View
43
Download
0
Category
Tags:
Preview:
DESCRIPTION
Molecular Genetics & Gene Function. NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS. Concepts We Already Know:. Chromosomes Genome Genes Central Dogma of Molecular Biology DNA, RNA, proteins Hershey-Chase experiment Mendel’s laws of heredity Alleles - PowerPoint PPT Presentation
Citation preview
Molecular Genetics & Gene Function
NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC PROCESS
Concepts We Already Know:
ChromosomesGenome GenesCentral Dogma of Molecular BiologyDNA, RNA, proteinsHershey-Chase experimentMendel’s laws of heredity Alleles Heterozygous vs. Homozygous
Transcription:DNA mRNA Translation:
mRNA protein
Regulation: DNA switched on
. .
Human Genome100%
transcribed
transcribed, both strands
Messenger RNAs ~ 2%
Mattick, J., Human Molecular Genetics, 2006, Vol. 15, Review Issue 1
The structure of DNA:
Meaning of a genetic code Proteins
variable sequence (string) built of 20 amino acids (building blocks)
strings of amino acids fold up into particular shape
Shape governs the Function (Meaning)
1) DNA encodes RNA2) RNA encodes Proteins3) Proteins encode shape / function
Genetic information (the MEANING) is encoded in the SEQUENCE of basis along the DNA strand;DNA is not a direct template for protein synthesis;
The Central Dogma of Molecular Biology:
DNA RNA Protein
The Codon Code
Triplets of RNA bases translate to particular amino acids. Triples are called Codons.
Codons are three-base strings, so the number of possible codons are theoretically 4·4·4 = 64
What is the biological significance of the extensive redundancy of the genetic code ???
There are 20 amino acids
This includes the 1 START codon (Methionine)
The 3 STOP codons don't code for amino acids
The Central Dogma of Molecular Biology
. . . AAAGCTTTTTATGCGTTCAAG . . .
. . . AAAGCUUUUUAUGCGUUCAAG . . .
Lys Ala Phe Ala Phe LysTyr
Essential amino acids:• Isoleucine, • Leucine, • Lysine, • Methionine, • Phenylalanine, • Threonine, • Tryptophan• Valine.
Real Genes: Globinfind the start site
atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc atggtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc
Real Genes: Globinnow find the stop codon
atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc
START of globin
Real Genes: Globin atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc
STOP of globin
atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg ctggtggtctacccttggacccagaggttctttgagtcctttggggat ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt cctttgttccctaagtccaactactaaactgggggatattatgaaggg ccttgagcatctggattctgcctaataaaaaacatttattttcattgc
Activity: Sickle cell anemia
DNA-based life is Chemical & Meaningful
Chemical: Molecules that encode hereditary information are complex, yet built out of the same atomic set: in particular C, H, O, N, P, and S.
Meaningful: Sequences or strings of bases encode meaningful information (govern structure & function of proteins).
DNA-based life is Improbable & Historical
Improbable: Likelihood of 2 DNA sequences being equal by chance is exceedingly small.
Historical: If you took at two people and compare a small stretch of their DNA, the chance that that small stretch agrees in all but one base pair is extraordinarily tiny if due to pure chance. It is far more likely that the correct explanation should be that all humans are related by some sort of process of inheritance. Inheritance implies ancestry, which in turn implies history.
Humans share ~99.8 % of DNA with one another,~98% of DNA with chimpanzees (our closest living relatives),
and some fraction of DNA with all life on Earth.
DNA-based life is Improbable & Historical
Probability: one way of quantifying what outcomes are liable to be observed
Probability P = (number of outcomes of interest) / (number of possible outcomes)
Always a number between zero and one P(A OR B OR C) = P(A) + P(B) + P(C)
P(A AND B AND C) = P(A) x P(B) x P(C)
What is a virus?
DNA or RNA molecule carrying virus’ genetic code
Encapsulated into protective protein shell (capsid)
Viruses generally cannot self-replicate
So they hijack the cell’s machinery
New Central Dogma of Molecular Biology:
Ex: HIV is a strand of RNA capable of transferring its information “backwards” into the cell’s DNA.
DNA RNA Protein
Vaccines against Viral Infections
Potential Problem: The vaccine version of the virus reverts to a virulent form.QUESTION: Suppose the chance of a base mutating is 20%, and chance to mutate back to original base is 1/3. What is the chance that base in a modified virus will revert back to what it was originally? QUESTION: Some poliovirus vaccines involves 5 effective mutations that weaken the virus. Imagine that the vaccine is administered to 5,000,000 people. How many people are liable to be infected by harmful polio that originates from a reversion of the vaccine?
BLASTING DNAGroup Activity
http://serc.carleton.edu/microbelife/k12/bioinformatics/index.html
ACTIVITY: BIOINFORMATICS
Mammals that have been sequenced (cont)
Organism Type Genome sizeNumber of
genes predicted
Year of completion
Ailuropoda melanoleuca
Giant panda 2.4Gb[104] 19,300
Bos primigenius taurus
Cow 2.92 Gb 21,000[105] 2009[106]
Callithrix jacchus
Marmoset 2.78 Gb 21,200[107] 2010
Canis lupus familiaris
Dog 2.4 Gb[108] 19,300[108] 2005[108]
Cavia porcellus Guinea Pig 2.72 Gb 18,650
Equus ferus caballus
Horse 2.1 Gb 20,436[109] 2007[110]
Felis silvestris catus
Cat 3 Gb 20,285 2007[111]
Gorilla gorilla Gorilla 3.04 Gb 20,803[112] 2008,2010
Source: wikipedia.org
Mammals that have been sequenced (cont)
Organism Type Genome sizeNumber of
genes predicted
Year of completion
Homo sapiens Human 3.2 Gb[113] 20,251 (UniProt)
Draft 2001[114][115]
Complete 2006[116]
Loxodonta africana
African Elephant 3.2 Gb 20,000 2009[117]
Macaca mulatta Rhesus Macaque 3.09 Gb 21,800[118] 2007[119]
Monodelphis domestica
Gray Short-tailed Opossum 3.5 Gb 19,400[120] 2007[121]
Mus musculusStrain: C57BL/6J Mouse 2.5 Gb 22,700[122] 2002[124]
Myotis lucifugus Little Brown Bat 1.96 Gb 13,659 2010[125]
Source: wikipedia.org
Mammals that have been sequenced (cont)
Organism Type Genome sizeNumber of
genes predicted
Year of completion
Ornithorhynchus anatinus
Platypus 1.9 Gb 18.600[126] 2007[126]
Oryctolagus cuniculus
Rabbit 2.7 Gb 19,000[128] 2010
Pan troglodytes Chimpanzee 3.35 Gb 19,700[129] 2005[130]
Pongo pygmaeus/Pongo abelii
Orangutan (Borneo/Sumatra)
3.08 Gb 20,100[131] 2011[132]
Rattus norvegicus
Rat 2.8 Gb 23,000[133] 2004[134]
Source: wikipedia.org
Other Vertebrates That have been Sequenced
Organism Type Genome size Number of genes predicted
Year of completion
Anolis carolinensis
Green anole lizard 1.74 Gb[135] [136] 2007 (6.3/6.8x)
Callorhinchus milii
Elephant shark 0.9 Gb 15,000[138] 2007 (survey 1.4x)
Danio rerio Zebrafish 1.4 Gb 24,200[139] 2007
Gadus morhua Atlantic cod 608 Mb 20,095[140] 2011
Gallus gallus Chicken 1.08 Gb 17,000[141] 2004[142]
Gasterosteus aculeatus
Three-spined stickleback
460 Mb[143] 20,800[143] 2006
Meleagris gallopavo
Wild turkey 1.04 Gb[144] 17,500[144] 2011
Source: wikipedia.org
Other Vertebrates That have been Sequenced
Organism Type Genome size Number of genes predicted
Year of completion
Taeniopygia guttata Zebra finch 1.2 Gb 18,447[148] 2010
Takifugu rubripes Puffer fish 390 Mb 22–29,000[145] 2002[147]
Tetraodon nigroviridis
Puffer fish 340 Mb[149] 22,400 (orig.),[149]
27,823 (UniProt) 2004[149]
Xenopus tropicalis
Western clawed frog
1.7 Gb 28,000[150] 2005
Source: wikipedia.org
Insects that have been sequenced
Organism Type Genome size Number of genes predicted
Year of completion
Acyrthosiphon pisum
Pea aphid 510 Mb <30,000[151] 2010[151]
Aedes aegypti Mosquito 1376 Mb 15,419[152] 2007[152]
Anopheles gambiae Mosquito 278 Mb 13,683[153] 2002[153]
Apis mellifera Honey bee 236 Mb 10,157[154] 2006[154]
Bombyx mori Moth(domestic silk worm) 530 Mb 2004[155]
Culex quinquefasciatus
Mosquito ? Mb 18,883 2010[156]
Source: wikipedia.org
Insects that have been sequenced (cont)
Organism Type Genome size Number of genes predicted
Year of completion
Drosophila melanogaster
Fruit fly 165 Mb 13,600[157] 2000[157]
Drosophila pseudoobscura
Fruit fly 139 Mb 11,000,[158]
15,948 (UniProt) 2005[158]
Pediculus humanus Sucking louse 108 Mb 10,773[159] 2010[159]
Tribolium castaneum
Strain:GA-2Beetle 204 Mb 16,404[160] 200
Source: wikipedia.org
Announcement:Your presentations are due by email Monday
night.
If they aren’t in by then you will not be permitted to present and your group will
get a ZERO.
Using DNA to our AdvantageGenetic Modification
Introduction of new DNA sequences into an organism to alter the genetic makeup
Introduces very specific characteristicsUse enzymes to manipulate DNA
Recombinant DNA - new form of DNA that is introducedGene cloning – splicing genes from a variety of species into
a host cellGene therapy – inserting, deleting or manipulating genes in
order to cure or lessen the effects of genetic diseases
Using DNA to our Advantage• Sequencing
• Compare nucleotide sequences from different cells• Analyze for similarities and differences
– PCR (polymerase chain reaction) copying selected segments of DNA
– Genetic fingerprinting– Cloning
Discussion Activity: GATTACA…our future?
It’s not so far off• The case of 23andme.com
39
What do you think?If you had the choice would you choose to
know your ‘genetic future’?
40
What do you think?Molecular biology scientists have developed a technique, which enables parents to select the sex of their future child.
This technique simply separates the X carrying sperms from the Y carrying sperms, and then inseminating females with the preferred sex chromosomes. This procedure is currently banned in Canada except for medical reasons. Potential parents with sex-linked diseases may choose to have a girl, avoiding the possibility of having a boy with
hemophilia, for example. Should sex selection for medical and non-medical reasons be available for parents in Canada or the rest of the world?
41
What do you think?In the movie clip, the genetic counselor tells the perspective parents:
“This child is still you, it is simply the best of you”. How do we understand that statement?
42
What do you think?• How would we as humans decide what are the
best genes to pass on?
43
What do you think?• How does nature select the best choice of
genes to pass on?
44
What do you think?• What are some of the implications of humans deciding which genes
should be selected for? Does such a selection put the entire human population at a greater risk?
45
What do you think?• In the short clip, the counselor is suggesting that one can screen for
alcoholism, baldness, etc., via genetics. How far are we from this level of technology today? Is it even plausible?
46
What do you think?• In the movie they state that Vincent will have a 60% chance of developing a
neurological condition, 42% of being manic depressive, 89% of having ADD, 99% of having heart disease. How accurate are these predictions for the various disorders?
47
What do you think?Why won’t Insurance cover the medical bills for Vincent?
Does that bring the ethical dilemma of DNA testing?
48
What do you think?Sperm and egg donation service agencies offer hope to infertile parents who hope to conceive their own children in the future. Sperm donation
is a relatively easy process, requiring no more than an hour’s time. However, donating eggs is a rather complicated task, requiring months of hormone therapy and minor surgical procedures to retrieve the harvested eggs. In addition, drugs injected into women cause their
ovaries to ovulate several eggs at once, greatly increasing the odds of developing cancer. To compensate for the ‘inconvenience’, women are given a large sum of money. Often, young, female college students are targeted for egg donations since they are considered more
educated and healthier that their older female counterparts. Do you think females should be compensated for donating their eggs? Why or why not? Is it appropriate for egg donation agencies to advertise for potential egg donors on college campuses?
49
Recommended