluation of
Veph1 protein expression is not attainable with current commercially available antibodies. I also
provide evidence that Veph1 is a novel disruptor of primary tumour growth rate and promotes
survival. This may be due to an induced reduction in microvessel density (MVD) by Veph1 that
could account for an increase in necrotic tumour area.
1.2 Epithelial Ovarian Cancer
1.2.1 Epidemiology and Stage-Dependent Survival
Ovarian cancer affects approximately 204,000 women worldwide each year and is the
fifth deadliest malignancy among women in North America [13]. In Canada, there were 2,600
new cases of ovarian cancer diagnosed and 1,750 deaths reported in 2012 [1]. Although this is a
relatively uncommon cancer, the death to incidence ratio is the highest of all gynecological
cancers in Canada [1] and the world [14]. The high mortality rate associated with this disease is
largely due to the frequency of advanced stage (stage III and IV) EOC detection: more than 80%
of women are diagnosed when metastases are present in the abdomen or beyond the peritoneal
cavity. Upon initial chemotherapeutic treatment, approximately 80% of patients with advanced
stage EOC will be responsive; however, up to 70% of patients will experience a recurrence of
disease [2, 3]. Ultimately, up to 90% of these patients will succumb to their disease as malignant
cells acquire resistance to existing chemotherapeutic options [2]. Conversely, patients diagnosed
at earlier stages (stage I and II), when malignancy is confined to the ovaries, have a 5-year
survival rate of greater than 90%; however, fewer than 20% of cases are diagnosed at this point
in disease progression [3, 15, 16]. Delayed detection is largely accountable to a lack of specific
symptoms or effective screening tests to indicate early stage disease [16, 17]. Novel screening
approaches can be developed once a thorough understanding of the initiating events in ovarian
tumourigenesis is established.
Delayed detection is due in part to the vague symptoms associated with this disease that
are poor indicators of ovarian cancer. Retrospective studies indicate that approximately 95% of
3
patients who are diagnosed with ovarian cancer experience one or more symptoms prior to
diagnosis [18]. Unfortunately, these symptoms- which include bloating, gas, nausea, diarrhea,
and fatigue- are common and poor specific indicators of disease. Women will often delay
seeking medical attention or will be initially misdiagnosed with gastrointestinal issues, allowing
tumour progression to continue [19]. Researchers from the Department of Obstetrics and
Gynecology at the University of Washington are currently conducting a clinical trial using
symptom-triggered screening for ovarian cancer [18]. This model involves patients completing
questionnaires regarding known symptoms. Women who screen positive using this symptom
index undergo the current standard of care for ovarian cancer testing: cancer antigen-125 (CA-
125) serum level measuring and transvaginal ultrasound (TVS). CA-125 is a poorly sensitive and
specific marker as not all ovarian cancer patients have elevated serum levels and benign
conditions can also increase serum CA-125; however, it is the only current screening option
available until novel serum markers of early disease are developed [18]. An additional
contributor to the poor survival associated with ovarian cancer is the complex nature of the
disease.
1.2.2 Heterogeneity of Epithelial Ovarian Cancer
“Ovarian cancer” is an overall name referring to a multitude of subtypes that differ in
terms of their clinical course, genetic mutations involved, and morphological phenotype. Upon
diagnosis, the current ovarian cancer treatment consists of surgical cytoreduction (debulking) in
an effort to remove the maximal amount of malignant tissue. This is followed by adjuvant
platinum-based and taxane drug combination chemotherapy [2]. The most frequently employed
combination is intravenous cisplatin and paclitaxel with additional drugs used depending on
tumour response. All ovarian malignancies are currently treated with similar therapeutic
approaches despite significant genomic differences between ovarian tumour subtypes.
Ovarian tumours consist of three main categories- germ cell, sex cord-stromal, or
epithelial cell- according to the ovarian structures the tumours appear to originate from. Ovarian
tumours of non-epithelial origin are less common and frequently benign [20]. Germ cell tumours
are derived from primordial germ cells and account for approximately 25% of ovarian tumours
and 3-7% of malignant ovarian tumours. Sex cord-stromal tumours originate from follicular -
thecal and granulosa- and stromal cells. These tumours are the least common, comprising only
4
8% of all ovarian tumours and 7% of malignant tumours. The most common category of ovarian
tumours is epithelial; these account for approximately 60% of all ovarian tumours. Importantly,
90% of epithelial tumours are malignant and thus this category is the most predominant and
lethal of all ovarian tumours [20]. Epithelial tumours are organized by surgical stage and
histological tumour subtype, which is further categorized as benign, malignant or borderline, and
low- or high-grade based on tumour differentiation [20]. Of the eight prominent EOC histotypes,
serous, endometrioid, mucinous, and clear cell are the most common [16]. These histotypes
differ by their unique genetic alterations that promote malignant transformation and underlie
their unique tumour progression [21].
The clear cell histotype comprises less than 3% of all EOCs. These tumours often present
as high-grade and commonly harbour inactivation mutations in the tumour suppressor gene
ARID1A, encoding AT-rich interactive domain-containing protein 1A (ARID1A) and oncogenic
activation of PIK3CA, encoding the catalytic p110α subunit of phosphatidylinositide 3-kinase
(PI3K) [16, 22]. Tumours of the endometrioid histotype represent approximately 7% of EOCs.
These tumours present as either high- or low-grade and often harbour activating mutations in
CTNNB1, the gene encoding β-catenin, and inactivating mutations of PTEN, the gene encoding
phosphatase and tensin homolog (PTEN). The mucinous histotype is the second most common
subtype which comprises 10% of patients with EOC. These tumours are commonly low-grade
and frequently harbour inactivating mutations in PTEN and oncogenic activation of V-Ki-ras2
Kirsten rat sarcoma viral oncogene homolog (KRAS) [16, 22].
The most common subtype, accounting for 70% of EOC cases, is serous. Serous tumours
present as either high- or low-grade. High-grade serous carcinomas (HGSC) are most common,
composing greater than 90% of the serous subtype. Over 75% of HGSC cases are diagnosed at
advanced stages when survival rates are low. The poor prognosis associated with this subtype is
largely due to the rapid proliferative and metastatic capacities of these tumours. In addition, these
tumours are genetically highly unstable with greater than 95% of tumours harbouring
inactivating tumour protein 53 (TP53) mutations and 40-50% exhibiting breast cancer type 1
susceptibility protein 1 (BRCA1) and/or BRCA2 inactivation via inherited mutation or epigenetic
inhibition [21, 23]. BRCA1/2 and p53 proteins are tumour suppressors with functions that
include: maintaining genomic stability, regulating cell cycle checkpoint control and apoptosis,
5
and promoting double-strand DNA break repair [23]. Recently it was revealed that HGSC itself
may have several subtypes as well. The Cancer Genome Atlas analyzed 489 HGSC tumours for
mutations, copy number alterations, and variations in miRNA expression. As expected, 96% of
tumours harbored TP53 mutations. In addition, four HGSC subtypes were identified based on
gene expression clusters categorized as immunoreactive, differentiated, proliferative, and
mesenchymal [24]. Independent genomic analyses reveal that the HGSC and high-grade
endometrioid histotypes are composed of subtypes that affect survival [25]. The fact that EOC is
composed of several unique subtypes offers an explanation as to why the current blanket
approach to treatment is not effective.
Upon diagnosis, the current ovarian cancer treatment strategy consists of surgical
cytoreduction, in an effort to remove the maximal amount of malignant tissue, followed by
adjuvant platinum-based and taxane drug combination chemotherapy [2]. As EOC is composed
of several histotypes that differ by their unique genetic alterations, chemoresponse and prognosis
between histotypes varies [21]. Five-year survival rates associated with mucinous ovarian
tumours varies from 83% at stage I to 9% at stage IV, similar to endometrioid tumours with a
five-year survival rate of 78% at stage I and 6% at stage IV. This indicates that both mucinous
and endometrioid have similar chemotherapy response to drugs that are currently used. By
contrast, stage I chemotherapy response rate for clear cell tumours can be as low as 15%,
whereas serous tumours have an approximately 70% response rate. The limited chemoresponse
of early stage clear cell tumours accounts for the reduced five-year stage I survival rate of 60%,
as compared to serous tumours at 80% [26]. The poor stage I prognosis of clear cell patients is of
importance as approximately 48% of patients with clear cell carcinoma are diagnosed at stages I
and II [26].
HGSC is the most common ovarian cancer subtype with greater than 75% of cases
diagnosed at advanced stages when five-year survival rates are as low as 25% for stage III
patients and 9% for stage IV patients [20]. Upon initial treatment, approximately 80% of patients
with advanced stage EOC will be responsive [2]; however, up to 70% of patients will experience
a recurrence of disease due to acquired resistance, accounting for the high mortality rates
associated with all subtypes at advanced stage disease [3]. Evidently, novel therapeutic
approaches are necessary to treat advanced stages and it is likely that subtype-specific treatment
6
will be of most importance due to the genomic variation between histotypes. A preferable
approach to improve overall ovarian cancer survival is to detect this disease during early tumour
progression at which point survival is dramatically improved. Development of detection
strategies requires a thorough understanding of the initiating and tumour progressing steps of
each histotype.
1.2.3 Ovarian Tumour Progression
Although there are significant genomic differences between the ovarian cancer subtypes,
tumour progression often follows a similar pattern. Tumour expansion will not exceed 1-2 mm if
angiogenesis is not sufficient to provide nutrient delivery and waste removal [27]. Tumour
progression of most cancer types begins with restricted primary tumour growth until
vascularization initiates a period of rapid proliferation, local invasion, and ultimate metastasis
due to newly formed, immature, and leaky capillaries that allow entry of tumour cells [27].
Unique to epithelial ovarian cancer is the implantation of malignant tissue onto the ovarian
surface often simultaneously with peritoneal implants. Most cancers require several crucial steps
of intra- and extra-vasation in order to metastasize to distant organs via the circulation; however,
ovarian cancer metastases rarely disseminate via the vasculature and thus are infrequently found
outside the peritoneal cavity [28]. All EOC histotypes have a similar passive mechanism of
metastasis; ovarian cancer cells detach from the primary tumour as single cells or multi-cellular
aggregates (spheroids) that are carried by the physiological movement of the peritoneal fluid to
the peritoneum and the omentum [28]. Epithelial-to-mesenchymal transition (EMT) of ovarian
cancer cells facilitates the detachment of these cells as an initiating event in metastasis.
EMT involves acquisition of mesenchymal properties and the loss of epithelial properties,
such as the reduction in E-cadherin-mediated cell-cell interactions, thereby promoting invasion.
Malignant ovarian cancer cells can detach as single cells or spheroid aggregates [28, 29]. Studies
indicate that ovarian cancer cells grown in three-dimensional (3-D) cultures exhibit enhanced
resistance to anoikis (anchorage-independent programmed cell death) when treated with
chemotherapeutic agents, providing a survival advantage of cell aggregates, as compared to
single cells [30, 31]. Metastatic cells attach to collagen I of exposed peritoneal extracellular
matrix and invade the mesothelium where tumour growth continues [28, 29, 32]. Ovarian cancer
cells rarely invade deeper than the mesothelial layers of the peritoneum [28].
7
Although metastasis via the vasculature is not a common characteristic of EOCs,
angiogenesis is an imperative process that supports cancer cell survival. Angiogenesis is the
development of new vessels from pre-existing ones; vascularization of malignant tissue is critical
in order to deliver nutrients and remove waste. Pathological angiogenesis is initiated by the
secretion of growth factors and proteolytic enzymes from tumour cells into the interstitium that
act on endothelial cells and basement membranes to remodel existing vessels and stimulate the
release of endothelial progenitor stem cells from the bone marrow to form new vessels [27].
Angiogenesis involves an initial activation phase that is comprised of basement membrane
degradation, increased vascular permeability, and increased endothelial cell proliferation and
migration. Following activation, a resolution phase occurs that involves basement membrane
reconstitution, inhibition of endothelial cell proliferation and migration, and stabilization of
newly formed vessels [33]. Migration and sprouting of endothelial cells is speculated to require
an endothelial-mesenchymal transition (EndMT) that must be reversed during the resolution
phase [34]. Impaired angiogenesis, resulting in reduced tumour MVD, can result in necrosis or
apoptosis of tumour cells as nutrient and oxygen delivery is limited [27].
Apoptosis is a regulated and ATP-dependent process of programmed cell death, whereas
necrosis is a pathological mechanism of cell death. Necrosis results from energy depletion and
elicits an immune response due to the rupture of necrotic cell membranes resulting in release of
cytoplasmic debris containing pro-inflammatory cytokines. Contrastingly, apoptosis is
infrequently accompanied by an inflammatory response as apoptotic bodies are phagocytosed
and cell membranes are not ruptured [35, 36]. Inflammation associated with necrosis can be both
tumour suppressing, by initiating an immune response that causes the destruction of tumour
cells, or tumour promoting, by increasing reactive oxygen species (ROS) and cytokine release
from infiltrating immune cells that induce DNA damage and replicative stress of tumour cells
[37]. Due to the multiple effects of necrosis-induced inflammation, the effect of necrotic tumour
area on prognosis is variable. For example, retrospective analysis of ovarian cancer patients that
received neo-adjuvant chemotherapy prior to debulking surgery revealed that absent or minimal
tumour necrosis was predictive of recurrent disease and prognosis [38]. Conversely, a correlation
between decreased necrotic tumour grading and improved prognosis was found in colorectal
patients [39]. Inflammatory signalling also has a role in promoting ascites formation that is
commonly identified in ovarian cancer patients.
8
A majority of patients (80%) are diagnosed when metastases are present in the abdomen
or beyond the peritoneal cavity [2, 3]. Extensive seeding of the peritoneal cavity by tumour cells
in advanced stage disease is often accompanied by ascites, an accumulation of peritoneal fluid.
Ascites results from the excessive infiltration of fluid into the peritoneal cavity due to an
inflammation-dependent increase in vessel permeability. Furthermore, fluid accumulates due to
obstruction of lymphatic vessels by tumour cells causing an impairment of peritoneal fluid
drainage [40, 41]. Ascites is present in 77% of ovarian cancer patients at diagnosis and almost all
patients develop ascites during tumour progression [42]. Accumulation of ascites fluid induces
significant morbidity by increasing abdominal pressure that results in pain, early satiety,
respiratory compromise, nausea, and reduced mobility [40, 41]. Therapeutic options commonly
include paracentesis and diuretics followed by peritoneovenous shunts [40]. Interestingly,
peritoneovenous shunts used to drain peritoneal fluid from the peritoneum into the venous
circulation does not result in disseminated hematogenous metastases due to the unique
preference of ovarian cancer cells to the mesothelial layers of the peritoneum [28]. This form of
treatment is effective in relieving symptoms in approximately 70% of patients with high volume
ascites, although a subset of patients are resistant and ascites commonly recurs [41].
Furthermore, 6% of patients suffer major complications including pulmonary edema, pulmonary
embolus, and infection [41]. As there are limitations in clinical management of ascites, there are
further difficulties in treating ovarian cancer itself.
The current standard of care involves debulking surgery and intraperitoneal
administration of chemotherapeutics, allowing direct delivery to malignant cells [28]. Optimal
debulking results in minimal residual tumour lesions greater than 1 cm and is associated with
improved prognosis [28]. Due to the high incidence of acquired chemoresistance, 90% of
patients will succumb to this disease [2] which underscores the need to establish the initiating
events of each subtype in order to develop novel early stage screening approaches. The theory of
pathogenesis for HGSC, the most common and lethal ovarian cancer subtype, involves ovulation;
however, the actual cell affected is debated.
1.2.4 Theory of High-Grade Serous Carcinoma Pathogenesis
Ovulation is a physiological process initiated by the mid-cycle surge of luteinizing
hormone that induces rupture of the ovarian wall adjacent to a mature follicle and the ultimate
9
release of an oocyte. This process involves necrosis, immune cell infiltration, vascular collapse,
and exposure of nearby cells to a transient pro-inflammatory environment [43]. In particular,
tissue repair following the liberation of the ovum results in chemokine release from cells of the
follicle that promotes immune cell recruitment [44]. Immune cells further maintain a pro-
inflammatory and oxidative environment by releasing cytokines and ROS. ROS production is
imperative for cumulus expansion and inducing cell signalling modifications that are crucial for
ovulation to occur; however, excessive ROS exposure can result in DNA damage [43, 45]. As
this is a physiological process that occurs repeatedly throughout a woman’s reproductive years, it
is vital that anti-inflammatory and tumour suppressor signalling mechanisms within exposed
cells are functional and inhibit malignant transformation. Inflammation and oxidative stress
associated with ovulation have a well-defined role in inducing DNA damage that could initiate
HGSC; however, exactly which cells are affected is debated.
There are two major proposed sites of origin of HGSC- ovarian surface epithelial (OSE)
cells and fallopian tube epithelial (FTE) cells [16]. The ovarian surface epithelium is a single
layer of uncommitted mesothelial cells that are protected from the intraovarian environment by
the tunica albuginea [16]. During the peri-ovulatory period, OSE cells are exposed to
inflammatory cytokines and ROS present in the follicular fluid which can cause DNA damage.
As a result of repair following ovulation, or as a result of aging, OSE cells can form inclusion
cysts in the hormone- and growth factor-rich ovarian stroma which induces replicative stress [16,
17]. These cells are predicted to be highly susceptible to malignant transformation as their cell
signalling systems are continuously disrupted due to mutations [17].
Transformed OSE cells have been shown to develop HGSC tumours. Mutation of the
retinoblastoma 1 (RB1) gene in normal OSE cells results in the development of ovarian tumours
that are characteristic of stage I HGSC tumours in mice [46]. Moreover, by additionally mutating
TP53, in the presence or absence of BRCA1 or BRCA2 mutations, tumours advance to stage IV
HGSC with associated peritoneal carcinomatosis. Gene expression analysis indicate that triple
mutant tumours have significant expression profile overlaps with human HGSC, supporting the
ability of transformed OSE cells to form HGSC tumours [46].
An additional theory supporting an OSE cell site of origin, independent of ovulation, is
that a population of OSE cells in the hilum region of the mouse ovary express stem cell markers
10
and are susceptible to malignant transformation. Inactivation of transformation-related protein
53 (Trp53) and RB1 in these cells induces HGSC formation in vivo [47]. OSE stem cells are not
fully differentiated which may account for the Mullerian phenotype seen in cortical inclusion
cysts that is not present in fully differentiated OSE cells.
An important characteristic of cortical inclusion cysts present in ovaries is that they are
composed of Mullerian-like epithelium. OSE cells originate from a region of coelemic
epithelium overlying the gonadal ridge during development and are mesothelial. Studies propose
that when OSE cells are exposed to the new environment of the stroma during cyst development,
cells acquire a Mullerian epithelial phenotype as they undergo metaplasia. These changes include
alterations in cell shape, secreted products, and epithelial markers [28, 48]. Importantly, FTE
cells compose a Mullerian epithelium that originates from an invagination beside the gonadal
ridge, separate from the ovarian surface epithelium [28]. The hypothesis that Mullerian epithelial
cells comprising ovarian cortical inclusion cysts may actually originate from the fallopian tube
cannot be excluded at present.
More recently, the fallopian tube has emerged as the possible site of origin of HGSC. It
has been postulated that as fimbria are in close proximity to the ovary, distal FTE cells are
exposed to the same peri-ovulatory inflammatory and oxidative microenvironment. Excessive
oxidative stress associated with ovulation induces DNA damage that can result in an increased
expression of mutated p53 as evident by a “p53 signature” on immunostained tissue sections.
The combination of DNA damage and loss of cell cycle regulation by p53 promotes clonal
expansion of these cells and the development of tubal intraepithelial carcinomas [16]. These
lesions can then progress into invasive serous carcinoma. Invasive cells exfoliate from the
fimbria and implant on the ovarian surface and the peritoneum nearly simultaneously [21]. There
is compelling evidence supporting a fallopian tube site of origin, including the ability of FTE
cells to transform into HGSC.
Analysis of fallopian tube epithelium post-ovulation in vivo reveals that a pro-
inflammatory microenvironment, mediated by macrophage infiltration, is created. As a
repercussion of peri-ovulatory oxidative stress, FTE cells harbour DNA damage that may result
in signalling disruption and ultimate transformation of these cells [49]. Experimentally, normal
FTE cells have the capability to be transformed and ultimately create HGSC tumours in vivo.
11
Karst et al. [50] transformed immortalized fallopian tube secretory epithelial cells by oncogenic
activation of myelocytomatosis oncogene (c-Myc), a locus commonly amplified in HGSC, and v-
Ha-ras Harvey rat sarcoma viral oncogene homolog (H-Ras), a constitutively active GTPase
that activates the mitogen-activated protein kinase (MAPK) proliferation pathway. Transformed
FTE cells were injected into the peritoneum of female Nude mice and gross examination
revealed that these cells had increased proliferative and metastatic capacities indicated by
widespread metastases throughout the abdomen. Importantly, tumour histology was consistent
with that of poorly differentiated HGSC [50]. In an additional study, Kim et al. [15]
demonstrated that tissue-specific double knockout of dicer 1 ribonuclease type III (DICER1) (an
essential gene in microRNA synthesis) and PTEN (a tumour suppressor that negatively regulates
the PI3K pathway) in the fallopian tube of mice resulted in HGSC tumour and ascites
development. Microarray analysis of primary tumours indicated a significant overlap in gene
expression with human HGSC [15]. An additional approach to support a fallopian tube site of
origin for ovarian cancer involves gene expression analysis of human tumours.
Gene profiling of RNA from human EOC tumours reveals that HGSC tumours
significantly correlate with fallopian tube epithelium brushings, rather than ovarian surface
epithelium. Interestingly, other common EOC tumour subtypes- clear cell, endometrioid, and
mucinous- did not have significant gene expression overlap with OSE brushings. This suggests
that only germ cell and sex cord-stromal tumours may actually originate from the ovary [51]. To
investigate this similarity of FTE cells with HGSC, Tone et al. [52] evaluated fallopian tube
epithelium of patients who were at increased risk of developing ovarian cancer due to inherited
BRCA1/2 mutations. Gene expression analysis revealed that FTE cells of the luteal phase in
BRCA mutation carriers had similar gene expression to HGSC [52]. In a follow-up study it was
identified that BRCA1-luteal phase FTE cells had elevated pro-inflammatory signalling and
altered response to ovulation-associated cytokines [53]. This gene expression profile would limit
inflammation mediation during the peri-ovulatory period in BRCA mutation carriers and may
contribute to the mechanism by which these patients are at increased risk of developing HGSC
[53].
Due to the increased risk for developing ovarian cancer, BRCA mutation carriers are
provided with the option to undergo prophylactic bilateral salpingo-oophorectomy (removal of
12
both the ovaries and fallopian tubes). Extensive analysis of fallopian tubes collected as a
preventative measure reveals important information as to the site of origin of HGSC. Medeiros et
al. [54] identified that of 13 BRCA mutation carriers undergoing a prophylactic bilateral
salpingo-oophorectomy, 38% had serous intraepithelial carcinomas in the fallopian tube, but not
in the ovary. Similarly, Callahan et al. [55] identified that 7 of 122 BRCA-positive patients had
early malignancy that originated in the fimbrial or ampullary region of the fallopian tube. Only
one of these cases had an ovarian implant [55]. Independent of BRCA status, a study analyzing
42 serous “ovarian” carcinomas collected during surgical cytoreduction found that 71% involved
the fallopian tube [55]. These data support a fallopian tube site of origin. The possibility that
HGSC originates from the fallopian tube has valuable clinical implications in terms of risk
reducing surgery as BRCA patients may only require prophylactic fallopian tube removal.
1.2.5 Theory of Clear Cell Carcinoma Pathogenesis
Similar to HGSC, clear cell carcinoma is thought to arise from extraovarian tissue. Clear
cell carcinoma differs from other histotypes as it is often diagnosed at early stages. Due to the
common occurrence of chemoresistance, clear cell carcinoma has the poorest stage I prognosis of
all EOC subtypes. Information regarding the pathogenesis of this subtype is limited. Gene
profiling of RNA from human EOC tumours reveals that clear cell tumours significantly
correlate with normal endometrium brushings, rather than OSE [51]. The proposed theory of
pathogenesis of clear cell carcinoma involves neoplastic transformation of endometriotic lesions
that transplant onto the ovarian and periotoneal surface [21]. Activation of oncogenic pathways
of endometriotic cells allows endometrial tissue to implant, survive, and invade ovarian and
peritoneal tissue. Support of an endometrial site of origin for clear cell carcinomas is provided by
epidemiological evidence that suggests a protective effect for tubal ligation, which prevents
passage of endometrial tissue to the ovary and peritoneum. This protective effect is not evident in
the mucinous and serous histotypes that are not thought to arise from endometrium tissue [21].
Furthermore, epidemiological data indicates women who have endometriosis or ovarian
endometriosis (transplantation of non-malignant endometrium) are at greater risk of developing
clear cell carcinoma, as compared to controls [56].
Endometriosis is a gynaecological condition whereby endometriotic cells lining the
uterus displace and transplant to ectopic locations including the peritoneum, ovary, or
13
rectovaginal septum. The most common explanation for transplanted endometrial tissue, which
does not apply to all cases of endometriosis, involves retrograde menstruation causing
endometrial debris to relocate and implant at ectopic sites [21]. Retrograde menstruation contains
pro-oxidant factors such as heme and iron that can promote ROS production and ultimate DNA
damage. Malignant transformation of endometriosis may be attributable to DNA mutations
induced by oxidative stress [21]. Greater than 90% of women experience retrograde
menstruation; however, the immune system clears displaced endometrium tissue in most women
[57]. Factors that allow endometriotic tissue to survive and form endometriosis are poorly
understood but are thought to include genetic predisposition, toxins, and immune status [57].
There are several mutations that are commonly acquired in the clear cell histotype.
Inactivation of the tumour suppressor gene ARID1A is seen in approximately 50% of cases.
Activating mutations of the oncogene (PIK3CA) that ultimately increases tumour promoting
PI3K/Akt signalling pathway, is also seen in 50% of tumours [21]. Activation of mammalian
target of rapamycin (mTOR), a downstream effector of PI3K/Akt (v-akt murine thymoma viral
oncogene homolog 1, Akt; also known as protein kinase B), has also been identified in clear cell
carcinomas and is involved in promoting cell cycle progression, proliferation, and angiogenesis
[56].
Due to the unique molecular signature of clear cell tumours, their chemoresponse rate to
drugs currently used to treat all ovarian histotypes differs greatly from other histotypes. Recent
genomic profiling of clear cell primary tumours revealed activation of pathways that are
involved in hypoxic cell growth, angiogenesis, and glucose metabolism that are not characteristic
of other histotypes [58]. Chemoresistance of clear cell tumours is likely attributed to the
increased capacity of tumour cells to survive in an environment with limited nutrients and
oxygen. Furthermore, in vivo studies indicate clear cell tumours are sensitive to anti-angiogenesis
chemotherapeutics, whereas serous tumours were not, suggesting an effective clear cell
histotype-specific treatment option [58]. It has also been identified that clear cell tumours often
have lower proliferative indexes, as compared to serous tumours. Low proliferative index of
clear cell tumours is correlated with reduced chemosensitivity that is likely attributable to
compromised intracellular drug accumulation in resting cells [59]. As clear cell tumours appear
to be the most resistant of all histotypes at early stages, it is imperative to identify gene mutations
14
in clear cell tumours that may account for this; Veph1 is a novel gene that is upregulated in copy
number in a subset of clear cell carcinoma cell lines [5].
1.3 Veph1
1.3.1 Discovery, Structure, Function
Vertebral ventricular zone expressed PH domain protein (Veph1) mRNA was discovered
in the ventricular zone of the murine fetal brain and has a critical function in the development of
the zebrafish central nervous system [12]. Prior to this discovery, the Drosophila orthologue of
Veph1, Melted, was shown to have an imperative role in the physiological development of the
Drosophila peripheral nervous system [60, 61]. Tissue expression data are limited. Muto et al.
[12] identified murine Veph1 mRNA in the developing embryonic eye and brain whereas adult
murine Veph1 tissue expression was restricted to the eye and kidney. Similar expression data
were found in zebrafish tissues [12].
There are four reported human transcript variants of Veph1 that encode 833 (full-length
Veph1; isoform 1), 788 (isoform 2), 213 (isoform 3), and 175 (isoform 5) amino acid isoforms.
Isoform 2 comprises the entirety of the full-length isoform 1, with an omission of amino acids
626-670. Isoforms 3 and 5 are C-terminus truncations of isoform 1 (Figure 1A). These Veph1
isoforms appear to be formed by alternative RNA splicing. The full-length human Veph1 protein
has 85% sequence homology with murine Veph1A with greatest sequence identity is within the
N- and C-terminal regions. In both human Veph1 and murine Veph1A, a conserved pleckstrin
homology (PH) domain is located from amino acid 717 to 821. A shorter murine Veph1
transcript, Veph1B, has been identified that encodes a 253 amino acid isoform corresponding
with the Veph1A C-terminal amino acids 580-833 containing the PH domain (Figure 1B).
Importantly, primers used in murine Veph1 expression studies did not distinguish between the
murine Veph1A and Veph1B isoforms [12]; expression of these individual isoforms has thus not
been investigated.
The PH domain was initially discovered in 1993 as an approximately 100 amino acid
residue motif that was present in several eukaryotic signal-transducing proteins. Proteins that
contain PH domains include serine/threonine protein kinases, tyrosine kinases, small G-protein
regulators, and phosphoinositide metabolizing enzymes [62]. Initially, the PH domain was
15
Figure 1: Schematic representation of human and murine Veph1 protein isoforms. A)
There are four transcript variants of human Veph1 identified that encode 833 (full-length Veph1;
isoform 1), 788 (isoform 2), 213 (isoform 3), and 175 (isoform 5) amino acid isoforms. Isoform
2 comprises the entirety of the full-length isoform 1, with an omission of amino acids 626-670.
Isoforms 3 and 5 are C-terminus truncations of isoform 1. B) There are two transcript variants of
murine Veph1 identified that encode 833 (Veph1A) and 253 (Veph1B) amino acid isoforms.
Veph1B is a 253 residue isoform corresponding with the Veph1A C-terminal amino acids 580-
833 that contain the PH domain. In both human and murine Veph1 proteins, a conserved PH
domain is located from amino acid 717 to 821. Amino acid sequence identity for the mid-region
and N- and C-termini between human (hVeph1) and murine (mVeph1) are indicated.
16
thought to function primarily as an anchor for PH domain host proteins to the cell membrane by
binding phospholipids. It has most recently been identified that cell membrane anchoring may
also be due to PH domain interactions with membrane receptors and that PH domains most
frequently serve as a protein-protein interaction platform. There is no specific cellular
compartment or function of PH motifs [62, 63]. As Veph1 contains a PH domain, it is likely that
this protein interacts with cell signalling mediators.
Barrios-Rodiles et al. [64] preformed a high-throughput protein-protein interaction screen
and identified the PH domain of murine Veph1A to be a novel interactor of TGF-β/BMP (bone
morphogenetic protein; BMP) signalling mediators including ALK2, ALK5, ALK6 (activin
receptor-like kinase 2/5/6; ALK2/5/6), and SMAD1 [64]. Furthermore, Teleman et al. [8]
discovered that Melted, the Drosophila orthologue of Veph1, formed PH domain-dependent
interactions with membrane phosphoinositides that resulted in cell membrane localization.
Melted recruited phosphorylated FoxO and tuberous sclerosis 1 (Tsc1) to the cell membrane
which prevented FoxO signalling and inhibition of mTOR signalling; interactions with these
proteins was PH domain-independent. mTOR signalling was promoted as Melted impeded
inhibitory Tsc1/2 complex formation [8]. Overexpression of Melted was found to promote tissue
overgrowth and this effect was PH domain-dependent [8]. Importantly, Melted and human
Veph1 proteins are highly conserved with 87% PH domain and 76% N-terminal sequence
identity thus suggesting similar functions of both proteins. Analysis of human Veph1 via the
Eukaryotic Linear Motif server (http://elm.eu.org) predicts putative Forkhead-associated domain
ligand domains (LIG_FHA_1, LIG_FHA_2) and 14-3-3 proteins interacting motifs in the Veph1
protein sequence (LIG_14-3-3_2, LIG_14-3-3_3). 14-3-3 proteins mediate FoxO signalling and
14-3-3ε was shown to interact with Melted [8]. The identified interaction of Veph1 with
members of the TGF-β/BMP cascades, and potential interaction with FoxO signalling mediators,
suggests that Veph1 may have a role in modulating these signalling pathways that have predicted
roles in ovarian tumourigenesis.
Our lab has recently generated microarray data comparing SKOV3 human ovarian cancer
cells that express low endogenous levels of Veph1 (SKOV3-M) and SKOV3 cells stably
transfected with Flag-tagged Veph1 cDNA (SKOV3-Ve). Analyses of these data indicate that
Veph1 expression alters downstream gene targets of the FoxO, TGFβ, and Hippo signalling
17
pathways (Shathasivam et al., in preparation). Each of these pathways has important
physiological and tumourigenic roles. Establishing tissue expression and the effect of Veph1 on
tumour properties warrants investigation.
1.3.2 Veph1 Involvement in FoxO Signalling
FoxO proteins compose the ‘O’ subgroup of the forkhead box family of transcription
factors. These proteins primarily act as tumour suppressors by targeting genes involved in cell
cycle regulation, apoptosis, and antioxidant defense [65]. In the presence of oxidative stress, as
occurs during ovulation, FoxO proteins act to protect cells from malignant transformation. This
is accomplished by inducing cell cycle arrest, upregulating DNA repair proteins [66], and
promoting ROS detoxification by increasing superoxide dismutase 2 (SOD2) and catalase
enzyme expression [65]. Reduced activity of these enzymes can result in accumulated DNA
damage and cell signalling disruptions. When cells are exposed to excessive oxidative stress,
FoxO transcription factors promote apoptosis by upregulating the expression of pro-apoptotic
proteins- such as Bcl2-like protein 11 (Bim), Bcl2 binding component 3 (Puma), and B-cell
lymphoma 6 (Bcl-6)- and proteins involved in cell cycle regulation- such as p27kip1, p21cip1,
p15INK4B [65]. Thus, in response to peri-ovulatory inflammation, FoxO transcription factors
are important in preventing excessive proliferation and survival of cells that are at high risk for
acquired mutations [16, 17]. Conversely, the FoxO signalling pathway may also be involved in
later events of tumour progression by promoting angiogenesis and invasion.
FoxO transcription factors upregulate SOD2 proteins in response to oxidative stress via c-
Jun N-terminal kinases (JNK)-mediated phosphorylation and activation of FoxO proteins [67].
Proteomic analysis of SKOV3 ovarian cancer cells, compared to a subseries SKOV3.ip1 cells
acquired from ascites with higher metastatic capability, indicates that SOD2 protein expression is
correlated with increased metastatic potential [68]. The effect of SOD2 on invasion is in part due
to indirect upregulation of matrix metalloproteinase (MMP) via hydrogen peroxide (H2O2)
production. Increased expression of SOD2 and decreased expression of catalase, resulting in
increased H2O2, exacerbates the effect of SOD2 on invasion [69]. Whether this SOD2-mediated
increase in MMP production is due to FoxO-dependent regulation of SOD2 has yet to be
established. FoxO-dependent MMP production has been identified in vitro and FoxO nuclear
retention due to serum starvation results in increased production of MMP-9 and MMP-13 [70].
18
Determining whether the effect of FoxO on MMP expression is SOD2-dependent was not
examined. Studies evaluating the link between FoxO and SOD2 on promoting invasion warrant
investigation.
Furthermore, H2O2 (produced in part by the enzymatic conversion of superoxide by
SOD2 [65]) has been shown to increase angiogenesis by regulating several H2O2-sensitive
signalling pathways [71]. For example, H2O2 exposure causes inhibition of PTEN, resulting in
activation of the PI3K/Akt signalling pathway that activates hypoxia-inducible factor 1 (HIF1α).
HIF1α activation promotes the transcriptional upregulation of potent pro-angiogenic vascular
endothelial growth factor (VEGF) production [71]. Whether SOD2 and/or FoxO proteins had a
role in upregulating H2O2 production in this study was not investigated. VEGF indirectly
increases SOD2 production by promoting the activation of nicotinamide adenine dinucleotide
phosphate (NADPH) oxidase, resulting in ROS production [71]. These data indicate a FoxO-
independent mechanism by which SOD2 is upregulated during angiogenesis. FoxO1 and FoxO3a
signalling represses expression of potent vasodilator and pro-angiogenic factor nitric oxide
synthase 3 (NOS3; also known as eNOS) [72]. Altogether, these data suggest that the role of
FoxO in angiogenesis is complex and warrants further investigation. Disruptors of FoxO
signalling will be valuable to investigate as this pathway can be both tumour suppressive and
promoting. Veph1 appears to be a novel potential disruptor of this pathway.
Gene Set Enrichment Analysis of microarray data comparing control SKOV3-M and
Veph1-overexpressing SKOV3-Ve cells indicates that Veph1 alters the expression of 331
putative FoxO4-regulated genes. For example, genes that are partly regulated by FoxO that were
altered by Veph1 expression are involved in angiogenesis- such as NOS3 [72]- and apoptosis-
such as B-cell lymphoma 2 (Bcl2) [65]. Inhibition of FoxO signalling by Melted, a Veph1
Drosophila orthologue, has been described by Teleman et al. (2005) [8]. Melted contains two
forkhead-associated domain ligand domains in its N-terminal region that allow it to directly
interact with and localize FoxO at the cell membrane, preventing FoxO activity. This study also
identified an interaction between Melted and 14-3-3ε proteins, which are mediators of FoxO
signalling [8] (Figure 2A). Co-immunoprecipitation experiments conducted in our lab reveal that
human Veph1 interacts with 14-3-3ε and FoxO3a proteins (Shathasivam et al., in preparation).
19
Figure 2: Schematic illustrating proposed mechanisms by which Veph1 modulates FoxO,
TGF-β, and Hippo signalling. A) Tyrosine kinase receptor binding of growth factors initiates a
phosphorylation cascade ultimately activating the kinase Akt. Akt translocates into the nucleus
and phosphorylates FoxO transcription factors at three distinct sites. This initiates a complex
process that results in the removal of FoxO proteins from the nucleus thereby diminishing the
transcription of their target genes. Inactive FoxO transcription factors interact with 14-3-3
proteins that facilitate the retention of FoxO in the cytoplasm. Studies conducted in Drosophila
indicate that Melted, a Veph1 homolog, interacts with both 14-3-3 and FoxO proteins and
inhibits FoxO activity by promoting its cell membrane localization [8]. Due to significant
sequence homology between Melted and Veph1, it is possible that Veph1 serves to inhibit FoxO
activity and expression of its target genes by interacting with 14-3-3 and FoxO proteins at the
cell membrane. Red question marks indicate interactions that have yet to be validated in human
cells. B) Binding of TGF-β dimers to their receptors results in a phosphorylation cascade that
activates SMAD2/3. These phosphorylated proteins then bind SMAD4 creating a complex that
translocates into the nucleus to regulate TGF-β target genes. Veph1 has been identified as an
inhibitor of canonical SMAD2/3-dependent signaling. Veph1 impedes the dissociation of
SMAD2 from TGF-β receptor 1 thereby reducing the nuclear localization of SMAD2/3/4
complexes and the expression of TGF-β target genes (Shathasivam et al., in preparation). C)
Several inputs (indicated by multiple arrows) regulate activation of MST1/2 kinases that
phosphorylate LATS1/2. Activated LATS1/2 kinases phosphorylate tumour promoting
YAP/TAZ transcription factors resulting in their interaction with 14-3-3 proteins and nuclear
exclusion, thereby decreasing the transcription of YAP/TAZ target genes. Studies investigating
Drosophila photoreceptor differentiation indicate that Melted inhibits the expression of wts
(LATS1/2 homolog), thus promoting YAP/TAZ nuclear activity. Wts also inhibits the expression
of melted [9, 10]. Due to significant sequence homology between Melted and Veph1, it is
possible that Veph1 also serves to inhibit LATS1/2 expression (indicated by dashed red line),
thereby promoting the expression of YAP/TAZ target genes. Orange-filled circles indicate
phosphorylation.
20
21
Alterations in phosphorylation status and localization of FoxO have been implicated in
endometrial, breast, and thyroid cancer [73]. FoxO signalling interruption can be attributed to
over-activation of the PI3K/Akt pathway, resulting in a loss of FoxO transcriptional activity [73,
74]. Lu et al. (2012) have identified an overexpression of threonine-32 phosphorylated FoxO3a
in ovarian tumours that is associated with poor survival. Threonine-32 is an Akt-regulated
residue that, once phosphorylated, prevents FoxO3a activity by promoting its nuclear
localization [75]. Furthermore, decreased ovarian tumour expression of FoxO3a is significantly
associated with decreased overall survival [76]. A correlation between decreased FoxO activity
and poor survival indicates a tumour suppressing role of this signalling pathway. Recent data
supporting a tumour promoting effect of FoxO signalling indicates that nuclear FoxO3a has a
significant positive correlation with poor survival in patients with invasive breast carcinoma
[77]. A possible mechanism by which nuclear FoxO promotes an aggressive phenotype is via
crosstalk with the wingless-type (Wnt) signalling pathway. Tenbaum et al. [78] identified that
increased co-expression of FoxO3a and β-catenin induced a metastatic phenotype in colon cancer
cells which was inversely related with patient survival time [78]. These data indicate that FoxO
transcription factors have a role in ovarian tumourigenesis and that Veph1 may modulate this
signalling pathway.
An important finding described by Teleman et al. (2005) includes the effect of Melted on
mTOR signalling. Melted localized the mTOR-inhibiting Tsc1/2 complex at the cell membrane
via interactions with Tsc1, resulting in activation of mTOR signalling [8]. The mTOR signalling
pathway causes transcriptional upregulation of tumour promoting genes involved in
angiogenesis, proliferation, survival, and motility [8]. The PI3K/Akt signalling pathway, that
activates mTOR signalling, was the most frequently altered cancer related pathway in 93 primary
epithelial ovarian tumours and mTOR activation has been described in clear cell carcinomas [56,
79]. These data suggest Veph1 may have a role in the pathogenesis of clear cell carcinomas, due
to modification of mTOR signaling. Considering the significant homology between Veph1 and
Melted, it is possible Veph1 may be a modulator of both FoxO and mTOR signalling in ovarian
tumourigenesis.
22
1.3.3 Veph1 Involvement in TGF-β Signalling
TGF-β is a multi-functional cytokine that has both tumour suppressing and promoting
roles. Protective effects of TGF-β signalling include suppressing tumourigenic inflammation and
regulating cytostasis and apoptosis [80]. TGF-β signalling has a protective, anti-inflammatory
role by inhibiting the development, proliferation, and function of immune cells which prevents
the tumourigenic effects of inflammatory responses [80]. In addition to this function, TGF-β
signalling maintains cell homeostasis by modulating expression of genes involved in cell cycle
regulation and apoptosis. For example, activated SMAD transcription factors form a
transactivation complex with FoxO proteins to increase the transcription of cyclin-dependent
kinase inhibitor p21CIP1 [81]. Despite the protective effects of TGF-β signalling, this pathway is
also involved in tumourigenesis.
Physiologically, TGF-β signalling promotes growth inhibition; however, tumour cells can
evade these protective effects by inactivating core components of this pathway or specific
abolition of the tumour suppressive effects of this pathway while maintaining signalling
responses that provide a tumourigenic advantage [24]. Tumour promoting functions of this
signalling pathway include regulation of invasion, EMT, angiogenesis, and immune response
evasion. TGF-β signalling has an established role in promoting metastases formation by
supporting EMT and invasion. This pathway initiates transcriptional upregulation of several
EMT-promoting transcription factors [82] including Snail which is responsible for suppressing
epithelial-specific genes and promoting the expression of genes associated with the
mesenchymal phenotype [83]. Slug, an additional TGF-β regulated transcription factor, and Snail
promote the EMT phenotype of ovarian cancer cell lines by inducing expression of mesenchymal
marker vimentin and repressing epithelial marker E-cadherin [82]. Haslehurst et al. [84]
discovered that knockdown of Snail and Slug resensitized ovarian cancer cells to cisplatin
suggesting that TGF-β signaling may have additional roles in chemoresponse [84]. TGF-β
treatment also promotes MMP-dependent invasion of epithelial ovarian cancer cell lines which is
required following EMT of metastatic cells [85].
In addition to promoting metastases, TGF-β signalling is implicated in ascites formation
and angiogenesis. Orthotopic injection of human ovarian cancer cells with and without soluble
TGF-β receptor II treatment to inhibit TGF-β signalling revealed that TGF-β blockade inhibited
23
ascites fluid accumulation by preventing abnormalization of the diaphragm lymphatic vessel
network allowing for improved ascites drainage. Furthermore, TGF-β signalling inhibition
resulted in a decrease of VEGF expression that ultimately reduced the prevalence of cluster of
differentiation 31 (CD31; also known as platelet endothelial cell adhesion molecule 1, PECAM-
1) positive endothelial cells [40]. In addition, TGF-β also promotes EndMT which may be an
important process in endothelial cell sprouting. Treatment of murine microvascular endothelial
cells with TGF-β increases the expression of the EMT-mediator Snail, resulting in EndMT
evident by morphology analysis and expression of epithelial and mesenchymal markers [86]. The
process of EndMT has also been implicated in the generation of cancer-associated fibroblasts
(CAFs) that contribute to tumourigenesis by releasing tumour promoting factors such as TGF-β
and VEGF, thereby further promoting angiogenesis [87]. As previously mentioned, TGF-β
signalling is immunosuppressive; however, when the immunosuppressive effects of TGF-β
outweigh the tumour-suppressive benefits of its anti-inflammatory action, a consequential net
protumourigenic advantage may result due to immune surveillance evasion by tumour cells [80].
Due to the pleiotropic effects of TGF-β signalling, up- and down-regulation of TGF-β signalling
has been identified in ovarian cancer samples.
Reports of contrasting effects on TGF-β signalling are evident in ovarian cancer samples.
For example, examination of ovarian tumours indicates that TGF-β isoforms are increased as
compared to benign tumours. Increased expression of the TGF-β3 isoform was significantly
associated with advanced stage disease [25]. Ovarian cancer studies have identified decreased
expression and disrupting mutations of TGF-β ligand binding receptors and downstream
signalling mediators [26]. Conversely, other studies have not identified inactivating mutations in
core mediators of this pathway in ovarian tumours [27]. Aberrant expression of positive and
negative modulators of TGF-β signalling has also been reported in ovarian tumours. For
example, microarray expression profiling reveals that TGF-β signalling inhibitors- such as BMP7
and dachshund homolog 1 (DACH1)- are up-regulated in advanced-stage ovarian serous
carcinomas [26]. In contrast, TGF-β signalling enhancers- such as enhancer of zeste homolog 2
(EZH2)- are also up-regulated [28]. These data suggest that TGF-β signalling is disrupted in
ovarian cancer. Due to the pleiotropic effects of TGF-β signalling in tumour progression, it is
difficult to predict whether loss or gain of TGF-β signalling will potentiate disease progression.
24
Identifying novel disruptors of this pathway and establishing the net effects of each modulator on
tumourigenesis is imperative.
Veph1 has recently been identified as a negative signalling modulator of canonical TGF-
β signalling. Veph1 limits nuclear accumulation of SMAD2 by impeding the dissociation of
SMAD2 from TGF-β receptor 1 (TβRI) thus reducing the transcription of TGF-β regulated genes
(Shathasivam et al., in preparation; Figure 2B). Genes affected by Veph1 expression were
identified in a microarray analysis of SKOV3 human ovarian cancer cells (Shathasivam et al., in
preparation). Veph1 increased expression of negative modulators of TGF-β signalling- such as
transmembrane prostate androgen-induced protein (TMEPAI) and BMP and activin membrane-
bound inhibitor homolog (BAMBI)- suggesting a possible SMAD-independent mechanism of
Veph1-mediated inhibition of TGF-β signalling. Veph1 caused decreased repression of the
epithelial marker CDH1 (gene encoding the epithelial marker E-cadherin) by TGF-β. Increased
E-cadherin would impair the EMT-promoting activity of TGF-β signalling and suggest Veph1
may be present in epithelial cells. Veph1 reduced the expression of potent pro-angiogenic factor
VEGFA mRNA which suggests it may inhibit angiogenesis as well. Interestingly, microarray
data indicated that positive modulators of TGF-β signalling- such as betaglycan (TGFBR3) and
disabled homolog 2 (DAB2)- were also up-regulated in the presence of elevated Veph1 levels
indicating that Veph1 may promote non-canonical TGF-β signalling. As TGF-β signalling has
pleiotropic effects, it is imperative to determine the ultimate effect of Veph1 on TGF-β-regulated
disease progression.
It is important to note that Veph1 has been implicated as possibly promoting EMT of
breast cancer cells [88]. Wnt signalling enhances the metastatic capability of breast cancer cells
and this may be mediated in part by Veph1. Breast tumour-associated fibroblasts secrete
exosomes that are internalized by breast cancer cells and induce Wnt-planar cell polarity
signalling that is necessary for protrusive activity, motility, and metastases. Proteomic analysis
reveals that Veph1 is present in these secreted exosomes, suggesting a possible role of Veph1 in
Wnt-induced metastasis [88]. The specific role of Veph1 in this study was not examined [88].
Microarray data from our lab indicates Veph1 induces up-regulation of Wnt ligands and nuclear
mediators of canonical Wnt/β-catenin signalling- such as lymphoid enhancer-binding factor 1
(LEF1) and transcription factor 4 (TCF4). This increase in Wnt signalling mediators translated
25
to increased Wnt signalling, as determined by a reporter assay measuring LEF/β-catenin
transcriptional activation in vitro (Shathasivam et al., in preparation). By promoting Wnt
signalling, Veph1 may support tumourigenesis.
1.3.4 Veph1 Involvement in Hippo Signalling
The Hippo tumour suppressor signalling pathway has a key role in regulating target genes
involved in cell proliferation and apoptosis to control tissue growth and organ size. Hippo
signalling involves activation of mammalian STE-20-like kinase 1/2 (MST1/2) kinases that act to
phosphorylate and activate LATS1/2 kinases which phosphorylate transcription factors yes-
associated protein (YAP) and transcriptional coactivator with PDZ-binding motif (TAZ),
resulting in their inhibition via nuclear exclusion [89]. Increased YAP expression induces
tumourigenic activity of human and Drosophila OSE cells by regulating gene expression that
promotes proliferation, reduces apoptosis, and increases cell migration and anchorage-
independent growth [90]; similar findings have been identified in clear cell carcinoma cells with
increased expression of YAP [91]. YAP signalling is also proposed to promote metastasis and
angiogenesis. Huntoon et al. [92] discovered that in vitro and in vivo inhibition of LATS1 and
LATS2 in ovarian cancer cells and primary tumours resulted in increased YAP activity evident
by accumulation of the target protein connective tissue growth factor (CTGF) that promotes cell
migration, proliferation, and angiogenesis [92]. Furthermore, YAP expression has been identified
as critical for the establishment and maintenance of CAFs that induce matrix remodeling
required for angiogenesis [93]. The Hippo signalling pathway crosstalks with additional
pathways by activating FoxO transcriptional activity during oxidative stress, and inhibiting TGF-
β and Wnt signalling [89]. As the Hippo pathway interacts with several signalling cascades,
modulators of this pathway have widespread implications. Dysregulation of the Hippo signalling
cascade has been identified in ovarian cancer.
Analysis of 284 human EOC samples reveals that approximately 15% of tumours express
elevated levels of activated nuclear YAP expression. High levels of nuclear YAP correlated with
a significant reduction in progression free survival in ovarian cancer patients [91]. These data are
further supported by an additional independent analysis of 70 human primary tumours that
revealed nuclear accumulation of YAP and reduced cytoplasmic retention of phosphorylated
YAP is correlated with approximately 50% lower 5-year survival and promotes resistance to
26
cisplatin-induced apoptosis in OSE cells [90]. Increased YAP expression has also been shown to
promote EMT, migration, anchorage-independent growth, and chemoresistance to cisplatin and
taxol in clear cell carcinoma cell lines [91]. Identifying novel Hippo signalling modulators that
promote YAP activity will be valuable to develop potential novel therapeutic targets.
Microarray data analyzed by our lab reveals that Veph1 expression has an impact on 274
YAP-regulated genes, suggesting that Veph1 expression impacts Hippo signalling. Whether
these gene expression alterations cause a net pro-tumourigenic or protective effect is yet to be
examined. Veph1 involvement in Hippo signalling is supported by studies conducted in
Drosophila that suggest Melted (Veph1 homolog) negatively regulates the transcription of the
wts (LATS1/2 homolog) gene, resulting in the differentiation of R8 photoreceptors to express
blue-sensitive rhodopsins (Figure 2C). Furthermore, Wts inhibits melted expression resulting in
the differentiation of R8 photoreceptors to express green-sensitive rhodopsins [9-11]. Due to the
significant homology between Veph1 and Melted, these data suggest Veph1 may be involved in
preventing tumour suppression by Hippo signalling within human cells.
1.3.5 Veph1 Expression in Epithelial Ovarian Cancer
The gene encoding human Veph1 is located on chromosome 3 at locus q24-q25 which
has been implicated as a site of mutation in tumour samples. A mutation discovery screen of
breast cancer samples indicates there was a significant frequency of VEPH1 mutations [94];
furthermore, an additional breast cancer genomic data analysis discovered an increase in VEPH1
copy number in breast tumour tissue as compared to normal tissue [95]. Copy number gain of a
region encompassing the VEPH1 locus has also been identified in patients with gastrointestinal
stromal cancer and may be correlated with poor survival [96]. In addition to these cancers,
mutations in VEPH1 and its locus region have been reported in ovarian cancer.
Array-based comparative genomic hybridization analysis preformed on 12 human
ovarian clear cell carcinoma cell lines found there was an amplification of the 3q24-q26 region,
encompassing the VEPH1 locus, in 7 of these cell lines [5]. Recent genome-wide association
studies of ovarian cancer patients and controls identified the 3q25 region as a susceptibility locus
that increases the risk of developing EOC [97]. Furthermore, an independent genome wide
analysis study of copy number in 68 primary human epithelial ovarian carcinomas indicated that
27
VEPH1 copy number and mRNA expression was significantly increased in >40% of these
samples [4]. These data raise the possibility that VEPH1 could be a novel ovarian cancer driver
gene, and may specifically be involved in the clear cell histotype.
Further support of a possible tumour promoting function of Veph1 involves
characterization of human ovarian cancer cell lines. The ES2, HEY, and OVCA429 ovarian
cancer cell lines are highly motile and exhibit invasive properties due to their ability to degrade
cross-linked collagen type I via membrane-type I matrix metalloproteinase (MT1-MMP)
upregulation [6, 7]. These aggressive cell lines have high levels of Veph1 protein as compared to
SKOV3 and OVCAR3 ovarian cancer cell lines that have non-detectable Veph1 levels
(Shathasivam et al., in preparation) and have a less invasive phenotype [6, 7]. HEY, ES2, and
OVCA429 ovarian cancer cell lines also form compact multicellular spheroids aggregates that
invade 3-D matrix culture systems while SKOV3 and OVCAR3 cell lines form loose aggregates
[7]. As compact spheroids exhibit enhanced resistance to anoikis following treatment with
chemotherapeutic agents, it is possible Veph1 expression status may modulate chemoresponse
[30, 31]. These data suggest that Veph1 expression may have a role in supporting aggressive
behaviour and chemoresistance of ovarian cancer cells by promoting invasion and compact
spheroid formation.
1.4 Thesis Hypothesis and Objectives
Veph1 may be a novel modulator of pathways involved in ovarian tumourigenesis. Our
lab has recently generated microarray data indicating Veph1 expression alters genes that are
partially regulated by the FoxO, TGF-β, and Hippo signalling pathways, which have both tumour
suppressing and promoting functions (Shathasivam et al., in preparation). These data are
supported by studies conducted in human and Drosophila cells [8-10] . A role for Veph1 in EOC
is strongly implicated by genomic analyses indicating an increase in VEPH1 gene copy number
in a subset of ovarian primary tumours and cell lines [4, 5]. Furthermore, Veph1 expression
correlates with an invasive and motile phenotype in ovarian cancer cell lines [6, 7].
Determination of the impact of Veph1 on ovarian tumourigenesis is unexplored but certainly
warranted. Given that only a single publication has addressed the expression of Veph1 in a
mammalian species, it is also important to confirm the reported expression of Veph1.
28
Based upon papers indicating a role of Veph1 in modulating multiple signaling pathways,
I hypothesized that Muto et al. [12] may have underestimated the range of tissues expressing
Veph1. Expression data are relevant to studies in cancer as it is important to determine if levels
of Veph1 in malignant cells deviates from that of normal tissues or cells of origin. Expression
information may also suggest involvement in particular physiological processes. I further
hypothesized that Veph1 expression in ovarian cancer cells promotes tumour progression. Thus,
there were two specific objectives of this thesis. The first was to identify expression of Veph1A
and Veph1B mRNA and protein in murine embryos and adult tissues. As Veph1 may be
implicated in modulating several physiological signalling pathways, I expected Veph1
expression to be widespread. As microarray studies in our lab have indicated that Veph1
increases the expression of the epithelial marker E-cadherin, at both the RNA and protein level, I
anticipated that Veph1 protein expression would be predominantly expressed in epithelial cells
of tissues examined.
The second objective was to determine the effect of Veph1 expression on ovarian tumour
progression, using a xenograft mouse model. As VEPH1 gene copy number is increased in select
ovarian samples [4, 5], suggesting a possible driver function, and Veph1 protein expression is
correlated with an aggressive phenotype of ovarian cancer cell lines [6, 7], I predicted Veph1
would promote tumour progression. I examined tumour growth, proliferative index, necrotic
tumour area, and microvessel density to investigate the effect of Veph1 expression on primary
tumours.
29
2.2. Chapte
MATERIALS AND METHODS
2.1 Tissue Culture
SKOV3 human epithelial ovarian cancer cells that express low endogenous Veph1 levels
were previously stably transfected with either a metallothionein-inducible vector containing
Flag-tagged Veph1 (SKOV3-Ve) or an empty vector (SKOV3-M) and were clonally selected
(Shathasivam et al., in preparation; Figure 3). The SKOV3-Ve3 clone was used for in vitro
experiments while the SKOV3-Ve4 clone was used for in vitro and in vivo experiments. Cells
were maintained as monolayers in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12
(Invitrogen, Burlington, ON, Canada) (without phenol red) pH 7.4, supplemented with 0.25%
(v/v) fungizone (amphotericin B) (Invitrogen, Burlington, ON, Canada), 1% (v/v) penicillin
(5000 U/ml) (Invitrogen), 5% (v/v) fetal bovine serum (FBS) (HyClone Laboratories Inc.,
Logan, UT, USA), and geneticin (G418; 100 µg/ml) (Invitrogen). Culture medium was changed
every three days and cells were subcultured at 80% confluency. The cells were grown in a
humidified 37ºC incubator, in the presence of 5% CO2.
2.2 Tissue Specimen Collection
Murine adult tissue specimens were collected from 6 to 8 week old male and female ICR
mice, after euthanization by CO2 inhalation and cervical dislocation. Mice were provided by the
Centre for Cellular and Biomolecular Research Animal Facility (Toronto, ON, Canada). Whole
ICR murine embryos were obtained as previously described [98]. Specimens were snap-frozen in
liquid nitrogen within 2 minutes of excision and stored in -80ºC.
2.3 Animals
Twenty-four female (12 mice per treatment group), 5 to 8 week old, BALB/c nude mice
were purchased from Charles River Laboratories (code 194; Wilmington, MA, USA). Mice were
housed at the Centre for Cellular and Biomolecular Research Animal Facility (Toronto, ON,
Canada). All mice were maintained in a controlled and sterile environment with a 12-hour light-
12-hour dark cycle and had access to food and water. All mice received drinking water
Chapter 2
30
Figure 3: Illustration of the pMEP5-3xFlag-Veph1 expression vector. Illustration of the
vector stably transfected into SKOV3-Ve cells. The pMEP5 vector was obtained from Dr. Jeff
Wrana, Mount Sinai Hospital. Veph1 cDNA was obtained from Open Biosystems (Thermo
Fisher Scientific; accession number BC101660). The 3xFlag-Veph1 cDNA was subcloned into
the pMEP5 vector at NheI and BamHI cloning sites. SKOV3-M cells were stably transfected
with the empty (omission of 3xFlag-Veph1 cDNA) pMEP5 vector.
31
containing 25 mM zinc sulfate (ZnSO4) in order to induce Veph1 expression in SKOV3-Ve cells.
All procedures were performed in accordance with a protocol approved by the University of
Toronto Faculty of Medicine and Pharmacy Animal Care Committee.
2.4 Tumour Model
SKOV3-M and SKOV3-Ve4 cells were harvested by trypsinization at 80% to 85%
confluency and centrifuged at 250 g for 5 minutes at room temperature and washed twice with
1X-phosphate buffered saline (PBS). Cells were resuspended in 1X-PBS and counted three times
with a TC10 Automated Cell Counter (Bio-Rad Laboratories Inc., Hercules, CA, USA). Counts
were averaged and a total of 3 x 106 cells were suspended in 300 µl of 1X-PBS for tumour
inoculation of each mouse and placed on ice until injection. Following a 7-day acclimation
period, cells were injected subcutaneously into the flank of each mouse using a 26.5 gauge
PrecisionGlide® needle (Becton Dickinson & Co., Franklin Lakes, NJ, USA), approximately 30
minutes after harvesting. Twelve mice received SKOV3-M cells and the remaining 12 mice
received SKOV3-Ve4 cells. To ensure an accurate transfer of cells, mice were anaesthetized
using 2% to 5% isoflurane at 1 L/min O2 flow for 2 minutes. The volume of the resulting
xenograft tumours were recorded using a Traceable® digital caliper (Thermo Fisher Scientific,
Rockford, IL, USA) every 24 to 48 hours. Tumour volumes were calculated using the following
formula: π/6(length x width x depth) [99]. Animals were weighed once a week and general
health was monitored every 24 to 48 hours.
Animals were euthanized by CO2 inhalation and cervical dislocation once tumour
volumes reached 520 mm3 (as instructed by the facility veterinarian) or 63 days post-injection if
tumours did not form. The tumours were excised, weighed, and cut in half; one half was snap-
frozen and the other half was placed in 10% formalin fixative (Sigma, Oakville, ON, Canada) for
paraffin embedding.
Xenograft tumours were fixed overnight at 4°C in 10% formalin and washed for 1 hour
with 1X-PBS (pH 7.4), overnight with 70% ethanol at 4°C, 1 hour with 80% and 90% ethanol
each, and two 1 hour washes with both 100% ethanol (ethanol from J.T. Baker, Mississauga,
ON, Canada) and xylene (Thermo Fisher Scientific). All washes were performed at room
temperature. Specimens were incubated in heated paraffin overnight and then embedded.
32
Embedded tissues were then sectioned (5 µm thick), using a Leica RM2255 microtome (Leica
Biosystems, Buffalo Grove, IL, USA).
2.5 RNA Extraction and Reverse Transcriptase-Polymerase Chain
Reaction (RT-PCR)
Mouse tissue specimens were mechanically homogenized, using a Caframo homogenizer
(Wiarton, ON, Canada), in Trizol (Ambion, Carlsbad, CA, USA) at 4°C. Total RNA was
extracted as specified by the manufacturer. RNA concentration was determined by measuring
absorbance at 260 nm with a spectrophotometer.
Three micrograms of total RNA were reverse transcribed using Oligo d(T)16 (Roche
Applied Science, Laval, QC, Canada) and SuperScript™ II reverse transcriptase (Invitrogen) as
per manufacturer’s protocol. The resulting cDNA was quantitated spectrophotometrically to
ensure equivalent amounts of cDNA were used per sample during amplification (1.8 µg for
whole embryos and non-reproductive tissue Veph1 isoforms; 2.5 µg for reproductive tissue
Veph1 isoforms; 300 ng for whole embryos and non-reproductive tissue actin; 400 ng for
reproductive tissue actin). cDNA was amplified using specific primers that cross intron-exon
boundaries (summarized in Table 1; illustrated in Figure 4). PCR was performed using Taq
polymerase (Fermentas, Burlington, ON, Canada) and involved: pre-incubation for 5 minutes at
95°C, denaturation at 94°C for 90 seconds, primer annealing at temperatures (annealing
temperature; Ta) indicated in Table 1 for 75 seconds, and extension at 72°C for 2 minutes. This
was repeated for 32 cycles and the resulting PCR products were resolved by 2% agarose gel
electrophoresis and subsequently verified by automated sequencing. Each panel of tissues was
repeated 3 times with specimens from different mice.
2.6 Protein Extraction and Western Blot Analysis
To confirm Veph1 induction via cadmium chloride (CdCl2; Sigma) treatment, 40,000
SKOV3-Ve3 cells were seeded per well in a 12-well plate with medium and were maintained in
the incubator for 24 hours to allow attachment. Cells were then treated with 1 µM CdCl2 for 24
or 48 hours. To examine SOD2 protein expression, 50,000 SKOV3-M, SKOV3-Ve3, and
SKOV3-Ve4 cells were seeded per well in a 24-well plate with medium and then treated with 1
µM CdCl2 for 24 hours (a 48 hour time point for SKOV3-Ve4 cells was included) to induce
33
Table 1: Primers used for RT-PCR analyses of Veph1A, Veph1B, and ACTB.
Name Accession
number
Sequence (5'-3') Ta
(°C)
Amplicon
Size (bp) Veph1AFwd NM_145820 GAATACCAAGATAAGCTCTACTT 52 871
Veph1ARev ATGTGGTTACTTCTCGGCTTT
Veph1BFwd NM_028357 TTGCAGCCTTCTGGTGATCA 54 871
Veph1BRev ATGTGGTTACTTCTCGGCTTT
ACTBFwd NM_007393 AGTGTGACGTTGACATCCGTAAAGA 56 296
ACTBRev AGCTCAGTAACAGTCCGCCTAGAA
34
Figure 4: Schematic illustrating RT-PCR primer location within Veph1A and Veph1B
transcripts. Illustration of the coding (blue) and non-coding (grey) regions of murine Veph1A
and Veph1B (region of sequence non-identity indicated by blue hatch lines). Primers used by
Muto et al., [12] are indicated with black arrows. Primers used in this study are indicated with
red arrows; the forward primers distinguish between Veph1A and Veph1B.
35
Veph1 expression. Cells were harvested using Radioimmunoprecipitation Assay (RIPA) lysis
buffer (150 mM sodium chloride, 50 mM 4-2-hydroxyethyl-1-piperazineethanesulfonic acid
(HEPES; pH 7.4; Sigma), 1% (v/v) Triton X-100 (ICN Biochemicals Inc., Aurora, OH, USA)),
0.1% (v/v) sodium dodecyl sulfate (SDS; BioShop Canada Inc., Burlington, ON, Canada), 1%
(w/v) sodium deoxycholate (EMD Chemicals, Philadelphia, PA, USA), Complete Protease
Inhibitor Cocktail and 1X PhosSTOP Phosphatase Inhibitor tablets (both from Roche Applied
Science)) for 30 minutes at 4ºC. Each well was scraped and total cell lysates were collected and
centrifuged at 24,100 g for 15 minutes, at 4ºC. The supernatants, containing total protein extract,
were collected and stored at -80ºC.
For protein extraction from tissue specimens, tissues were mechanically homogenized in
RIPA buffer, containing protease and phosphatase inhibitor tablets (Roche), and centrifuged
twice at 24,100 g for 15 minutes, at 4ºC. The supernatants, containing total protein extract, were
collected and stored at -80ºC. Protein content of all the lysates was quantified with a
Bicinchoninic Acid (BCA) Protein Assay Kit (Pierce, Rockford, IL, USA) following the
manufacturer’s recommended protocol.
Aliquots of total protein were diluted in RIPA lysis buffer to obtain 8 µg to 40 µg per
well (as specified in figure legends). SDS loading buffer (1M Tris-HCl pH 6.8, 10% SDS, 5%
glycerol (BDH Chemicals, Mississauga, ON, Canada), 5% β-mercaptoethanol (Sigma) and
0.05% bromophenol blue dye) was added to the samples. Each sample was boiled for 5 minutes
and then loaded on to 8% to 12% SDS-polyacrylamide gels (as specified in figure legends) and
electrophoresis was performed. The proteins were transferred in transfer buffer (48 mM Tris, 39
mM glycine, 20% methanol; all from Thermo Fisher Scientific) to an activated Immun-blot
Polyvinylidene Fluoride (PVDF) membrane (Bio-Rad Laboratories Inc.) by electrophoresis at
125 mA, at 4ºC, for 1.5 hours. The membranes were then blocked for 1 hour, at room
temperature, in blocking solution comprised of 5% skim milk powder and 1% normal goat serum
(Vector Laboratories Inc., Burlingame, CA, USA) in 1XPBS-T (PBS containing 1% tween-20;
Sigma) and incubated overnight at 4ºC with primary antibodies diluted with blocking solution.
Primary antibody information is listed in Table 2. Membranes were then washed with 1XPBS-T
and incubated for 1 hour at room temperature with horseradish peroxidase (HRP)-tagged
36
Table 2: Antibodies used for Western blot analyses.
Target Source Dilution Catalog Number Manufacturer
Veph1 Rabbit Polyclonal 1:100 HPA026645 Sigma
Flag Mouse Monoclonal 1:500 200472 Stratagene
SOD2 Rabbit Polyclonal 1:5000 ab13533 Abcam
GAPDH Rabbit Polyclonal 1:2000 sc-25778 Santa Cruz
Biotechnology Inc.
37
secondary antibody targeting the host species of the primary antibody (1:1000; Santa Cruz
Biotechnology, Santa Cruz, CA, USA) and then washed twice with 1XPBS-T. Immmunoreactive
proteins were visualized by enhanced chemiluminescence (ECL; Santa Cruz Biotechnology)
following the manufacturer’s recommended protocol after exposure to HyBlot CL
Autoradiography Film (Denville Scientific, Inc., Woodbridge, ON, Canada). Immunoreactive
band intensities were quantified using Image Quant 5.0 software (Molecular Dynamics,
Pittsburgh, PA, USA). Each experiment was independently repeated three times, where
applicable. Data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
levels.
2.7 Immunohistochemistry
Paraffin-embedded tissue sections were deparaffinised in xylene for 2X5 minutes and
rehydrated by washing with decreasing percentages of ethanol (100%, 95%, 70%) for 2X5
minutes each. Slides were then rinsed with double distilled water (DDW). Antigen retrieval was
performed using 10 mM citrate buffer, pH 6.0 (0.1 M citric acid and 0.1 M sodium citrate).
Sections were heated in a 750 W microwave oven at low setting for 4X5 minutes with gentle
agitation between heating intervals, followed by a 20 minute room temperature cooling period.
The slides were heated again for 5 minutes and cooled for 20 minutes [100].
Sections were then rinsed once with DDW and then 2X5 minutes with 1X-PBS. A 10
minute incubation, at room temperature, in 1X-PBS containing 0.3% (v/v) TritonX-100 was
performed to allow permeabilization. This was followed by 3X5 minute 1X-PBS washes at room
temperature. The slides were then incubated for 20 minutes, at room temperature, in 0.3% (v/v)
H2O2 (Sigma), dissolved in methanol (Thermo Fisher Scientific), and washed 3X5 minutes in
1X-PBS which was followed by a one hour incubation in 10% (v/v) normal goat serum in 1X-
PBS. Sections were incubated overnight at 4°C in a humidified chamber with either primary
antibody, or matching primary antibody host-species non-specific IgG (Santa Cruz
Biotechnology Inc.), diluted in 1X-PBS containing 1% normal goat serum. Primary antibody
information is listed in Table 3. Sections were then washed at room temperature for 3X5 minutes
with 1X-PBS prior to one hour incubation with biotinylated secondary antibody (Vector
Laboratories Inc.) targeting primary antibody IgG (diluted at 1:200 in 1X-PBS containing 1%
(v/v) normal goat serum). The slides were washed 3X5 minutes with 1X-PBS and then incubated
38
Table 3: Antibodies used for immunohistochemical staining.
Target Source Dilution Catalog
Number
Manufacturer
Veph1 Rabbit Polyclonal 1:30 HPA026645 Sigma
PCNA Mouse Monoclonal 1:2000 M879 Dako
Ki-67 Mouse Monoclonal 1:200 0505 Immunotech
Cleaved Caspase-3 Rabbit Polyclonal 1:300 9661 Cell Signalling
CD34 Rabbit Monoclonal 1:250 ab81289 Abcam
CD31 Rabbit Polyclonal 1:50 *Outsourced ab28364 Abcam
SOD2 Rabbit Polyclonal 1:250 sc-25778 Abcam
39
at room temperature with a 1:400 dilution of a streptavidin-peroxidase complex (Vector
Laboratories Inc.) in 1X-PBS, followed by 3X5 minute 1X-PBS washes.
To visualize stained protein, sections were incubated for 1-10 minutes with 3,3-
diaminobenzidine (DAB; 0.7 mg/ml in 1X-PBS; Sigma) in the presence of 0.03% (v/v) H2O2, at
room temperature. The sections were rinsed with DDW and counterstained, where applicable,
with Harris Hematoxylin solution (Sigma) for 40 seconds, followed by a 2 minute rinse with
running tap water. Sections were then dehydrated with increasing ethanol concentrations (70%
for 5 minutes, 95% and 100% for 10 minutes each) and then a 10 minute incubation in xylene.
Coverslips (VWR Scientific, Mississauga, ON, Canada) were then mounted with DPX permount
(Sigma). CD31 immunohistochemical (IHC) staining was performed by Pathology Services at
The Toronto Centre for Phenogenomics (Toronto, ON, Canada).
For hematoxylin and eosin staining, tumour sections were placed in hematoxylin for 40
seconds following rehydration of sections, and then rinsed for 2 minutes with running tap water.
Sections were then placed in Eosin Y (ICN BioChemicals Inc.) for 2 minutes and then rinsed for
2 minutes with running tap water. Slides were then dipped in 100% ethanol twice and incubated
in xylene for 10 minutes prior to mounting coverslips with DPX permount (Sigma).
2.8 Double Terminal Deoxynucleotidyl Transferase dUTP Nick
End Labeling (TUNEL) and Cleaved Caspase-3 Staining
Paraffin-embedded tumour sections were double stained for TUNEL, to detect dying
cells, and cleaved caspase-3, to detect apoptotic cells specifically. Each section was initially
stained for TUNEL using TACS2 TdT-DAB In Situ Apoptosis Detection Kit (Trevigen,
Gaithersburg, MD, USA) following the manufacturer’s protocol. Following completion of DAB
staining, sections were washed with 1XPBS for 20 minutes and then the Cell and Tissue HRP-
AEC Staining Kit was used to detect cleaved-caspase 3 using a 3-amino-9-ethylcarbazole (AEC)
red chromogen stain by following the manufacturer’s protocol. Sections were incubated with
cleaved caspase-3 primary antibody (Cell Signaling Technology, Danvers, MA, USA) at a 1:300
dilution overnight at 4°C, following avidin and biotin blocking. After AEC staining was
complete, slides were counterstained with a 1:2 dilution of Gill No. 1 hematoxylin solution for
30 seconds and then rinsed with tap water for 2 minutes. Coverslips were mounted using aqueous
40
ImmunoHistoMount (Sigma). A positive TUNEL control was included for each tumour by
treating a section with TACs-Nuclease to generate DNA breaks in every cell. A positive cleaved
caspase-3 control slide was included with paraffin-embedded jurkat cells treated with apoptosis-
inducing etopiside (Sigma).
2.9 Immunohistochemistry Imaging and Quantitation
For all IHC analyses, digital images of slides were created using a Hamamatsu
NanoZoomer 2.0-RS Digital Slide Scanner (Meyer Instruments, Houston, TX, USA). Ki-67
Antigen (Ki-67) and proliferative cell nuclear antigen (PCNA) nuclear labeling index (LI) was
determined using the ImmunoRatio quantitative image analysis program (Isola J. and Tuominen
V., University of Tampere, Tampere, Finland) [101]. Each image was analyzed for the percent of
DAB-stained nuclei out of the total (DAB- and hematoxylin-stained) nuclei. Three randomly
selected 20× power field images per tumour, with areas of necrosis excluded, were analysed and
an average PCNA and Ki-67 nuclear LI was calculated per tumour. Data were compiled to create
an average PCNA and Ki-67 nuclear LI for SKOV3-M and SKOV3-Ve tumours.
Necrotic tumour area was determined by annotating hematoxylin stained whole sections
of tumours using the Hamamatsu NanoZoomer Digital Pathology viewer (Meyer Instruments).
Areas of necrotic tissue were outlined using a freehand area annotation and necrotic area was
divided by total tumour area to determine the percentage of necrotic tumour area based on cell
and tissue morphology. Necrosis morphology and necrotic tumour area annotations were verified
by gynecologic oncology pathologist Dr. Blaise Clarke of the University Health Network
(Toronto, ON, Canada). Double TUNEL/cleaved caspase-3 staining was quantitated by counting
the number of TUNEL and cleaved caspase-3 positive cells per mm2 necrotic and non-necrotic
area of each tumour at 40× power field. Analysis was blinded as treatment conditions were
unknown during quantitation.
MVD (number of microvessels (MV) per 1 mm2) was visualized by staining all tumours
for the endothelial cell markers CD34 and CD31, and quantitated using the methodology
described by the International Consensus in 2002 [102]. MV were counted, at 40× power field, in
the three most vascularized areas (0.74 mm2 per field) of the tumour. MV were defined as any
distinct CD34+, or CD31
+, cell or cell cluster and the presence of a lumen was not required.
41
Large vessels with thick muscular walls and areas of necrosis were excluded from the count.
CD31 images were analyzed blindly as treatment condition for each tumour was unknown while
counting. An average CD34+ and CD31
+ MVD was calculated for each tumour and data were
compiled to create an average CD34+ and CD31
+ MVD for SKOV3-M and SKOV3-Ve tumours.
CD34+ and CD31
+ MVD counts were verified by gynecologic oncology pathologist Dr. Blaise
Clarke of the University Health Network (Toronto, ON, Canada).
SOD2 total positive intensity was analysed using the Positive Pixel Count v9 Algorithm
included with ImageScope 11.0 software (Aperio Technologies, Inc., Vista, CA, USA). This
algorithm counts the number of pixels within three intensity ranges (weak, positive, and strong)
to create a total intensity. Three non-necrotic areas of each SKOV3-M and SKOV3-Ve tumour
were analyzed and data were compiled to determine an average total SOD2 positive intensity for
each treatment group.
2.10 SOD2 Activity Assay
SKOV3-M and SKOV3-Ve3 cells were seeded at 80,000 cells per well in a 24-well plate
and treated with 1 µM CdCl2 24 hours post-seeding to induce Veph1 expression (3 wells were
seeded per cell line). Twenty-four hours after treatment, cells were harvested by scraping and
suspended in media on ice. Cells were then centrifuged for 10 minutes, at 4°C, at 1,500 g and the
pellet of cells was mechanically homogenized in a cold solution of 20 mM HEPES buffer pH 7.2
(containing 1mM ethylene glycol tetraacetic acid (EGTA; Sigma), 210 mM mannitol (BDH
Chemicals), and 70 mM sucrose (Mallinckrodt Chemical, St. Louis, MO, USA)). Homogenized
cells were centrifuged for 5 minutes, at 4°C, at 1,500 g and the supernatant was collected and
seeded into a 96-well plate with each replicate seeded into 3 wells. Total protein concentration
was determined using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). SOD2
activity was determined using the recommended protocol for the Superoxide Dismutase Assay
Kit (Cayman Chemical Company, Ann Arbor, MI, USA). Potassium cyanide (3 mM; Acros
Organics, NJ, USA) was added to all wells to inhibit the activities of both Cu/Zn-SOD (SOD1)
and extracellular SOD (SOD3), resulting in the detection of only mitochondrial SOD2 activity.
Formazan dye accumulation, indicating superoxide radical dismutation, was quantified by
measuring absorbance at 450 nm with a spectrophotometer. The calculated average of each
standard was used to create a linearized SOD standard rate. The equation of the standard curve
42
was used to determine SOD2 activity (U/ml) which was normalized to total protein
concentration. This experiment was independently repeated three times.
2.11 Statistical Analyses
Student’s t-test (p<0.05) was used to analyze IHC and non-necrotic TUNEL
quantitations, average number of days to tumour formation, necrotic tumour area, and in vitro
Flag induction data. One sample t-test to compare the ratio of SKOV3-Ve3/SKOV3-M to a
theoretical mean of 1.0 (p<0.05) was used for SOD2 in vitro protein and activity data. Fisher’s
Exact test (p<0.05) was used to examine percentage tumour formation and tumour liquid
accumulation data. Two-way analysis of variance (ANOVA), followed by a Student-Newman-
Keuls (SNK) post-hoc test, was used to analyze necrotic area TUNEL and cleaved caspase-3
positive staining (p<0.05).
A Kaplan-Meier survival plot was created using GraphPad Prism version 5 (GraphPad
Software Inc., La Jolla, CA, USA) and analyzed using a Gehan-Breslow-Wilcoxon Test
(p<0.05). A growth rate plot indicating tumour volume (mm3) at each time point, with
exponential lines of best-fit, was created using GraphPad Prism version 5 (GraphPad Software
Inc.). Analysis of covariance was used to compare the linear regression lines generated for
SKOV3-M and SKOV3-Ve tumour growth as a function of time (p<0.05).
43
2.3. Chapte
RESULTS
3.1 Veph1 Expression in Murine Embryos and Adult Tissues
3.1.1 Veph1A and Veph1B mRNA expression in murine whole embryos and adult tissues
To determine expression of Veph1 during development and its tissue distribution, the
presence of transcripts in whole embryos and adult tissues was examined by RT-PCR. Two
mRNA variants of Veph1 have been described in mice, one encoding the full-length protein
(Veph1A) and another (Veph1B) predicted to encode the C-terminal portion of Veph1A, including
the PH domain. Total RNA was extracted from murine embryos (E9.5-18.5) and various adult
tissues and RT-PCR was performed using primers specific to each isoform. Veph1A transcripts
were detected from embryonic day 10.5 to E18.5, whereas Veph1B expression was not detected
beyond E17.5 (Figure 5). Veph1A RNA was expressed in the following murine adult
reproductive tissues: ovary (detected in 1 of 3 independent tissue sets; not shown), oviduct,
epididymis, and testis, but was not detected in the uterus, ovarian fat pad, prostate, and seminal
vesicle. Veph1B expression was not detected in any adult reproductive tissue examined (Figure
6A). Veph1A RNA was expressed in the following murine adult non-reproductive tissues: liver,
lung, brain, kidney, and eye but was not detected in the heart, spleen, adrenal gland, or skeletal
muscle. Veph1B expression was not detected in any adult non-reproductive tissue examined
(Figure 6B). PCR amplicons were verified to be either Veph1A or Veph1B by automated
sequencing.
3.1.2 Veph1A protein expression and distribution in murine adult tissues
To determine the expression and localization of Veph1A protein, murine adult tissues
were examined by Western blot analysis and IHC staining. Currently, there are four
commercially available antibodies raised against human Veph1; however, only three of these
target murine Veph1A epitopes with greater than 90% sequence identity (Figure 7).
Optimization experiments indicated that the Santa Cruz rabbit polyclonal (SC-Rab-PC) and
Santa Cruz goat polyclonal (SC-Goat-PC) antibodies did not detect Veph1 protein in human
ovarian cancer HEY cells by Western blot analysis. HEY cells express high levels of endogenous
Chapter 3
44
Figure 5: Veph1A and Veph1B transcript expression in murine whole embryos. Total RNA
was extracted from three independent sets of murine whole embryos and RT-PCR was
performed using primers specific to Veph1A, Veph1B, and ACTB (β-actin). Amplicons were
resolved on 2% agarose gels and shown to consist of a single product corresponding to the
expected sizes of the target sequences. A representative of 3 gels are shown. No RT control was
created by omission of reverse transcriptase during E18.5 cDNA synthesis. PCR control was
created by substituting double distilled water in place of cDNA during PCR.
45
Figure 6: Veph1A and Veph1B transcript expression in murine adult reproductive and non-
reproductive tissues. Total RNA was extracted from three independent sets of murine adult
reproductive (A) and two to four independent sets (see Table #) of non-reproductive (B) tissues.
RT-PCR was then performed using primers specific to Veph1A, Veph1B, and ACTB. Amplicons
were resolved on 2% agarose gels and shown to consist of a single product corresponding to the
expected sizes of the target sequences. A representative of 3 gels are shown. No RT control was
created by omission of reverse transcriptase during testes (A) and kidney (B) cDNA synthesis.
PCR control was created by substituting double distilled water in place of cDNA during PCR.
Representative images are shown; positive ovary band not shown. Total RNA extracted from
E15.5 whole embryos was used as a positive control.
A
B
46
Figure 7: Homology between murine and human Veph1 protein sequences and summary of
epitopes of the human Veph1 protein targeted by commercially available antibodies.
Protein sequence of human full-length Veph1 (isoform 1) aligned with murine Veph1A (Veph1B
start site indicated at amino acid 580). Sequence alignment was performed using the protein
Basic Local Alignment Search Tool from National Center for Biotechnology Information. Non-
identical amino acid residues between murine and human Veph1 are indicated in red text. PH
domain of human and murine Veph1 proteins is indicated in light blue text. Commercially
available antibodies are listed with manufacturer name, source (Rabbit-polyclonal, Rab-PC;
Goat-polyclonal, Goat-PC), identity of targeting antigen with murine Veph1 protein sequence,
and optimization details for both Western blot and IHC analyses. HEY cell lysates were used as
a positive control for Western blot analyses.
47
48
Veph1 (Shathasivam et al., in preparation; data not shown). Further, IHC optimization with the
SC-Rab-PC antibody indicated staining in the IgG control at the concentration required to detect
staining and the SC-Goat-PC antibody did not stain any tissue. The Sigma rabbit polyclonal
(Sigma-Rab-PC) antibody detected a band consistent with Veph1 in HEY lysates and staining
was evident in select tissue sections at concentrations that did not result in staining by normal
IgG. Therefore the Sigma-Rab-PC antibody was selected for use throughout this study.
IHC analyses revealed positive staining in select murine adult female (Figure 8) and
male (Figure 9) tissues with localization in oocytes and corpora lutea of the ovary, B
spermatogonia and late spermatids of the testis, stroma of the prostate, and the epithelium of the
oviduct, uterus, prostate, epididymis, and seminal vesicle. Positive Veph1A staining was also
identified in the ventricular zone of the brain, myofibril striations of skeletal muscle, select cells
of the spleen, bronchial epithelium of the lung, and epithelia of proximal and distal kidney
tubules. Lung, brain, and kidney staining are depicted in Figure 10 and heart, liver, spleen, and
skeletal muscle staining are shown in Figure 11. Reproductive tissue Veph1A RNA expression
and protein localization is summarized in Table 4 and non-reproductive is summarized in Table
5.
To analyze the specificity of the Sigma-Rab-PC antibody, Western blot analysis was
performed on two independent sets of murine adult tissues. An expected 95 kDa band in positive
control HEY human ovarian cancer cell lysates was observed; however, additional bands of
various molecular weights were detected in all murine tissues (Reproductive tissue Figure 12;
Non-reproductive tissue Figure 13).
3.2 Veph1 Expression Effect on Ovarian Tumour Progression
3.2.1 Veph1 effect on tumour formation
To determine if Veph1 affects tumour formation, nude mice were injected
subcutaneously with SKOV3 cells stably transfected with either a metallothionein-inducible
vector containing Flag-tagged Veph1 or an empty vector. Tumour formation was monitored
every 24-48 hours. Veph1 expression did not have a significant effect on the formation of end-
49
Figure 8: Veph1A localization in murine adult female reproductive tissues. Veph1A
localization in the ovary (A; 10X), oviduct (C; 20X), and uterus (E; 20X) revealed by IHC
staining with Sigma-Rab-PC antibody targeting Veph1A. Brown staining indicates Veph1
expression. IgG control sections were incubated with an equivalent amount of rabbit IgG as
primary antibody (B 10X, D 10X, and F 20X). Scale bars are 50-100 µm as indicated.
100 µm
100 µm 50 µm
50 µm
A
C D
E
100 µm
B
50 µm
F
50
Figure 9: Veph1A localization in murine adult male reproductive tissues. Veph1A
localization in the prostate (A; 20X), seminal vesicle (C; 20X), epididymis (E; 100X), and testis
(G; 100X) revealed by IHC staining with Sigma-Rab-PC antibody targeting Veph1A. Brown
staining indicates Veph1 expression. IgG control sections were incubated with an equivalent
amount of rabbit IgG as primary antibody (B 20X, D 10X, F 10X, and H 100X). Scale bars are
10-100 µm as indicated.
51
50 µm
50 µm
100 µm
100 µm 10 µm
A
C D
E F
G H
50 µm
B
52
Figure 10: Veph1A localization in murine adult non-reproductive tissues. Veph1A
localization in the lung (A; 20X), brain (C; 20X), proximal kidney (E; 20X), and distal kidney
(G; 20X) revealed by IHC staining with Sigma-Rab-PC antibody targeting Veph1A. Brown
staining indicates Veph1 expression. IgG control sections were incubated with an equivalent
amount of rabbit IgG as primary antibody (B 10X, D 10X, F 10X, and H 10X). Scale bars are
50-100 µm as indicated.
53
50 µm 100 µm
50 µm 100 µm
100 µm
A B
C D
E F
G H
54
Figure 11: Veph1A localization in murine adult non-reproductive tissues. Veph1A
localization in the spleen (A; 40X) and skeletal muscle (C; 20X; IgG staining identified)
revealed by IHC staining with Sigma-Rab-PC antibody targeting Veph1A. Brown staining
indicates Veph1 expression. Veph1A expression was negative in the heart (E; 20X) and liver (G;
20X). IgG control sections were incubated with an equivalent amount of rabbit IgG as primary
antibody (B, D, F, and H; 10X). Scale bars are 20-100 µm as indicated.
55
50 µm 100 µm
50 µm 100 µm
A B
C D
E F
G H
56
Table 4: Summary of Veph1A mRNA and protein expression, and protein localization, in
murine adult male and female reproductive tissues.
Tissue RT-PCR
(Veph1A)*
IHC
(Veph1A)
IHC Veph1A Localization
Ovary 1/3 Positive -Oocytes
-Corpus luteum
Oviduct 2/3 Positive -Fallopian tube epithelium
Uterus 0/3 Low to
undetectable
-Endometrial + uterine glandular
epithelium
Prostate 0/3 Positive -Prostate epithelium
-Stroma
Seminal
Vesicle
0/3 Positive -Select seminal vesicle epithelium
Epididymis 3/3 Positive -Epididymal epithelium
Testes 3/3 Positive -B spermatogonia
-Late spermatids
Veph1A transcripts were detected by RT-PCR, and protein by IHC staining, in murine adult male
and female reproductive tissues. * column with RT-PCR data indicates number of independent
tissue sets positive for Veph1A from the total number of tissue sets examined.
57
Table 5: Summary of Veph1A mRNA and protein expression, and protein localization in
murine adult non-reproductive tissues.
Tissue RT-PCR
(Veph1A)*
IHC
(Veph1A)
IHC Veph1A Localization
Liver 2/4 Negative Negative
Lung 3/3 Positive -Bronchial epithelium
Brain 2/4 Positive -Ventricular zone
Spleen 0/3 Positive -Select cells
Adrenal
Gland
0/3 N/A N/A
Kidney 3/3 Positive -Proximal + distal tubule
epithelium
Eye 2/2 N/A N/A
Skeletal
Muscle
0/2 Positive -Myofibril striations
Veph1A transcripts were detected by RT-PCR, and protein by IHC staining, in murine adult non-
reproductive tissues. * column with RT-PCR data indicates number of independent tissue sets
positive for Veph1A from the total number of tissue sets examined. Tissues that were not
analyzed via immunohistochemistry are indicated (N/A).
58
Figure 12: Veph1A protein expression in murine adult male and female reproductive
tissues, as determined by Western blot analyses. Total protein was extracted from two
independent sets of selected murine adult male and female reproductive tissues and examined by
Western blot analysis using Sigma-Rab-PC antibody to detect Veph1A. Protein lysates (40 µg of
tissue lysate; 8 µg of HEY positive control lysate) were resolved by 10% SDS-polyacrylamide
gel electrophoresis (PAGE), transferred to a PVDF-membrane, and probed with Veph1 antibody
(1:100). Tissues that were positive for Veph1A RNA, detected by RT-PCR, are indicated (*).
GAPDH (1:2000) was used as a loading control.
59
60
Figure 13: Veph1A protein expression in murine adult non-reproductive tissues, as
determined by Western blot analyses. Total protein was extracted from two independent sets
of selected murine adult non-reproductive tissues and examined by Western blot analysis using
Sigma-Rab-PC antibody to detect Veph1A. Protein lysates (40 µg of tissue lysate; 8 µg of HEY
positive control lysate) were resolved by 10% SDS-PAGE, transferred to a PVDF-membrane,
and probed with Veph1 antibody (1:100). Tissues that were positive for Veph1A RNA, detected
by RT-PCR, are indicated (*). GAPDH (1:2000) was used as a loading control.
61
62
point volume tumours (520 mm3), growths of less than 520 mm
3, or non-respondent tumours
between groups (p=1.00; Figure 14).
To verify that supplementation of 25 mM ZnSO4 in the drinking water (provided to all
mice) resulted in Flag-tagged Veph1 expression in SKOV3-Ve tumours, Western blot analysis
was conducted on all tumours obtained. As expected, Flag expression was detected in all
SKOV3-Ve tumours and was absent in SKOV3-M tumours (Figure 15).
3.2.2 Veph1 effect on tumour growth rate and survival
To determine if Veph1 expression altered in vivo growth rate of SKOV3 cells, tumour
dimensions were determined every 24-48 hours via digital caliper measurements. SKOV3-M
tumours advanced to endpoint volume (520 mm3) tumours more rapidly than SKOV3-Ve
tumours (31.6 days vs. 45.8 days; p<0.001; Figure 16A). Kaplan-Meier survival curves for the
two groups of mice indicated a significant difference due to SKOV3 Veph1 expression with mice
injected with SKOV3-Ve cells having greater survival (death resulting from euthanasia due to
end-point volume tumour size or 63 days post-injection; p=0.0097; Figure 16B). The average
growth rate of SKOV3-M tumours (n=9; 27.46 +/- 1.792 mm3/time) was significantly greater
than SKOV3-Ve (n=8; 17.50 +/- 0.822 mm3/time) at each time point. This was determined by
analysis of covariance of linear regression lines depicting tumour growth as a function of time
(p<0.001; Figure 16C). Plotting the growth pattern of each tumour revealed a similar, yet
delayed, exponential growth pattern for SKOV3-M and SKOV3-Ve tumours (Figure 16D).
3.2.3 Veph1 effect on proliferative index
To determine whether the slower growth rate of SKOV3-Ve tumours was due to a
Veph1-dependent reduction in proliferative index, all tumours were immunohistochemically
stained for the proliferative markers PCNA and Ki-67. IHC analysis revealed no significant
difference in cycling cells (Ki-67 labeling index) between SKOV3-M (15.2 +/- 0.8%) and
SKOV3-Ve (13.9 +/- 1.5%) tumours (p=0.448; Figure 17). Similarly, there was no significant
difference in S-phase cells (nuclear PCNA labeling index) between SKOV3-M (34.8 +/- 2.6%)
and SKOV3-Ve (40.3 +/- 2.1%) tumours (p=0.126; Figure 18).
63
Figure 14: SKOV3-M and SKOV3-Ve tumour formation. Graph demonstrating percentage of
mice that formed an endpoint volume tumour (>520 mm3; red) and percentage of mice that
formed any tumour growth (ie. not including non-respondent mice; blue) from a total of 12 mice
injected initially in the SKOV3-M and SKOV3-Ve treatment groups. Tumour formation data
were analyzed using a Fisher’s Exact test.
64
Figure 15: ZnSO4-supplemented drinking water induction of Flag-Veph1. Total protein
lysates were extracted from all excised tumours and examined by Western blot analysis to detect
Flag-Veph1 expression using a Flag antibody. Protein lysates (20 µg) were resolved by 8% SDS-
PAGE, transferred to a PVDF-membrane, and probed with mouse monoclonal Flag antibody
(1:500). The membranes were then probed for GAPDH (1:2000) as a loading control. Graphs
demonstrate a quantitative presentation of Flag-Veph1 protein levels observed in tumours,
normalized to GAPDH levels. Each bar label represents mouse identification numbers.
65
66
Figure 16: SKOV3-M and SKOV3-Ve tumour growth rate and survival. A) Number of days
to formation of endpoint volume (>520 mm3) SKOV3-M (n=9) and SKOV3-Ve (n=8) tumours.
Data are shown as mean +/- standard error of mean (SEM) and were analyzed using Student’s t-
test. * indicates significant difference relative to SKOV3-M tumours (p<0.05). B) Kaplan-Meier
survival curve indicating percentage of surviving SKOV3-M (n=11) and SKOV3-Ve (n=10)
mice as a function of time (ie. tumours have not reached endpoint of >520 mm3) at each time
point. Data were analyzed using a Gehan-Breslow-Wilcoxon Test (p<0.05). C) Graph
demonstrating the exponential growth rate of SKOV3-M (n=9) and SKOV3-Ve (n=8) tumours
that reached endpoint volume; tumour volumes at each time point are indicated. Analysis of
covariance was used to compare the linear regression lines generated for SKOV3-M and
SKOV3-Ve tumour growth as a function of time (p<0.05). D) Graph demonstrating the
individual growth rate of all SKOV3-M (n=11) and SKOV3-Ve (n=10) tumours; tumour
volumes at each time point are indicated.
67
A
B
C
D
68
Figure 17: SKOV3-M and SKOV3-Ve tumour nuclear Ki-67 proliferative labeling index.
A) Nuclear Ki-67 proliferative labeling index (number of Ki67 stained nuclei compared to total
number of nuclei) for SKOV3-M (n=10) and SKOV3-Ve (n=10) tumours. Data are shown as
mean +/- SEM and were analyzed using a Student’s t-test (p<0.05). Representative SKOV3-M
(B) and SKOV3-Ve (C) mouse monoclonal Ki-67 (1:200) stained tumour images are presented.
IgG control section was incubated with normal mouse IgG rather than primary antibody at an
equivalent amount as primary antibody (D).
A
B
C
D
69
A
B
A
Figure 18: SKOV3-M and SKOV3-Ve tumour nuclear PCNA proliferative labeling index.
A) Nuclear PCNA proliferative labeling index (number of PCNA stained nuclei compared to
total number of nuclei) for SKOV3-M (n=11) and SKOV3-Ve (n=10) tumours. Data are shown
as mean +/- SEM and were analyzed using a Student’s t-test (p<0.05). Representative SKOV3-M
(B) and SKOV3-Ve (C) mouse monoclonal PCNA (1:2000) stained tumour images are
presented. IgG control section was incubated with normal mouse IgG rather than primary
antibody at an equivalent amount as primary antibody (D).
C
D
70
3.2.4 Veph1 effect on necrotic tumour area
To examine morphology, all tumours were stained for hematoxylin and eosin.
Microscopic observation of these images revealed necrotic areas in all tumours. Analysis of
tumour necrotic area, based on morphology, revealed a 55.0% greater average area of necrosis in
SKOV3-Ve tumours (24.3 +/- 5.4%), as compared to SKOV3-M tumours (11.0 +/- 2.7%;
p=0.034; Figure 19A). Necrosis morphology was verified by gynecologic oncology pathologist
Dr. Blaise Clarke of the University Health Network. Upon tumour excision it was noted that
60% of SKOV3-Ve tumours collected were fluid filled, often associated with necrosis, while
none of the SKOV3-M tumours contained fluid (p=0.004; Figure 19B).
To verify whether areas of apparent necrosis identified actually reflected necrosis or
apoptosis, double staining for TUNEL, used to detect DNA fragmentation in dying cells, and
cleaved caspase-3, which is present in cells undergoing apoptosis, was conducted on all tumours.
Analysis of TUNEL staining revealed a 64.9% greater average number of TUNEL positive cells
per necrotic area in Veph1 expressing (390.30 +/- 84.40 TUNEL+
cells/mm2 necrotic area), as
compared to non-expressing tumours (136.92 +/- 46.16 TUNEL+ cells/mm
2 necrotic area;
p<0.001). IHC analysis revealed no difference in cleaved caspase-3 staining between SKOV3-M
(20.07 +/- 8.89 cleaved caspase-3+ cells/mm
2 necrotic area) and SKOV3-Ve (20.73 +/- 9.12
cleaved caspase-3+ cells/mm
2 necrotic area) tumours. Fewer cleaved caspase-3
+ cells, as
compared to TUNEL+ cells, were identified in necrotic areas of SKOV3-M (85.68% reduction)
and SKOV3-M (99.95% reduction) tumours (p<0.001; Figure 20A). A greater (46.6%) average
number of TUNEL positive cells per non-necrotic area was also identified in SKOV3-Ve
tumours (6.82 +/- 2.49 TUNEL+ cells/mm
2 non-necrotic area), as compared to SKOV3-M
tumours (0.73 +/- 0.19 TUNEL+ cells/mm
2 non-necrotic area) (p=0.04; Figure 20D). No cleaved
caspase-3 staining was identified in non-necrotic tumour areas.
3.2.5 Veph1 effect on microvessel density
To determine if there was an effect of Veph1 expression on MVD, tumours were
immunohistochemically stained for the endothelial cell markers CD31 and CD34. Quantitation
of CD34 staining revealed a 50.6% decrease in MVD in SKOV3-Ve tumours (27.7 +/-5.6
MV/mm2), as compared to SKOV3-M tumours (56.1 +/- 6.5 MV/mm
2; p=0.004; Figure 21).
71
Figure 19: SKOV3-M and SKOV3-Ve tumour necrotic area and liquid accumulation. A)
Average necrotic tumour area (percent of necrotic area as compared to total tumour area;
determined by annotation based on morphology) for SKOV3-M (n=11) and SKOV3-Ve (n=10)
tumours. Data are shown as mean +/- SEM and were analyzed by Student’s t-test. B) Percentage
of tumours filled with liquid, that is commonly associated with necrosis, for SKOV3-M (n=11)
and SKOV3-Ve (n=10) treatment groups. Data were analyzed by Fisher’s Exact test (p<0.05). *
indicates significant difference relative to SKOV3-M tumours (p<0.05). Representative SKOV3-
M (C) and SKOV3-Ve (D) tumours stained with hematoxylin and eosin reflect necrotic areas
(indicated by black arrows).
D C
A B
72
Figure 20: SKOV3-M and SKOV3-Ve tumour double TUNEL and cleaved caspase-3
staining. A) Average number of TUNEL and cleaved caspase-3 positive cells per necrotic
tumour area (mm2) for SKOV3-M (n=11) and SKOV3-Ve (n=8) tumours. Bars with different
letters are statistically significant from one another as determined by ANOVA followed by a
SNK post-hoc test (p<0.05). Representative SKOV3-M (B) and SKOV3-Ve (C) necrotic tumour
areas stained for TUNEL and cleaved caspase-3 are shown. Green arrows indicate several
cleaved caspase-3 stained cells. D) Graph demonstrating average number of TUNEL positive
cells per non-necrotic tumour area (mm2) for SKOV3-M (n=11) and SKOV3-Ve (n=8) tumours.
Data were analyzed by Student’s t-test. * indicates significant difference relative to SKOV3-M
tumours (p<0.05). Representative SKOV3-M (E) and SKOV3-Ve (F) non-necrotic tumour areas
stained for TUNEL and cleaved caspase-3 are shown. Red arrows indicate several TUNEL
positive tumour cells. Data are shown as mean +/- SEM.
73
A
D
B
C
E
F
74
A
Figure 21: SKOV3-M and SKOV3-Ve tumour microvessel density as determined by CD34
staining. A) Average MVD (number of CD34+ microvessels per mm
2 tumour area) for SKOV3-
M (n=11) and SKOV3-Ve (n=10) tumours. Data are shown as mean +/- SEM and were analyzed
by Student’s t-test. * indicates significant difference relative to SKOV3-M tumours (p<0.05).
Representative SKOV3-M (B) and SKOV3-Ve (C) rabbit monoclonal CD34 (1:250) stained
tumour images are presented with red arrows indicating CD34+ MV. IgG control section was
incubated with normal rabbit IgG rather than primary antibody at an equivalent amount as
primary antibody (D).
B
C
D
75
Quantitation of CD31 staining revealed a similar 35.2% decrease in MVD in SKOV3-Ve
tumours (31.4 +/- 3.6 MV/mm2), as compared to SKOV3-M tumours (48.4 +/- 6.7 MV/mm
2)
(p=0.041; Figure 22).
3.2.6 Veph1 effect on SOD2 protein expression and activity
The effect of Veph1 on SOD2 protein expression was examined in vitro and in vivo as
SOD2 has a potential function in promoting angiogenesis [71]. A significant 86.4% reduction in
SOD2 protein expression was identified in SKOV3-Ve3 cells, as compared to SKOV3-M (three
independent repeats; p=0.0046; Figure 23A). A reduction in SOD2 protein levels was also seen
in the SKOV3-Ve4 clone, as compared to SKOV3-M cells (Figure 23B). A 75.5% reduction in
SOD2 activity, as compared to SKOV3-M cells (three independent repeats; p=0.0008; Figure
23C), was identified in SKOV3-Ve3 cells which correlates with the decrease in SOD2 protein
levels. Confirmation of the induction of Flag-Veph1 expression following 24 and 48 hour CdCl2
treatment in SKOV3-Ve3 cells was evident by Western blot detection using an anti-Flag
antibody (24 hours, p=0.034; 48 hours, p=0.026; Figure 23D).
To determine whether this effect of Veph1 on decreasing the protein expression of SOD2
was maintained in vivo, all xenograft tumours were examined via Western blot and IHC
analyses. Western blot analysis did not reveal a significant difference in SOD2 expression
between SKOV3-M and SKOV3-Ve tumours (Figure 24). Tumour sections were stained for
SOD2 to analyze total staining intensity in SKOV3 tumour cells. Quantitation of SOD2 staining
also did not reveal a significant difference in protein expression between SKOV3-M (1.64x107
+/- 2.67x106 total staining intensity) and SKOV3-Ve tumours (1.93x10
7 +/- 2.71x10
6 total
staining intensity) (p=0.442; Figure 25).
76
Figure 22: SKOV3-M and SKOV3-Ve tumour microvessel density as determined by CD31
staining. A) Average MVD (number of CD31+ microvessels per mm
2 tumour area) for SKOV3-
M (n=11) and SKOV3-Ve (n=10) tumours. Data are shown as mean +/- SEM and were analyzed
by Student’s t-test. * indicates significant difference relative to SKOV3-M tumours (p<0.05).
Representative SKOV3-M (B) and SKOV3-Ve (C) rabbit monoclonal CD31 (1:50) stained
tumour images are presented with red arrows indicating CD31+ MV (IHC staining was
performed by Pathology Services at The Toronto Centre for Phenogenomics).
B
A
C
77
Figure 23: SKOV3-M and SKOV3-Ve SOD2 expression and activity in vitro. A) SKOV3-M
and SKOV3-Ve3 cells were grown in the presence or absence of 1 µM CdCl2 for 24 hours and
total protein was extracted and examined by Western blot for SOD2 expression. Data were
analyzed using a one sample t-test to compare the ratio of SKOV3-Ve3/SKOV3-M SOD2
protein levels to a theoretical mean of 1.0 (three independent experiments). This experiment was
repeated in the SKOV3-Ve4 clone once (24 and 48 hour treatments with 1 µM CdCl2) to confirm
the effect of Veph1 on SOD2 expression (the membranes were probed for Flag to confirm
CdCl2-induction of Flag-Veph1; B). C) SKOV3-M and SKOV3-Ve3 cells were grown in the
presence or absence of 1 µM CdCl2 for 24 hours and SOD2 activity was determined (three
replicates per experiment; three independent experiments). The equation of the standard curve
was used to determine SOD2 activity (U/ml) and SOD2 activity was normalized to total protein
concentration. Data were analyzed using a one sample t-test to compare the ratio of SKOV3-
Ve3/SKOV3-M SOD2 activity levels to a theoretical mean of 1.0. D) SKOV3-M and SKOV3-
Ve3 cells were grown in the presence or absence of 1 µM CdCl2 for 24 and 48 hours. Total
protein was extracted and examined by Western blot for Flag expression. Data were analyzed by
Student’s t-test (three independent experiments). Protein lysates (8 µg) were resolved by 12%
SDS-PAGE in A and B, and 8% SDS-PAGE in D. The membranes in A, B, and D were probed
for GAPDH (1:2000) as a loading control. Graphs demonstrate a quantitative presentation of
protein levels, normalized to GAPDH levels. Graphs in A, C, and D present as mean +/- SEM of
three independent experiments. * indicates a statistically significant difference relative to
SKOV3-M cells (p<0.05).
78
A B
C
D
79
Figure 24: SOD2 protein expression in SKOV3-M and SKOV3-Ve tumours, as determined
by Western blot analysis. Total protein lysates were extracted from all excised tumours and
examined by Western blot analysis to detect SOD2 expression. Protein lysates (20 µg) were
resolved by 12% SDS-PAGE, transferred to a PVDF-membrane, and probed with rabbit
polyclonal SOD2 antibody (1:5000). The membranes were also probed for GAPDH (1:2000) as a
loading control. Graphs demonstrate a quantitative presentation of SOD2 protein levels observed
in tumours that were normalized to GAPDH levels. Each bar label represents mouse
identification numbers.
80
81
A
Figure 25: SOD2 protein expression in SKOV3-M and SKOV3-Ve tumours, as determined
by immunohistochemical analysis. A) Average total intensity of SOD2 staining for SKOV3-M
(n=10) and SKOV3-Ve (n=10) tumours. Data are shown as mean +/- SEM and were analyzed by
Student’s t-test. Representative SKOV3-M (B) and SKOV3-Ve (C) rabbit monoclonal SOD2
(1:250) stained tumour images. IgG control section was incubated with normal rabbit IgG rather
than primary antibody at an equivalent amount as primary antibody (D).
B
C
D
82
2.4. Chapte
DISCUSSION
4.1 Summary of Findings
Veph1 may alter the expression of genes that are partially regulated by the FoxO, TGF-β,
and Hippo signalling pathways that have both ovarian tumour suppressing and promoting
functions (Shathasivam et al., in preparation). Signalling modulation by Veph1 is supported by
studies conducted in human and Drosophila cells [8-11]. A role for Veph1 in EOC is strongly
implicated by genomic analyses that indicate an increase in VEPH1 gene copy number in a
subset of ovarian primary tumours and cell lines [4, 5]. Furthermore, Veph1 expression
correlates with an invasive and motile phenotype in ovarian cancer cell lines (Shathasivam et al.,
in preparation) [6, 7]. Altogether these data indicate Veph1 may have both physiological and
tumourigenic roles.
In this thesis, expression of Veph1A/Veph1B transcripts and protein was investigated in
murine embryonic and adult tissues. Expression of Veph1 transcripts was more widespread than
initially reported [12]. Adult murine Veph1A protein localization appeared to be largely
restricted to epithelium; however, further studies with more specific antibodies are required.
Furthermore, the effect of Veph1 expression on SKOV3 primary tumour formation and
progression was established. Expression of Veph1 reduced the growth rate of tumours; however,
this was not due to an effect on proliferative capacity. A significant impairment in angiogenesis
was identified in SKOV3 cell xenograft tumours that expressed Veph1. The resultant low MVD
in SKOV3-Ve tumours may suggest a mechanism by which these tumours exhibited a significant
increase in necrotic tumour area associated with liquid accumulation. Lastly, Veph1 expression
resulted in a significant reduction in SOD2 protein and activity levels in vitro; however, these
findings were not replicated in vivo.
4.2 Widespread Physiological Expression of Veph1 in Mice
Veph1 has a critical function in the development of the zebrafish central nervous system
[12]. In addition, the Drosophila orthologue of Veph1, Melted, has been identified to have an
imperative role peripheral nervous system development [60, 61]. However, tissue expression
Chapter 4
83
data are limited. Muto et al. [12] identified murine Veph1 mRNA in the developing embryonic
eye and brain, particularly in the ventricular zone. Adult murine Veph1 tissue expression is
maintained in the eye and kidney while other examined tissues appear to be negative for Veph1
transcript expression [12]. Importantly, murine Veph1 protein tissue expression and localization
has not been investigated.
Microarray data generated previously in our lab indicate that Veph1 protein expression in
SKOV3 human ovarian cancer cells alters the expression of genes that are partly regulated by the
FoxO, TGF-β, and Hippo signalling pathways (Shathasivam et al., in preparation). As these
signalling pathways have tumour suppressing and promoting roles, it was of interest to establish
the physiological expression of murine Veph1 transcript and protein during embryonic
development and adulthood. While Muto et al. [12] examined murine Veph1 mRNA expression
using primers that detect both transcript variants, my study used primers that distinguish between
Veph1A and Veph1B.
My studies reveal that Veph1A and Veph1B transcript expression is maintained
throughout embryogenesis, suggesting a potential role for both Veph1 isoforms during
embryonic development. Interestingly, Veph1B expression does not appear to be maintained in
adult tissues which may be indicative of an embryonic-specific role. This is of interest as our lab
has identified that a truncated protein consisting of amino acids 662-833 of full-length human
Veph1, which is similar to Veph1B (amino acids 580-833 of Veph1A), promotes TGF-β
signalling. This is in contrast to the full-length protein which inhibits TGF-β signalling. Further,
co-expression of this truncated peptide prevents the inhibition of TGF-β signalling by full-length
Veph1 (Shathasivam et al., in preparation). These data suggest that Veph1B may modulate TGF-
β signalling during embryonic development.
Morpholino-based knockdown of the zebrafish Veph1 gene (zVeph1) in fertilized eggs
results in embryos with defective central nervous system development, including specific
impairment in the formation of the midbrain–hindbrain boundary and otic vesicle formation [12].
Furthermore, mutation of melted in Drosophila results in abnormal morphology and loss of
peripheral neurons [61]. Due to possible species conservation, these data suggest that mutation of
murine Veph1 may also result in impaired brain development. Generation of Veph1 knockout
84
mice has revealed no defects in embryonic or adult development [12]. However, this lack of
effect of Veph1 on phenotype may be due to the region of gene deletion. Mice were generated by
deleting exons encoding amino acids 576-710 thus preserving the PH domain in both Veph1A
and Veph1B and a majority of the N-terminus of Veph1A [12]. Expression of these regions
could potentially preserve the function of murine Veph1 isoforms and allow normal
development. Therefore, a knockout of full length Veph1 would be required to assess its impact
in mammalian brain development.
Veph1A was expressed in the adult kidney and eye in my studies, consistent with
previous reports [12]. These data indicate that adult kidney and eye expression reported by Muto
et al. [12] represented Veph1A isoform specifically. In contrast to the murine transcript data
previously reported, I identified widespread expression of Veph1A in adult tissues. This
discrepancy may be due to procedural differences. It is important to note that PCR products
identified in my study were sequence verified. As my data suggest adult murine tissue expression
of Veph1A is widespread, it was then imperative to establish whether identified transcripts are
translated.
There are four commercially available antibodies that target human Veph1, with three
having >90% epitope sequence identity with murine Veph1A. One of these antibodies was used
in this study as it revealed IHC staining and identified Veph1 in positive control HEY cells by
Western blot analysis; however, several unexpected immunoreactive bands of different
molecular weights were also identified in murine tissues. These bands may represent different
isoforms, non-specific bands due to poor antibody specificity, or degradation products.
There is evidence that supports the validity of the Sigma-Rab-PC antibody. In contrast to
several bands identified in mouse tissues by Western blot analyses, one band at the expected 95
kDa molecular weight for human Veph1 was identified in positive control HEY ovarian cancer
cells (data not shown). Furthermore, several immunoreactive bands were detected in the heart
and liver; however, no IHC staining was observed in these tissues suggesting that the Sigma-
Rab-PC antibody is not detecting these bands when used for immunohistochemical analyses.
Additionally, Veph1 mRNA has been previously identified in the ventricular zone of the murine
fetal brain [12] and this specific region stained positive for Veph1A in adult murine brain tissue
in my studies. Lastly, specificity of this antibody is supported by immunocytofluorescence
85
detection of green fluorescent protein (GFP)-tagged Veph1 that is in agreement with Veph1
staining identified with the Sigma-Rab-PC antibody in SKOV3 cells (Shathasivam personal
communication). Staining identified in my studies will need to be verified upon the production of
more specific antibodies directed toward murine Veph1A. In situ hybridization to detect murine
Veph1 transcripts in adult tissues would also verify both mRNA expression and protein
localization data described in this study.
Positive Veph1A staining in adult tissues was localized to the epithelia of all tissues
examined, except for that of the ovary. Additional areas that were stained include specific
regions of the brain, corpus lutea and oocytes in the ovary, and B spermatogonia and late
spermatids in the testis. Melted and zVeph1, human Veph1 homologs, have imperative functions
in the development of the nervous system [12, 61]. My studies suggest that murine Veph1 may
have a function in the brain that is maintained during adulthood. In addition, Veph1A positive
staining of reproductive tissues suggests additional functions.
Veph1A positive staining was identified in oocytes and B spermatogonia which require
FoxO signalling for partial regulation of oogenesis and spermatogenesis, respectively. FoxO1
expression is required for spermatogonial stem cell maintenance as conditional FoxO1
knockdown in murine germ cells results in defective proliferative expansion of spermatogonia
[103]. FoxO1 signalling promotes stem cell maintenance by upregulating the transcription of
stem cell markers; however, by an unknown mechanism, FoxO1 becomes inactivated allowing
spermatogenic differentiation [103]. It is possible that Veph1 may be involved in stem cell
differentiation as its expression is induced upon the differentiation of human testis embryonal
carcinoma stem cells [12]. Veph1 may be involved in the mechanism by which FoxO is
inactivated during spermatogonial stem cell differentiation as Melted is reported to inhibit FoxO
activity [8] and Veph1 was specifically expressed in differentiated B spermatogonia in my study.
Veph1 may also be preventing FoxO signalling in oocytes.
FoxO signalling acts to prevent oocyte survival. The accumulation of active nuclear
FoxO3a results in apoptosis of rat oocytes that is accomplished by increased expression of pro-
apoptotic proteins- such as Bim and p27kip1 [104]. Although FoxO3a-induced oocyte apoptosis
is necessary to prevent excessive follicular activation, uncontrolled FoxO activation may result
in premature ovarian failure [104]. In my studies, Veph1A staining was identified in oocytes,
86
suggesting a possible mechanism by which FoxO activity is inhibited and oocyte survival is
maintained.
Veph1 staining was identified most commonly in the epithelia of tissues examined. This
localization was predicted prior to this study as our lab has identified upregulation of epithelial
marker E-cadherin mRNA and protein in Veph1 expressing cells (Shathasivam et al., in
preparation). Veph1 was identified in FTE, however, not in OSE; E-cadherin is expressed in
normal FTE [105], neoplastic OSE, and inclusion cysts, but not in normal OSE [106].
Correlating localization data support the possible function of Veph1 in promoting E-cadherin
expression.
E-cadherin levels are reduced in metastatic ovarian tumour cells isolated from ascites as
compared to primary solid tumours from the same patient [107]. Further, increased E-cadherin
expression is associated with reduced invasive capability due to its prevention of EMT that is
necessary for ovarian cancer metastasis [107]. In addition to a function in preventing invasion, E-
cadherin expression has been shown to promote proliferation of SKOV3 cells which is prevented
by treating with an siRNA targeting the CDH1 gene [108]. These data suggest that Veph1-
dependent upregulation of E-cadherin may promote primary tumour growth while impairing
metastatic development. Establishing the effect of Veph1 on primary ovarian tumour growth was
the next objective of this thesis.
4.3 Veph1 Impedes SKOV3 Primary Tumour Growth
In this study, Veph1 unexpectedly reduced the growth rate of primary SKOV3 tumours in
vivo. This effect of Veph1 on tumour growth rate was not due to effects on the proliferative
capacity of cells; rather, it is likely due to a Veph1-induced impairment on angiogenesis that
causes a net promotion of tumour cell death and ultimate deficiency in overall growth.
Microarray data established in our lab indicate Veph1 affects the FoxO, TGF-β, and Hippo
signalling pathways. These pathways have been implicated in regulating angiogenesis and thus
there are several possible mechanisms by which Veph1 impairs angiogenesis.
The Drosophila Veph1 homolog Melted has been identified as an inhibitor of FoxO
activity [8]. The FoxO signalling pathway promotes SOD2 expression [65] which aids in the
production of H2O2 that regulates signalling pathways involved in promoting blood vessel
87
formation [71]. H2O2 exposure can cause activation of the transcription factors HIF-1α, activator
protein 1 (AP-1), and v-ets erythroblastosis virus E26 oncogene homolog 1 (Ets-1), that
collectively cause the upregulation of genes encoding proteins involved in promoting
angiogenesis- such as VEGF, MMPs, and urokinase plasminogen activator (uPA) [71]. By
inhibiting FoxO-mediated SOD2 expression, Veph1 may reduce H2O2 production thereby
reducing MVD. I established that Veph1 causes a significant reduction in SOD2 protein and
activity levels in SKOV3 cells in vitro; however, this was not maintained in vivo. This loss of
Veph1-dependent SOD2 reduction may be due to differences between tissue culture conditions
and the in vivo tumour microenvironment. This inconsistency suggests that Veph1 may act via
another mechanism to reduce MVD. Alternatively, Veph1 may exert its effects on impeding
angiogenesis by its disruption of the TGF-β signalling pathway.
Our lab has established that Veph1 is a novel inhibitor of canonical TGF-β signalling
(Shathasivam et al., in preparation). TGF-β promotes angiogenesis in part by increasing the gene
expression of potent pro-angiogenic factor VEGF [40] and by promoting EndMT resulting in the
generation of cancer-associated fibroblasts that release angiogenesis-promoting factors including
TGF-β and VEGF [87]. Inhibition of TGF-β signalling decreases the expression of VEGF that
ultimately reduces CD31+ MV formation in human xenograft tumours [40]. Tissue microarray
analyses of 339 primary ovarian tumours revealed that increased VEGF protein expression was
significantly associated with poor survival [109]. Importantly, only 7% of tumours exhibited
high expression of VEGF suggesting that anti-angiogenic drugs may only be successful in a
subset of patients with ovarian cancer [109]. Analyses of microarray data conducted in our lab to
investigate the effect of Veph1 on gene expression of SKOV3 cells indicate that Veph1 causes a
significant decrease in VEGFA RNA levels (Shathasivam et al., in preparation). This effect has
not yet been validated but may suggest a possible mechanism by which Veph1 reduced MVD in
my studies.
Another possible mechanism by which Veph1 exerts its effects on angiogenesis is via its
potential impact on the Hippo signalling pathway. Melted is a negative regulator of Hippo
signalling [9-11] and our lab has identified that Veph1 alters the expression of several YAP-
regulated genes (Shathasivam et al., in preparation). The transcription factor YAP has been
described as an oncogene due to its role in increased cell proliferation, migration, survival, and
88
chemoresistance [90]; however, a role in angiogenesis regulation has not been described.
Inhibition of LATS1 and LATS2 in ovarian cancer cells and primary tumours results in an
increased expression of YAP-regulated pro-angiogenic factor CTGF [92]. Our microarray data
indicate that Veph1 causes a significant increase in CTGF gene expression (Shathasivam et al.,
in preparation), which has not yet been validated, but suggests that the effect of Veph1 on
decreasing MVD is not likely due to regulation of the Hippo signalling pathway.
Decreased MVD has been associated with improved ovarian cancer survival in several
studies as it correlates with reduced intraperitoneal tumour burden. Development of metastases is
promoted by tumour vasculature providing nutrient delivery and waste removal that facilitates
rapid proliferation of tumour cells that disseminate throughout the abdomen [110-112]. In
contrast, examination of 64 primary ovarian tumours by Gadducci et al. [113] revealed that low
ovarian tumour MVD is correlated with poor chemoresponse and reduced overall survival. This
suggests that Veph1 expression may be a predictive marker of chemosensitivity.
Chemoresistance of tumours with reduced vasculature may be due to an impaired delivery of
chemotherapeutics, which is common when tumour cells are distanced from blood vessels [113].
These contrasting reports regarding the impact of MVD on survival are continued when
examining the effect of tumour cell death.
As a result of poor tumour perfusion, low MVD can result in tumour cell death often by
apoptosis or necrosis [27]. Necrosis elicits an immune response due to the rupture of necrotic cell
membranes resulting in release of cytoplasmic debris and pro-inflammatory cytokines. In
contrast, apoptosis is infrequently accompanied by an inflammatory response as apoptotic bodies
are phagocytosed and cell membranes are not ruptured [35, 36]. TUNEL assays detect DNA
fragmentation in apoptotic and necrotic cells and thus additional markers must be used to
distinguish between these two forms of cell death. Caspase-3 cleavage is an early event in
apoptosis; however, it is not likely to occur during necrosis [36, 114]. Morphology (as examined
gynecologic oncology pathologist Dr. Blaise Clarke) and double TUNEL/cleaved caspase-3
staining data indicate that observed tumour cell death is likely due to necrosis in the Veph1
expressing tumours.
89
This finding has clinical implications as necrotic cell death causes a pro-inflammatory
tumour microenvironment that can be both tumour suppressing, by initiating an immune
response that causes the destruction of tumour cells, or tumour promoting, by increasing ROS
and cytokine release from infiltrating immune cells that induce DNA damage and replicative
stress of tumour cells [37]. Studies indicate that low tumour necrosis is predictive of recurrent
disease and poor survival in patients with ovarian cancer [38]; however, it is also associated with
improved prognosis of colorectal patients [39]. These contrasting reports suggest that Veph1-
dependent impairment of angiogenesis and resulting necrosis likely has clinical relevance;
however, it is not clear how this would affect overall survival.
Although we initially predicted that increased Veph1 expression would potentiate ovarian
tumour progression due to data suggesting a possible driver function of this protein as VEPH1
gene copy number is increased in a subset of ovarian cancer samples [4, 5], we discovered that
Veph1 improved survival in a SKOV3 xenograft model. Our finding is consistent with data from
The Cancer Genome Atlas indicating that VEPH1 gene variations are significantly associated
with improved survival. Genomic analysis of 311 ovarian serous cystadenomas reveals that
17.7% of tumours had a VEPH1 gene variation (54 of 55 variations were gene amplifications;
Figure 25) (http://www.cbioportal.org). These data are concordant with my results. This
suggests that an increase in VEPH1 gene copy number may have a passenger effect or be a
survival advantage. The effect of Veph1 on survival can be further investigated performing
ovarian tumour microarrays upon the availability of a suitable Veph1 antibody and using
additional mouse models that do not have the limitations in the approach used in this study.
Advantages of the subcutaneous xenograft tumour mouse model used in this study
include the ability to accurately measure tumour volume, as the tumour site is accessible, and to
evaluate the effect of Veph1 on primary tumour formation and progression. However, there are
limitations to this approach. As a human ovarian cell line was used, immunocompromised Bagg
Albino/c (BALB/c) nude mice were required to prevent a host immune response and to allow
human cell survival. This strain of mice has a Forkhead Box N1 (FoxN1) mutation causing
thymus epithelium deficiency that results in absent T cell development and impaired B cell
maturation (as described by the supplier, Charles River Laboratories). This influences the tumour
90
Figure 26: Survival of serous ovarian cancer patients with and without VEPH1 alterations.
Kaplan-Meier survival curve indicating percentage of surviving serous ovarian cancer patients
with (n=55) and without (n=257) VEPH1 variations as a function of time. These variations were
predominantly gene amplifications. Data were analyzed using a Logrank Test (p<0.05).
91
microenvironment by preventing the lymphocyte-mediated host tumour response that can
prevent tumour cell survival or promote inflammatory-mediated tumour progression [80]. By
using immunocompromised mice, I may not be capturing the ultimate impact of extensive
tumour necrosis in SKOV3-Ve tumours. Furthermore, the subcutaneous model used in this study
requires the placement of cells in the dorsal region of the mouse. This site of tumour cell
injection allows for accessible tumour volume monitoring; however, the ovarian cells are not in
their physiological environment of the peritoneal cavity and the impact of Veph1 on metastases
and ascites development was not addressable. As this was the first study examining the effect of
Veph1 on ovarian tumourigenesis in vivo, analysis of primary tumour progression was of initial
interest; however, future experiments exploring the effect of Veph1 on other properties of
ovarian cancer progression warrant investigation.
An additional limitation to our model is the use of only one ovarian cancer cell line that
may not be representative of a tumour histotype. Genomic profiling reveals that, although
SKOV3 is the most commonly used cell line in ovarian cancer research, these cells do not
represent any specific tumour histotype [115]. Future studies using other cell lines that more
effectively represent tumour histotypes will be beneficial in determining if Veph1 has a
histotype-specific role.
4.4 Future Directions
As my study indicates a significant impact of Veph1 on impairing angiogenesis, it is
warranted to investigate the effect of this protein on additional properties of ovarian cancer
progression. Low MVD has been correlated with both increased and decreased survival, which is
often determined by tumour chemoresponse and the extent of metastases and ascites formation
[110-113]. Veph1 has been identified as a novel inhibitor of the canonical TGF-β signalling
(Shathasivam et al., in preparation) pathway that has been implicated in promoting angiogenesis,
EMT required for metastases development, and ascites accumulation by causing abnormalization
of the diaphragm lymphatic vessel network [40]. This suggests that Veph1 may affect ascites and
metastases progression, in addition to observed effects on angiogenesis. It is thus possible that
Veph1 has a greater impact on ovarian tumour progression and survival than what has been
identified in my study; additional mouse models are required.
92
Human xenograft murine models can be used to examine metastases and ascites
development when cells are injected directly into the intraperitoneal cavity or into the intrabursal
area beneath the bursal membrane on the ovarian surface. In these approaches,
immunocompromised mice would be required which would not allow for the influence of
immune responses to be included [116]. An additional mouse model of ovarian cancer involves
the use of murine ovarian cancer cells injected into non-immunodeficient mice which allows for
the host immune response to remain [117]. Tumour cell migration and metastases can be
effectively monitored by using in vivo imaging of GFP-labeled tumour cells and ascites
accumulation can be monitored by measuring abdominal girth [116]. Upon establishing the
effect of Veph1 on additional processes in ovarian tumour progress, in vitro studies will be of
importance to determine the mechanism by which Veph1 exerts its effects.
The potential impact of Veph1 on human disease had not been investigated prior to this
study. My findings indicate that Veph1 has important functions in normal physiological
conditions and in pathologies, such as cancer. I have expanded on what is known about tissue
expression of Veph1 and I have identified an interesting differential pattern of transcript isoform
expression during murine embryonic development. Additional studies are required to verify
murine Veph1A expression and localization identified in my study. I have also identified Veph1
as a novel disruptor of angiogenesis and a promoter of ‘survival’ (as defined by tumours
reaching end-point volume) in mice with ovarian xenograft tumours. Future studies to establish
the effect of Veph1 on additional properties affecting ovarian tumour progression, such as
chemosensitivity and formation of metastases and ascites, will be of great importance. Although
little is known of the specific mechanisms by which Veph1 exerts its effects, studies indicate it
may modulate multiple signalling pathways. The role of Veph1 in development, physiological
processes, and cancer progression is thus likely to be quite complex. Further work investigating
this protein is warranted and should lead to important further discoveries.
93
Chapter 5
REFERENCES
1. Society, C.C. Canadian Cancer Statistics 2012. 2012; Available from:
https://www.cancer.ca/Canada-
wide/About%20cancer/Cancer%20statistics.aspx?sc_lang=EN.
2. Mantia-Smaldone, G.M., R.P. Edwards, and A.M. Vlad, Targeted treatment of recurrent
platinum-resistant ovarian cancer: current and emerging therapies. Cancer management
and research, 2011. 3: p. 25-38.
3. Herzog, T.J. and B. Pothuri, Ovarian cancer: a focus on management of recurrent
disease. Nature clinical practice. Oncology, 2006. 3(11): p. 604-11.
4. Ramakrishna, M., L.H. Williams, S.E. Boyle, J.L. Bearfoot, A. Sridhar, T.P. Speed, K.L.
Gorringe, and I.G. Campbell, Identification of candidate growth promoting genes in ovarian
cancer through integrated copy number and expression analysis. PloS one, 2010. 5(4): p.
e9983.
5. Tan, D.S., M.B. Lambros, S. Rayter, R. Natrajan, R. Vatcheva, Q. Gao, C. Marchio, F.C.
Geyer, K. Savage, S. Parry, K. Fenwick, N. Tamber, A. Mackay, T. Dexter, C. Jameson,
W.G. McCluggage, A. Williams, A. Graham, D. Faratian, M. El-Bahrawy, A.J. Paige, H.
Gabra, M.E. Gore, M. Zvelebil, C.J. Lord, S.B. Kaye, A. Ashworth, and J.S. Reis-Filho,
PPM1D is a potential therapeutic target in ovarian clear cell carcinomas. Clinical cancer
research, 2009. 15(7): p. 2269-80.
6. Sodek, K.L., M.J. Ringuette, and T.J. Brown, MT1-MMP is the critical determinant of
matrix degradation and invasion by ovarian cancer cells. British journal of cancer, 2007.
97(3): p. 358-67.
7. Sodek, K.L., M.J. Ringuette, and T.J. Brown, Compact spheroid formation by ovarian
cancer cells is associated with contractile behavior and an invasive phenotype. International
journal of cancer, 2009. 124(9): p. 2060-70.
8. Teleman, A.A., Y.W. Chen, and S.M. Cohen, Drosophila Melted modulates FOXO and
TOR activity. Developmental cell, 2005. 9(2): p. 271-81.
9. Jukam, D. and C. Desplan, Binary regulation of Hippo pathway by Merlin/NF2, Kibra,
Lgl, and Melted specifies and maintains postmitotic neuronal fate. Developmental cell,
2011. 21(5): p. 874-87.
10. Mikeladze-Dvali, T., M.F. Wernet, D. Pistillo, E.O. Mazzoni, A.A. Teleman, Y.W. Chen,
S. Cohen, and C. Desplan, The growth regulators warts/lats and melted interact in a bistable
loop to specify opposite fates in Drosophila R8 photoreceptors. Cell, 2005. 122(5): p. 775-
87.
11. Hsiao, H.Y., D. Jukam, R. Johnston, and C. Desplan, The neuronal transcription factor
erect wing regulates specification and maintenance of Drosophila R8 photoreceptor
subtypes. Developmental biology, 2013. 381(2): p. 482-90.
12. Muto, E., Y. Tabata, T. Taneda, Y. Aoki, A. Muto, K. Arai, and S. Watanabe,
Identification and characterization of Veph, a novel gene encoding a PH domain-containing
protein expressed in the developing central nervous system of vertebrates. Biochimie, 2004.
86(8): p. 523-31.
13. Jemal, A., R. Siegel, E. Ward, Y. Hao, J. Xu, T. Murray, and M.J. Thun, Cancer
statistics, 2008. CA: a cancer journal for clinicians, 2008. 58(2): p. 71-96.
94
14. Sankaranarayanan, R. and J. Ferlay, Worldwide burden of gynaecological cancer: the
size of the problem. Best practice & research. Clinical obstetrics & gynaecology, 2006.
20(2): p. 207-25.
15. Kim, J., D.M. Coffey, C.J. Creighton, Z. Yu, S.M. Hawkins, and M.M. Matzuk, High-
grade serous ovarian cancer arises from fallopian tube in a mouse model. Proceedings of
the National Academy of Sciences of the United States of America, 2012. 109(10): p. 3921-
6.
16. Karst, A.M. and R. Drapkin, Ovarian cancer pathogenesis: a model in evolution. Journal
of oncology, 2010. 2010: p. 932371.
17. Levanon, K., C. Crum, and R. Drapkin, New insights into the pathogenesis of serous
ovarian cancer and its clinical impact. Journal of clinical oncology, 2008. 26(32): p. 5284-
93.
18. Goff, B.A., Ovarian cancer: screening and early detection. Obstetrics and gynecology
clinics of North America, 2012. 39(2): p. 183-94.
19. Bast, R.C., Jr., B. Hennessy, and G.B. Mills, The biology of ovarian cancer: new
opportunities for translation. Nature reviews. Cancer, 2009. 9(6): p. 415-28.
20. Chen, V.W., B. Ruiz, J.L. Killeen, T.R. Cote, X.C. Wu, and C.N. Correa, Pathology and
classification of ovarian tumors. Cancer, 2003. 97(10 Suppl): p. 2631-42.
21. Kurman, R.J. and M. Shih Ie, Molecular pathogenesis and extraovarian origin of
epithelial ovarian cancer--shifting the paradigm. Human pathology, 2011. 42(7): p. 918-31.
22. Seidman, J.D., I. Horkayne-Szakaly, M. Haiba, C.R. Boice, R.J. Kurman, and B.M.
Ronnett, The histologic type and stage distribution of ovarian carcinomas of surface
epithelial origin. International journal of gynecological pathology, 2004. 23(1): p. 41-4.
23. Lalwani, N., S.R. Prasad, R. Vikram, A.K. Shanbhogue, P.C. Huettner, and N. Fasih,
Histologic, molecular, and cytogenetic features of ovarian cancers: implications for
diagnosis and treatment. Radiographics : a review publication of the Radiological Society of
North America, Inc, 2011. 31(3): p. 625-46.
24. Integrated genomic analyses of ovarian carcinoma. Nature, 2011. 474(7353): p. 609-15.
25. Tothill, R.W., A.V. Tinker, J. George, R. Brown, S.B. Fox, S. Lade, D.S. Johnson, M.K.
Trivett, D. Etemadmoghadam, B. Locandro, N. Traficante, S. Fereday, J.A. Hung, Y.E.
Chiew, I. Haviv, D. Gertig, A. DeFazio, and D.D. Bowtell, Novel molecular subtypes of
serous and endometrioid ovarian cancer linked to clinical outcome. Clinical cancer research,
2008. 14(16): p. 5198-208.
26. del Carmen, M.G., M. Birrer, and J.O. Schorge, Clear cell carcinoma of the ovary: a
review of the literature. Gynecologic oncology, 2012. 126(3): p. 481-90.
27. Bamberger, E.S. and C.W. Perrett, Angiogenesis in epithelian ovarian cancer. Molecular
pathology : MP, 2002. 55(6): p. 348-59.
28. Lengyel, E., Ovarian cancer development and metastasis. The American journal of
pathology, 2010. 177(3): p. 1053-64.
29. Tan, D.S., R. Agarwal, and S.B. Kaye, Mechanisms of transcoelomic metastasis in
ovarian cancer. The lancet oncology, 2006. 7(11): p. 925-34.
30. Frankel, A., K. Rosen, J. Filmus, and R.S. Kerbel, Induction of anoikis and suppression
of human ovarian tumor growth in vivo by down-regulation of Bcl-X(L). Cancer research,
2001. 61(12): p. 4837-41.
31. Tang, M.K., H.Y. Zhou, J.W. Yam, and A.S. Wong, c-Met overexpression contributes to
the acquired apoptotic resistance of nonadherent ovarian cancer cells through a cross talk
95
mediated by phosphatidylinositol 3-kinase and extracellular signal-regulated kinase 1/2.
Neoplasia, 2010. 12(2): p. 128-38.
32. Sodek, K.L., K.J. Murphy, T.J. Brown, and M.J. Ringuette, Cell-cell and cell-matrix
dynamics in intraperitoneal cancer metastasis. Cancer metastasis reviews, 2012. 31(1-2): p.
397-414.
33. Lebrin, F., M. Deckers, P. Bertolino, and P. Ten Dijke, TGF-beta receptor function in the
endothelium. Cardiovascular research, 2005. 65(3): p. 599-608.
34. Potenta, S., E. Zeisberg, and R. Kalluri, The role of endothelial-to-mesenchymal
transition in cancer progression. British journal of cancer, 2008. 99(9): p. 1375-9.
35. Elmore, S., Apoptosis: a review of programmed cell death. Toxicologic pathology, 2007.
35(4): p. 495-516.
36. Zong, W.X. and C.B. Thompson, Necrotic death as a cell fate. Genes & development,
2006. 20(1): p. 1-15.
37. Vakkila, J. and M.T. Lotze, Inflammation and necrosis promote tumour growth. Nature
reviews. Immunology, 2004. 4(8): p. 641-8.
38. Le, T., P. Shahriari, L. Hopkins, W. Faught, and M. Fung Kee Fung, Prognostic
significance of tumor necrosis in ovarian cancer patients treated with neoadjuvant
chemotherapy and interval surgical debulking. International journal of gynecological cancer,
2006. 16(3): p. 986-90.
39. Richards, C.H., C.S. Roxburgh, J.H. Anderson, R.F. McKee, A.K. Foulis, P.G. Horgan,
and D.C. McMillan, Prognostic value of tumour necrosis and host inflammatory responses
in colorectal cancer. The British journal of surgery, 2012. 99(2): p. 287-94.
40. Liao, S., J. Liu, P. Lin, T. Shi, R.K. Jain, and L. Xu, TGF-beta blockade controls ascites
by preventing abnormalization of lymphatic vessels in orthotopic human ovarian carcinoma
models. Clinical cancer research, 2011. 17(6): p. 1415-24.
41. Kipps, E., D.S. Tan, and S.B. Kaye, Meeting the challenge of ascites in ovarian cancer:
new avenues for therapy and research. Nature reviews. Cancer, 2013. 13(4): p. 273-82.
42. Woopen, H. and J. Sehouli, Current and future options in the treatment of malignant
ascites in ovarian cancer. Anticancer research, 2009. 29(8): p. 3353-9.
43. Maccio, A. and C. Madeddu, Inflammation and ovarian cancer. Cytokine, 2012. 58(2): p.
133-47.
44. Richards, J.S., D.L. Russell, R.L. Robker, M. Dajee, and T.N. Alliston, Molecular
mechanisms of ovulation and luteinization. Molecular and cellular endocrinology, 1998.
145(1-2): p. 47-54.
45. Shkolnik, K., A. Tadmor, S. Ben-Dor, N. Nevo, D. Galiani, and N. Dekel, Reactive
oxygen species are indispensable in ovulation. Proceedings of the National Academy of
Sciences of the United States of America, 2011. 108(4): p. 1462-7.
46. Szabova, L., C. Yin, S. Bupp, T.M. Guerin, J.J. Schlomer, D.B. Householder, M.L.
Baran, M. Yi, Y. Song, W. Sun, J.E. McDunn, P.L. Martin, T. Van Dyke, and S.
Difilippantonio, Perturbation of Rb, p53, and Brca1 or Brca2 cooperate in inducing
metastatic serous epithelial ovarian cancer. Cancer research, 2012. 72(16): p. 4141-53.
47. Flesken-Nikitin, A., C.I. Hwang, C.Y. Cheng, T.V. Michurina, G. Enikolopov, and A.Y.
Nikitin, Ovarian surface epithelium at the junction area contains a cancer-prone stem cell
niche. Nature, 2013. 495(7440): p. 241-5.
96
48. Maines-Bandiera, S.L. and N. Auersperg, Increased E-cadherin expression in ovarian
surface epithelium: an early step in metaplasia and dysplasia? International journal of
gynecological pathology, 1997. 16(3): p. 250-5.
49. King, S.M., T.S. Hilliard, L.Y. Wu, R.C. Jaffe, A.T. Fazleabas, and J.E. Burdette, The
impact of ovulation on fallopian tube epithelial cells: evaluating three hypotheses
connecting ovulation and serous ovarian cancer. Endocrine-related cancer, 2011. 18(5): p.
627-42.
50. Karst, A.M., K. Levanon, and R. Drapkin, Modeling high-grade serous ovarian
carcinogenesis from the fallopian tube. Proceedings of the National Academy of Sciences of
the United States of America, 2011. 108(18): p. 7547-52.
51. Marquez, R.T., K.A. Baggerly, A.P. Patterson, J. Liu, R. Broaddus, M. Frumovitz, E.N.
Atkinson, D.I. Smith, L. Hartmann, D. Fishman, A. Berchuck, R. Whitaker, D.M.
Gershenson, G.B. Mills, R.C. Bast, Jr., and K.H. Lu, Patterns of gene expression in different
histotypes of epithelial ovarian cancer correlate with those in normal fallopian tube,
endometrium, and colon. Clinical cancer research, 2005. 11(17): p. 6116-26.
52. Tone, A.A., H. Begley, M. Sharma, J. Murphy, B. Rosen, T.J. Brown, and P.A. Shaw,
Gene expression profiles of luteal phase fallopian tube epithelium from BRCA mutation
carriers resemble high-grade serous carcinoma. Clinical cancer research, 2008. 14(13): p.
4067-78.
53. Tone, A.A., C. Virtanen, P. Shaw, and T.J. Brown, Prolonged postovulatory
proinflammatory signaling in the fallopian tube epithelium may be mediated through a
BRCA1/DAB2 axis. Clinical cancer research, 2012. 18(16): p. 4334-44.
54. Medeiros, F., M.G. Muto, Y. Lee, J.A. Elvin, M.J. Callahan, C. Feltmate, J.E. Garber,
D.W. Cramer, and C.P. Crum, The tubal fimbria is a preferred site for early
adenocarcinoma in women with familial ovarian cancer syndrome. The American journal of
surgical pathology, 2006. 30(2): p. 230-6.
55. Callahan, M.J., C.P. Crum, F. Medeiros, D.W. Kindelberger, J.A. Elvin, J.E. Garber,
C.M. Feltmate, R.S. Berkowitz, and M.G. Muto, Primary fallopian tube malignancies in
BRCA-positive women undergoing surgery for ovarian cancer risk reduction. Journal of
clinical oncology, 2007. 25(25): p. 3985-90.
56. Kobayashi, H., H. Kajiwara, S. Kanayama, Y. Yamada, N. Furukawa, T. Noguchi, S.
Haruta, S. Yoshida, M. Sakata, T. Sado, and H. Oi, Molecular pathogenesis of
endometriosis-associated clear cell carcinoma of the ovary (review). Oncology reports,
2009. 22(2): p. 233-40.
57. Robboy, S.J. and S.M. Bean, Pathogenesis of endometriosis. Reproductive biomedicine
online, 2010. 21(1): p. 4-5.
58. Stany, M.P., V. Vathipadiekal, L. Ozbun, R.L. Stone, S.C. Mok, H. Xue, T. Kagami, Y.
Wang, J.N. McAlpine, D. Bowtell, P.W. Gout, D.M. Miller, C.B. Gilks, D.G. Huntsman,
S.L. Ellard, Y.Z. Wang, P. Vivas-Mejia, G. Lopez-Berestein, A.K. Sood, and M.J. Birrer,
Identification of novel therapeutic targets in microdissected clear cell ovarian cancers. PloS
one, 2011. 6(7): p. e21121.
59. Itamochi, H., J. Kigawa, T. Sugiyama, Y. Kikuchi, M. Suzuki, and N. Terakawa, Low
proliferation activity may be associated with chemoresistance in clear cell carcinoma of the
ovary. Obstetrics and gynecology, 2002. 100(2): p. 281-7.
97
60. Prokopenko, S.N., Y. He, Y. Lu, and H.J. Bellen, Mutations affecting the development of
the peripheral nervous system in Drosophila: a molecular screen for novel proteins.
Genetics, 2000. 156(4): p. 1691-715.
61. Salzberg, A., S.N. Prokopenko, Y. He, P. Tsai, M. Pal, P. Maroy, D.M. Glover, P. Deak,
and H.J. Bellen, P-element insertion alleles of essential genes on the third chromosome of
Drosophila melanogaster: mutations affecting embryonic PNS development. Genetics, 1997.
147(4): p. 1723-41.
62. Rebecchi, M.J. and S. Scarlata, Pleckstrin homology domains: a common fold with
diverse functions. Annual review of biophysics and biomolecular structure, 1998. 27: p. 503-
28.
63. Scheffzek, K. and S. Welti, Pleckstrin homology (PH) like domains - versatile modules in
protein-protein interaction platforms. FEBS letters, 2012. 586(17): p. 2662-73.
64. Barrios-Rodiles, M., K.R. Brown, B. Ozdamar, R. Bose, Z. Liu, R.S. Donovan, F. Shinjo,
Y. Liu, J. Dembowy, I.W. Taylor, V. Luga, N. Przulj, M. Robinson, H. Suzuki, Y.
Hayashizaki, I. Jurisica, and J.L. Wrana, High-throughput mapping of a dynamic signaling
network in mammalian cells. Science, 2005. 307(5715): p. 1621-5.
65. Tran, H., A. Brunet, E.C. Griffith, and M.E. Greenberg, The many forks in FOXO's road.
Science's STKE : signal transduction knowledge environment, 2003. 2003(172): p. RE5.
66. Tran, H., A. Brunet, J.M. Grenier, S.R. Datta, A.J. Fornace, Jr., P.S. DiStefano, L.W.
Chiang, and M.E. Greenberg, DNA repair pathway stimulated by the forkhead transcription
factor FOXO3a through the Gadd45 protein. Science, 2002. 296(5567): p. 530-4.
67. Sunayama, J., F. Tsuruta, N. Masuyama, and Y. Gotoh, JNK antagonizes Akt-mediated
survival signals by phosphorylating 14-3-3. The Journal of cell biology, 2005. 170(2): p.
295-304.
68. Wang, Y., L. Dong, H. Cui, D.H. Shen, X.H. Chang, T.Y. Fu, X. Ye, and Y.Y. Yao, Up-
regulation of mitochondrial antioxidation signals in ovarian cancer cells with aggressive
biologic behavior. Journal of Zhejiang University. Science. B, 2011. 12(5): p. 346-56.
69. Connor, K.M., N. Hempel, K.K. Nelson, G. Dabiri, A. Gamarra, J. Belarmino, L. Van De
Water, B.M. Mian, and J.A. Melendez, Manganese superoxide dismutase enhances the
invasive and migratory activity of tumor cells. Cancer research, 2007. 67(21): p. 10260-7.
70. Storz, P., H. Doppler, J.A. Copland, K.J. Simpson, and A. Toker, FOXO3a promotes
tumor cell invasion through the induction of matrix metalloproteinases. Molecular and
cellular biology, 2009. 29(18): p. 4906-17.
71. Connor, K.M., S. Subbaram, K.J. Regan, K.K. Nelson, J.E. Mazurkiewicz, P.J.
Bartholomew, A.E. Aplin, Y.T. Tai, J. Aguirre-Ghiso, S.C. Flores, and J.A. Melendez,
Mitochondrial H2O2 regulates the angiogenic phenotype via PTEN oxidation. The Journal
of biological chemistry, 2005. 280(17): p. 16916-24.
72. Potente, M., C. Urbich, K. Sasaki, W.K. Hofmann, C. Heeschen, A. Aicher, R. Kollipara,
R.A. DePinho, A.M. Zeiher, and S. Dimmeler, Involvement of Foxo transcription factors in
angiogenesis and postnatal neovascularization. The Journal of clinical investigation, 2005.
115(9): p. 2382-92.
73. Reagan-Shaw, S. and N. Ahmad, The role of Forkhead-box Class O (FoxO) transcription
factors in cancer: a target for the management of cancer. Toxicology and applied
pharmacology, 2007. 224(3): p. 360-8.
98
74. Karger, S., C. Weidinger, K. Krause, S.Y. Sheu, T. Aigner, O. Gimm, K.W. Schmid, H.
Dralle, and D. Fuhrer, FOXO3a: a novel player in thyroid carcinogenesis? Endocrine-
related cancer, 2009. 16(1): p. 189-99.
75. Lu, M., J. Xiang, F. Xu, Y. Wang, Y. Yin, and D. Chen, The expression and significance
of pThr32-FOXO3a in human ovarian cancer. Medical oncology, 2012. 29(2): p. 1258-64.
76. Fei, M., Y. Zhao, Y. Wang, M. Lu, C. Cheng, X. Huang, D. Zhang, J. Lu, S. He, and A.
Shen, Low expression of Foxo3a is associated with poor prognosis in ovarian cancer
patients. Cancer investigation, 2009. 27(1): p. 52-9.
77. Chen, J., A.R. Gomes, L.J. Monteiro, S.Y. Wong, L.H. Wu, T.T. Ng, C.T. Karadedou, J.
Millour, Y.C. Ip, Y.N. Cheung, A. Sunters, K.Y. Chan, E.W. Lam, and U.S. Khoo,
Constitutively nuclear FOXO3a localization predicts poor survival and promotes Akt
phosphorylation in breast cancer. PloS one, 2010. 5(8): p. e12293.
78. Tenbaum, S.P., P. Ordonez-Moran, I. Puig, I. Chicote, O. Arques, S. Landolfi, Y.
Fernandez, J.R. Herance, J.D. Gispert, L. Mendizabal, S. Aguilar, S. Ramon y Cajal, S.
Schwartz, Jr., A. Vivancos, E. Espin, S. Rojas, J. Baselga, J. Tabernero, A. Munoz, and H.G.
Palmer, beta-catenin confers resistance to PI3K and AKT inhibitors and subverts FOXO3a
to promote metastasis in colon cancer. Nature medicine, 2012. 18(6): p. 892-901.
79. Huang, J., L. Zhang, J. Greshock, T.A. Colligon, Y. Wang, R. Ward, D. Katsaros, H.
Lassus, R. Butzow, A.K. Godwin, J.R. Testa, K.L. Nathanson, P.A. Gimotty, G. Coukos,
B.L. Weber, and Y. Degenhardt, Frequent genetic abnormalities of the PI3K/AKT pathway
in primary ovarian cancer predict patient outcome. Genes, chromosomes & cancer, 2011.
50(8): p. 606-18.
80. Massague, J., TGFbeta in Cancer. Cell, 2008. 134(2): p. 215-30.
81. Seoane, J., H.V. Le, L. Shen, S.A. Anderson, and J. Massague, Integration of Smad and
forkhead pathways in the control of neuroepithelial and glioblastoma cell proliferation.
Cell, 2004. 117(2): p. 211-23.
82. Davidson, B., C.G. Trope, and R. Reich, Epithelial-mesenchymal transition in ovarian
carcinoma. Frontiers in oncology, 2012. 2: p. 33.
83. Medici, D., E.D. Hay, and B.R. Olsen, Snail and Slug promote epithelial-mesenchymal
transition through beta-catenin-T-cell factor-4-dependent expression of transforming growth
factor-beta3. Molecular biology of the cell, 2008. 19(11): p. 4875-87.
84. Haslehurst, A.M., M. Koti, M. Dharsee, P. Nuin, K. Evans, J. Geraci, T. Childs, J. Chen,
J. Li, J. Weberpals, S. Davey, J. Squire, P.C. Park, and H. Feilotter, EMT transcription
factors snail and slug directly contribute to cisplatin resistance in ovarian cancer. BMC
cancer, 2012. 12: p. 91.
85. Rodriguez, G.C., C. Haisley, J. Hurteau, T.L. Moser, R. Whitaker, R.C. Bast, Jr., and
M.S. Stack, Regulation of invasion of epithelial ovarian cancer by transforming growth
factor-beta. Gynecologic oncology, 2001. 80(2): p. 245-53.
86. Medici, D., S. Potenta, and R. Kalluri, Transforming growth factor-beta2 promotes Snail-
mediated endothelial-mesenchymal transition through convergence of Smad-dependent and
Smad-independent signalling. The Biochemical journal, 2011. 437(3): p. 515-20.
87. Zeisberg, E.M., S. Potenta, L. Xie, M. Zeisberg, and R. Kalluri, Discovery of endothelial
to mesenchymal transition as a source for carcinoma-associated fibroblasts. Cancer
research, 2007. 67(21): p. 10123-8.
88. Luga, V., L. Zhang, A.M. Viloria-Petit, A.A. Ogunjimi, M.R. Inanlou, E. Chiu, M.
Buchanan, A.N. Hosein, M. Basik, and J.L. Wrana, Exosomes mediate stromal mobilization
99
of autocrine Wnt-PCP signaling in breast cancer cell migration. Cell, 2012. 151(7): p. 1542-
56.
89. Pan, D., The hippo signaling pathway in development and cancer. Developmental cell,
2010. 19(4): p. 491-505.
90. Hall, C.A., R. Wang, J. Miao, E. Oliva, X. Shen, T. Wheeler, S.G. Hilsenbeck, S. Orsulic,
and S. Goode, Hippo pathway effector Yap is an ovarian cancer oncogene. Cancer research,
2010. 70(21): p. 8517-25.
91. Zhang, X., J. George, S. Deb, J.L. Degoutin, E.A. Takano, S.B. Fox, D.D. Bowtell, and
K.F. Harvey, The Hippo pathway transcriptional co-activator, YAP, is an ovarian cancer
oncogene. Oncogene, 2011. 30(25): p. 2810-22.
92. Huntoon, C.J., M.D. Nye, L. Geng, K.L. Peterson, K.S. Flatten, P. Haluska, S.H.
Kaufmann, and L.M. Karnitz, Heat shock protein 90 inhibition depletes LATS1 and LATS2,
two regulators of the mammalian hippo tumor suppressor pathway. Cancer research, 2010.
70(21): p. 8642-50.
93. Calvo, F., N. Ege, A. Grande-Garcia, S. Hooper, R.P. Jenkins, S.I. Chaudhry, K.
Harrington, P. Williamson, E. Moeendarbary, G. Charras, and E. Sahai,
Mechanotransduction and YAP-dependent matrix remodelling is required for the generation
and maintenance of cancer-associated fibroblasts. Nature cell biology, 2013. 15(6): p. 637-
46.
94. Sjoblom, T., S. Jones, L.D. Wood, D.W. Parsons, J. Lin, T.D. Barber, D. Mandelker, R.J.
Leary, J. Ptak, N. Silliman, S. Szabo, P. Buckhaults, C. Farrell, P. Meeh, S.D. Markowitz, J.
Willis, D. Dawson, J.K. Willson, A.F. Gazdar, J. Hartigan, L. Wu, C. Liu, G. Parmigiani,
B.H. Park, K.E. Bachman, N. Papadopoulos, B. Vogelstein, K.W. Kinzler, and V.E.
Velculescu, The consensus coding sequences of human breast and colorectal cancers.
Science, 2006. 314(5797): p. 268-74.
95. Hernandez, P., X. Sole, J. Valls, V. Moreno, G. Capella, A. Urruticoechea, and M.A.
Pujana, Integrative analysis of a cancer somatic mutome. Molecular cancer, 2007. 6: p. 13.
96. Ylipaa, A., K.K. Hunt, J. Yang, A.J. Lazar, K.E. Torres, D.C. Lev, M. Nykter, R.E.
Pollock, J. Trent, and W. Zhang, Integrative genomic characterization and a genomic
staging system for gastrointestinal stromal tumors. Cancer, 2011. 117(2): p. 380-9.
97. Pharoah, P.D., Y.Y. Tsai, S.J. Ramus, C.M. Phelan, E.L. Goode, K. Lawrenson, M.
Buckley, B.L. Fridley, J.P. Tyrer, H. Shen, R. Weber, R. Karevan, M.C. Larson, H. Song,
D.C. Tessier, F. Bacot, D. Vincent, J.M. Cunningham, J. Dennis, E. Dicks, K.K. Aben, H.
Anton-Culver, N. Antonenkova, S.M. Armasu, L. Baglietto, E.V. Bandera, M.W.
Beckmann, M.J. Birrer, G. Bloom, N. Bogdanova, J.D. Brenton, L.A. Brinton, A. Brooks-
Wilson, R. Brown, R. Butzow, I. Campbell, M.E. Carney, R.S. Carvalho, J. Chang-Claude,
Y.A. Chen, Z. Chen, W.H. Chow, M.S. Cicek, G. Coetzee, L.S. Cook, D.W. Cramer, C.
Cybulski, A. Dansonka-Mieszkowska, E. Despierre, J.A. Doherty, T. Dork, A. du Bois, M.
Durst, D. Eccles, R. Edwards, A.B. Ekici, P.A. Fasching, D. Fenstermacher, J. Flanagan,
Y.T. Gao, M. Garcia-Closas, A. Gentry-Maharaj, G. Giles, A. Gjyshi, M. Gore, J. Gronwald,
Q. Guo, M.K. Halle, P. Harter, A. Hein, F. Heitz, P. Hillemanns, M. Hoatlin, E. Hogdall,
C.K. Hogdall, S. Hosono, A. Jakubowska, A. Jensen, K.R. Kalli, B.Y. Karlan, L.E.
Kelemen, L.A. Kiemeney, S.K. Kjaer, G.E. Konecny, C. Krakstad, J. Kupryjanczyk, D.
Lambrechts, S. Lambrechts, N.D. Le, N. Lee, J. Lee, A. Leminen, B.K. Lim, J. Lissowska, J.
Lubinski, L. Lundvall, G. Lurie, L.F. Massuger, K. Matsuo, V. McGuire, J.R. McLaughlin,
U. Menon, F. Modugno, K.B. Moysich, T. Nakanishi, S.A. Narod, R.B. Ness, H.
100
Nevanlinna, S. Nickels, H. Noushmehr, K. Odunsi, S. Olson, I. Orlow, J. Paul, T. Pejovic,
L.M. Pelttari, J. Permuth-Wey, M.C. Pike, E.M. Poole, X. Qu, H.A. Risch, L. Rodriguez-
Rodriguez, M.A. Rossing, A. Rudolph, I. Runnebaum, I.K. Rzepecka, H.B. Salvesen, I.
Schwaab, G. Severi, V. Shridhar, X.O. Shu, W. Sieh, M.C. Southey, P. Spellman, K. Tajima,
S.H. Teo, K.L. Terry, P.J. Thompson, A. Timorek, S.S. Tworoger, A.M. van Altena, D. van
den Berg, I. Vergote, R.A. Vierkant, A.F. Vitonis, S. Wang-Gohrke, N. Wentzensen, A.S.
Whittemore, E. Wik, B. Winterhoff, Y.L. Woo, A.H. Wu, H.P. Yang, W. Zheng, A. Ziogas,
F. Zulkifli, M.T. Goodman, P. Hall, D.F. Easton, C.L. Pearce, A. Berchuck, G. Chenevix-
Trench, E. Iversen, A.N. Monteiro, S.A. Gayther, J.M. Schildkraut and T.A. Sellers, GWAS
meta-analysis and replication identifies three new susceptibility loci for ovarian cancer.
Nature genetics, 2013. 45(4): p. 362-70.
98. Kollara, A. and T.J. Brown, Variable expression of nuclear receptor coactivator 4
(NcoA4) during mouse embryonic development. The journal of histochemistry and
cytochemistry, 2010. 58(7): p. 595-609.
99. Tomayko, M.M. and C.P. Reynolds, Determination of subcutaneous tumor size in
athymic (nude) mice. Cancer chemotherapy and pharmacology, 1989. 24(3): p. 148-54.
100. Kollara, A. and T.J. Brown, Functional interaction of nuclear receptor coactivator 4 with
aryl hydrocarbon receptor. Biochemical and biophysical research communications, 2006.
346(2): p. 526-34.
101. Tuominen, V.J., S. Ruotoistenmaki, A. Viitanen, M. Jumppanen, and J. Isola,
ImmunoRatio: a publicly available web application for quantitative image analysis of
estrogen receptor (ER), progesterone receptor (PR), and Ki-67. Breast cancer research :
BCR, 2010. 12(4): p. R56.
102. Vermeulen, P.B., G. Gasparini, S.B. Fox, C. Colpaert, L.P. Marson, M. Gion, J.A. Belien,
R.M. de Waal, E. Van Marck, E. Magnani, N. Weidner, A.L. Harris, and L.Y. Dirix, Second
international consensus on the methodology and criteria of evaluation of angiogenesis
quantification in solid human tumours. European journal of cancer, 2002. 38(12): p. 1564-
79.
103. Goertz, M.J., Z. Wu, T.D. Gallardo, F.K. Hamra, and D.H. Castrillon, Foxo1 is required
in mouse spermatogonial stem cells for their maintenance and the initiation of
spermatogenesis. The Journal of clinical investigation, 2011. 121(9): p. 3456-66.
104. Sui, X.X., L.L. Luo, J.J. Xu, and Y.C. Fu, Evidence that FOXO3a is involved in oocyte
apoptosis in the neonatal rat ovary. Biochemistry and cell biology, 2010. 88(4): p. 621-8.
105. Levanon, K., V. Ng, H.Y. Piao, Y. Zhang, M.C. Chang, M.H. Roh, D.W. Kindelberger,
M.S. Hirsch, C.P. Crum, J.A. Marto, and R. Drapkin, Primary ex vivo cultures of human
fallopian tube epithelium as a model for serous ovarian carcinogenesis. Oncogene, 2010.
29(8): p. 1103-13.
106. Sundfeldt, K., Y. Piontkewitz, K. Ivarsson, O. Nilsson, P. Hellberg, M. Brannstrom, P.O.
Janson, S. Enerback, and L. Hedin, E-cadherin expression in human epithelial ovarian
cancer and normal ovary. International journal of cancer, 1997. 74(3): p. 275-80.
107. Veatch, A.L., L.F. Carson, and S. Ramakrishnan, Differential expression of the cell-cell
adhesion molecule E-cadherin in ascites and solid human ovarian tumor cells. International
journal of cancer, 1994. 58(3): p. 393-9.
108. Dong, L.L., L. Liu, C.H. Ma, J.S. Li, C. Du, S. Xu, L.H. Han, L. Li, and X.W. Wang, E-
cadherin promotes proliferation of human ovarian cancer cells in vitro via activating
MEK/ERK pathway. Acta pharmacologica Sinica, 2012. 33(6): p. 817-22.
101
109. Duncan, T.J., A. Al-Attar, P. Rolland, I.V. Scott, S. Deen, D.T. Liu, I. Spendlove, and
L.G. Durrant, Vascular endothelial growth factor expression in ovarian cancer: a model for
targeted use of novel therapies? Clinical cancer research, 2008. 14(10): p. 3030-5.
110. Stone, P.J., M.J. Goodheart, S.L. Rose, B.J. Smith, B.R. DeYoung, and R.E. Buller, The
influence of microvessel density on ovarian carcinogenesis. Gynecologic oncology, 2003.
90(3): p. 566-71.
111. Alvarez, A.A., H.R. Krigman, R.S. Whitaker, R.K. Dodge, and G.C. Rodriguez, The
prognostic significance of angiogenesis in epithelial ovarian carcinoma. Clinical cancer
research, 1999. 5(3): p. 587-91.
112. Nadkarni, N.J., K.D. Geest, T. Neff, B.D. Young, D.P. Bender, A. Ahmed, B.J. Smith, A.
Button, and M.J. Goodheart, Microvessel density and p53 mutations in advanced-stage
epithelial ovarian cancer. Cancer letters, 2013. 331(1): p. 99-104.
113. Gadducci, A., P. Viacava, S. Cosio, G. Fanelli, A. Fanucchi, D. Cecchetti, R. Cristofani,
and A.R. Genazzani, Intratumoral microvessel density, response to chemotherapy and
clinical outcome of patients with advanced ovarian carcinoma. Anticancer research, 2003.
23(1B): p. 549-56.
114. Hetz, C.A., M. Hunn, P. Rojas, V. Torres, L. Leyton, and A.F. Quest, Caspase-dependent
initiation of apoptosis and necrosis by the Fas receptor in lymphoid cells: onset of necrosis
is associated with delayed ceramide increase. Journal of cell science, 2002. 115(Pt 23): p.
4671-83.
115. Domcke, S., R. Sinha, D.A. Levine, C. Sander, and N. Schultz, Evaluating cell lines as
tumour models by comparison of genomic profiles. Nature communications, 2013. 4: p.
2126.
116. Sale, S. and S. Orsulic, Models of ovarian cancer metastasis: Murine models. Drug
discovery today. Disease models, 2006. 3(2): p. 149-154.
117. Greenaway, J., R. Moorehead, P. Shaw, and J. Petrik, Epithelial-stromal interaction
increases cell proliferation, survival and tumorigenicity in a mouse model of human
epithelial ovarian cancer. Gynecologic oncology, 2008. 108(2): p. 385-94.
Recommended