View
1
Download
0
Category
Preview:
Citation preview
PATHOGENESIS AND TRANSFER OF KARNAL BUNT (Tilletia
indica) RESISTANCE IN BREAD WHEAT (Triticum aestivum)
HAFIZ MUHAMMAD ZIAULLAH 05-arid-1182
Department of Plant Pathology
Faculty of Crop and Food Sciences
Pir Mehr Ali Shah
Arid Agriculture University Rawalpindi
Pakistan
2011
ii
PATHOGENESIS AND TRANSFER OF KARNAL BUNT (Tilletia
indica) RESISTANCE IN BREAD WHEAT (Triticum aestivum)
By
HAFIZ MUHAMMAD ZIAULLAH (05-arid-1182)
A thesis submitted in partial fulfillment of
the requirement for the degree of
DOCTOR OF PHILOSOPHY
in
PLANT PATHOLOGY
Department of Plant Pathology
Faculty of Crop and Food Sciences
Pir Mehr Ali Shah
Arid Agriculture University Rawalpindi
Pakistan
2011
iii
CERTIFICATION
I hereby undertake that this research is original and no part of this thesis
falls under plagiarism. If found otherwise, at any stage, I will be responsible for the
consequences.
Student’ Name: Hafiz Muhammad Ziaullah Signature: ____________
Registration No: 05-arid-1182 Date:
Certified that the contents and form of the thesis entitled “Pathogenesis and
Transfer of Karnal Bunt (Tilletia indica) Resistance in Bread Wheat (Triticum
aestivum)” submitted by Mr. Hafiz Muhammad Ziaullah have been found
satisfactory for the requirement of the degree.
Supervisor: ____________________________ (Dr. Irfan Ul-Haque)
Member: ____________________________
(Dr. Abdul-Rauf ) Member: ____________________________
(Dr. Muhammad Munir) Member: ____________________________
(Dr. Lal Hussain Akhtar)
Chairman: ____________________
Dean: _________________________
Director, Advanced Studies: _______________________
iv
v
DEDICATED
TO
(PEACE AND BLESSINGS OF ALLAH BE UPON HIM)
LIST OF ABBREVIATIONS
ANOVA Analysis of Variance
BK-02 Bhakar-2002
BNG Bahawal Nagar
BWP Bahawalpur
CI Co-efficient of infection
DHE Days to Heading
GY Grain Yield
INQ-91 Inqilab-91
KB Karnal Bunt
KHL Khanewal
LDN Lodhran
MN-03 Manthar-03
MTN Multan
NARC National Agricultural Research Center
NA Not Available
PMAS-AAUR Pir Mehr Ali Shah –Arid Agriculture University
Rawalpindi
PLH Plant height
PND-1 Punjnad-1
RYK Rahim Yar Khan
RARI Regional Agricultural Research Institute
SL Spike length
SOV Sources of Variance
VHR Vehari
vii
CONTENTS
TITLE PAGE
LIST OF TABLES x
LIST OF FIGURES xi
ACKNOWLEDGEMENTS xii
ABSTRACT 1
1 INTRODUCTION 3
1.1 Tilletia indica and Wheat 5
1.2 Prevalence and Nature of Pathogen 6
1.3 Losses caused by karnal Bunt of wheat 9
1.4 Screening and Breeding for Resistance 10
1.5 Objectives of The Research 11
2 REVIEW OF LITERATURE 13
2.1
Survey, Monitoring and geographical distribution 14
2.2
Screening aginst karnal bunt of wheat
17
2.3
Qualitative and quatitative losses.
19
2.4
Inoculation and Culture Viability
20
2.5
Sources of resistance
23
2.6
Inheritance of resistance 25
viii
2.7
Variability of pathogen isolates 32
3 MATERIALS AND METHODS 38
3.1 Survey and Monitoring 38
3.1.1 Survey and Sampling Procedure 39
3.1.2 Collection of samples 40
3.2 Comparative concert of commercial cultivars 40
3.3 Reaction under Artificial inoculated Conditions 41
3.3.1 Techniques for extraction and detection of Tilletia
indica
41
3.3.2 Inoculum preparation and Teliospore mass culturing 44
3.3.3 Germplasm collection 45
3.3.4 Inoculation of germplasm 46
3.3.5 Boot inoculation 46
3.3.6 Spray inoculation 49
3.3.7 Disease Scoring 50
3.4 Breeding for Resistance 51
3.5 Marker assisted Selection 54
3.6 Polymerase chain reaction 57
3.7 Statistical Analysis 57
4 RESULTS AND DISCUSSIONS 59
4.1 Reactions under natural conditions. 60
4.1.1 Arbitrary Sampling in Seven districts 60
ix
4.1.2 Disease prevalence on hot spots 64
4.1.3. Disease incidence on hot spots 65
4.1.4 Comparative varietals behavior at diverse locations 66
4.2 Comparative virulence of isolates 75
4.2.2 Comparative phenomenon of % incidence and CI 85
4.2.3 Relative proportional values under natural and
artificial environment
86
4.3 Transfer of resistance and trend of
susceptibility/Resistance in Filial generations
98
4.4 Effect of Severity on yield components of wheat 99
4.5 Marker Assisted Selection 110
SUMMARY 118
LITERATURE CITED 121
LIST OF TABLES
Table No. Page
1. Genotypes including commercial wheat cultivars and
advanced lines, tested for their susceptibility against
the artificial inoculation of karnal bunt of wheat
inoculum.
48
2. Disease rating scale to evaluate degree of incidence for
karnal bunt of wheat on 5 point symptom based
categories.
52
3. Relevant numeric values indicating each infection
category for calculating Co-efficient of infection.
52
4. Standardization of susceptibility category for
commercial cultivars/Lines, based on Co-efficient of
Infection.
53
5. . Detail of Crosses of all four Resistant and Four
Susceptible Cultivars/Lines on 8x8 full diallel fashion
55
6. Percent incidence of karnal bunt among seven
districts and range of infecting intensities for each, on
an average basis.
62
7. Details of sampling sites of disease hot spots with
cultivar sown. Average Disease incidence and range
of infection gives the comparison among various
locations.
71
8. Performance of selected high yielding commercial
cultivars against karnal bunt at identified hot spots in
all seven district under study, in Southern Punjab.
73
9. Analysis of Variance for Cultivar’s response in
different Districts at different locations of hot spots.
74
xi
10. Susceptibility category of each host lines including
commercial cultivars, based on coefficient of infection
when inoculated with mixture of isolates.
80
11. ANOVA expressing the significant variations among
isolates and genotypes as well as Genotype x Isolates
interactions.
87
12. Karnal bunt incidence with standard error of mean, on
different host lines of varying genetic potentials for
resistance aginst the disease.
88
13. Similarity Matrices in principle order, among the
genotypes resulted after screening against Karnal Bunt
of wheat.
91
14. Comparison of incidence of karnal bunt of wheat, for
physiological and morphological resistance, among
the genotypes of varying pedigree
96
15. Susceptibility categorization of various commercial
cultivars and advance wheat lines, on the basis of co-
efficient of infection.
97
16. Level of Susceptibility in Parents, F1 and F2 100
17. Mean values of severity and their effect on various
yield components in F1
103
18. ANOVA showing regression analysis for effect of
severity on Spike Length in F1
105
19. Mean values of % severity in Parents, Crosses and its
effect on yield components in F2
107
20. Parentage/Padegree of various accessions used in
screening as well as in hybridization process.
117
xii
LIST OF FIGURES
Figure No. Page
1. Spikes showing infection on grains within the infected
spikelets when inoculated at boot stage, with mixture of
fungal isolates collected from seven different regions.
63
2. Variations in Temperature regimes (°C) at Bahawal pur
Region during the months of February and march in crop
growth season 2007. Wheat crop under high temperature of
38 C 0 during march being non conducive to the flair up of
pathogen results less incidence under natural inoculatining
conditions.
67
3. Bars indicating the highest temperature of 40 °C during the
march 2008. thus the occurrence of karnal bunt under natural
field conditions remained in low intensities. While the low
temperature in February had not impact for the disease as the
crop stage did not reach at boot stage – suitable for the floral
infecting karnal bunt disease.
68
4. Bars indicating the highest ranges of temperature in the
month of march 2009, while lowest in the month of February
69
xiii
as the year had cool nights during the crop season. But due to
less showers in the month of March again the low incidence
of disease was observed.
5. Temperature range in March 2010 touched the peak of 39 °C
indicating the scenario of temperature regimes in all over the
Bahawalpur region of South Punjab.
70
6. Response of six commercial cultivars is shown at various locations. Punjnad-1 holds Susceptibility with it level at the least while manthar-03 shows maximum susceptibility. On the other hand, Bahawal Nagar and Rahim Yar Khan districts show the least epidemics as compared to Multan and Lodhran districts.
83
7. Susceptibility categories of various commercial
cultivars/lines when inoculated with mixture of isoltes.
PND-1, V03010, V032862, V056132 and Kiran show less
than 10% incidence, while WL-711 displays more than 60
% disease incidence.
84
8. Comparison of percent seed infected and extent of seed
colonization on each test genotype. Commercial cultivar
WL-711 is at its highest susceptible level comparing with the
PND-1 as highly resistant.
90
9. Series in rows showing the trend line indicating the
relationship between coefficient of infection and %
incidence. Regression equation expresses the multiple of x
value (% incidence as an independent variable) to yield the
seed colonization for calculation of susceptibility category.
93
xiv
10. Regression analysis of % disease incidence by mixture of
isolates and relative Coefficient of infection. Value of R2
shows moderate relationship among the both parameters.
94
11. Pertinent proportional rate of recurrence of % incidence Vs
CI. Susceptibility categories with CI less than 5, representing
the resistant genotypes.
95
12. Proportional values of incidence shown under natural and
simulated settings. Low level of incidence under natural
conditions reflects the morphological resistance as compared
to the high level incidence in artificial conditions showing
less physiological resistance in all 39 genotypes.
101
13. Level of % disease incidence in F1 and F2. Mean values
showing no significant difference among both generations
except one abrupt change in F2 due to segregation principle.
Stable trend for transfer of resistance traits is shown in the
figure.
102
14. Crossing block showing hybridization of various genetic
traits. Crosses were made among Resistant and susceptible
cultivars/lines on full diallel pattern.
106
15. Demonstrations of Partial dominance in Crop stand F1.
Inoculated Spikes don’t show sori of fungal black mass on
maturity.
109
16 Amplification Profile from agarose gel 2.5% representing the
products of Polymerase chain rection from DNAs of 39
different wheat accessions, with Primer Wgwm 538snpF1
(5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder 50
bp, Fermentas is represented with lane M. Bands in the lane
above and below demonstrate the tagging of susceptible and
resistant alleles respectively in genotypes 1-14 (Table 1).
112
17 Amplification Profile from agarose gel 2.5% representing
the products of Polymerase chain rection from DNAs of 39
113
xv
different wheat accessions, with Primer Wgwm 538snpF1
(5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder
50 bp, Fermentas is represented with lane M. Bands in the
lane above and below demonstrate the tagging of
susceptible and resistant alleles respectively in genotypes
15-29 (Table 1).
18 Amplification Profile from agarose gel 2.5% representing the
products of Polymerase chain rection from DNAs of 39
different wheat accessions, with Primer Wgwm 538snpF1
(5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder 50
bp, Fermentas is represented with lane M. Bands in the lane
above and below demonstrate the tagging of susceptible and
resistant alleles respectively in genotypes 30-39 (Table 1).
114
19 Aarose gel 2.5% representing the products of PCR from
DNA of 39 genotypes (Table 1). Bands in lower an above
lanes representing the tagginh of susceptible and resistant
geotypes respectively with primer Xgwm337-1D and Xgwm
637-4A. DNA Ladder 50 bp, Fermentas is represented with
lane M.
115
20 Products of PCR run on 2.5 % agarose gel from DNA of 39
Genotypes (Table 1) representing two groups with Xgwm-
337 primer. Arrow (from left to right) indicating bands for
susceptible and resistant genotypes respectively. Genotypes
in lane #1, 2, 5,9,13, 14, 15,16, 33, 38, and 39 were tagged
as susceptible against the karnal bunt of wheat.
116
xvi
ACKNOWLEDGEMENTS
All praises are for ALLAH Almighty, The Creator, who illuminated the human
soul with knowledge and wisdom. He is the only Who rules the world. All the
respects and the honors to The Holy Prophet Hazrat MUHAMMAD (Peace and
Blessings of ALLAH be upon Him); a brightening SUN for the path of faith and
knowledge, peace and endless bliss for the whole universe, who guided us to truth
and justice and enabled us to recognize our Creator and showed us the enlightened
path of Haqq.
I express my insightful gratitude to my venerable, affectionate, kind and
praiseworthy Supervisor Professor Dr. Irfan Ul-Haque, Chairman Department of
Plant Pathology, Pir Mehr Ali Shah Arid Agriculture University Rawalpindi, for
his supervision, encouragement, valuable suggestions, technical and moral support,
with out which, this task was quite impossible to have accomplished. His self-
disciplined personality, considerate ideologies and precious teachings during the
course of my studies are my belongings and chattels for the whole life.
xvii
I am also thankful to my committee members, Professor Dr. Abdul-Rauf,
Department of Plant Pathology, Pir Mehr Ali Shah Arid Agriculture University
Rawalpindi, Professor Dr. Muhammad Munir, Dean Faculty of Crop and Food
Sciences, Department of Plant Breeding and Genetics, Pir Mehr Ali Shah Arid
Agriculture University Rawalpindi and Dr. Lal Hussain Akhtar Guar Botanist
Agricultural Research Station Bahawalpur, for their help, continuous support, keen
interest and moral encouragement.
I am especially thankful to Dr. Armaghan Shahzad S.S.O, and Dr. Munir Ahmad
Assistant Professor, Department of Plant Breeding & Genetics for their
cooperation and technical support which contributed a lot for the completion of
molecular studies at NARC, Islamabad.
I would like to appreciate the role of my friends Ramzan Anser, Ghulam
Ahmad, Malik Faisal Abbas, Waqas and Sajid for encouraging and helping me at
every step in the process of completion of this difficult toil.
I am especially gratifying to Higher Education Commission – Islamabad
for providing me Scholarship and funds, under HEC Indigenous fellowship
scheme, to support my research work at NARC as well as in the field during the
course of my studies.
I have no words to express my feelings for my great Parents whose prayers
are now with me as assets in my life even now from their heavenly home.
(HAFIZ MUHAMMAD ZIAULLAH)
1
ABSTRACT
Wheat is staple food of inhabitants of the Indian subcontinent and is grown
all over the irrigated and rain fed areas of this region. This important crop is now
under the threat of Karnal bunt disease caused by Tilletia indica; a fungus of
basidiomycetes, that seriously affects the quality of the grains, by emitting fishy
odour of tri-methylamine which makes the flour quality unacceptable for human
consumption. Previously the disease was considered of minor importance and was
prevalent in the areas of low temperature and high humidity only, but now it has
got the status of emerging infectious quarantine disease in many parts of the world
including Pakistan.
Present studies were conducted to scrutinize the prevalence, infestation
level of the infection and identification of genetic sources resistant to Tilletia
indica pathogen. Studies were conducted in the wheat growing areas of the
Southern Punjab that is under dry hot climate. Seven districts viz. Khanewal,
Multan, Lodhran , Bahawalpur, Vehari, Bahawal Nagar and Rahim Yar Khan were
selected to evaluate the disease as well as genotypes potential regarding the disease
occurrence. During survey and monitoring of these localities forty nine hot spots of
the karnal bunt disease were identified. Six high yielding commercial varieties
were grown at these spots, out of which Punjnad-1 showed maximum capacity to
resist the disease pressure followed by Inqilab-91. while Manthar -03 and Uqab-
2000.
2
Results indicated that South Punjab is not free from Karnal Bunt infection.
Pathogen can survive in climate of high temperature and low humidity. No
commercial variety found to be immune to Karnal bunt infection; however
resistance against the disease exists in the wheat germplasm and expressed
obviously in the screening procedures. Out of 39 genotypes tested against the
disease, accessions and varieties namely INQ-91, FSD-85, V045006, V056007,
V056038, BWP-79, Sutluj-86, Shafaq-06,Uqab-2000, AS-2002, BK-2002,
Manthar-03, Lasani, Sahar-06,BWP-2000 remained moderately susceptible (MS)
and susceptible (S) while PND-1, Kiran, Fareed-06, exhibited resistant (R)
response against the disease. Diversified isolates of the pathogen collected from
seven different regions showed diverse virulence pattern on all different genotypes
and showed significant variability among them. Hybridization for transfer of this
resistance was also the focus of these studies. Crosses of the resistant and
susceptible genotypes yielded significant results of positive transfer of gene for
resistance in F1. Data taken from F1 and F2 illustrated the stable level of resistance
response in both the generations. Molecular studies were also conducted to verify
the presence of gene for resistance and susceptibility in various genotypes. SSR
primers Xgwm 538 snp showed efficacy to detect the resistance and susceptibility
up to 50 % and 100 % respectively in the test genotypes. Bands showing the
resistance and susceptibility pattern at 152 and 171 bp respectively in the same 39
test genotypes also were of the parallel consequences and match with the results as
were yielded in the field screening experiments. SSR primer Xwgm 337-1D had
the efficiency 84.61% to detect susceptibility in the test accessions, while to detect
resistance, it had efficacy up to 26.66 %.
3
Chapter 1
INTRODUCTION
Wheat, (Triticum aestivum L.) belonging to family Graminae (Poaceae)
commonly known as grass family, has been cultivated for at least 6000 years and is
the leading food grain of human beings, while animals use its straw as feed. It
plays a pivotal role in the agricultural strategies and policies. Wheat is of two types
according to its habitat. On a very limited area, winter wheat is cultivated which
gives maximum tillers and takes long period to mature while spring wheat is
cultivated in hot climate areas where it matures earlier and spares the land for the
next crop.
Because of its increasing demand, the anticipated global wheat requirement
at the end of second decade of 20th century varies from 840 (Rosegrant et al.,
1995) to 1,050 million tons (Kronstad, 1998). To accomplish the projected target,
world's wheat production will have to enhance from 1.6 to 2.6 percent, annually
(Rajaram, 1999). Accordingly, the average global grain yield would have to
enhance from the existing 2.5 t ha-1 to 3.8 t ha-1. Only 18 countries in the world
meet target of producing average wheat grain yields of around 3.8 t ha-1 in 1995
whereby most of which are located in the Northern Europe (CIMMYT, 1996).
Of the worldwide 215 million hectares sown to hexaploid (Triticum
aestivum) and tetraploid (T. turgidum var. durum) wheat, 95 million hectares (44
percent) is in Asia and out of which, 62 million hectares attributed to wheat are
located in China, India, and Pakistan (Singh et al., 2004b). Despite of such a vast
area under the golden grains production, the food security as well as production
4
stability are of paramount significance in most of the Asian countries as the
majority of farmers are resource poor.
The global location of Pakistan is in south-west Asia and its neighboring
countries are Iran, Afghanistan, China and India. The federal capital of Islamabad
is a unity symbol of its four provinces: Sindh, Punjab, Khyber Pakhtoon khwa and
Baluchistan. Pakistan engages a strategic position between Southern Asia and the
Middle East. Four mountain ranges as the Karakorams, the Pamirs, the Himalayas
and the Hindu Kush join within its jurisdictions (WCMC, 1991). Nature has
blessed Pakistan with a blend of climatic conditions and diversified land including
mountains, forests, deserts and the fertile plains. It experiences the most extreme
temperatures on the globe ranging from 50 °C in the Sindh region during summers
to minus 50°C in the northern mountain ranges in winters.
Being an important crop of the zone, sown in the months of November-
December and harvested in April having short statured, early maturing attributes,
spares the field for the next crop in the of April i.e. much earlier of the onset of
rainy season which results in least favorable environmental settings for the
pervasiveness of the plant pathogens. Irrigated plan lands of South Punjab
(Pakistan) are the sub tropical warm areas of the country with high temperature and
low humidity.
Yield and production constraints are associated with several biotic and
abiotic stresses. This has gained grounds for changing the prior trends set for the
teliospores epidemiology. Environmental fluctuations support the surveillance and
prevalence of pathogen of karnal bunt of wheat. Dry and arid zone of the south
Punjab differing not distinctly with their temperature regimes, have been proving
5
equally a substrate for the Tilletia indica inoculum. Extensive studies at some
department level, on this disease is direly needed, in these wheat growing areas.
However individual efforts by some workers reflects the alarming situations of
threatening increase in the incidence level
of karnal bunt of wheat in almost all cultivated varieties of bread wheat grown in
these districts. Studies on the basis of intensity level and extent of damage caused
bt karnal bunt has become a question. Existence of differential pathogenic
virulences among the various isolates of Tilletia indica in wheat growing areas of
South Punjab and to determine host- pathogen interaction with the advanced
cultivars of bread wheat is also an issue of the day.
1.1 Tilletia indica and Wheat
Common wheat [Triticum aestivum (2n = 6x = 42)] is an allohexaploid
comprising three distinct genomic complements namely A, B and D, with the
genomic structure AABBDD. Limiting wheat production constraints are associated
with several biotic and abiotic stresses. Increased yield with disease resistance is
the ultimate goal of plant breeding. Because of crucial importance of wheat crop,
Karnal Bunt caused by Tilletia indica (Mitra), a disease of wheat and triticale with
high focus of economic significance, attracts the attention of the researchers. The
disease was first reported from the former state of Karnal, India in 1930 (Mitra
.(1931). Tilletia indica Mitra [syn. Neovossia indica (Mitra) Mundkur] is a
basidiomycetous fungus causing this disease in several countries, including India,
Mexico, Pakistan, Nepal, Iraq, and Afghanistan (Singh et al. 1989; Warham.
1986).
6
1.2 Prevalence and nature of Pathogen
Prevalence of karnal bunt in wheat seed lots were tested in Pakistan to
assess the incidence of Karnal bunt (Tilletia indica) using the dry inspection
method from 1993/94 to 1996/97. Out of 730 wheat seed samples, high infection
percentage (3%) of karnal bunt in various seed lots was found in Central Punjab
and northwest areas of
Pakistan. Southern parts of the country were found free from Tilletia indica.
Incidence of Karnal bunt showed a descending trend (up to 0.5%) at the country
level (Bhutta et al., 1999). Previously it has been known to occur in 1950 in the
areas of Sialkot district in (Saleem and Akhtar, 1988) and during the year 1986-87,
it attacked many parts of the Punjab, where the seed samples received from
different seventeen districts showed incidence up to 37% ( Ilyas et al.,1989). An
extensive survey of seed sampling was done during the crop season 2003-04 from
the various localities of Punjab and Khyber Pakhtoon Khwa by Mirza (2005). Two
hundred and fifty four samples were collected from Punjab and 96 samples from
Khyber Pakhtoon Khwa province. According to this report, almost all cultivars
grown in the areas were susceptible to the disease. All seed samples received from
districts Gujranwala, Sialkot, Pakpatan Sharif, Faisalabad, Rawalpindi, Kasur,
Okara and Khushab were infected with disease spores of karnal bunt ranging
between 32.14%-83.33%.
During a survey of 78 localities in the NWFP (now Khyber Pakhtoon khwa,
Pakistan) in year 2002, the highest disease incidence up to 46.0% was observed on
WL-711 grown in Hathion, Disease incidence was also recorded for Pak-81 (0.47-
7
6.32%) and Pirsabak-85 (0.41-5.57%) while district wise incidence wasobserved as
Mangora (2.53-23.42%), Mardan (0.41-46.00%), Malakand (6.32%), and Swabi
(0.54-5.85%). Wheat-growing areas in Manshera (0.42-1.04%), Peshawar (0.64-
2.36%), Abbottabad (0.00-1.37%). Its incidence was low to medium (0.00-1.25%)
in northern areas of district Attock (Ehsan-Ul-Haq et al.,2002).
The first report of Karnal bunt from a non-Asian country came from
Mexico in 1972. Several very dubious distribution records have been published by
various
authors and institutions, giving Lebanon, Sweden, Syria and Turkey as countries
where the fungus has been recorded. However, these records were based on
intercepted wheat consignments and have not been confirmed by the countries or
by a screening survey of the International Center for Agricultural Research in the
Dry Areas (ICARDA) on wheat germplasm from the Middle East (Diekmann,
1987). Very recently, isolated outbreaks have been found in southwestern USA.
However the Italian Emmer wheat (Triticum dicoccoides) accessions show various
degree of infection ranging from 5.4-75.0 % (Riccioni et al.,2006).
The fungus T. indica spreads through seed and survives on seed as well as
in the soil. Spores of the fungus remain viable in the soil for many years. It is
almost not possible to eliminate the disease from the field where it has been once
introduced. However in some cases disease can be reduced by keeping the fields
free from wheat for a period of two years. Fungus has its infectivity both on durum
wheat and bread wheat when climatic condition favors the contract of the disease.
8
Fungus germinates its teliospores at flowering stage of crop development when
temperature ranges normally between 20 Co and 25 Co and produces promycelium
bearing sickle-shaped primary sporidia in abundance. Later on these primary
sporidia develop protuberances to produce secondary sporidia (Krishna and Singh,
1982). There are two types of sporidia produced i.e. filiform and allantoid. Only
allantoid sporidia are considered capable of causing disease. Wind or the rain
splashes help to move sporidia on to the growing wheat spikes in the standing crop
where they develop a germ tube from the secondary sporidia that ultimately grows
and enter in the natural openings of the palea, lemma and glumes of the ear heads.
Intercellular growth of
hyphae starts with in these parts and enters in to the ovary. This infection as a
result leads to the infection on developing kernel but normally remains confined to
the pericarp (Goates, 1988).
Karnal bunt of wheat is favored by relatively low temperatures and
triggered with high humidity especially light showers at the time of flowering.
Favorable climatic conditions play a significant role in the disease epidemics.
Ranges of high temperatures, dry spans and intense sun shines are unfavorable
factors in the development of the disease. Seed borne and soil borne infection
usually becomes as an initiative in the disease epidemics. In addition to soil borne
and seed borne infection, infective secondary sporidia can grow and proliferate
over the surfaces of the glumes and leaves in resistant varieties. This phenomenon
provides an abundance of inoculum for air borne infection (Dhaliwal, 1989).
9
1. 3 Losses caused by karnal Bunt of wheat
Disease losses due to K. bunt is not in term of yield technically due to being slight,
but it does have serious impact on the international market as causing severe
damage to the wheat quality wherever wheat is grown. Attack of pathogen causes
reduction in the flour quality mainly, along with loss in viability of seed , and also
the crop grains weight is affected (Singh et al, 1990). In case of more than three
percent infection, a foul fishy smell emits from infected wheat grains on account of
presence of chemical trimethylamine due to which produce becomes undesirable
for human consumption (Mehdi et al., 1973). Fungus prevails as soil borne as well
as seed borne and permits no effective chemical treatment (Warham, 1986).
The disease is regarded as being of quarantine significance, ban and check
of imports/shipments of wheat infected with karnal bunt thus results across the
borders especially from quarantined areas. Presence of teliospores on wheat seeds
provides the basis for the detection of Karnal bunt. For the accurate and reliable
detection, molecular techniques are the most useful procedures for diagnosis and
identification. Molecular methods based on DNA analysis have provided very
useful information for species identification of plant pathogens.
In the recent years efforts have been made for analysis of virulence and
various approaches of molecular studies have facilitated the analysis and
identification procedures of this pathogen of very imperative nature. Species-
specific PCR primers being highly sensitive and accusative one, are providing
valuable information regarding the detection and identification of the T. indica as
of (Bansal et al., 1983; Chahal, 1993; Goates , 1988).
10
1.4 Screening and Breeding for Resistance
In Pakistan wheat varieties/lines are being tested in a continuous program of
evaluation and screening against the karnal bunt pathogen in various institutes and
no variety /line has yet could be declared immune or free from the disease under
the maximum pressure of inoculum.
Continuous working over three years on screening for karnal bunt resulted
different genotypes with their greater potential to resist the disease including paul#
14106,14178, 14195,14130, 14245 and 14095 while some others pau #
14249,14228,14160, and 14091 proved to be with moderate capacities to resist the
inoculum stress of karnal bunt (Chhuneja et al. 2008). Work on the development
of spring-type synthetic hexaploid (SH) wheat germplasm lines and spring-type
bread wheat (Triticum aestivum) germplasm lines with karnal bunt (Tilletia indica)
resistance has been done through Wide Cross Program of the International Maize
and Wheat Improvement Center in Mexico by Mujeeb-Kazi et al. (2001).
The synthetic germplasm enables incorporation of the genetic diversity of
Triticum turgidum cultivars together with the attributes of the Aegilops tauschii
accessions. SH wheats were earlier identified with highly resistant response. These
SHs have unique Ae. tauschii accessions as parents. The resistance exhibited by
SH wheats has been transferred into elite but KB vulnerable bread wheat cultivars
thus generating a new and unique genetic resource that can be readily exploited by
conventional breeding programs (Mujeeb-Kazi et al., 2006).
11
In Pakistan during the crop seasons 2004-05 and 2005-06, official and unofficial
reports about the incidence of the karnal bunt on shafaq, inqilab-91 and Iqbal -
2000 from some districts of southern Punjab have been on the scene.
Extensive studies are yet needed to observe the incidence, severity and variability
of the karnal bunt pathogen in the country. The range of temperature and humidity
varies from the coastal areas of the Sindh up to the hilly areas of Kashmir and
Khyber Pakhtoon khwa (K.P.K) thus provides a multi selective option for the
disease prevalence in Pakistan. Studies regarding the Karnal bunt incidence in
Southern Punjab that contributes more than 40% of the total wheat production are
still lacking.
1.5 Objectives of the Research
The occurrence of the disease in different districts of the Southern Punjab
(Pakistan) is an issue yet to be studied on continuous basis by an institute or on
organizational level. High yielding bread wheat cultivars are sown in this region.
Response for resistance or susceptibility of these cultivars both morphologically
and physiologically is of great importance for the breeders to identify the sources
of resistance. Pattern for transfer of resistance in the next filial generation gives the
direction to plan the studies on particular linings towards a targeted approach.
Keeping in view of the above requirements, the objectives of our studies are being
summarized as under.
To observe the severity of the disease in different areas by survey.
12
To identify the genetic sources resistant and susceptible to Karnal
Bunt disease.
Transfer of these resistant genes to the next generations for yielding
the resistant genotypes for further breeding studies.
13
Chapter 2
REVIEW OF LITERATURE
Wheat (Triticum aestivum L.) is cultivated as irrigated as well as rainfed
crop in all over the Pakistan. Areas of southern belt broadly comes under the crop
rotations with inclusion of wheat as mandatory crop. Among other wheat diseases
like wheat rust Wheat grain is a staple food used to make flour for bakery items
namely fruit cakes, chips, sand witches, cereals biscuits, bread patties, noodles ,
fast foods, and for fermentation to make products. Wheat products are the principle
cereal foods, forage and fodder crop of livestock’s, dairy animals, horses and other
animals. More over, its by-broductsits ie wheat chaff etc are also used as sheltering
materials in the villages as well as in buildings constructions. It takes up the land
mark status in Pakistan economics. Diseases are the major threat to the yield and
quality of wheat crop in Pakistan. Among which this bunt disease of wheat
extensively reviewed by various researchers as under:
To study on the causal agent of partial bunt in Iran (Jafari et al.,1999)
reported morphological and some physiological characteristics of Tilletia indica,
the causal agent of partial bunt (karnal bunt) in wheat. In 1996, several infected
seed samples were collected from the infected areas. Teliospores were isolated
from affected wheat seeds and purified on acidified PDA. Selected scanning
electron micrographs were taken and morphological characters were determined.
Teliospores in mass appeared dark in colour, but individually were brownish,
spherical and oblong to ellipsoidal with warted walls. Teliospore diameter ranged
from 27.5 to 47 micro m with average of 35.3 micro m. Sterile spores were yellow
14
to yellowish-brown and rarely hyaline with smooth walls. Primary and secondary
sporidial length of various isolates ranged on an average from 67.3 to 68 and 12.5
to 13.1 micro m, respectively. Despite some minor differences, the results of this
investigation and those of Indian and Mexican isolates (Fuentes-Dávila et al.,
1995; Singh et al.,1995a, 1995b) were similar.
Modes of teliospore germination and its promycelial morphology were
independent of isolates and their sources of geographic origins, but affected by
various culture media, physical location of germinating teliospores, light and
temperature. Soil extract and additional sucrose and dextrose in the medium (water
agar) stimulated teliospore germination. Intensity and duration of light as well as
nature of culture media also had profound effects on the growth and formation of
secondary sporidia.
2.1 Survey, Monitoring and geographical distribution
Prevalence of Tilletia indica,, the causal agent of karnal bunt of wheat was
studied (Ehsan-Ul-Haq et al., 2002) at 78 localities in Khyber Pakhtoon khaw; the
then Northern Western Frontier Province (Pakistan) .The highest disease incidence
was observed on cv. WL-711, Pak-81, and Pirsabak-85, ranging between 0.64-
46.0%. This was studied in the districts of Hathion, Mangora, Mardan, Malakand
and in Swabi. Wheat-growing areas in Manshera, Peshawar, Abbottabad , and
Attock had low to medium disease incidence. While in Southern Punjab, the zone
declared as free from karnal bunt, has now been reported under the attack of
pathogen. Analysis of the seed samples collected from various stores, agricultural
15
farms, farmers fields, and extension workers of the districts of Multan, Khanewal,
Muzaffer garh, Kot ado, Layyah, Dera Ghazi khan, etc gave the incidence up to
40% on percent incidence basis (Shakoor et al., 2008). However the level of
infection according to the susceptibility category was in lower trends as compared
to the infections levels reported in Northern Punjab and areas of Kayber Pahktoon
Khwa.
Javaid and Tehmina (2005) worked on the reviews of the common diseases
of wheat (Triticum aestivum) in Pakistan as well as the methods for their control.
They reported that approximately 50 diseases of wheat are known to occur in
Pakistan, of which karnal bunt (Tilletia indica) is economically an important
disease. They suggested diseases control by cultivating resistant species, using
chemicals and adopting cultural practices.
Another effort to highlight the status of different grain markets of Punjab State
(India) with regards to Karnal bunt [Tilletia indica] was made by Indu-Sharma et
al. (2004) Less affected areas during the years (1994-2004) from where wheat may
be procured for export either by segregation at the grain market level or by contract
farming were identified. They concluded that year to year variations occurs in the
disease as it was evident from the percent KB-free samples they recorded in
different years.
In USA, studies on the monitoring during the year 1996 were carried out by
Marshall et al. (2003) to detect the invasion pathways of Karnal bunt of wheat. The
seed lots of infected samples associated with the initial detection were traced to
plant fields in California, Arizona, New Mexico, and Texas. They reported that all
16
interceptions (98.8%) were made on wheat transported at land border crossings.
They were of the view that Karnal bunt has probably arrived in the United States
on many occasions, at least since 1984. Because of the relatively unaggressive
nature of the disease and its reliance on rather exacting weather conditions for
infection, they surmised that it is possible this disease had properties of long
lasting survival range in the soil rhizospheres between the period of its primary
incumbent and becoming to a prosperous flared up epidemics.
Another study on the incidence of karnal bunt caused by Tilletia indica in
1025 seed samples of 15 wheat cultivars from major wheat growing areas in India
was carried out by Varshney et al. (2004). Certified seeds were rejected due to
karnal bunt, and the number of rejected seeds varied from seed lot to seed lot of the
same cultivar. The rejection for cv. HD-2009 was 0.25% in 1995-96, but was
100% in cv. HS-240 in the same year.
Studies to determine the occurrence of Karnal bunt (Tilletia indica) on
wheat grain samples were made by Singh et al. (2001) from different markets in
Punjab (India). From a total of 552 samples collected, 42.7% samples were
affected by Karnal bunt. The maximum bunted samples were found in Faridkot
district where the prevalence of the disease was 92.8%, whereas the minimum
prevalence of bunt was 3.4% in Amritsar district. The overall disease incidence in
Punjab was 0.24%. The disease incidence ranged from 0.002% in Kapurthala
district to 1.34% in Ropar district. The samples from Ropar (2.53% incidence) and
Sangrur (2.13% incidence) revealed the endemic occurrence of the disease in
certain areas of Punjab. Wheat cv. HD 2329 showed higher susceptibility to Karnal
17
bunt compared to cv. PBW 343, which occupies the maximum area in Punjab. The
prevalence and incidence of the disease were 53.6 and 0.36%, respectively, on HD
2329, and 35.8 and 0.20%, respectively, on PBW 343. The survey also indicated
the existence of low bunt areas in Punjab.
2.2. Screening against karnal bunt of wheat
Ahmad et al. (1999) worked on the evaluation of different wheat accessions
including commercial varieties and advance lines for studying the potential against
karnal bunt. 141 wheat varieties/lines were evaluated at the Wheat Research
Institute; Ayub Agricultural Research Institute, Faisalabad (Pakistan) during the
year1993-94. Four (4) lines, T-91731, T-911734, T-91736 and T-91740, remained
free from karnal bunt infection caused by Neovossia indica [Tilletia indica]. T-
92733, T-91729 and D-91690 were moderately resistant while 51 showed a
moderately susceptible response. Thirty nine lines were susceptible and 44 highly
susceptible. The results indicated the scarcity of resistance in most of the lines
against karnal bunt disease.
Sidhu et al. (2001) screened some 17 wheat-rye disomic (1R, 2R, 3R, 4R,
5R, 6R, and 7R) and ditelocentric (1RS, 2RL, 3RS, 4RS, 4RL, 5RS, 5RL, 6RL,
7RS, and 7RL) addition lines, along with their parents (Chinese Spring wheat and
Imperial rye), for resistance to karnal bunt (caused by Tilletia indica syn.
Neovossia indica) induced by inoculation of spore suspension from 1998-99 to
2000-2001. Significant genetic variation in grain infection was observed. Grain
18
infection ranged from 2.98 to 18.80% in disomic addition lines and from 6.37 to
20.06% in ditelosomic addition lines. The addition lines RAL-4 and RAL-5, as
well as their short arms and the long arm of rye chromosome 7, had low percentage
of grain infection, indicating that these genotypes possessed Karnal bunt resistant
genes.
In an experiment conducted by Riccioni et al.(2008), European wheat
varieties were tested for their susceptibility to karnal bunt under quarantine
containments. In this study spring wheat (Triticum aestivum), winter and durum
wheat (Triticum durum) were tested for their physiological susceptibility by
inoculating them at boot stage prior to the ear emergence. These selected
accessions were then retested by spray inoculation to determine their
morphological susceptibility. This becomes the good indicator to detect the
resistance of a particular cultivar in the field. After harvesting, the spikes and
grains were assessed for their resistance. Winter wheat cultivars were infected
ranging up to 32%, spring cultivars up 48% and for durum wheat varieties the
infection in the grains ranged up to 2-95%. Universally approved pattern of
categorization for testing the karnal bunt incidence was adopted in this experiment.
On basis of which it was assessed that in all tested cultivars, three were
susceptible, eleven showed moderately resistant response, twenty cultivars as
resistant while the six varieties responded as highly resistant reaction. Spray
inoculation also yielded susceptible reaction but in lower ranges indicating the
susceptibility under field condition. This all clearly revealed that karnal bunt can
prevail and persist in the cultivar of European wheat if introduced in the tract.
19
.
Double haploid wheat production and screening for resistance to karnal bunt in
vitro conditions was studied by Singh et al. (2002). Two Karnal bunt (Tilletia
indica) susceptible wheat varieties, viz. UP2338 and WH533, were crossed with
two Karnal bunt tolerant varieties, viz. HD2285 and PBW343. Resultant F1 were
crossed with different maize lines (Prabhat, Vijay, and accessions 803, 1344, 645,
and 1040 as pollinators) and embryos were rescued between 13 to 16 days post-
pollination. To enhance embryo survival, 2, 4-D+GA3 solution was injected into
the upper node and applied to florets. Rescued embryos were cultured on
Murashige and Skoog's (MS) medium containing 5 mg 2, 4-D/litre. The calluses as
well as the callus-regenerated haploid plantlets were screened in vitro at the
threshold concentration of culture filtrate. The resistant haploid calluses and
plantlets were selected and plated on colchicine mediated MS medium for doubling
their chromosomes and production of Karnal bunt resistant doubled haploids.
Kaur and Nanda, (2002) studied wheat genotypes WL 711, WL 1562, HD
2329, PBW 343, PBW 396 and WH 542 along with resistant genotype HD 29 for
susceptibility to Karnal bunt (Tilletia indica) during 1995-2002. Using boot
injection technique, inoculation was done to the genotypes on daily basis. Results
showed that WL 711 was the most susceptible to disease.
2.3. Qualitative and quantitative losses.
20
Nutrient composition in bunted wheat (infected by Tilletia indica) differs
from that of healthy grains were studied by Shramabharati et al. (2001).
Carbohydrate content varied from 60.25 to 71.20% in different grades of infection.
Highest carbohydrate contents were recorded from healthy wheat seeds and lowest
content was recorded in the high-infection category. Protein content ranged from
11.80-14.69%. Maximum protein contents were observed in the high-infection
category and lowest in low-infection category.
The effects of Karnal bunt pathogen yield components, germination
potentials and tillering capacities of wheat were studied by Jatav et al. (2003).
Several infected seeds did not germinate due to the complete loss of embryo,
whereas point infected seeds germinated and produced tillers. In 1999/2000,
2000/2001 and 2001/2002, the rate of germination of infected seeds was 91, 88 and
90%, respectively (compared to 96, 95 and 95% in healthy seeds); Point infection
of seeds reduced tillering by 29.17, 30.00 and 29.42%, and yields by an average of
55.2, 56.6 and 53.8%, respectively. The reduction in yield was due to the decreased
size of ear heads and seeds, and death of tillers before producing ear heads. The
point infected seeds exhibited germination greater than the minimum prescribed
level; however, these seeds should not be used for sowing because the pathogen,
introduced into the field via infected seeds, may remain viable in the soil for
several years and may provide the inoculum to cause infection in the subsequent
years.
2.4. Inoculation and Culture Viability
21
Inoculation methods for testing wheat resistance to T. indica were
evaluated by Beniwal et al. (2001). Boot inoculation at the boot stage was the most
effective method, with 47.56% infected grain and 29.5% coefficient of infection.
Disease development was least with spray inoculation at full ear head emergence.
Of 50 wheat cultivars and genotypes evaluated, 6 bread wheat entries were highly
resistant, while 2 durum and 4 triticale varieties/genotypes were completely free
from infection. Triticale had the greatest resistance followed by durum and bread
wheat.
Thinggaard and Leth (2003) developed a vital staining method using the
fluorochrome acridine orange (AO) for staining teliospores and primary sporidia
(basidiospores) of T. indica the causal agent of Karnal bunt of wheat. This
procedure allowed determination of the viability of teliospores in soil. The method
also made it possible to monitor germination of teliospores in different soil types
and soil moisture levels. The primary sporidia produced from germinated
teliospores could be easily detected in small soil samples (10 g). The AO
procedure, as a supplement to the quarantine inspection of seed lots, could be used
for routine testing of the viability of teliospores of T. indica extracted from seed
lots.
The teliospore viability was drastically reduced after 6 years of their burial
in the field and soil solarization for 3-4 weeks in the months of May and June as
reported by Indu-Sharma and Nanda (2002). Deep seated teliospores in the soil
which get mixed up during the year of harvesting have insignificant role in the
disease in the crop season to follow but subsequently the teliospores survive and
22
play important role in the disease epidemiology, as the secondary sporidia are only
virulent in spreading the disease instead of primary sporidia. They found if
commended provided with adequate humidity, the teliospores may germinate from
2nd week of October to 3rd week of March under field conditions. Stimulation in
germination of teliospores was recorded after 6 hrs exposure to UV radiation, dry
heating at 90 degrees C for 30 min., shock treatment at freezing and boiling
temperatures for 5 min., presoaking in N/10 HCl followed by in N/10 Na2HCO3,
N/20 NaCl, CaCl2 and KCl. The teliospores did not germinate after cooking
(Chapati and Dalia making), at a constant temperature of 35 degrees C in distilled
water and dry heating at 140 degrees C for 10 min.
The survival of the teliospores of the Karnal bunt of wheat pathogen,
Tilletia indica, was determined by Bonde et al. (2004) in field plots in Arizona,
USA. One method determined the total number of viable teliospores in a soil
sample. The total number of viable teliospores declined over time in both irrigated
and non irrigated field plots and in the same soils in the laboratory. They observed
that the total number of viable teliospores decreased from 55.7% at time zero to 9.7
and 6.7% for non-irrigated and irrigated field soils, respectively, in 48 months. The
total number of viable teliospores from the soil in the laboratory decreased from
55.7 to 34.0% after 48 months. The second method determined the germination
percentages of teliospores extracted from the soil samples by means of a sucrose
centrifugation technique. The rate of decrease in germination was significantly
greater in teliospores from irrigated field plots than from non-irrigated plots and
the laboratory soil. At time zero, 55.7% of teliospores were germinated, and by 48
months, the average germination of teliospores extracted from the soil in non-
23
irrigated plots decreased to 13.6% compared to 4.4% in irrigated plots and 36.8%
for teliospores in the laboratory. Neither field site nor soil depth had any effect on
the total number of viable teliospores or on teliospore germination percentages.
In another experiment Bonde et al. (2004) determined the potential for T.
indica, the causal agent of Karnal bunt in wheat, to survive and become established
in new areas, a teliospore longevity study was initiated in Kansas, Maryland,
Georgia, and Arizona, USA. Soil from each location was infested with T. indica
teliospores and placed in polyester mesh bags. The bags were placed within the
soil from the same location within polyvinyl chloride pipes. The pipes were buried
in the respective plots such that the bags were at 5-, 10- and 25-cm depths. Each
pipe was open at the ends to allow interaction with the outside environment,
however fitted with screens to prevent the possibility of teliospore escape. In the
Karnal bunt-quarantine area, bags of infested soil were also placed outside the
pipes. Teliospore-infested soil from each location was maintained dry in the
laboratory. During the first 2 years, the viability of the teliospores declined more
rapidly in the pipes than outside the pipes, and more rapidly in fields. After 2
years, viability declined nearly equally. In the laboratory over 3 years, viability
decreased significantly more rapidly in dry soil than in wet soil while pure
teliospores remained unchanged. We hypothesized that soils, irrespective of
weather, affect teliospore longevity.
2.5. Sources of resistance
24
Mujeeb-Kazi et al. (2001) developed ten spring-type synthetic hexaploid
(SH) wheat germplasm lines and six spring-type bread wheat (Triticum aestivum)
germplasm lines with karnal bunt (Neovossia indica syn. Tilletia indica) resistance
by the Wide Cross Program of the International Maize and Wheat Improvement
Center in Mexico. The SH lines were derived from T. turgidum s.l./Aegilops
tauschii crosses, and designated CIGM93.183, CIGM87.2765, CIGM87.2767,
CIGM90.561, CIGM88.1239, CIGM88.1344, CIGM92.1727, CIGM90.845,
CIGM90.846 and CIGM90.590 (Reg. no. GP-695 to GP-704, PI 613302 to PI
613311). The bread wheat lines are CIGM90.257-1, CIGM91.61-1, CIGM90.462,
CIGM90.248-1, CIGM90.250-2, CIGM90.412 (Reg. no. GP-705 to GP-710, PI
613312 to PI 613317). The durum wheat in the pedigrees of the immune SH
germplasms registered demonstrated infection intensities up to 1.6 percent.
Singh et al. (2003) obtained resistant sources of wheat from Advanced
varietals Trials and other sources like CIMMYT were tested at hot spot
multilocations and under artificially inoculated and favorable conditions for Karnal
bunt (Tilletia indica) development during 1990/91-1993/94 in Indian Punjab,
Himachal Pradesh, Haryana, New Delhi and Uttar Pradesh, India. Of the 66
entries, 18 were resistant lines, namely HD 29, HD 30, HD 2385, RAJ 2296, WL
1786, WL 6975, WL 7247, HW 502, PBW 34, PBW 225, W 285, W 382, W 388,
W 485, DWL 5010, ND 589, ND 602 and HP 1531. PBW 34 and PBW 225 are
released varieties. Nineteen lines received from CIMMYT were also resistant to
Karnal bunt. HD 29 and HD 30 have already been registered by the National
Bureau of Plant Genetic Resources, New Delhi, as INGR 99012 and 99011,
respectively.
25
2.6 Inheritance of resistance
Mujeeb-Kazi et al. (2008) reported that Aegilops tauschii (syn. Triticum
tauschii (Coss.) Schmalh., syn. Ae. squarrosa auct. Non L., 2n=2x=14, DD
genome), with its numerous accessions and wide distribution, provided
unparalleled genetic diversity for addressing global wheat production constraints
through genetic improvement. Their hybridisation efforts produced 1014 synthetic
hexaploid combinations (2n=6x=42, AABBDD), resulting from chromosome
doubling of the F1 hybrids between elite Triticum turgidum L. s. lat. cultivars and
Ae. tauschii accessions. The extensive production of synthetic hexaploids
represents a step-wise progression over 2 decades in the generation of a valuable
resource of user-friendly genetic diversity. Abundant synthetic hexaploids with
different Ae. tauschii accessions have been identified from their screening.
Mujeeb-Kazi et al. (2006) carried out studies on generations from crosses
durum wheat x Aegilops tauschii and derivatives of SH x bread wheat for the test
of karnal bunt resistance in SH (synthetic hexaploid). by applying the method of
bridge crosses utilizing the D genome synthetic hexaploids (SH). They utilized
Triticum turgidum /Aegilops tauschii (2n=6x=42, AABBDD), as a potent means of
improving bread wheat (T. aestivum) for biotic and abiotic stresses. The synthetic
germplasm enables incorporation of the genetic diversity of T. turgidum cultivars
together with the attributes of the Ae. tauschii accessions. In this research, SH
wheats were screened for karnal bunt in Obregon, Mexico over six crop cycles and
several SHs were earlier identified with an immune response. These SHs have
26
unique Ae. tauschii accessions as parents. The resistance exhibited by SH wheat
has been transferred into advance cultivars which were susceptible to KB thus
generating a new and unique genetic resource that can be readily exploited by
conventional breeding programs.
Inheritance of Karnal bunt-free trait in bread wheat was studied by Sharma
et al. (2004) by obtaining a karnal bunt (KB)-free wheat stock ('KBRL22') from a
cross of two resistant lines ('HD29' and 'W485').This KB free wheat stock was
used as a donor to introgress the KB-free trait into 'PBW343' (an 'Attila' sib), the
most widely grown wheat cultivar in India. The number of KB-free and KB-
affected plants in BC1, BC2, BC3 and BC4 as well the F2 was recorded after
artificial inoculations. The segregation pattern in these generations clearly
indicated two independently segregating, dominant genes which jointly confer the
KB-free attribute. The importance of the KB-free line generated in this experiment
is discussed.
Monika et al. (2001) studied the inheritance of resistance in bread wheat
(Triticum aestivum) against partial bunt or KB disease (Tilletia indica) using an
11-parent diallel analysis excluding reciprocals. These parents comprised eight
resistant (ALDAN, HD 29, W 485, H 567.71, WL 6975, HP 1531, CPAN 3045,
and CMH 77.308) and three susceptible (WH 542, UP 2382, and PBW 343)
cultivars. Disease severity was scored using two methods, namely, Karnal bunt
27
percent infection (PI) and Karnal bunt score (i.e. coefficient of infection or CI).
Additive gene action as a mandatory factor was observed, of crucial significance in
the genetic control of Karnal bunt percent infection, whereas the dominance gene
action was pronounced for coefficient of infection. The variance due to specific
combining ability (SCA) and general combining ability (GCA) effects for both
characters was significant.
Evaluation of resistance of some advanced cultivars/lines of wheat to Tilletia
indica, the causal organism of Karnal bunt was investigated by Jafari et al. (2000)
by inoculating Spikes of 26 wheat advanced cultivars/lines with a suspension of
secondary sporidia of Tilletia indica at booting stage by injection method.
Percentage of infected grains and coefficient of infection for each entry were
assessed in matured spikes and they were categorized in to four classes according
to their responses to the disease. Not a single entry was completely resistant to the
disease and most of them were susceptible. Cultivars Pastour, N-75-3 and N-75-5
were partially resistant. Darab-2 with coefficient of infection 44.1 and 68.1% of
infected grains was the most susceptible cultivar, Atrak and Niknejad very
susceptible and Falat susceptible. A significant correlation was found between
coefficient of infection and percentage of infected grain for each entry and the
regression model was calculated.
Monika et al. (2004) in another experiment divided the whole range of
Karnal bunt (Tilletia indica, syn. Neovossia indica) infection into 4 categories, i.e.
0-5, 5-10, 10-15 and >15% as resistant, moderately resistant, susceptible and
28
highly susceptible classes, respectively. According to them, results based on bread
wheat plants falling into different infection groups in P1, P2, F1 and F2 for the
crosses R x R, R x S and S x S revealed that the resistance was partially dominant.
In the present study, 2 dominant genes/gene groups were speculated in the resistant
lines and it was concluded that HD29, W485, H567.71, HP1531 and CMH77.308
constituted the resistant group and WH542, UP2382 and PBW343 constituted the
susceptible group. The cultivar ALDAN possessed some minor susceptibility
genes whereas WL6975 and CPAN3045 expressed differently in different genetic
backgrounds and showed a variable segregation behavior.
Kumar et al. (2002) excised embryos from seeds of six generations (P1, P2, F1,
BC1, BC2 and F2) of a wheat cross HD29 x HD2329 were cultured on modified
MS medium in petriplates already inoculated with secondary sporidia of Karnal
bunt of wheat (Neovossia indica [Tilletia indica]). Significant variation for
callusing response (CR) (45.55-76.66%) was observed among generations.
Presence or absence of N. indica did not affect callusing response. A clear
inhibition zone (IZ) was formed around each of the embryo showing callusing, the
diameter of IZ varied significantly among generations. It was maximum (3.70 cm)
in HD29, the resistant genotype. Generation mean analysis indicated that three-
parameter model was insufficient for CR, fresh weight and dry weight. Six-
parameter model showed that in presence of N. indica additive, and additive x
dominance effects were significant for CR, however, in absence of N. indica only
additive effects were significant. Duplicate type of epistasis for fresh weight of
29
calluses and dominance and dominance x dominance effects for dry weight of
calluses were observed in presence of N. indica. Only additive gene effects were
significant for diameter of IZ in both three and six parameter model, therefore,
selection might be helpful for improving resistance to N. indica.
Next year Kumar et al. (2003) reported their work on genetic analysis of
Karnal bunt (Neovossia indica) resistance in another wheat cross WH 283 x WH
533. Embryos excised from seeds of six generations (P1, P2, F1, BC1, BC2 and
F2) were cultured on modified MS medium already inoculated with secondary
sporidia of N. indica [Tilletia indica], the causal agent of karnal bunt in wheat.
Significant variations for callusing response (CR) (54.55-75.55%) were observed
among generations but the presence or absence of N. indica did not affect callusing
response. A clear inhibition zone (IZ) was formed around each embryo showing
callusing. The diameter of IZ varied significantly among generations and was
maximum in the resistant genotype, WH 283 (3.60 cm). Fresh weight and dry
weight of calluses, initiated from embryo cultured and inoculated with N. indica,
varied significantly among generations. Coefficient of infection as well as
percentage of infection reflected the over dominance of susceptibility. Generation
mean analysis showed that the three parameter model was adequate for diameter of
IZ only. Six-parameter model showed that additive (in presence of N. indica),
additive and additive x dominance (in absence of N. indica) effects were also
significant. Complementary type of epistasis for fresh weight of calluses and
dominance, and dominance x dominance effects for dry weight of calluses were
30
observed in the presence of N. indica. Magnitude of additive effects was higher for
diameter of IZ in three parameter model. They suggested that selection might assist
in improving this trait and thus indirectly help in attaining the resistance towards
N. indica.
Gartan et al. (2004) worked on identification of multiple resistance sources
for Karnal bunt in wheat. Among 100 advanced breeding lines and advanced lines
of wheat (Triticum aestivum) and triticale (Secale cereale), the genotypes HS450,
HS455, HPW232, VL861, PW731, PW733, PW738 and PW739 manifested
multiple resistance against Karnal bunt [Tilletia indica]. They concluded that the
evaluation of these genotypes for agronomic characters for their use in crossing
program with otherwise agronomically superior varieties may prove fruitful for the
development of high yielding, disease resistant varieties.
Sharma et al. (2004) obtained a Karnal bunt (KB)-free wheat stock
('KBRL22') from a cross of two resistant lines ('HD29' and 'W485'). It was used as
a donor to introgress the KB-free trait into 'PBW343' (an 'Attila' sib), the most
widely grown wheat cultivar in India. The number of KB-free and KB-affected
plants in BC1, BC2, BC3 and BC4 as well the F2 was recorded after artificial
inoculations. The segregation pattern in these generations clearly indicated two
independently segregating, dominant genes which jointly confer the KB-free
31
attribute. The importance of the KB-free line generated in this experiment was
discussed.
Indu-Sharma et al. (2005) studied the genetics of Karnal bunt (KB)
resistance in populations derived from crosses of four resistant stocks (HD 29, W
485, ALDAN 'S'/IAS 58, H 567.71/3*PAR) and a highly susceptible cultivar, WH
542. The plant materials screened for KB response consisted of F2, BC1 and RILs
from all 'Resistant' x 'Susceptible' crosses and RILs from the six possible 'Resistant'
x 'Resistant' crosses as well as the parents and F1s. The screening was performed
under optimal conditions for disease development with a mixture of isolates from
North Western Plains of India using the widely followed syringe method of
inoculation. The KB scores of the F1 from the four 'Resistant' x 'Susceptible'
crosses indicated partial dominance of resistance. Genetic analysis revealed that
HD 29, W485 and ALDAN 'S'/IAS 58 each carried two resistance genes whereas 3
genes were indicated in H 567.71/3*PAR. The six 'Resistant' x 'Resistant' RIL sets
showed that the genes in the four resistant stocks were different and that there may
be up to nine genes governing Karnal Bunt resistance in the four parents.
Experiment regarding Resistance to Karnal bunt (KB) caused by Neovossia
indica (syn. Tilletia indica) was incorporated by Indu-Sharma et al. (2003) into the
most widely grown wheat cultivar, PBW 343 A limited backcross approach was
used and BC3F4 progenies were subjected to a preliminary trial. Data were
32
recorded for yield, 1000-grain weight, plant height, days to 50% heading, tillers
per plant, grains per ear, , KB and rust score of 7 selected BC3F4 progenies. KB-
resistant lines with plant yield comparable to PBW 343 were recovered.
2.7 Variability of pathogen isolates
Sharma et al. (2004) collected ten isolates of Neovossia indica [Tilletia
indica] from various locations in plains of north India and Zone I of Himachal
Pradesh, India, were grouped into 5 pathotypes (I to V), based on their differential
reaction on a set of 20 genotypes of wheat and triticale showing variable degree to
resistance of Karnal bunt. Gurdaspur isolate was the most virulent whereas,
isolates from Dhaulakuan, Jalandhar and Bathinda showed intermediate virulence.
Isolates from Amb, Palampur, Paraur and Garhjamula were the least aggressive. In
an effort to identify sources with multiple resistance, approximately 150 wheat and
triticale genotypes were evaluated against local isolates of N. indica. Twenty-seven
genotypes were resistant to Karnal bunt.
Gogoi, et al, (2002) studied two highly resistant genotypes of wheat viz.
HD 29 and DWL 5023 and one highly susceptible genotype WL 711 against
Karnal bunt disease (caused by Neovossia indica [Tilletia indica]) for their
difference in morphological features, growth parameters and isoenzyme patterns. It
revealed that both the resistant genotypes were bearing higher number of spikelets
with short internodes in the spike compared to the susceptible genotype. In contrast
WL 711 had a significantly higher number of stomata in sheaths, flag leaf base,
33
booted glumes and rachis. The hair count was significantly high on the glumes and
rachis of HD 29 and DWL 5023 than on WL 711. HD 29 possessed significantly
narrow glume opening distance between lemma and palea followed by DWL 5023
and WL 711. Moreover, the period between ear emergence and anthesis was short
in HD 29 followed by DWL 5023 and WL 711. Out of the twelve isoenzyme
systems performed using grains and seedlings of theaccessions, majority of them
gave rise to comparatively higher number of bands in HD 29 and DWL 5023 than
in WL 711.
The study executed by Sharma et al. (2002) revealed the biochemical
variation of different pathotypes with host-pathogen responses on 10 differential
hosts, which included bread wheat, durum wheat [Triticum durum] and rye,
distinguished populations of six isolates into three pathotypes, pathotype I (KB-1,
KB-2 and KB-4), pathotype II (KB-3 and KB-5) and pathotype III (KB-6). Isolate
KB-2, which was the most virulent, showed the highest content of lipid (131.1
mg/g), nitrogen (24 mg/g), protein (15.3%), sugars (35 mg/g) and reducing sugar
(0.131 mg/g). Comparatively, KB-6 which was less aggressive and slower growing
isolate, had the minimum amount of these constituents. KB-2 could be
distinguished from other isolates by the presence of linolenic acid and KB-6 by the
absence of capric and pentadecanoic acids. Polyacrylamide gel electrophoretic
analysis reflected variations in soluble protein fractions among the three differently
virulent pathotypes of N. indica. In KB-6, 23 bands were resolved, of which 16
were common to all the representative isolates. Esterase isozyme detected in the
34
mycelial extracts revealed the presence of four bands of different Rf values in
KB6.
Sharma et al. (2001) grouped based on differential reaction, a set of 20
genotypes of wheat and triticale, isolates of N. indica collected from north india
into five categories (i to v). Isolate from Gurdaspur was the most aggressive
whereas, isolates from Dhaulakuan, Delhi and Thathal (Una) were the least
aggressive. Out of the 80 genotypes comprising Elite Karnal Bunt Screening
Nursery obtained from Directorate of Wheat Research, Karnal showing stable
resistance to a Dhaulakuan isolate of N. indica for the last five years, 23 genotypes
of Triticum aestivum, 15 of Triticum durum and 2 of triticale remained free from
disease. Twelve genotypes of T. aestivum and fifteen of T. durum were resistant to
Karnal bunt. The genotypes possessing multiple disease resistance could be
utilized in the breeding program to evolve multiple disease resistant varieties.
Sharma and Basandrai. (2004) conducted Field experiments during 1995-96 and
1996-97 in Dhaulakuan, Himachal Pradesh, India, to determine the efficacy of
propiconazole (0.05%), 10% oxadixyl + 54% copper oxychloride (0.05%),
triadimefon (0.05%), myclobutanil (0.05%), difenconazole [difenoconazole]
(0.05%) and hexaconazole (0.05%), and leaf extracts of Vitex negundo (25%),
Cassia fistula (25%), Azadirachta indica (25%), Eucalyptus tereticornis (25%) and
Lantana camara (25%) against Karnal bunt (Neovossia indica [Tilletia indica])
disease of wheat (cultivars HD 2009 and WL711). Disease incidence was
significantly less in all the treatments in both cultivars during 1995-96 and 1996-
97. The plots sprayed with propiconazole, triadimefon, A. indica, C. fistula and
difenconazole developed 0.97, 1.30, 2.30, 2.69 and 2.79% mean disease incidence,
35
respectively, on WL-711. On HD 2009, the plots treated with propiconazole,
difenconazole, A. indica, myclobutanil, triadimefon and C. fistula showed 2.17,
2.38, 3.80, 3.79, 4.31 and 4.36% disease incidence, respectively. This is thought to
be the first observation on the efficacy of aqueous plant extracts against N. indica.
All the leaf extracts were non-phytotoxic and markedly differed in their
fungitoxicity.
Borgen (2004) reported that in conventional agriculture the disease is
controlled exclusively by fungicide seed treatment, but in organic farming these
fungicides are not accepted. Previous studies in India have shown that seed
treatment with extracts of Canabis sativa [Cannabis sativa], Eucalyptus globulus,
Thuja sinensis and Datura stramonium was fully effective against the disease
under field conditions. Later, in vitro studies have shown that also germination of
spores of the Karnal bunt pathogen (Neovossia indica [Tilletia indica]) could be
prevented by these plant extracts. The experiment was repeated in Denmark with
extracts from the same species grown in Denmark, which has climate conditions
that are very different from India. In this experiment, the same seed treatments had
no or very limited effect on the frequency of the disease. The treatments were
compared with indigenous methods from Europe including salty brine, Thuja
leaves and lime. These methods had a significant, but insufficient effect on disease
suppression.
Bryson et al. (2002) evaluated different fungicides as seed dressing against
the karnal bunt of wheat.The treatments comprised Bavistin 50 WP (carbendazim),
Vitavax 75 WP (carboxin), Thiram 75 WS (thiram), Vitavax 200 WP (carboxin
36
37.5% + thiram 37.5%), Vitavax 200 FF (carboxin 17.5% + thiram 17.5%), Pulsor
2F (thifluzamide), Tilt 25 EC (propiconazole), Contaf 25 EF (hexaconazole) and
Raxil 2DS (tebuconazole). Raxil 2DS reduced Neovossia indica [Tilletia indica]
teliospore germination between 89.60 and 100%. Raxil, Tilt, and Pulsor were very
effective even at 1 g ml-1 kg -1 seed with a 47.68-74.03% reduction in teliospore
germination. Thiram combined with Vitavax 200 WP and 200 FF also significantly
controlled teliospore germination compared to the control after 45 and 65 days of
seed treatment.
Greenhouse experiments were conducted by Sharma et al. (2005), to
determine the efficacy of new fungicides against the karnal bunt of wheat and
durum wheat, caused by Tilletia indica. The treatments comprised: 0.05, 0.10,
0.20, 0.40 and 0.80% Folicur (tebuconazole); 0.05, 0.10 and 0.20% Contaf
(hexaconazole); 0.05, 0.10 and 0.20% Tilt (propiconazole); 50, 100 and 200 g a.i.
thifluzamide/ha; and the control, applied at 48 h after fungal inoculation. Infected
and healthy grains were counted in the inoculated ear heads and the percent
infection was calculated. Folicur at 0.20%, Contaf at 0.10%, Tilt at 0.10% and 100
g a.i. thifluzamide/ha resulted in more than 90% karnal bunt control, while Folicur
at 0.40% and 0.80%, and Contaf at 0.20% resulted in 100% bunt control.
Another study was carried out by Singh et al. (2000) from 1996 to 1999 to evaluate
fungicides for the control of karnal bunt (Neovossia indica [Tilletia indica])
through foliar spray under field conditions to ensure healthy wheat seed
production. The highly susceptible cv. HD 2329 was subjected to the following
37
treatments: propiconazole, hexaconazole, tricyclazole, flusilazole, thiophanate-
methyl, cymoxanil and carbendazim at 0.05 and 0.1% using a knapsack sprayer
were adopted during crop seasons. Among the fungicides, the maximum disease
control (99.8%) was achieved by two sprays of propiconazole (0.1%) whereas a
single spray controlled (97.68%) disease, followed by hexaconazole (94.40%) in
the post-inoculation treatment. In the pre-inoculated spray treatments, maximum
disease control (99.78%) was achieved with two sprays of propiconazole, while a
single spray provided 96.46% control followed by hexaconazole (92.87%). None
of the fungicides resulted in a complete control of the disease. Flusilazole
controlled the disease by 70.25-83.76%, but was phytotoxic to the wheat crop.
Tricyclazole, cyamoxanil, carbendazim and thiophanate-methyl did not provide
significant disease control. Two sprays of propiconazole (0.1%) at 15 days interval
reduced the disease from 19.83 to 0.02 and 18.66 to 0.04% in post-inoculation and
pre-inoculation treatments, respectively, which is below the level of international
seed certification standard for foundation seed (0.05%).
38
Chapter 3
MATERIALS AND METHODS
Current studies were conducted at different sites of wheat growing areas of
the Southern Punjab including Pir Mehr Ali Shah Arid Agriculture University
Rawalpindi and Regional Agriculture Research Institute Bahawalpur. Laboratory
facilities at both of the above institutes were utilized during the complete course of
investigations. Different aspects were undertaken to elaborate and to manifest the
all what was required for the fulfilment of the need and requirement of the
objectives of the project. Data were collected and analyzed statistically. Details
are given as under.
3.1 Survey and Monitoring
Survey and sampling of any targeted county provides information about the
disease prevalence and potential of karnal bunt in new areas. Strategies could
easily be formulated for the transaction of wheat germplasm from an area to
another on the basis of such surveys.
To observe the occurrence of the disease in southern Punjab, samples were
collected from districts viz Bahawalpur. Lodhran, Multan, Bahawalnagar, Rahim
Yar Khan, Khanewal, and Vehari. A sample of 4 pounds (1.8 kg) was considered
as standard sample size for karnal bunt sampling. These samples were taken
randomly during the years 2006 at the stage of maturity of the wheat crop in
39
different wheat growing areas. Best suitable time considered for sampling was
immediately before or after the harvest.
Fields were visited with co assistance through agriculture extension
department for ready information about the occurrence or suspect of the karnal
bunt infection in a particular area. Progressive and groups of innovative farmers
community, agriculture extension workers along with technically skilled members
of IPM facilitators team in some specific areas working under national IPM
program were contacted to collect the information about the hot spots of karnal
bunt disease. Each sample consisted of at least ten bunted ears. Spores were
collected from these samples to confirm the occurrence of the disease. Samples
were labeled bearing the date of collection, location and germplasm detail, grower
name etc.
3.1.1 Survey and Sampling Procedure
Irrigated plan lands of Southern Punjab (Pakistan) are mainly the sub
tropical hot areas of the country with high temperature and low humidity zone.
Wheat is an important crop sown in the months of November-December and
harvested in late April. Best time suitable for the survey and sampling was after the
maturity up to end of harvesting and storage. Seven districts of hot climate were
visited both randomly as well as what were reported as hot spots of the disease by
technical staff and the progressive growers. Areas of canal banks, low lying, river
belt of Chenab, water logged etc were remained under special focus during the
40
sampling with a concept of relatively high humidity areas as this factor adds much
to the indenture and pervasiveness of the disease.
3.1.2 Collection of samples
To observe and identify the disease incidence at the time of standing crop is
generally not possible. However in some cases of severe attacks bunted spike could
also be observed apparently at crop maturity stage. Two types of sampling i.e.
bunted ears from the standing crop and collection of seeds for bunted kernels from
the seed lots, storage/godowns after harvest and threshing, was done. Both sides of
the roads of arbitrarily selected in wheat growing areas were inspected with
intermittent gap of 10 kilometers keeping the way at a diagonal Kris cross map
division of the field for sampling consisting of at least 10 spikes for each. Spikes
were clipped off to pouch them in a glycine bags bearing the necessary convection
information about the sample.
3.2 Comparative concert of commercial cultivars
During the survey and monitoring in year 2006, hot spots were identified in
all seven districts of the southern Punjab i.e., Khanewal, Multan, Lodhran,
Bahawalpur, Vehari, Bahawalnagar and R.Y. Khan. Farmers of the relevant fields
in each location were provided seed of six commercial approved varieties BK-
2002, PND-1, INQ-91, Uqab-2000, Fareed-2006, and BWP-2000 in the next year
2007. To assess the performance, each variety was sown at three different locations
and the data of these three locations were treated as for replication. Spikes were
collected from each entry at the time of maturity and disease data were taken after
41
the harvest. Varieties were compared on the basis of reaction against the infection
under natural condition.
3.3 Reaction under Artificial inoculated Conditions
Artificial epidemics were created by inoculating the germplasm of varying
parentage/pedigrees (Table 20) selected for screening of commercial varieties as
well as advanced lines with high yield performance in different wheat breeding
programs continued at Regional Agricultural Research Institute Bahawalpur. These
genotypes were inoculated with freshly prepared sporidial suspension of one year
old Teliospores collected from assorted vicinities. All seven districts were visited
for the collection of inoculum to measure their isolate variability. Fungal isolates
collected from these regions during the survey were multiplied in the laboratory for
the testing their virulence pattern. Isolates collected from three regions were
outlined as follows.
Isolate KBi = Collected from district Bahawal Nagar
Isolate KBj = Collected from district Khanewal
Isolate KBm = Collected from district Lodhran
Isolate Kbn = Collected from district Vehari
Isolate Kbp = Collected from district Multan
Isolate Kbs = Collected from district Bahawalpur
Isolate Kbw = Collected from district Rahim Yar Khan
3.3.1 Techniques for extraction and detection of Tilletia indica
42
Karnal bunt infection cannot be simply detected and identified in plants of
growing wheat fields. Infected spikes do not differ symptomatically from the
healthy ones except in severe cases of infection. Also the four other diseases of
grain i.e black point, common bunt, dwarf bunt of wheat, and a bunt of rye weed
may baffle with karnal bunt and mistaken for Tilletia indica (Durán & Fischer,
1961; Durán, 1987). Black point is usually taken for KB infected seed. So grain
has to be removed from the ear heads for conformity test as illustrated in
diagnostic protocol suggested by European and Mediterranean plant protection
organization (EPPO) Anonnymous (2004c).
Procedure for testing T. indica was followed as described by EPPO
(OEPP//EPPO, 1991b) for quarantine purposes. Crops were inspected at the stage
of heading and before and after the harvest. Normally some ear heads are infected
in a stool and some grains are bunted in a spike. Infection proceeds at the time of
flowering and disease symptoms were evident to some extent at grain development
stage.
Visual examination for karnal bunt is considered unsatisfactory as small
level of infectivity may go undetected (Agrawal et al., 1986) and even nominal
kernel infections might largely infect healthy seed masses so direct seed analysis is
regarded as inadequate when testing for quarantine objectives (Aujla et al., 1988).
For more accuracy, seed wash test was done; about 100 seeds were taken in test
tubes and submerged in a sufficient quantity of water with five replicates. Tubes
43
were mounted on a rotary shaker for ten minutes and a spore suspension of the
fungus thus obtained was centrifuged at 3000 rpm for 10 minutes. Sediment of the
fungus T. indica was received as pellet in all test tubes which were observed under
the compound microscope for the presence of fungal teliospores in the sample. For
quantitative estimation and detection of the of karnal/partial bunt spore a simple
laboratory process was also used which is known as soaking method. Three
thousand seeds in three replications of 1000 kernels all were drenched in a 250 ml
solution of 0.2 per cent sodium hydro oxide contained in a flask or beaker at 25Co
for 24 hours). Solution was decanted out after 24 hours soaking and seed were
washed thoroughly in sterilized distilled water. Using magnifying lens on
examining the seeds visually, wheat seeds with black look at its exterior along the
groove were easily illustrious from the seed without black appearance.
Cracks in the surface revealed a black powdery spore mass within the
endosperm at the embryo end of the kernel or along the kernel groove. Seeds
indicating the presence of black sori of the fungus were ruptured in a little quantity
of sterilized distilled water for the discharge of bunt spore as a torrent flow of
teliospores.
This procedure was adopted for all bunted seeds collected during the
sample collection and field inspections. Teliospores collected were observed under
high magnifications and were seen as tuberculate, dark brown in color spherical to
oval in projections measuring on an average 30-40um in diameter verified as of
Tilletia indica through guide lines of Inman et al. (2003) and compared with the
findings of Ehsan-ul-haq et al.,2002.
44
3.3.2 Inoculum preparation and Teliospore mass culturing
Infected kernels from various locations of hot spots were used for inoculum
preparation and mass culturing to ensure the diverse and mixed fungus population
using the procedure adopted by Bonde et al. (1996). Suspensions of teliospore
were primed from the bunted grains obtained, along with the fungal isolates of
Bahawalpur, Bahawalnagar, Multan, Khanewal, Vehari, Lodhran and R.Y. Khan
districts.
Pericarp of the infected grains was ruptured and teliospores of the pathogen T.
indica were detached and scrapped off the bunted kernels, shaken well in solution
of a detergent tween-20 and water with a ratio of 3-4 drops of tween-20 in 100 ml
of water for 20 seconds. Solution was then centrifuged at 3000 rpm in a conical
centrifuge tubes to get the teliospores sedimented as a pellet. Teliospores thus
obtained, were thereafter screened through 100 m sieve, to remove the kernel
debris from the suspension. Kernel residues were retained on the sieve, and
teliospores passed on through membrane. These were again screened through a 50
m mesh to ensure the retension of all teliospores in the solution. Sodium
hypochlorite (NaOCl) 0.5% (Bonde et al, 1999) was added to the solution for
surface sterilization and centrifuged at 3000 rpm for about 2 minutes. Decanting
the excess of disinfectant, teliospores thus retained were rinsed twice in sterilized
distilled water. To circumvent the possibility of contamination the same procedure
was repeated by disinfecting with Chlorox (commercial bleach) during
centrifugation. Excess volume of the bleach was removed off and a final
concentration of the teliospore suspension was made by re-suspending in sterilized
water. One to two drops of the teliospore suspension was added with the help of
45
micro pipette to the Petri dishes containing water agar medium with composition
of 20 grams agar dissolved in one liter of sterilized distilled water. These plates
were incubated at 21 + 2 C0 for about 15 days which were later upon, used for the
pure culture preparation of T. indica by streaking them on agar slants of another set
of Petri plates prepared with pure sterilized water agar. Colonies of the fungus
were developed in 9-10 days by introducing light rays by fluorescent lamp with 12
hr cycle. Fresh colonies from PDA were cut into small pieces for preparing
mycelial plugs or inoculum bits of 4-6 mm diameter from actively sporulating
inoculum. These bits were made stick to the lower side of the lid of the freshly
prepared PDA in 100 ml Erlenmeyer flasks and also in some Petri plates by
placing the pieces on the lid of Petri plates. Small amount of sterilized distilled
water was added to both culture medium. This process supplemented much to the
discharge and liberation of the secondary sporidia which were later on incubated at
20 C0 for 20 days for mass multiplication of sporidial suspension.
3.3.3 Germplasm collection
Thirty nine genotypes were taken from Regional Agriculture Research
Institute Bahawalpur and National Agriculture Research Center Islamabad. These
included commercial wheat varieties and advanced lines of breeding program that
had the better genetic potential and characteristics for yield components
morphologically and economically. All advanced lines were taken from the
Economic Botanist, Economic Botany section Regional Agricultural research
Institute Bahawalpur. These lines had the maximum capacity to stand with the hot
climate of Southern Punjab belt of Pakistan. These genotypes (Table 1) were tested
46
out for their resistance against the karnal bunt pathogen under the high pressure of
inoculum under artificial conditions of inoculation. These varieties were sown at
field area of Regional Agriculture Research Institute and experimental area of
PMAS-Arid Agriculture University Rawalpindi during November, 2006. All
varieties were sown in RCBD fashion with three replications keeping plant spacing
10 cm and row to row distance as 30 cm. Due to being arid and rain fed climate,
sowing at University field area was done in the first week of November while at
Bahawalpur it was done in the last week of the month as this vicinity was dry hot
and irrigated tract.
3.3.4 Inoculation of germplasm
On an average fifteen plants from each genotype were randomly selected
for testing the efficacy of inoculation up to its greater extent with two different
methods i) boot inoculation and ii) spray inoculation .
3.3.5 Boot inoculation
Selected commercial and advanced wheat genotypes were sown at two
different sowing dates with an interval of ten days. One ml of freshly prepared
sporidial suspension (10,000 sporidia/ml of water) of the karnal bunt fungus T.
indica was injected in to the boot cavity (Aujla et al., 1982) of fifteen plants /entry
randomly at growth stages 48-49 according to Zadoks et al., 1974), using a
hypodermic needle usually at awn emergence. Inoculated plants were tagged with
stain coding strip to specify the time of inoculation. Also 1 ml of sterilized distilled
47
water was injected to the plant kept as control. Inoculation was done in the evening
time and plants were covered with polyethylene bags to provide and maintain
sufficient humidity for fungus to multiply with in the ears of wheat genotypes.
Being a hot zone of southern Punjab the temperature remained high in the month
of March and polyethylene covers were removed after three days. Plants were
maintained with recommended doses of water and fertilizers. Spikes were
collected, hand threshed and assessed for bunted grains at the time of maturity.
Disease incidence and the infection category were calculated following the disease
rating scale of Aujla et al. (1989).
48
Table. 1 Genotypes including commercial wheat cultivars and advanced lines,
tested for their susceptibility against the artificial inoculation of
karnal bunt of wheat inoculum.
S.No Genotypes S.No Genotypes S.No Genotypes
1 INQ-91 14 V04 5006 27 V06 6284
2 Uqab-2000 15 V05 6007 28 V06 6301
3 PND-1 16 V05 6037 29 V06 6302
4 AS-2002 17 V05 6038 30 WL-711
5 BK-2002 18 V05 6041 31 V06 6305
6 Manthar-03 19 V05 6132 32 V06 6309
7 Shafaq-06 20 V06 6205 33 BWP-79
8 Lasani 21 V06 6211 34 Sahar-06
9 Faisalabad-85 22 V06 6213 35 Fareed-06
10 Chakwal-50 23 V06 6237 36 Kiran
11 Blue Silver 24 V06 6238 37 Satluj-86
12 V03 2862 25 V06 6240 38 V06 6303
13 V03 3010 26 V06 6253 39 BWP-2000
49
3.3.6 Spray inoculation
Spray inoculation was done for the assessment of morphological
susceptibility and to investigate the worth of inoculation using this technique.
Fifteen heads of each cultivar on the same way were inoculated on a stage best
suited for spray inoculation as of half emerged ear stage GS 55; (Singh & Krishna,
1982, Kumar & Nagarajan, 1998). Each head was sprayed on to all out in open
parts of every ear along with flag leaf sheath as well dispersed fine smog. Wheat
heads treated as control were sprayed with sterilized distilled water. Inoculated
heads and plants were labeled and tagged properly bearing the date of inoculation.
Inoculated heads were covered with the sealable bags and the whole plant in the
pot was covered with polyethylene sheet cover in order to facilitate the humidity
for maximum infection proliferation. Polyethylene bags were removed from the
plants after three days. This technique normally requires more humidity than the
boot inoculation and hence relatively performs less resourceful domino effect in
field conditions. Plants were kept under rigorous care to maintain the requirements
of fertilizer, light and water. At the time of crop maturity in the month of April,
treated heads were collected from the pots, rubbed and threshed with mini wheat
thresher. Percent incidence was assessed for the quality of infection through spray
inoculation.
50
3.3.7 Disease Scoring
While scoring for the incidence of disease and its intensity, samples were
collected during the stage of maturity, in the craft paper bags labeled with name of
geno types, date of collection, location etc .Five to eight ears were taken as one
sample during collection and the ears were collected by clipping the stem right
below the stem. These were threshed manually or with mini wheat thresher. Seeds
of the mature kernels were removed from the ears and collected separately with
thorough concern and isolation. Data for the disease included the % disease
infection with the number of infected and disease free grains from each spike with
the help of the following.
No. of Seeds infected
Disease incidence (%) = _________________ x 100
Total No. of Seeds
Extent of damage due to karnal bunt was calculated with rating scale
comprised of five points used by Bonde et al. (1996) and Aujla et al. (1989), rati-
-ing scale is given in Table 2.
Wheat seeds were assessed and counted visually for each category. For
point infection assessment, magnifying glass was used or seeds were observed
under binocular microscope where necessary. Each category was given a particular
numerical value (Table 3).
Value of coefficient of infection was calculated for the level of resistance
51
and susceptibility of the tests genotypes. Number of infected kernels in each
category was multiplied with their numeric value thus a gross total was obtained. y
dividing the gross total with the total number of seed (multiplied by 100), CI was
calculated. CI value thus calculated was to categorize for the level of resistance or
susceptibility of the test lines in Table 4.
3.4 Breeding for Resistance
Results of artificial epidemics led to the mining of genes conferred for
resistant and susceptible rejoinder imparted by the test genotypes. Consequently,
four susceptible but high yielding genotypes viz. Uqab-2000, WL-711, Manthar-03
and V05-6037 and four resistant viz. PND-1 , V03-2862 , V05-6132 , and V05-
6041 were identified.
8x8 diallel crosses (Table 5) were made on full diallel pattern. Male parts
of the female plants were removed by emasculation and spikes were covered with
glysine bags for two to three days. Pollen received from the male resistant plant
was shed on to female plant spike by removing/cutting the upper side of cover bag
and later on closed after pollination. At maturity, ten plant / population were
selected for further studies. Seed of crossing block was carefully stored and was
sown as F1 crop in the next crop season 2008-09.
52
Table. 2 Disease rating scale to evaluate degree of incidence for karnal
bunt of wheat on 5 point symptom based categories.
Infection
category
Symptoms
0 Healthy Seed
1 Well developed point infection at the germinal tip
2 Infection spreading along side the groove
3 Three-quarters of seed bunted and transformed to sorus and
4 Seed entirely converted to black sori of the fungus
Table 3. Relevant numeric values indicating each infection category for
calculating Co-efficient of infection.
Infection category Numerical value
0 0
1 0.25
2 0.50
3 0.75
4 1.00
53
Table 4. Standardization of susceptibility category for commercial
cultivars/Lines, based on Co-efficient of Infection.
C.I Value Category
0 Highly resistant (HR)
0·1 to 5 Resistant (R)
5·1 to 10 Moderately Susceptible (MS)
10·1 to 20 Susceptible (S)
> 20·1 Highly Susceptible (HS)
(Aujla et al., 1989).
54
These all four generations i.e. P1, P2, F1 and F2 were again provided artificial
epidemics and at the time of maturity, data of plant height, days to heading (from
sowing up to awn emergence) and spike length were recorded. While data of grain
yield per plant and percent disease severity percentage were recorded after the
harvest. For the ease of experiment, data regarding the result of crosses of all pairs
of homogenous capacities i.e both four resistant and four susceptible traits were not
included in the analysis.
3.5 Marker assisted Selection
An effort was made to identify the gene resistant and susceptible for karnal
bunt with PCR-based markers. The all thirty nine genotypes were subjected to
molecular characterization to evaluate their genetic potential for resistance or
susceptibility against T. indica. Studies were carried out at Institute of Agriculture
Biotechnology and Genetic Resources, NARC –Islamabad. DNA from the tender
leaf tissues were extracted using CTAB method (Saghai-Maroof et al., 1984).
Xgwm 538-4B, Xgwm 538-snp, Xgwm 337-1D and Xgwm 637-4A were used for
assisted selection of karnal bunt resistant genotypes
55
Table 5. Detail of Crosses of all four Resistant and Four Susceptible
Cultivars/Lines on 8x8 full diallel fashion
Crosses
Uqab-2000 PND-1
Uqab-2000/WL-711. PND-1/Uqab-2000
Uqab-2000/Manthar-03 PND-1/WL-711
Uqab-2000/V05-6037 PND-1/Manthar-03
Uqab-2000/PND-1 PND-1/V05-6037
Uqab-2000/V03-2862 PND-1/V03-2862
Uqab-2000/V05-6132 PND-1/V05-6132
Uqab-2000/V05-6041 PND-1/V05-6041
WL-711 V03-2862
WL-711/Uqab-2000 V03-2862/Uqab
WL-711/Manthar-03 V03-2862/WL-711
WL-711/V05-6037 V03-2862/Manthar-03
WL-711/PND-1 V03-2862/V05-6037
WL-711/V03-2862 V03-2862/PND-1
WL-711/V05-6132 V03-2862/V05-6132
WL-711/V05-6041 V03-2862/V05-6041
Manthar-03 V05-6132
Manthar-03/Uqab-2000 V05-6132/Uqab-2000
Manthar-03/WL-711 V05-6132/WL-711
Manthar-03/V05-6037 V05-6132/Manthar-03
56
Manthar-03/PND-1 V05-6132V05-6037
Manthar-03/V03-2862 V05-6132/PND-1
Manthar-03/V05-6132 V05-6132/V05-2862
Manthar-03/V05-6041 V05-6132/V05-6041
V05-6037 V05-6041
V05-6037/Uqab-2000 V05-6041/Uqab-2000
V05-6037/WL-711 V05-6041/WL-711
V05-6037/Manthar-03 V05-6041/Manthar-03
V05-6037/PND-1 V05-6041/05-6037
V05-6037/V03-2862 V05-6041/PND-1
V05-6037/V07-6132 V05-6041/V03-2862
V05-6037/V05-6041 V05-6041/V05-6132
57
3.6 Polymerase Chain Reaction
DNA amplification were made in 20 ul reaction mixture each containing
1unit of Taq DNA polymerase (Fermentas) , 2 ul of 10 X buffer, 2.5ul of 2.5mM
MgCl2, 0.4 ul of dnTPs mix, 1 pmole of 50 ng of template DNA, 1 pmole of each
primer was used. Amplification condition for Xgwm538 and Xgwm 637-4A (5'
AAAGAGGTCTGCCGCTAACA3' and 5' TATACGGTTTTGTGAGGGGG 3'
) were as follows: denaturizing step at 94 C0 for 3 min; 45 cycles with 1 min at
94 C0, 1 min at 60 C0, and 2 min at 72 C0; and a final extension step of 10
min at 72 C0 ,while for Xgwm 337-1D ( 5' CCTCTTCCTCCCTCACTTAGC 3'
and 5' TGCTAACTGGCCTTTGCC 3') all other conditions remaining the same
with a slight difference of temperature requirement of 55 C0 for one minute in the
third step were maintained. Primer sequences for gwm538 were obtained from
Röder et al. (1998): gwm538F 5'-GCATTTCGGGTGAACCC-3'and
Gwm 538R (5'- GTTGCATGTATACGTTAAGCGG-3'. Gwm-538snpF1 was
designed by extending the original forward primer by five nucleotides on the 3' end
(5'-GCATTTCGGGTGAACCCATCAT-3').
3.7 Statistical Analysis
Results were statistically computed by MSTAT-C program. Correlation and
regression analysis were calculated through MS-Excel while comparison of
individual means were accomplished by Least Significant Difference (LSD) at 0.05
and 1% level of probability / significance, according to Steel et al. (1997).
Randomized Complete Block Design was used with three replications for all the
treatments. The collected data were subject to Analysis of Variance applying
58
methods of Gomez and Gomez (1984) on computer program MSTAT-C (Michigan
State University, 1996). The treatment means were compared by standard error
method computed as s/√n, where s stands for standard deviation while n denotes
the number of observations.
59
Chapter 4
RESULTS AND DISCUSSIONS
Present studies were comprised of step by step improvement of different
events in the disease development in the wheat growing area of southern Punjab to
be acquainted with the pathogenesis of karnal bunt of wheat. These included:
disease occurrence/prevalence in natural conditions monitored by survey
and sampling procedures.
varietal behaviour and their potential against the disease.
Disease incidence on reprted hot spots in the wheat growing area
Collection of isolates from various locations in seven districts of Southern
Punjab and to evaluate about variability pattern of the pathogen.
Behaviour of six commercial varieties sown in each districts on identified
hot spots to know the varietal potential against the disease pressure etc.
Southern Punjab is an area of hot climate falls mainly under irrigated as well as
arid lands. Fungal population at high temperature with low humidity generally
becomes limited. With the unexpected increasing trends of emerging infectious
diseases even under adverse and non conducive environmental circumstances,
present studies were conducted to test the hypothesis “karnal bunt of wheat is not
the disease of hot climate”.
60
4.1 Reactions under natural conditions.
Present studies were conducted to appraise the disease trend in a selective
hot belt of southern Punjab in two phases viz. under natural conditions and under
inoculated settings of artificial epidemics. Disease observation under natural
circumstances included sampling and monitoring while artificial and control
conditions involved the screening procedures against the karnal bunt disease.
4.1.1 Arbitrary Sampling in Seven districts
Seven districts viz. Khanewal Multan Lodhran Bahawalpur Vehari
Bahawal Nagar and Rahim Yar Khan of southern Punjab (Table 6) were visited for
the survey of karnal bunt disease during the year 2006 at the time of crop maturity
between heading and harvest.
Sampling procedure was adopted on random selection basis of various sites
both in the fields as well as from the farmers during field harvesting. Suspected
locations were thought as of prime consideration for the disease occurrence and
reservoir of the inoculum in the soil. A total of four hundred and ninety five
samples were collected from different locations of all seven districts. Out of 495
samples collected, 51 samples were found infected with the disease. District
Lodhran showed a higher susceptibility up 13.10 percent while samples received/
collected from Khanewal, exhibited the lower infection percentage of 8.22.
Infection range on the basis of coefficient of infection remained below 1 %
showing the less incidence of disease under natural conditions. Samples from three
districts viz. Multan, Bahawalpur and Vehari depicted the almost equal percentage.
61
No district was found free from disease. Maximum disease incidence was observed
in district Lodhran where CI ranged between 0.21-0.69, whereby minor stress of
infection in the wheat cultivars in the areas of Multan zone denotes the meager
chances of disease proliferation due to non conducive back up for T. indica fungus.
Occurrence of the karnal bunt disease in Pakistan in general survey has
been reported by Ehsan-Ul-Haq et al. (2002). They conducted a survey at seventy
eight spots in hilly areas of Khyber Pakhtoon khaw province and found the disease
prevalence in higher range on susceptible variety WL-711 up to 46.0%.
Commercially grown recommended cultivar Pak-81 showed prevalence up to
6.32% while Pirsbak-85 was under the attack of pathogen up to 5.57%. Two
districts Mangora and Mardan exhibited the range of incidence from 2.53-23.42%
and 0.41-46.0% respectively, whereby in other districts of the province disease
incidence remained lower and less than 5%. Range of infection in commercial
varieties at different places varies from 1.25-46.0%. In districts of southern Punjab,
scenario differs a little. Figure of incidence percentage stays at lower rank due to
unfavorable environments for the disease creation and development. Low
temperature with high humidity prevails for a short period in these areas at tillering
crop stage while temperature raises high during the flowering stage of development
resulting the less spread of disease in this belt of hot atmosphere.
62
Table 6. Percent incidence of karnal bunt among seven districts and
range of infecting intensities for each, on an average basis.
Location No. of Samples
Samples without infection
Sample infected
% infected samples
C.I
Khanewal 73 67 6 8.22 0.15-0.46
Multan 58 52 6 10.34 0.21-0.41
Lodhran 84 73 11 13.10 0.21-0.69
Bahawalpur 56 50 6 10.71 0.16-0.66
Vehari 73 65 8 10.96 0.26-0.68
Bahawal Nagar 65 59 6 9.23 0.15-0.59
Rahim Yar Khan 86 76 10 11.63 0.18-0.48
495 442 53 10.60
63
Fig 1. Spikes showing infection on grains within the infected spikelets when
inoculated at boot stage, with mixture of fungal isolates collected from
seven different regions.
Black Sori of Fungal mass
64
4.1.2 Disease prevalence on hot spots
Various localities of wheat growing areas were identified as hot spots
during the survey by seeking the help from local growers and reports from the
extension workers in the field. Information about variety or seed origin was
specious as the local growers were not sure about the variety inventory counts.
Total number of hot spots in each district varied but for the ease of experiment, a
homogeneous trend regarding the number of location in each district was set by
deleting the data of adjacent locations so as to evaluate the relevant correlation and
inter action among the spots. Data of the disease prevalence was scored on percent
infection basis. Higher infection was recoded (Table 7) on an average in district
KHL followed by district Lodhran and Vehari as 2.46, 2.11 and 2.10 respectively.
Locations of Kabeer pur, chak Pir kahawni, in BNG district, Dera Shamas and
Rukan pur at District Rahim Yar Kahn, Mari Qasim at BWP, and Chak 200/EB at
Vehari were of the least disease occurrence as 0.98,1.17,1.11,1.12, and 1.14
percent respectively. Whereas areas of mauza Aria at Lodhran and Pul bagar at
distt. KHL showed percentage prevalence as 3.04 and 3.64 respectively. High
yielding commercial varieties BK-2002 and Pak-81 were sown at these locations
that have minimum resistance against the disease. In testing of 730 samples for the
assessment of Tilletia indica incidence using dry inspection method for
consecutive three years (Bhutta et al., 1999) it was observed that infection prevails
in Punjab in general, However high infection percentage (3%) of karnal bunt in
various seed lots was found in Central Punjab and northwest areas of Pakistan.
They declared Southern parts of the country free from the karnal bunt infection
from 1994/95 to 1996/97 as the samples were collected at random along with the
65
samples received from the different farmer fields with no particular information
and identification of the sites as hot spots. Similar to the present findings which
yielded 89.3% samples free from disease and only 10.6 % samples were found
infested with the teliospores of the fungus. No commercial variety in the test zone
found immune to T.indica. Similar results regarding the immunity among the
cultivars grown were observed by (Joshi et al. 1970, Gill et al. 1981 and
Hoffmann, 1983) and they found that no cultivar of the aestivum group was free
from karnal bunt.
4.1.3 Disease incidence on hot spots
Disease incidence technically accounts for the response and intensity of the
karnal bunt pathogen at a particular place and normally in case of T. indica it is
based on an accumulative picture by calculating the coefficient of infection.
Through out the span of wheat growing area under study, out of 49 sites in all 7
districts, greater value of CI was obtained from Lodhran district followed by
Multan and Vehari as 0.73, 0.70 and 0.70 correspondingly. On the other hand R.Y.
Khan and BNG responded more resistant than the previous one as figure of CI
touches the lowest range of 0.43 and 0.44 likewise on an average. Reason for lower
value of infection could be the sowings of local mixtures of wheat population at six
sites of both areas that might have generated polygenic horizontal resistance which
eventually lead to the lowest frequency. Location wise comparison demonstrated
that Dera Shamas at R.Y.K and Tibi Kalan and Kabeer pur at Bahawal Nagar distt.
were responding comparatively as a resistant site against the disease, whilst
Mubarak Shah at Multan and Mauza Aria at Lodhran displayed as comparatively
66
susceptible locations among the all 49 sites under observation. Studies conducted
by Singh et al. (2001) to determine the occurrence of Karnal bunt (caused by
Tilletia indica) on wheat grain samples from different markets in Indian Punjab
also revealed the incidence percentage up to 42.7%. among which the maximum
sampling was done from a hot spot Farid kot where the disease prevalence was
92.8%, whereas the minimum prevalence of bunt was 3.4% in Amritsar district of
India.
4.1.4 Comparative Varietal behavior at diverse locations
Six high yielding commercial cultivars viz. Manthar-03, PND-1, INQ-91,
Uqab-2000, Fareed-2006, and BWP-2000 (Table 8) sown in three sets at different
location of identified hot spots in all seven districts of southern Punjab signified
the varying pattern of behaviors. These varieties were recommended by the
agriculture department for cultivation in the wheat growing areas of the said zone
under studies and had better potential to withstand the unfavorable circumstances
of A- biotic and biotic risks. Mean values representing the greater prospective of
variety PND-1 followed by Inqilab and Fareed wheras the resistance of manthar -
03 and Uqab-2000 against the disease comparatively remained poor. All cultivars
displayed significant variation regarding the resistance pattern.
Analysis of variance (ANOVA) in table 9 shows the major divergences
among the replication as the same variety was sown at distant locations at least of
25 kilo meters apart from each other and these three locations were treated as
replication.
67
05
1015202530354045
32 24 11
Max Mean Min
Feb-07 Mar-07
Fig 2. Variations in Temperature regimes (°C) at Bahawal pur Region during
the months of February and march in crop growth season 2007. Wheat
crop under high temperature of 38 °C during march being non
conducive to the flair up of pathogen results less incidence under
natural inoculatining conditions.
68
05
1015202530354045
33 22 11
Max Mean Min
Feb-08 Mar-08
Fig 3. Bars indicating the highest temperature of 40 °C during the march
2008. thus the occurrence of karnal bunt under natural field conditions
remained in low intensities. While the low temperature in February
had not impact for the disease as the crop stage did not reach at boot
stage – suitable for the floral infecting karnal bunt disease.
69
05
10152025303540
29 26 17
Max Mean Min
Feb-09 Mar-09
Fig 4. Bars indicating the highest ranges of temperature in the month of
march 2009, while lowest in the month of February as the year had
cool nights during the crop season. But due to less showers in the
month of March again the low incidence of disease was observed.
70
0
5
10
15
20
25
30
35
40
45
34 23 16
Max Mean Min
Feb-10 Mar-10
Fig 5. Temperature range in March 2010 touched the peak of 39Co indicating
the scenario of temperature regimes in all over the Bahawalpur region
of South Punjab.
71
Table 7. Details of sampling sites of disease hot spots with cultivar sown.
Average Disease incidence and range of infection gives the
comparison among various locations.
Dis
tt.
Locations and Varieties Sown Av. %
incidence
Av.C.
I
Kh
anew
al
Kotla Maharan,Mauza Lothar,Pirowaal,Chak
Puthi,kacha khoo,Pul Bagar,Chak 136/10R
Sahar,AS-2002,Local mixture, FSD-85, Pak-81, Blue
silver
2.46 0.69
Mu
ltan
Gajju hatta,Khan garh,mauza,Buch,Mubarak Shah,shah
pur,ayyaz abad,Baseera
Uqab-2000,Unknown,INQ-91,Unknown,
Local mixture,INQ-91,INQ-91
2.05 0.7
Lod
hra
n
Mauza aria,Ain wahin,Mangwani,Bahar goth
Mundhali,Kala dehri,Dhanot
BK-2002,INQ-91,Ufaq-2002,Punjab-96,Shafaq,MH-
97,Unknown
2.11 0.73
72
Bah
awal
Kalanch wala, Dera masti, Shikrani, Noor Pur,,Mari
qasim, Head Rajkan, Qaim pur
Kohinoor-83,INQ-91,Watan,Unknown,Local
mixture,Local mixture,BK-2002
1.63 0.63
V
ehar
i
karam pur Ludden Arey wahin Chak 200/EB
Chak 12/WB Chak 64/KB Chak 44/WB
FSD-85,Unknown,Uqab-2000,Local mixture
Local mixture,Ufaq-2002,Unknown
2.1 0.7
Nag
ar
Nadir Shah, Chak Girdari, Pir khawni, Chak salamat,
Shahi pur, Tibi klan, kabeer pur
Local mixture,Iqbal-2000,AS-2002,Local
mixture,Unknown,Local mixture,Watan
1.24 0.44
R.Y
.Kh
an
Kala dhora, Rukan pur Pul geeri Sanjar pur Kot sabzal
Dera Shamas Mauza Klaan
Pak-81,Local mixture,Iqbal-2000,Unknown,
Bakhtawar-92,Local mixture,Local mixture
1.24 0.43
73
Table 8. Performance of selected high yielding commercial cultivars against
karnal bunt at identified hot spots in all seven district under study, in
Southern Punjab.
Mean Percent infection
Variety Khanewal Multan Lodhran BahawalPur
Bahawal Nagar
Vehari R.Y.K Ave.
Manthar-03 1.26 1.33 1.46 1.28 0.74 1.51 0.64 1.18
PND-1 0.07 0.34 0.15 0.11 0.08 0.22 0.12 0.16
INQ-91 0.32 0.52 0.47 0.18 0.31 0.3 0.25 0.34
Uqab-2000 1.1 0.98 0.95 1.13 0.58 1.07 0.6 0.91
Fareed-06 0.72 0.61 0.74 0.58 0.47 0.41 0.52 0.58
BWP-2000 0.96 0.74 0.92 0.7 0.53 0.9 0.58 0.76
Average 0.74 0.75 0.78 0.67 0.45 0.74 0.45
74
Table 9. Analysis of Variance (ANOVA) showing Cultivar’s response in
different Districts at different locations of hot spots.
SOV DF SS MS F-cal F-tab
5% 1%
Rep. (Spots) 2 0.609 0.304 18.3866 3.10 4.87
Variety (A) 5 14.841 2.968 179.2286 2.33 3.25
Districts (B) 6 2.2 0.367 22.1404 2.21 3.03
A x B 30 3.16 0.105 6.3603 1.60 1.93
Error 82 1.358 0.016
Total 125
75
Significant difference among the varieties is obvious from the table 9 indicates the
genetic variation relevant to responsiveness against the karnal bunt fungal pressure
at hot spots under normal conditions. Each variety comprising of different origin of
its parents, obtaining the traits for resistance from different pedigrees, represents
significantly distinct character. Factor B representing the district wise momentous
dissimilarity that specifies the difference of cultivar retort aligned with the varying
factors affecting the disease convention. This may include variation of factors. For
example pathogen variability, time of sowing, cultural practices, climate, soil,
water, etc would have been the reason for differing consequences, with respect to
the disease incidence among the cultivars. Moreover, the significantly varying
interaction among the varieties and the locations marked from the ANOVA table
reflects the situation that varying prototype for disease epidemics in all these spots
were most likely. On the basis of which we can not assume that a simple factor
contributes to the disease expression on a particular site under natural conditions.
Intercept points of variety performance in Fig 8. shows the highest peak of
susceptibility for Manthar -03, followed by Uqab -2000 and Bahawal pur-2000. No
variety in all over the zone of Southern Punjab expressed stable and uniform
reaction. Fareed-06, PND-1, BWP-2000 and INQ-91 displayed reaction less than 1
%, but Uqab-2000 and Manthar-03 responded more than 1% infection.
4.2 Comparative virulence of isolates
Teliospores obtained from diverse wheat samples collected from
seven regions were categorized in to seven isolates as KBi, KBj, KBm, KBn, KBp,
KBs and KBw. These isolates were mass cultured in separate 250 ml flasks which
76
were later upon injected to all test accessions at awn emergence stage. Wheat
varieties were inoculated by all seven varying isolates separately as well as with
the mixture of inoculum of these culture isolates. All isolates could be
differentiated on the basis of their differential reactions on each accession.
Virulences among the isolates differed significantly high (Table 11). Percent
incidence caused by various isolates showed variety of susceptibility categories in
the all cultivars/lines. Analysis of variance shows that significant variation exists
among the genotypes with respect to their genetic potentials against the KB
virulences. The isolates collected from the districts of Lodhran and Khanewal
proved to be the most virulent among all, followed by isolate collected from
district of Bahawalnagar. While pathogenically, the least virulence was observed in
the isolate of Vehari district.
The significant genotype- isolate interaction indicates the presence of
vertical resistance and there is gene for gene relationship in host-pathogen system
(Van der Plank, 1968). Genotypes possessing the gene for resistance
/susceptibility against the isolates verily responded with the varying intensities.
Commercial varieties/cultivars included in the set showed the inheritance for
resistance against the pathogen. Due to boot inoculation, least genetic potential was
observed as the maximum success of infection in this regard is achieved. Studying
the segregation pattern in the generations, Sharma et al. (2004) suggested that two
independently segregating, dominant genes jointly confer the KB-free attribute
(Table 10).
77
Indian variety WL-711 unanimously recognized as susceptible check in karnal
bunt screenings (Dhaliwal, 1995; Satvinder & Nanda, 2002), showed highly
susceptible reaction in our studies. Distinctive disease incidence was pragmatic on
different host lines with the inoculation of different isolates. Kbi, and Kbp caused
less than 5% incidence on Punjnad-1, V066211 and kiran; whereas Blue silver,
BK-2002, Manthar-03, Lasani, Faisalabad-85, V056007, V066238, V066309 and
WL-711 gave reaction of more than 20% incidence (highly susceptible), inoculated
with the similar isolates, indicating that both posses the different genes for
resistance against karnal bunt infection (Table 12). Still the same lines V032862
and V056132 on the other hand, were susceptible in their reaction (23.73% and
27.58% respectively) against KB infection when inoculated with isolate Kbm. Low
incidence of disease on Kiran and V066211 with inoculation of isolate Kbn and
Kbw, was observed as 0.89% and 0.92% respectively, while on Blue Silver, high
incidence of 34.36% and 26.54% was observed with the same isolates. Isolate Kbj
caused the highest incidence on Blue silver (52.60%) and WL-711(63.68%); while
Kbp and Kbn caused lowest infection 26.24% and 27.71% on the same most
susceptible cultivars, respectively. These results match with the findings of Sharma
et al. (2001) & Sharma et al. (2004) who categorized ten isolates of Tilletia indica
into various pathotypes based on their differential reaction, collected from various
locations in plains of north India and Zone I of Himachal Pradesh, India, on a set
of 20 genotypes of wheat and triticale showing variable degree to resistance of
Karnal bunt. They also found that some isolates were more virulent and showed
high aggressiveness in causing the incidence, as compared to the others.
Varieties/lines ranked with similar category of their susceptibility, in our study,
78
advocate that, either there is no pathogenic differences exist among those particular
isolates or there is no resistance gene in those genotypes that could have responded
to them. Similar findings have earlier suggested by Bonde et al. (1996), while
studying the four isolates obtained from separate field collections. No cultivar /line
showed immune response to any of the isolates. They reported that this rare
category came with the ratio of eight out of 20,000 entries when a continuous
screening studies were carried out for 10 years; still including very low infection
and not the immune all eight. In our studies, all commercial cultivars vastly sown
in these regions including INQ-91, Uqab-2000, BK-2002, Manthar-03, Lasani,
Faisalabad-85, AS-2002, Sahar-06, and Fareed-06 etc were susceptible in their
reactions against the pressure of inoculum specially with boot inoculation
methodology that allows to yield the maximum ratio of successful infection
(Beniwal et al., 2001). However, under natural field conditions, these cultivars
behave as resistant varieties due to high temperature and low rain fall in the south.
In addition to this, varieties also show their morphological (field) resistance (Royer
& Rytter, 1985; Warham, 1988, 1990). (Riccioni et al., 2006) when inoculated
with spray inoculation techniques or exposed to the air borne infection of the
disease because of the relative differences between morphological and
physiological susceptibility (Riccioni et al., 2008). Presence of less resistance gene
against KB virulences, in almost all commercial cultivars, is well compensated
with the unfavourable environmental conditions in the area. With the low
populations of the pathogen, the probability of booming infection also becomes
low even under favorable environmental conditions because of what is known as
the Allee effect (Smilanick et al., 1989). More over, a little period in the wheat
79
physiological system permits the infection to occur and, during that critical period
of two to three weeks, the environmental conditions have to be favorable for the
disease development. Threats for the epidemics could not be ignored as the
pathogen exists and disease prevails at the hot spots.
80
Table 10. Susceptibility category of each host lines including commercial
cultivars, based on coefficient of infection when inoculated with
mixture of isolates.
Genotypes Grains infected
Total No. of Grains
% infection 0 1 2 3 4
Gross Total C.I
INQ-91 77 503 15.31 426 45 25 5 2 29.5 5.86
Uqab-2000 157 479 32.78 322 112 26 14 5 56.5 11.8
PND-1 40 411 9.73 371 37 2 1 0 11 2.68
AS-2002 262 617 42.46 355 245 14 2 1 70.75 11.47
BK-2002 204 392 52.04 188 189 10 3 2 56.5 14.41
Manthar-03 282 707 39.89 425 215 45 20 2 93.25 13.19 Fareed-06 118 455 25.93 337 87 24 6 1 39.25 8.63
Lasani 146 303 48.18 157 98 33 11 4 53.25 17.57
Faisalabad-85 101 390 25.9 289 68 29 2 2 35 8.97 Chakwal-50 182 364 50 182 144 14 19 5 62.25 17.1 Blue Silver 196 360 54.44 164 123 41 16 16 79.25 22.01
V03 2862 28 254 11.02 226 23 4 1 0 8.5 3.35
V03 3010 23 294 7.82 271 9 6 4 4 12.25 4.17
V04 5006 50 374 13.37 324 22 4 21 3 26.25 7.02
V05 6007 104 467 22.27 363 56 34 12 2 42 8.99
V05 6037 308 539 57.14 231 278 24 4 2 86.5 16.05
V05 6038 182 524 34.73 342 171 10 1 0 48.5 9.26
V05 6041 43 428 10.05 385 36 4 3 0 13.25 3.1
V05 6132 40 417 9.59 377 27 9 4 0 14.25 3.42
81
V06 6205 192 615 31.22 423 176 14 2 0 52.5 8.54
V06 6211 66 403 16.38 337 60 3 2 1 19 4.71
V06 6213 76 417 18.23 341 73 2 1 0 20 4.8
V06 6237 204 483 42.24 279 177 25 2 0 58.25 12.06
V06 6238 205 569 36.03 364 162 36 7 0 63.75 11.2
V06 6240 325 614 52.93 289 265 45 15 0 100 16.29
V06 6253 225 412 54.61 187 201 21 2 1 63.25 15.35
V06 6284 282 708 39.83 426 270 9 3 0 74.25 10.49
V06 6301 146 403 36.23 257 119 23 4 0 44.25 10.98
V06 6302 311 666 46.7 355 241 56 12 2 99.25 14.9
WL-711 401 527 76.09 126 268 76 43 14 151.25 28.7
V06 6305 199 583 34.13 384 161 25 10 3 63.25 10.85
V06 6309 91 460 19.78 369 25 21 44 1 50.75 11.03
BWP-79 88 541 16.27 453 22 35 28 3 47 8.69
Sahar-06 110 479 22.96 369 14 56 33 7 63.25 13.2
Shafaq-06 56 610 9.18 554 24 12 14 6 28.5 4.67
Kiran 51 614 8.31 563 14 14 21 2 28.25 4.6
Satluj-86 67 413 16.22 346 26 24 13 4 32.25 7.81
V06 6303 237 546 43.41 309 174 36 15 12 84.75 15.52
BWP-2000 185 550 33.64 365 141 34 8 2 60.25 10.95
82
A positive correlation between the % incidence and co-efficient of infection was
observed. Percent incidence being an independent variable, after calculating the
intensity of seed colonization, determines the susceptibility category under which a
test genotype falls. Jafari et al. (2000) also reported significant positive correlation
between coefficient of infection and percentage of infected grain for each entry.
While working with nine isolates of Tilletia indica, Pannu and Chahal (2000) also
reported a positive correlation between secondary sporidial production and disease
incidence. Using the regression analysis, a trend line was extended in a chart
beyond the actual data to predict future values. Value of R2 shows more than 85%
dependence upon incidence of disease while other factor contributes up to 15%
that uses a simple linear trend line clearly indicating a rising trend (Fig. 9).
Varieties/lines PND-1, V032862, V033010, V056041, V056132, V066211,
V066213, Shafaq-06 and Kiran were ranked as resistant, while Uqab-2000,AS-
2002, BK-2002, Manthar-03, Lasani, Chakwal-50,V05 6037,V06 6237, V06
6238,V06 6240,V06 6253,V06 6284,V06 6301,V06 6302,V06 6305,V06 6309,
Sahar-06, V06 6303, BWP-2000, Blue silver and WL-711 showed response as
susceptible and highly susceptible
Difference among the isolates prevails with respect to the frequency of
virulence/avirulence alleles at different pathogenicity loci, corresponding to the
resistance genes in the host lines (Datta et al., 1999). However, the study derived
from the diagnostics by identifying the molecular markers based on pathogenicity
loci will prove more confirmatory to the isolate characterization.
83
00.20.40.60.8
11.21.41.6
Manthar-03
INQ-91 Fareed-06
KHLLDN
BNGRYK
KHLMTNLDNBWPBNGVHRRYK
Fig 6. Response of six commercial cultivars is shown at various locations.
Punjnad-1 holds Susceptibility with it level at the least while manthar-03 shows
maximum susceptibility. On the other hand, Bahawal Nagar and Rahim Yar Khan
districts show the least epidemics as compared to Multan and Lodhran districts.
84
INQ‐91
Uqab‐2000
PND‐1
AS‐2002
BK‐2002
Manthar‐03
Fareed‐06
Lasani
Faisalabad‐85
Chakwal‐50
Blue Silver
V03 2862
V03 3010
V04 5006
V05 6007
V05 6037
V05 6038
V05 6041
V05 6132
V06 6205
V06 6211
V06 6213
V06 6237
V06 6238
V06 6240
V06 6253
V06 6284
V06 6301
V06 6302
WL‐711
V06 6305
V06 6309
BWP‐79
Sahar‐06
Shafaq‐06
Kiran
Satluj‐86
V06 6303
BWP‐2000
Mean
0.00
10.00
20.00
30.00
40.00
50.00
60.00
70.00
% DIS EAS E INC IDENC E
Fig 7. Susceptibilty categories of various commercial cultivars/lines when
inoculated with mixture of isoltes. PND-1, V03010, V032862, V056132
and Kiran show less than 10% incidence, while WL-711 displays more than
60 % disease incidence.
85
All varieties/accessions do vary from each other in relation to their feedback
against the karnal bunt disease infection while the interaction between the isolates
and the accessions was also significant at 5% probability level.
It is evident from the response of all seven regions of the south zone that
the isolates collected from these sites expressed their diverse virulence behavior
with respect to their incidence. However the pathogenic capacity of this virulent
type is of greater concern as it has its dominance against the all commercial gene
pool for wheat crop exclusively in dry hot zone. There is no well developed race
concept based on the virulence pattern of different T. indica isolates on different
host genotypes and genetics of the pathogen (Aujila et al., 1987)
4.2.2 Comparative phenomenon of % incidence and CI
Disease scoring done on both percentage infection and CI basis was
compared (Fig. 9) symbolizes the difference of indicator about the level of
susceptibility or resistance in any cultivar under study. Commercially approved
variety PND-1, has shown disease incidence up to 9.54 % but its CI was 2.64 i.e.
less than 5 that permits to grade PND-1 as resistant variety. Analysis shows that
there exists a moderate relationship between % incidence and C.I as the value of R2
obtained as 0.72 (Fig 6).
86
4.2.3 Relative proportional values under natural and artificial environment.
All test genotypes kept as control and non sprayed of inoculum pressure,
yielded quite different results. Table 14 and Fig. 10 demonstarte the relative
spectrum of response, reflecting the occurrence situation, greatly varying. Reaction
of approved varieties under normal condition representing the predominance of
inoculum in the field, but due to natural habitat it could not flourish to greater
extent as was in case of artificial epidemics.
87
Table 11. ANOVA expressing the significant variations among isolates and
genotypes as well as Genotype x Isolates interactions.
S.O.V. d.f. S.S. M.S. F-Cal
F-Tab
0.05 0.01
Genotype 38.00 52636.37 1385.17 11.93** 1.43 1.65
Isolates 6.00 26818.78 4469.80 38.51** 2.12 2.84
G x I 228.00 40296.54 176.74 1.52** 1.20 1.29
Error 546.00 63376.37 116.07
Total 818.00
** Highly significant
88
Table. 12 Karnal bunt incidence with standard error of mean, on different host lines of
varying genetic potentials for resistance against the disease.
Accessions Kbi Kbj Kbm Kbn Kbp Kbs Kbw
INQ-91 18.71 ± 3.19 14.44 ± 0.48 15.77 ± 2.23 16.61± 3.98 13.06 ± 3.39 25.22±12.47 18.27 ±4.99
Uqab-2000 25.74 ± 7.42 28.55 ± 7.13 28.46 ± 9.13 15.23 ± 4.44 12.76 ± 3.31 31.75±11.35 28.35 ± 4.38
PND-1 3.59 ± 1.91 18.75 ± 3.52 7.29 ± 1.82 16.98 ± 3.71 3.68 ± 0.40 2.76±1.38 2.70 ±1.39
AS-2002 31.90 ± 6.59 34.76 ± 6.78 30.64± 9.19 19.00 ± 5.69 15.48 ±1.27 15.88±4.14 13.23 ±5.55
BK-2002 31.46 ± 10.46 45.71 ± 7.46 39.24±11.49 10.79 ± 2.59 20.64±12.36 8.26±3.26 16.23 ±2.03
Manthar-03 43.44 ± 1.55 38.63 ± 3.26 30.87± 1.07 6.64 ± 2.24 20.85±11.40 13.69±4.29 12.01 ±3.39
Shafaq-06 2.60 ± 1.51 6.72 ± 3.47 10.18± 4.07 7.21 ± 3.71 7.92± 3.21 6.29±4.24 7.56 ±3.83
Lasani 47.99 ± 1.75 44.69 ± 2.20 36.32± 1.81 12.87± 3.06 26.78±13.33 18.62±8.05 24.87 ±4.84
Faisalabad-85 25.51 ± 5.75 26.65 ± 1.03 25.23± 4.21 15.77± 5.27 34.04 ±1160 16.17±3.11 29.74 ±8.21
Chakwal-50 17.59 ± 9.28 43.65 ± 8.75 32.94±11.01 21.40 ± 3.95 19.48 ± 2.14 14.04±2.40 25.57±6.61
Blue Silver 38.29 ± 4.31 52.60 ± 3.55 47.02± 5.43 34.36 ± 8.10 26.24 ± 3.25 37.33±8.93 26.54 ±2.94
V03 2862 8.02± 6.32 6.01± 1.89 5.86±1.34 1.98 ± 0.44 5.22 ± 2.32 5.86±2.66 16.63±7.04
V03 3010 10.80 ± 1.19 9.43 ± 2.51 16.47 ± 8.68 8.11± 1.44 11.09 ± 3.61 17.84±9.28 20.85±12.30
V04 5006 7.99 ± 4.13 11.99 ± 0.69 33.20 ± 1.15 3.87± 1.54 22.00±15.63 20.04±11.39 16.20 ±6.23
V05 6007 22.44 ± 0.50 21.49 ± 0.51 24.99 ± 5.90 11.46 ± 3.35 25.69 ± 5.74 23.00±7.32 18.26 ±5.49
V05 6037 29.90 ± 12.32 43.25 ± 2.96 41.50 ± 5.24 16.37± 3.15 11.21 ± 2.15 42.77±12.33 19.24 ±5.57
V05 6038 30.24 ± 4.94 34.17 ± 0.46 27.41±11.02 16.10 ± 2.50 11.01 ± 1.45 34.68±11.52 21.70 ±2.90
V05 6041 11.49 ± 6.71 13.48 ± 4.10 7.69±3.85 9.96 ± 3.65 4.87 ± 4.21 6.35 ±1.85 4.61 ±2.65
V05 6132 12.33 ± 7.03 6.22 ± 2.37 27.58 ± 12.19 3.13 ± 0.92 23.39±16.89 16.85 ±9.79 11.82 ±4.88
V06 6205 32.26 ± 10.63 37.14 ± 3.92 38.14 ± 4.14 9.25 ± 1.34 18.40 ± 8.17 30.13±10.56 15.73 ±4.86
V06 6211 26.27 ± 7.79 31.51 ± 2.82 42.16 ± 6.24 15.93 ± 2.72 12.83 ± 3.72 42.95±17.49 22.76 ±1.81
V06 6213 21.94 ± 8.54 26.25±8.83 38.93 ± 5.72 16.93 ± 2.71 11.49 ±1.91 23.78 ± 5.29 30.94 ±9.75
V06 6237 36.99 ± 5.23 45.24±1.54 33.61 ± 6.45 12.97± 2.0 17.02 ± 8.11 11.11± 4.79 14.74 ±3.73
V06 6238 39.64 ± 8.06 42.90±6.72 45.03±10.59 16.55 ± 2.84 20.35 ± 8.07 14.54 ±1.15 22.03 ±4.06
V06 6240 40.73 ± 2.84 49.24±2.19 32.21±11.08 14.36 ± 3.78 14.93 ± 3.59 20.90 ±1.30 18.35 ±3.04
V06 6253 31.67 ± 3.12 43.38±8.42 40.62±12.19 15.40 ± 3.46 12.56 ± 2.09 17.28 ±2.63 15.75 ±1.89
V06 6284 29.64 ± 5.85 32.28±4.34 29.12 ± 8.23 9.75 ± 1.95 10.48 ±1.16 15.01 ±3.27 11.74 ±1.29
89
V06 6301 25.01 ± 8.07 29.77±6.06 33.21±6.72 9.22 ± 1.62 13.45 ± 4.27 13.64 ±1.87 19.17±5.20
V06 6302 36.26 ± 1.72 43.19 ± 2.38 28.85 ± 8.89 15.82 ± 3.96 16.69 ± 4.63 38.84±10.63 18.82 ±1.77
WL-711 54.30 ± 8.57 63.68 ± 6.50 51.74±7.63 27.71 ± 6.70 53.09±10.85 42.16 ±7.98 46.25 ±0.73
V06 6305 28.48 ± 4.22 30.20 ± 3.73 29.32 ±7.74 17.05 ± 3.32 13.03 ± 2.43 18.35 ±1.16 17.47±4.55
V06 6309 21.99 ± 2.06 22.43 ±3.77 34.13±10.36 14.43 ± 3.06 25.30 ± 4.67 20.96 ± 2.99 18.01±6.14
BWP-79 11.32 ± 0.62 14.42 ±1.14 27.63 ± 6.78 12.10 ± 3.83 19.66 ± 7.97 15.97 ± 3.20 19.20 ±4.91
Sahar-06 13.32 ± 2.84 19.99 ± 2.68 32.36 ± 9.11 11.75 ± 2.28 13.42 ± 2.15 15.53 ±1.61 25.36 ±6.97
Fareed-06 17.03 ± 4.26 13.86 ± 0.82 21.32±10.87 16.67± 3.31 16.59 ±1.00 22.89 ± 3.17 22.98 ±1.73
Kiran 2.17 ± 0.62 22.74 ± 4.33 16.93 ±2.68 0.89 ± 0.38 4.23 ± 3.53 6.34 ± 4.23 16.99 ±2.69
Satluj-86 17.01 ± 2.05 16.10±0.23 13.00 ± 0.68 15.80 ± 3.42 15.99 ± 3.20 18.80 ±2.72 21.30 ±5.14
V06 6303 39.13 ± 6.79 37.36±5.00 25.68±8.77 13.47± 3.10 16.40±3.21 23.34±11.18 20.87±1.31
BWP-2000 32.42 ± 5.75 37.52±3.04 29.41±5.76 13.26 ± 2.71 19.90±1.38 21.18±11.26 19.92±0.85
90
0.00
10.00
20.00
30.00
40.00
50.00
60.00
70.00
80.00
% incidence C.I
INQ-91 Uqab-2000 PND-1 AS-2002 BK-2002 Manthar-03 Fareed-06 Lasani Faisalabad-85 Chakwal-50
Blue Silver V03 2862 V03 3010 V04 5006 V05 6007 V05 6037 V05 6038 V05 6041 V05 6132 V06 6205
V06 6211 V06 6213 V06 6237 V06 6238 V06 6240 V06 6253 V06 6284 V06 6301 V06 6302 WL-711
V06 6305 V06 6309 BWP-79 Sahar-06 Shafaq-06 Kiran Satluj-86 V06 6303 BWP-2000
S D = 17.2 S D = 5.56
Fig. 8. Comparison of percent seed infected and extent of seed colonization on
each test genotype. Commercial cultivar WL-711 is at its highest
susceptible level comparing with the PND-1 as highly resistant.
91
Table 13. Similarity Matrices in principle order, among the genotypes
resulted after screening against Karnal Bunt of wheat.
Analogous genotypes Means
INQ-91 Mean 4 22.03 A
Uqab-2000 Mean 10 21.59 A
PND-1 Mean 18 20.75 AB
AS-2002 Mean 11 19.65 ABC
BK-2002 Mean 31 19.42 ABC
Manthar-03 Mean 30 19.05 ABC
Fareed-06 Mean 29 18.40 ABC
Lasani Mean 9 18.31 ABC
Faisalabad-85 Mean 25 18.12 ABC
Chakwal-50 Mean 2 17.88 ABC
Blue Silver Mean 1 17.71 ABC
V03 2862 Mean 21 17.59 ABC
V03 3010 Mean 22 17.39 ABC
V04 5006 Mean 16 17.21 ABC
V05 6007 Mean 26 16.99 ABCD
V05 6037 Mean 24 15.84 BCDE
V05 6038 Mean 17 15.43 BCDEF
V05 6041 Mean 32 15.05 CDEFG
V05 6132 Mean 15 11.94 DEFGH
V06 6205 Mean 8 11.69 EFGH
V06 6211 Mean 5 10.70 EFGH
92
V06 6213 Mean 28 10.69 EFGH
V06 6237 Mean 20 10.14 FGHI
V06 6238 Mean 7 9.857 GHI
V06 6240 Mean 27 9.817 GHI
V06 6253 Mean 6 9.357 HIJ
V06 6284 Mean 23 8.597 HIJK
V06 6301 Mean 13 8.093 HIJK
V06 6302 Mean 19 4.987 IJKL
WL-711 Mean 14 4.457 JKL
V06 6305 Mean 3 3.837 KL
V06 6309 Mean 12 1.680 L
93
y = 0.3312x
R 2 = 0.86
0.00
10.00
20.00
30.00
40.00
50.00
60.00
70.00
80.00
0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00
% Inc idence
Coefficient of infection
Fig. 9. Series in rows showing the trend line indicating the relationship between
coefficient of infection and % incidence. Regression equation expresses the
multiple of x value (% incidence as an independent variable) to yield the
seed colonization for calculation of susceptibility category.
94
y = 0.4486x + 0.541
R 2 = 0.7142
0
2
4
6
8
10
12
14
16
18
0 5 10 15 20 25 30
% inc idence with Mix
C.I (%) from
mix
Fig. 10. Regression analysis of % disease incidence by mixture of isolates
and relative Coefficient of infection. Value of R2 shows moderate
relationship among the both parameters.
95
01020304050607080
INQ-91 Fareed-06 V03 3010 V05 6132 V06 6240 V06 6305 Satluj-86
% infection C.I (%)
Fig 11. Pertinent proportional rate of recurrence of % incidence Vs CI.
Susceptibility categories with CI less than 5, representing the resistant
genotypes.
96
Table 14. Comparison of incidence of karnal bunt of wheat, for
physiological and morphological resistance, among the
genotypes of varying pedegree.
Genotypes % infection
% incidence under natural condition Genotypes
% infection
% incidence under natural condition
INQ-91 15.31 0.00 V06 6211 36.05 0.30 Uqab-2000 32.78 0.94 V06 6213 36.38 0.00 PND-1 9.73 0.00 V06 6237 42.24 0.00 AS-2002 42.46 0.47 V06 6238 36.03 0.23 BK-2002 52.04 0.00 V06 6240 52.93 0.89 Manthar-03 39.89 0.00 V06 6253 54.61 0.53 Fareed-06 25.93 0.00 V06 6284 39.83 0.00 Lasani 48.18 0.29 V06 6301 36.23 0.00 Faisalabad-85
25.90 0.47 V06 6302 46.70 0.00
Chakwal-50 50.00 0.00 WL-711 76.09 0.72 Blue Silver 54.44 0.87 V06 6305 34.13 0.34 V03 2862 11.02 0.45 V06 6309 19.78 0.37 V03 3010 7.82 0.55 BWP-79 16.27 0.21 V04 5006 13.37 0.00 Sahar-06 22.96 0.28 V05 6007 22.27 0.00 Shafaq-06 13.50 0.00 V05 6037 57.14 0.46 Kiran 13.18 0.30 V05 6038 34.73 0.44 Satluj-86 16.22 0.00 V05 6041 10.05 0.38 V06 6303 43.41 0.53 V05 6132 9.59 0.00 BWP-2000 33.64 0.31 V06 6205 33.18 0.00
97
Table 15. Susceptibility categorization of various commercial cultivars
and advance wheat lines, on the basis of co-efficient of infection.
C.I Susceptibilty
Category
Genotypes tested
0 Highly Resistant
(HR)
-
0.1-5.0 Resistant ( R ) PND-1,V03-2862,V03-3010,V05-6041,V05-
6132,V066211,V066213, Shafaq-06, Kiran
5.1-10 Moderately
susceptible (MS)
INQ-91,Fareed-06,FSD-85,
V045006,V056007,V056038,BWP-79,Sutluj-86,
10.1-20 Susceptible (S) Uqab-2000,AS-2002, BK-2002, Manthar-03,
Lasani, Chakwal-50,V05- 6037, V06-6237, V06-
6238, V06-6240, V06-6253,V06 6284,V06-6301,
V06-6302,V06-6305,V06- 6309,Sahar-06,V06-
6303,BWP-2000
20.1 and
above
Highly
Susceptible (HS)
Blue Silver,WL-711
98
4.3 Transfer of resistance and trend of susceptibility/Resistance in Filial
generations
8x8 diallel crosses (Table 5) of four susceptible high yielding varieties with
four resistant lines were carried out which consequently yielded filial generations
F1 and F2 in the consecutive crop seasons 2008-09, and 2009-10 respectively.
These generations were again put under maximum pressure of freshly prepared
karnal bunt inoculum from one year old bunted grains, to examine the ability to
retard the disease effect. Comparing the severity % age (Table 16) of F1 and F2, it
was observed that a stable trend of resistance prevails in both the generations.
However the normal disease rating in F1 remained a little bit higher but not
significantly varied from F2. Coefficient of infection and percentage of infected
grains showed maximum rating in F1 (Kumar et al., 2003) because of
homogeneous nature of dominance for resistance or susceptibility. But in F2 it
goes differ due to variation in the genetic components of the all crop stand. In
varying or mixed plant population, the effect of morphological resistance exists
that helps retard the pressure against invading pathogen.
Trend set for the transfer of resistance is obvious from the table when
infection percentage in parent Uqab-2000 decreases down from 33.62 to 16.23,
19.85, 19.64, and 15.75 when crossed with the resistant PND-1, V032862,
V056132, and V056041 respectively. Same pattern of reposition of resistance
resulted in other three sets of crosses when resistant varieties were crossed with
high yielder susceptible WL-711, Manthar -03 and V056037 consequently
demonstrating a partial dominance of resistance over susceptibility. These results
match with the other reports (Singh 1994, Gill et al.1990, Chand et al 1989) which
99
stated that partial dominance of resistance exists over susceptibility in genetic
studies of KB. Applying t-test for two means of F1 and F2, variance of difference
between the two means was non-significant that indicates no considerable variation
of increase or decrease in both generations pertinent to the severity percentage
could be identified.
4.4. Effect of Severity on yield components of wheat
Severity of karnal bunt disease normally does not effect yield greatly and is
responsible for minor yield losses but adversely affects grain quality via the
discoloration of flour and the generation of a fishy odour caused by the production
of trimethylamine (Mehdi et al., 1973). Data of resistant and susceptible parent
combinations was statistically analyzed for regression analysis. Effect of severity
on plant height, days to heading and grain yield showed non significant ratios (not
shown) while regression analysis regarding the spike length in F1 (Table 18)
showed negatively significant ratio determining the tangible contrary effect. It also
indicates that karnal bunt disease affects the spike length up to 32%, while the
remaining would be depending upon factors other than severity. Reports from
other workers (Ehsan-ul-Haq et al., 2002) also indicated that disease causes
reduction in the length of ear as well as number of spikelets in ear heads. But again
in analysis of F2, severity effect on spike length was non significant (not shown).
Reason behind this could be the segregation effect on genetic parameters in F2
which ultimately leads to non sequential order of all genetic components.
100
Table 16. Level of Susceptibility in Parents, F1 and F2
Severity (% age)
Parents/ Crosses F1 F2
Uqab-2000 33.62 26.12
Uqab-2000/PND-1 16.23 13.78
Uqab-2000/V03-2862 19.85 15.14
Uqab-2000/V05-6132 19.64 23.54
Uqab-2000/V05-6041 15.75 14.42
WL-711 53.92 49.83
WL-711/PND-1 22.43 12.25
WL-711/V03-2862 16.91 17.19
WL-711/V05-6132 20.02 15.93
WL-711/V05-6041 19.55 12.58
Manthar-03 33.79 37.2
Manthar-03/PND-1 14.12 10.96
Manthar-03/V03-2862 17.9 16.89
Manthar-03/V05-6132 19.31 13.95
Manthar-03/V05-6041 16.22 15.78
V05-6037 48.35 40.23
V05-6037/PND-1 16.72 15.87
V05-6037/V03-2862 16.24 14.25
V05-6037/V07-6132 15.09 57.74
V05-6037/V05-6041 17.2 15.83
PND-1 3.1 2.33
V03-2862 3.46 2.96
V05-6132 4.04 3.44
V05-6041 3.03 3.3
SD 10.9 9.0
101
020406080
INQ-91 Faisalabad-85
V05 6038 V06 6240
% Incidence (mix. ofisolates)
% Incidence (mix. of isolates) % incidence under natural condition
Fig. 12. Proportional values of incidence shown under natural and simulated
settings. Low level of incidence under natural conditions reflects the
morphological resistance as compared to the high level incidence in
artificial conditions showing less physiological resistance in all 39
genotypes.
102
010203040506070
Uqab-2000
Uqab-2000/V03-2862
Uqab-2000/V05-6041
WL-711 /PND-1
WL-711 /V05-6132
Manthar-03
Manthar-03 /V03-2862
Manthar-03 /V05-6041
V05-6037 /PND-1
V05-6037 /V07-6132PND-1
V05-6132
Severity (% age) F1 Severity (% age) F2
Fig.13. Level of % disease incidence in F1 and F2. Mean values showing
no significant difference among both generations except one abrupt
change in F2 due to segregation principle. Stable trend for transfer
of resistance traits is shown in the figure.
103
Table 17. Mean values of severity and their effect on various yield
components in F1
Genotypes/Crosses
(%Severity
) PLH SL DHE GY
Uqab-2000 33.62 93.17 10.68 102.67 24.67
Uqab-2000/PND-1 16.23 91.27 10.90 97.33 23.00
Uqab-2000/V03-2862 19.85 95.33 11.77 95.33 28.33
Uqab-2000/V05-6132 19.64 89.33 11.83 97.33 24.00
Uqab-2000/V05-6041 15.75 94.43 11.17 99.00 28.67
WL-711 53.92 82.80 10.40 95.33 26.00
WL-711/PND-1 22.43 99.03 10.73 98.67 27.00
WL-711/V03-2862 16.91 90.57 11.03 93.33 28.33
WL-711/V05-6132 20.02 93.23 12.13 98.33 24.33
WL-711/V05-6041 19.55 93.30 11.83 94.67 30.00
Manthar-03 33.79 92.90 10.00 100.00 28.00
Manthar-03/PND-1 14.12 97.27 11.53 95.00 27.00
Manthar-03/V03-
2862 17.90 96.00 11.13 100.33 28.67
Manthar-03/V05-
6132 19.31 95.33 11.33 100.67 27.67
Manthar-03/V05-
6041 16.22 91.23 11.53 95.33 26.00
V05-6037 30.14 103.20 11.00 93.67 27.33
V05-6037/PND-1 16.72 96.90 10.70 95.67 27.67
104
V05-6037/V03-2862 16.24 96.97 10.80 96.67 23.67
V05-6037/V07-6132 15.09 96.71 11.00 98.00 31.67
V05-6037/V05-6041 17.20 96.43 12.17 94.33 27.33
PND-1 3.10 90.52 11.13 96.00 30.00
V03-2862 3.46 93.77 11.70 96.33 29.33
V05-6132 4.04 101.00 11.80 93.00 29.67
V05-6041 3.03 90.57 12.03 98.33 25.33
Ave. 18.68 94.22 11.26 96.89 27.24
105
Table 18. ANOVA showing regression analysis for effect of severity on
Spike Length in F1
SOV SS df M S F-cal F-tab
5% 1%
Regression
Residual
2.430216
5.122519
1
22
2.43022
0.23284
10.44
4.30 7.95
Total 7.5527 23
Intercept = 11.808983
Slope = -0.029212982
y =11.808-0.0292 x
R2 = 0.321766331
106
Fig.14. Crossing block showing hybridization of various genetic traits.
Crosses were made among Resistant and susceptible cultivars/lines on full diallel pattern
107
Table 19. Mean values of % severity in Parents, Crosses and its effect on
yield components in F2
Crosses Geno types (%)Severity PLH SL DHE GY
V1 Uqab-2000 26.12 94.33 9.93 86.33 25.00
V1XV5 Uqab-2000/PND-1 13.78 83.00 11.53 87.00 22.67
V1XV6 Uqab-2000/V03-2862 15.14 93.67 11.30 91.67 19.67
V1XV7 Uqab-2000/V05-6132 23.54 79.67 10.47 92.67 20.67
V1XV8 Uqab-2000/V05-6041 14.42 91.33 11.13 95.00 25.00
V2 WL-711 49.83 79.67 9.84 91.33 21.67
V2XV5 WL-711/PND-1 12.25 92.33 10.67 99.33 26.33
V2XV6 WL-711/V03-2862 17.19 92.67 11.17 93.00 20.00
V2XV7 WL-711/V05-6132 19.39 85.33 12.23 94.33 23.67
V2XV8 WL-711/V05-6041 12.58 86.33 10.70 88.00 25.67
V3 Manthar-03 37.20 94.33 9.47 93.33 23.33
V3XV5 Manthar-03/PND-1 10.96 100.00 10.47 100.67 24.33
V3XV6 Manthar-03/V03-2862 16.89 87.33 10.43 94.67 22.33
V3XV7 Manthar-03/V05-6132 13.95 91.33 10.13 90.33 23.67
V3XV8 Manthar-03/V05-6041 15.78 88.67 11.33 94.33 22.33
V4 V05-6037 36.80 95.00 10.93 99.33 22.67
V4XV5 V05-6037/PND-1 15.87 92.67 11.13 95.00 23.00
V4XV6 V05-6037/V03-2862 14.25 94.33 10.03 84.67 19.67
V4XV7 V05-6037/V07-6132 16.40 90.33 9.33 84.00 22.67
108
V4XV8 V05-6037/V05-6041 15.83 93.67 10.37 81.33 23.33
V5 PND-1 3.19 91.00 10.70 85.00 28.67
V6 V03-2862 2.96 87.33 11.20 98.67 27.33
V7 V05-6132 3.44 95.33 10.63 91.67 24.33
V8 V05-6041 3.30 86.67 10.57 88.67 25.67
Ave. 17.13 90.26 10.65 91.68 23.49
109
Fig 15. Demonstration of Partial dominance in Crop stand F1. Inoculated
Spikes don’t show sori of fungal black mass on maturity.
110
4.5 Marker Assisted Selection
SSR primers Xgwm-538snpF1 (Fig. 16,17 and 18) and Xwgm 337-1D (Fig.
20) tagged specific alleles conferring resistance and susceptibility to karnal bunt in
genotypes under study, with obvious bands while Xgm-637 amplified some of
them and did not amplify all fragments. Two polymorphic alleles of 152 and 171
bp in the resistant and susceptible genotypes respectively, were amplified by
gwm538. Tagging of gwm 538 on 152 bp for resistant and 171 for susceptible have
also been earlier reported by Singh et al., (2003). In sixteen varieties namely INQ-
91, PND-1, FSD-85, V03-2862, V03-3010, V03-5006, V05-6037, V05-6041, V05-
6132, V06-6205, V06-6213, V06-6253, Sahar-06, Shafaq-06, Kiran, and Satluj-86
gene for resistance was identified on the basis of Marker assisted selection. SSR
Xgwm 337-1D , exhibited amplification profiles in lane #1, 2, 5,9,13, 14, 15,16,
33, 38, and 39 as susceptible for varieties INQ-91, Uqab-2000, BK-2002, FSD-85,
V04-5006, V05-6007, V05-6037, BWP-79, V06-6303 and BWP-2000 while lane #
3,4,6,7,810,11,12,31,34,35,36 and 37 as resistant for genotypes PND-1, AS-2002,
Manthar-03, Fareed -06, Lasani, chakwal -50, Blue silver, V03-2862, V06-6284,
V06-6301, V06-6305, Sehar-06, Shafaq-06, Kiran and Satluj-86. These results
were compared with the findings of Kumar et al., (2007) and were found in
accordance that indicated an association of these markers with karnal bunt
resistance.
Xgwm-538snpF1 accurately tagged genotypes, eight out of sixteen as
resistant and demonstrated efficiency of 50 % to detect presence of resistance in
the accessions while 100 % accuracy in case of detecting susceptibility in the
111
commercial cultivars/lines as it tagged all sixteen accurately as susceptible when
these were compared with the results of field studies..
Xwgm 337-1D tagged accurately eleven out of thirteen and had the
efficiency 84.61% to detect susceptibility while to detect resistance in the
genotypes it had efficiency up 26.66 % when it tagged resistance in four varieties
accurately out of fifteen.
112
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14
Fig 16. Amplification Profile from agarose gel 2.5% representing the of Polymerase chain rection from DNAs of 39 different wheat accessions, with Primer Wgwm 538snpF1 (5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder 50 bp, Fermentas is represented with lane M. Bands in the lane above and below demonstrate the tagging of susceptible and resistant alleles respectively in genotypes 1-14 (Table 1).
113
Fig 17. Amplification Profile from agarose gel 2.5% representing the products of Polymerase chain rection from DNAs of 39 different wheat accessions, with Primer Wgwm 538snpF1 (5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder 50 bp, Fermentas is represented with lane M. Bands in the lane above and below demonstrate the tagging of susceptible and resistant alleles respectively in genotypes 15-29 (Table 1).
15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 M
114
M 30 31 32 33 34 35 36 37 38 39
Fig.18. Amplification Profile from agarose gel 2.5% representing the products of Polymerase chain rection from DNAs of 39 different wheat accessions, with Primer Wgwm 538snpF1 (5'-GCATTTCGGGTGAACCCATCAT-3'). DNA Ladder 50 bp, Fermentas is represented with lane M. Bands in the lane above and below demonstrate the tagging of susceptible and resistant alleles respectively in genotypes 30-39 (Table 1).
115
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
M 3132 33 34 35 36 37 38 39 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
M 16 17 1819 20 21 22 23 24 25 26 27 28 29 30 M 31 32 33 34 35 36 37 38 39
Fig. 19. Aarose gel 2.5% representing the products of PCR from DNA of 39 genotypes (Table 1). Bands in lower an above lanes representing the tagginh of susceptible and resistant geotypes respectively with primer Xgwm337-1D and Xgwm 637-4A. DNA Ladder 50 bp, Fermentas is represented with lane M.
116
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 M16 17 1819 20 21 22 23 24 25 26 2728 29 3
M 31 32 33 34 35 36 37 38 39
150
100
50
Fig. 20. Products of PCR run on 2.5 % agarose gel from DNA of 39 Genotypes (Table 1) representing two groups with Xgwm-337 primer. Arrow (from left to right) indicating bands for susceptible and resistant genotypes respectively. Genotypes in lane #1, 2, 5,9,13, 14, 15,16, 33, 38, and 39 were tagged as susceptible against the karnal bunt of wheat.
117
Table 20 . Parentage/Padegree of various accessions used in screening as well as in hybridization process.
S.No Genotypes Parentage/Pedgree 1 INQ-91 WL-711/CROW‘S’
PB1954-9A-1A-0A-0PAK(PAK) 2 Uqab-2000 CROWS 'S' /NAC// BOW 'S' 3 PND-1 PB-85/NKT 'S' 4 AS-2002 KHP/D31708//CN74A370/3/CIAN079/4/RL6043/*4NAC
5 BK-2002 P20102/PIMA/SKA/3/TTR`S'/BOW` 6 Manthar-03 KAUZ//ALTAR 84/AOS 7 Shafaq-06 CM11163-6M-20Y-10M-0M-0B 8 Lasani KVZ/TRM//PTM/ANA
CM43903-H-4Y-1M-1Y-3M-3Y-0B-0PAK 9 Faisalabad-85 MAYA/MON//KVZ/TRM
CM44083-N-3Y-1M-1Y-1M-1Y-0B 10 Chakwal-50 F1n/ACS//ANA
SWM4578-56M-3Y-3M-0Y-0PAK 11 Blue Silver 1154-388/AN/3/YT54/N10B//LR64/AN//YT54/
N10B/3/LR864/4/B4946. 12 V03 2862 PRC/PASTOR//2236 13 V03 3010 PRL//PASTOR/2/2236 14 V04 5006 CHOIX/STAR/3* CNO791/2* SERI 15 V05 6007 CMBWMO2703F-OTOPY/SKAUZ Z*/FCT 16 V05 6037 URS/BBL//KAUZ/3/KAUZ/4/CHEN/… 17 V05 6038 CHIABIA/PRL//CM 65531 18 V05 6041 SHA7/VEE#5//5//ARIV92 19 V05 6132 CAL/NH/H567.71/3/SERI/4/CAL/NH/H H5567.71/5/… 20 V06 6205 INQ 91/KAKUNA 21 V06 6211 INQ 91 2*/TUKURU 22 V06 6213 INQ 91/KAKUNA 23 V06 6237 ESDA/VEE#10//7394 24 V06 6238 ESDA/VEE#10//7394 25 V06 6240 ESDA/VEE#10//7394 26 V06 6253 CROC-1/AE. SQ(205)/KAUZ/3/KAUZ Z*/…. 27 V06 6284 ETHOPIA-6/INQ-91 28 V06 6301 KAUZ//ALTAR 84/AOS/3/MILAN/KAUZ/4/HUTTES 29 V06 6302 KAUZ//ALTAR 84/AOS/3/MILAN/KAUZ/4/HUTTES 30 WL-711 S308/CHRIS//KAL 31 V06 6305 ATTILA/3* BCN//BAV 92/3/PASTOR 32 V06 6309 CAL/NH/H567.71/3/SERI/4/CAL/NH/H H5567.71/5/… 33 BWP-79 CNO/LR 64* 2/SON 64/SON 34 Sahar-06 CHL/2* STAR/4/BOW//CROW//BUC/PVN/3… 35 Fareed-06 PTS/3/TOB/LFN//BB/4/BB/HD-832-
5//ON/5/GV/ALD’S’//HPO’S’ 36 Kiran NA 37 Satluj-86 CMT/YR//MON 38 V06 6303 TOBA 97/ATTILA
39 BWP-2000 AU/UP301//GLL/Sx/3/PEW ‘S’/4/MAI ‘S’/MAY A ‘S’//PEW’S’
118
SUMMARY
Step wise disease prevalence was observed in the hot belt of Southern
Punjab where temperature ranges between 12C0-31C0 in February and 22C0-38C0
in March while in June it touches the highest figure of 52C0. Wheat grown areas of
seven districts exposed that disease occurs in all districts and all varieties
commercially grown by the farming community are under the threat of karnal bunt.
Hot climate of Multan has the popularity as a maxim in the past history of
thousand years has been proved as gift scientifically as the low infection was
observed in this belt, while Lodhran remained comparatively higher in incidence/
occurrence up to 13.10 percent with CI range 0.21-0.69 as it has maximum cover
crop area thus providing the chances of micro environments favorable for
infection. Samples received/ collected from Khanewal, exhibited the lower
infection percentage of 8.22. Infection range on the basis of coefficient of infection
remained below 1 % showing the less incidence of disease under natural
conditions. These studies rejected the hypothesis that southern Punjab is free from
karnal bunt of wheat.
Locations of Kabeer pur, chak Pir kahawni, in BNG district, Dera Shamas
and Rukan pur at District Rahim Yar Kahn, Mari Qasim at BWP, and Chak
200/EB at Vehari were of the least disease occurrence as 0.98,1.17,1.11,1.12, and
1.14 percent respectively. Whereas areas of mauza Aria at Lodhran and Pul bagar
at distt. KHL showed percentage prevalence as 3.04 and 3.64 respectively
Out of six commercially approved varieties, PND-1 showed maximum
capacity to retard the disease effect followed by Inqilab-91 and Fareed-06, where
119
as the resistance of manthar -03 and Uqab-2000 against the disease comparatively
remained less when grown on identified hot spots. All cultivars displayed
significant variation regarding the resistance pattern.. No variety in all over the
zone of Southern Punjab expressed immunity against the karnal bunt pathogen.
Fareed-06, PND-1, BWP-2000 and INQ-91 displayed reaction less than 1 %, but
Uqab-2000 and Manthar-03 responded with more than 1% disease infection.
Commercially approved variety PND-1, has shown disease incidence up to 9.54 %
but its CI was 2.64 i.e. less than 5 that permits to grade PND-1 as resistant variety.
Effect of severity on plant height, days to heading and grain yield showed
non significant ratios while regression analysis regarding the spike length in F1
showed significant ratio determining the obvious effect of severity on spike length.
But again in F2, severity effect on spike length was non significant due to the
morphological resistance in segregating population having heterozygous pattern of
all genetic components.
Data of the mean severity shows that all 39 test genotypes/accessions were
significantly varying from each other while variation among isolates was also
significant. It indicates the distinct inconsistency in pathogenic behavior of all
seven isolates collected from the seven different zones.
In sixteen cultivars/lines namely INQ-91, PND-1, FSD-85, V03-2862,
V03-3010, V03-5006, V05-6037, V05-6041, V05-6132, V06-6205, V06-6213,
V06-6253, Sahar-06, Shafaq-06, Kiran, and Satluj-86 potential for resistance was
120
observed on the basis of Marker assisted selection through SSR primer Xgwm 538
snp F1.
SSR Xgwm 337-1D , exhibited amplification profiles as susceptible for
varieties INQ-91, Uqab-2000, BK-2002, FSD-85, V04-5006, V05-6007, V05-
6037, BWP-79, V06-6303 and BWP-2000 while as resistant for genotypes PND-1,
AS-2002, Manthar-03, Fareed -06, Lasani, chakwal -50, Blue silver, V03-2862,
V06-6284, V06-6301, V06-6305, Sehar-06, Shafaq-06, Kiran and Satluj-86.
It clearly indicates that all commercially approved varieties do have the gene for
resistance, but due to its additive and partial dominance effect its exposure does
not stay stable against the inoculum pressure. But when these varieties are grown
in field conditions, they exhibit better performance (< 5% incidence). In field
inoculation INQ-91 showed 5.86 % infection against the disease under artificial
epidemics that clearly showing still good potential of this variety to resist against
the disease.
121
LITERATURE CITED
Ahmad. S., M. A. Hussain, H. Z. Ghazali. 1999. Evaluation of wheat germplasm
for resistance to karnal bunt. Pakistan Journal of Phytopathology, 11: 149-
151.
Anonymous, 1991a. Neovin. Tilletia indica occurance in Mexico. European and
Mediterranean Plant Protection Organisation (EPPO). Reporting Service
No.513/06.
Anonymous, 2004c. Diagnostic protocols for regulated pests. European and
Mediterranean plant protection organization (EPPO). Bulletin, 34(2):219-
227.
Aujla, S. S., I. Sharma, and B. B. Singh. 1989. Rating scale for identifying wheat
varieties resistant to Neovossia indica. Ind. Phytopathol, 42: 161-162.
Aujila S.S, Sharma I, Singh B.B .1987. Physiologic specialization of karnal bunt of
wheat. Indian Phytopathol. 40:333-336.
Aujla, S. S., Sharma, I., Gill, K. S. and H. S. Grewal. 1988. Establishment of
Neovossia indica in wheat kernel. Plant Dis. Res., 3: 62-63.
Bansal, R., D. V. Singh, and L. M. Joshi. 1983. Germination of teliospores of
Karnal bunt of wheat. Seed Res., 11: 258-261.
Beniwal, M. S., C. Pankaj and S. Rajender. 2001 Comparison of different methods
of inoculation and evaluation of wheat material against Neovossia indica
(Mitra) Mundkur. Crop-Research-Hisar, 21: 105-108.
122
Bhutta, A. R, A. Hussain and I. Ahmad. 1999. Prevalence of karnal bunt in wheat
seed lots in Pakistan. Rachis,18: 38-42.
Bonde, M. R., D. K. Berner, S. E. Nester, G. L. Peterson, M. W. Olsen, B. M. and
S. T. Cunfer. 2004. Survival of Tilletia indica teliospores in different soils.
Plant-Disease, 88: 316-324.
Bonde, M. R., Nester, S. E., Khayat, A., Smilanick, J. L., Frederick, R. D., and
Schaad, N. W.1999. Comparison of effects of acidic electrolyzed water and
NaOCl on Tilletia indica teliospore germination. Plant Dis. 83:627-632.
Bonde, M. R., G. L. Paterson, G. Fuentes-Davil, S. S. Aujila, G. S. Nanda and J. G.
Phillips. 1996. Comparison of the virulence of isolates of Tilletia indica,
causal agent of karnal bunt of wheat, from India, Pakistan and Mexico.
Plant Dis., 80: 1071-1074.
Borgen, A. 2004. Organic seed treatment to control common bunt (Tilletia tritici)
in wheat. Seed Testing Intern., 128: 12-13.
Bryson, R., J. Froment, M. A. and S. S. Karwasra. 2002. Evaluation of fungicides
as seed dressings against Karnal bunt (Neovossia indica) of wheat. Tests of
Agrochem. And Cultiv., 23: 6-7.
Chahal S. S, K. S., Aulakh and S. B. Mathur. 1993. Germination of teliospores of
barclayana, the causal agent of kernel smut of rice, in relation to some
physical factors. J. Phytopathol. 137:301–8.
123
Chona ,B L., R.L. Munjal and K. L. Adlakha (1961). A method of screening wheat
plants for resistance to Neovossia indica. Indian Phytopathol. 14: 90–101.
Chhuneja P, Kaur S, Singh K, Dhaliwal H.S (2008). Evaluation of Aegilops
tauschii (L.) Germplasm forKarnal Bunt Resistance in a Screen House with
Simulated Environmental Conditions. Plant Genetics Resources:
Characterization and Utilization doi:10.1017/S1479262108982654
CIMMYT. 1996. CIMMYT 1995/96 World Wheat Facts and Trends. Mexico, D.F.
Pp 33-38.
Datta , R., Hargit Singh, V. S. Gupta, P. K. Ranjekaro and H. S. Dhaliwal (1999).
Gene for gene relationship for resistance in wheat to isolates of Karnal bunt
(Neovossia indica). Plant Breeding 118: 362-364.
Dhaliwal, H. S., M. R. Navarrete and J. C. Valdez. 1989. Scanning electron
microscope studies of penetration mechanism of Tilletia indica in wheat
spikes. Rev. Mex. Fitopatol, 7: 150-155.
Diekmann, M.1987. Monitoring the presence of Karnal bunt (Tilletia indica) in
germplasm exchange at (ICARDA). Phytopathologia Mediterranea, 26, 59-
60.
Durán R. and G .W. Fischer . (1961) The Genus Tilletia. Pullman, WA:
Washington State University, Seattle (US). 138pp.
124
Duran R. 1987. Ustilaginales of Mexico.Taxonomy, symptomology, spore
germination and basidial cytology. Pullman, WA: Wash. State Univ. 331
pp.
Ehsan-Ul-Haq, U. R. Rehman and J. I. Mirza. 2002. Prevalence of karnal bunt of
wheat in NWFP (Pakistan). Intern. J. Agric. Biol., 4: 150-152.
Fuentes-Dávila, G., S. Rajaram & G. Singh, 1995. Inheritance of resistance to
Karnal bunt (Tilletia indica Mitra) in bread wheat (Triticum aestivum L.).
Plant Breed 114: 250–252.
Gartan, S. L., Basandrai, A. K. and S. C. Sharma. 2004. Identification of multiple
resistance sources for rusts, powdery mildew and Karnal bunt in wheat.
Crop Improvement, 31: 136-140.
Gill, K.S, A.S. Randhawa, S.S. Aujila, H.S. Dhaliwal, A.S. Grewal and I. Sharma.
1981. Breeding Wheat varieties resistant to karnal bunt.. Crop Improve,
82:73-80.
Goates, B. J. 1988. Histology of infection of wheat by Tilletia indica, the Karnal
bunt pathogen. Phytopathology, 78: 1434-1441.
Gogoi, R., D. V. Singh, K. N. Srivastava, S. M. S. Tomar, and K. D. Srivastava.
2002. Morphological and isozymic variations among Karnal bunt resistant
and susceptible genotypes of wheat - a comparison. Acta-Phytopathologica-
et-Entomologica-Hungarica, 37: 99-108.
125
Gomez, K. A. and A. A. Gomez. (1984). Statistical Procedures for Agricultural
Research. Wiley, New York.
Hoffmann, J.A.1983. karnal bunt of wheat. Phytopathology 73:782, (Abstr.)
Iftikhar, K., M.B. Ilyas, M.A.R. Bhatti and M. Arshad. 1988. Evaluation of wheat
inoculation techniques with Neovossia indica and screening of wheat
germplasm against the pathogen. Pak. J. Agri. Sci., 24(4): 368-375.
Ilyas, M.B., K. Majeed and K. Iftikhar, 1989b. Survey of Karnal bunt diseases of
wheat in the Punjab. Pak. J. Phytopath., 1(1-2): 48-51.
Ilays, M.B., K. Iftikhar and M. Arshad. 1989a. Chemical control of Karnal bunt of
wheat. Pak. J. Phytopath., 1(1-2):20-25.
Inman A. J., K. J. D. Hughes and R. J. Bowyer. 2003. EU/EPPO Recommended
Protocol For the Diagnosis of a Quarantine Organism: Tilletia indica.
http://www.csl.gov.uk/science/organ/ph/diagpro/tipro.pdf.
Jafari, H, M. Torabi and A. Alizadeh.1999. Study on Tilletia indica the causal
agent of partial bunt in Iran. Seed-and-Plant. 15:262-279.
Jafari, H., M. Torabi and A. Alizadeh. 2000. Evaluation of resistance of some
advanced cultivars/lines of wheat to Tilletia indica, the causal organism of
Karnal bunt. Seed and Plant, 15: 296-312.
126
Jatav, A. L., Singh, C. B. A. A. Khan and C. P. Sachan. 2003. Effects of Karnal
bunt disease infection on the germination, tillering and yield of wheat.
Progr. Agric., 3: 145.
Javaid, A. and Tehmina, A. 2005. Wheat and rice diseases in Pakistan and their
management: a review. Inten. J. Biol. and Biotech., 2: 785-791
Joshi,L.M., B.L. Renfro,E.E. Sarri, R.D.Wilcoxson, and S.P. Raychaudhuri.1970.
rust and smut diseases of wheat in india.plant Dis. Rep.54:391-394.
Kaur, S., and G. S. Nanda. 2002 . Identifying differential susceptibility to Karnal
bunt in bread wheat. Crop Improvement, 29: 164-168.
Krishna, A., and R. A. Singh. 1982. Effect of physical factors and chemicals on the
teliospore germination of Neovossia indica. Ind. Phytopathology, 35: 448-
455.
Kronstad, W. E. 1998. Agricultural development and wheat breeding in the 20th
century. In: H. J. Braun, F. Altay, W. E. Kronstad, S. P. S. Beniwal and A.
McNab (eds). Wheat: Prospects for Global Improvement. Proc. of the 5th
Int. Wheat Conf., Ankara, Turkey. Developments in Plant Breeding, vol.
6. Kluwer Academic Publishers. Dordrecht. PP 1-10.
Kumar, J. and S. Nagarajan. 1998. Role of flag leaf and spike emergence stage on
the incidence of Karnal bunt in wheat. Plant Dis., 82: 1368-1370.
Kumar, J., M. S. Saharan, A. K. Sharma and S. Nagarajan. 2003. Effect of
temperature on teliospore germination in Tilletia indica under simulated
127
conditions and its relevance in pest risk analysis in wheat. Indian-
Phytopathology, 56: 14-21.
Kumar, M., O. P. Luthra, V. Chawla, R. Arya. 2002. Genetics of resistance to
Karnal bunt of wheat [Neovossia indica (Mitra) Mundkur]. Ind. J. Genetics
and Plant Breeding, 62: 113-115.
Kumar, M., O. P. Luthra, V. Chawla, N. R. Yadav, R. Kumar and A. Khar. 2003.
Genetic analysis of Karnal bunt (Neovossia indica) resistance in wheat. J.
Biosci. 28: 199–203.
Kumar, M., O. P. Luthra, N. R. Yadav, Lakshmi Chaudhary, Navinder Saini,
Rajiv Kumar, Indu Sharma and V. Chawla.2007. Identification of micro
satellite markers on chromosomes of bread wheat showing an association
with karnal bunt resistance. African Journal of Biotechnology. 6:1617-
1622.
Marshall, D., T. T Work and J. F. Cavey. 2003. Invasion pathways of Karnal bunt
of wheat into the United States. Plant-Disease, 87: 999-1003.
Mehdi, V., L. M. Joshi, and Y. P. Abrol. 1973. Studies on chapati quality VI.
Effect of wheat grains with bunts on the quality of chapaties. Bull. Grain
Tech., 11: 195-197.
Mirza, J. I., 2005. Identification of sources of resistance to Karnal bunt disease of
wheat ALP-Wheat Umbrella Component-IV. Final Progress Report of the.
Crop Disease Research Program, Institut of Plant and Environmental
Protection. National Agricultural Research Centre Islamabad. pp1-40.
128
Mitra, M. 1931. A new bunt of wheat in India. Ann. Appl. Biol., 18: 178-179.
Monika, S., G. S. Nanda, I. Sharma, V. S. Sohu. 2004. Qualitative approach to
study Karnal bunt inheritance in bread wheat (Triticum aestivum L.). J.
Res., Punjab Agric. Univ., 41: 1-7.
Mujeeb- Kazi, A. 2008. Integrated-plant-disease-management Challenging
problems in horticultural and forest-pathology, Solan, India, 6:14 -15.
Mujeeb-Kazi, A., D. Fuentes, G. Davilla, A. Gul and J. I. Mirza. 2006. Karnal bunt
resistance in synthetic hexaploid wheats (SH) derived from durum wheat x
Aegilops tauschii combinations and in some SH x bread wheat derivatives.
Cereal Res. Communication, 34: 1199-1205.
Mujeeb-Kazi A, Fuentes-Davila G, Villareal RL, Cortes A, Rosas V and Delgado
R (2001) Registration of 10 synthetic hexaploid wheat and six bread wheat
germplasms resistant to Karnal bunt. Crop Science 41: 1652–1653.
Pannu, P.P.S and S.S. Chahal (2000). Variability in Tilletia indica, the incidence of
Karnal bunt of wheat. Indian Phytopathology 53(3): 279-282.
Rajaram, S. 1999. Opening Remarks: Historical Aspects and Future Challenges of
an International Wheat Program. In: Proceedings of the 5th International
Septoria Workshop 20-24 September 1999. Wheat Program, CIMMYT, El
Batan, Mexico.
129
Riccioni1, L., M. Giuseppe, D. Giambattista1, and A. Porta-Puglia. 2006. Emmer
wheat, a potential new host of Tilletia indica. European Journal of Plant
Pathology 116:167–170.
Riccioni, L., A. Inman, H. A. Magnus, M. Valvassori, A. Porta-Puglia, G. Conca,
G. Di Giambattista, K. Hughes, M. Coates, R. Bowyer, A. Barnes, C. E.
Sansford, J. Razzaghian, A. Prince and G. L. Peterson (2008).
Susceptibility of European bread and durum wheat cultivars to Tilletia
indica. Plant Pathology 57(4): 612-622.
Röder, M.S., V. Korzun, K. Wendehake, J. Plaschke, M.H. Tixier, P. Leroy, and
M.W. Ganal. 1998. A microsatellite map of wheat. Genetics 149:2007–
2023.
Rosegrant, M. W., A. Agcaoili-Sombilla and N. Perez. 1995. Global Food
Projections to 2020. Implications for Investment, Food, Agriculture and
the Environment. Discussion paper 5. Washington, D.C., IFPRI. Pp 1-54.
Royer M.H. and J.L Rytter (1985). Artificial inoculation of wheat with Tilletia
indica from Mexico and India. Plant Diseases 69(4):317–319.
Saghai-Maroof M.A, Soliman K.M, Jorgensen R.A, Allard R.W (1984).
Ribosomal DNA spacer length polymorphism in barley: Mandelian
inheritance, chromosomal location and population dynamics. Proc. Nat.
Acad.Sci. (USA). 81: 8014-8018.
130
Saleem, A. and K.M. Akhtar. 1988. Karnal bunt of wheat in Pakistan. National
Seminar on the role of plant health and care in Agriculture Production.
Held on Dec. 28-29. at University of Agriculture Faisalabad, Pakistan.
Satvinder-Kaur and G.S. Nanda (2002). Identifying differential susceptibility to
Karnal bunt in bread wheat. Crop Improvement 29(2): 164-168.
Shakoor, M. A., M. A. Khan, M. J. Arif, N. Javed, M. B. Ilyas, M. Arshad and S.
T. Sahi (2008). Incidence of Karnal bunt disease of wheat in various
districts of Punjab during 2006 and 2007 crop years. Pak. J. Phytopathol.
20(2): 190-194.
Sharma, A. K., D. P Singh, J. Kumar, I. Sharma and B. K Sharma. 2005. Efficacy
of some new molecules against Karnal bunt (Tilletia indica) of wheats
(Triticum aestivum and T. durum). Indian J. Agric. Scie., 75: 369-370.
Sharma, B. K., A. K. Basandrai and K. D. Sharma. 2001. Pathogenic variations in
Neovossia indica and sources with multiple disease resistance in different
wheats. Crop Improvement, 28: 99-104.
Sharma, I., N. S. Bains and G. S. Nanda. 2004. Inheritance of Karnal bunt-free trait
in bread wheat. Plant Breeding, 123: 96-97.
Sharma, I., N. S. Bains, G. S. Nanda and D. R. Satija. 2003. Incorporation of
Karnal bunt resistance in wheat variety, PBW 343. Crop-Improvement, 30:
21-24.
131
Sharma, I., N. S. Bains, S. Kuldeep and G. S. Nanda. 2005. Additive genes at nine
loci govern Karnal bunt resistance in a set of common wheat cultivars.
Euphytica, 142: 301-307.
Sharma, S. K. D. V. Singh, A. Rashmi and K. D. Srivastava. 2002. Pathogenic and
biochemical variations in Neovossia indica. Indian Phytopathology, 55:
133-139.
Sharma, A.K., D. P. Singh, J. Kumar, I. Sharma, and B. K. Sharma. 2005. Efficacy
of some new molecules against Karnal bunt (Tilletia indica) of wheats
(Triticum aestivum and T. durum). Indian J. of Agri. Sci. 75: 369-370.
Sharma,B. K., A. K. Basanerai, K. D. Sharma. 2004. Variability in Neovossia
indica and sources of multiple disease resistance in Triticum spp. and allied
genera. J. Mycol. and Plant Pathol., 34: 33-36.
Sidhu, M. C., C. K. Satija and I. Sharma. 2001. Screening of wheat-rye addition
lines for Karnal bunt resistance. Crop Improvement, 28: 214-217.
Singh, S., G.L. Brown-Guedira, T.S. Grewal, H.S. Dhaliwal, J.C. Nelson, H.
Singh, and B.S. Gill. 2003. Mapping of a resistance gene effective against
Karnal bunt pathogen of wheat. Theor. Appl. Genet. 106:287–292.
Singh, B., N. Singh; P. P. S. Pannu, S. S. Chahal. 2001. Occurrence of Karnal bunt
of wheat in Punjab. India, Plant-Disease-Research. 16(2): 266- 267.
132
Singh, R. P., H. M. William, J. H. Espino and G. Rosewarne. 2004b. Wheat rust in
Asia: Meeting the challenges with old and new technologies. In:
Proceedings of the 4th International Crop Science Congress, 26 Sep – 1
Oct 2004, Brisbane, Australia.
Singh D. V., K. A. Siddiqui, R. Aggarwal, K. D. Srivastava, A. K. Maurya and P.
Arora, 1990. Extraction of teliospores of Neovossia indica from the soil
mixed with the teliospores. Indian Phytopathol. 43: 500-503.
Singh, G., S. Rajaram, K.J. Montoya & G. Fuentes-Davila, 1995a. Genetic analysis
of karnal bunt resistance in 14 Mexican bread wheat genotypes. Plant
Breed 114: 439–441.
Singh, G., S. Rajaram, J.Montoya & G. Fuentes-Davila, 1995b. Genetic analysis of
resistance to Karnal bunt (Tilletia indica, Mitra) in bread wheat. Euphytica
81: 117–120.
Singh, D. P. V. C. Sinha, L. B. Goel, I. Sharma, S. S Aujla, S. S. Karwasra, M. S.
Beniwal, S. Amerika K. P. Singh, A. N. Tewari, P. S. Bagga, B. K. Sharma,
D. V. Singh, K. D. Srivastav, A. Rashmi and B. R. Verma. 2003.
Confirmed sources of resistance to Karnal bunt in wheat in India. : Plant
Dis. Res. Ludh., 18: 37-38.
Singh, D. V., R. Agarwal, J. K. Shrestha, B. R. Thapa and H. J. Dubin. 1989. First
report of Tilletia indica on wheat in Nepal. Plant Dis., 73: 273.
Singh, R. A. and A. Krishna. 1982. Susceptible stage for inoculation and effect of
133
Karnal bunt on viability of wheat seed. Ind. Phytopathol, 35: 54-56.
Singh, R. N., R. P. Singh and A. P. Singh. 2001. Effect of karnal bunt infection on
carbohydrate and protein content of wheat grain. J. Appl. Biol., 11: 48-52.
Singh, R., M. S. Beniwal and S. S. Karwasra. 2000. Field evaluation of fungicides
against Karnal bunt of wheat through foliar spray. Tests of Agrochem. and
Cultiv., 21: 9-10.
Singh. N., R. K. Behl, M. S. Punia and V. Singh. 2002. In vitro screening and
production of Karnal bunt resistant doubled haploids in wheat. Wheat
Information Service, 94: 5-8.
Smilanick, J. L., J. M. Prescott, J.A. Hoffman, L. R. Secrest, and K. Weise (1989).
Environmental effects on survival and growth of secondary sporidia and
teliospores of Tilletia indica. Crop Prot. 8:86-90.
Steel, R. G. D., J. H. Torrie, and D. Dickey. 1997. Principles and Procedures of
Statistics. 3rd Edition. Mc Graw Hill, New York, U.S.A.
Thinggaard, K and V. Leth. 2003. Use of the fluorochrome vital dye acridine
orange to determine viability and germination of Tilletia indica teliospores
in soil. Seed Sci. and Technol., 31: 329-340.
Van der Plank, J. E. (1968). Disease Resistance in Plants. Academic Press, New
York.
Varshney, J. L, G. Ashok and K. Rajendra. 2004. Incidence of Karnal bunt in seed
lots from major wheat growing areas of the country. Seed Res., 32: 69-71.
134
Warham, E. J., Mujeeb-Kazi, A. and V. Rosas. 1986. Karnal Bunt (Tilletia indica)
resistance screening of Aegilops species and their practical utilisation for
Triticum aestivum improvement. Can. J. Plant Pathol., 8: 65-70.
WCMC, 1991. Biodiversity guide to Pakistan. A report for IUCN – The World
Conservation Union. World Conservation Monitoring Centre. Pp 32.
Zadoks, J.C., T.T. Chang, and C.F. konzak. 1974. A decimal code for growth
stages of cereals. Weed Research. 14: 415-421.
Recommended