View
2
Download
0
Category
Preview:
Citation preview
Characterization of the
Mitochondrial Peptide Pβ
By
Wendy Tan
A Thesis submitted in conformity with the requirements
for the degree of Master of Science
Department of Biochemistry
University of Toronto
© Copyright by Wendy Tan 2018
ii
Characterization of the Mitochondrial Peptide Pβ by
Wendy Tan
Master of Science
Department of Biochemistry
University of Toronto
2018
ABSTRACT
Mitophagy, the degradation of damaged mitochondria, and mitochondrial
biogenesis, the formation of new mitochondria, are two critical mitochondrial quality
control pathways that maintain a healthy mitochondrial network and thus a healthy cell.
We propose that the mitochondrial protease presenilins-associated rhomboid-like (PARL)
coordinates these two processes. PARL undergoes regulated cleavage, termed β
cleavage, in response to mitochondrial stress to produce N-terminally cleaved β PARL
and a 25 amino acid peptide, Pβ. We have recently demonstrated that β PARL promotes
mitochondrial fragmentation and has reduced proteolytic activity for a key component of
PINK1/Parkin-mediated mitophagy, PINK1, which may instigate mitophagy. In contrast,
Pβ’s putative role and mechanism of action in mitochondrial biogenesis remains poorly
defined. In this thesis, I determined that the mitochondrial Pβ peptide translocates to the
nucleus where it associates with chromatin. Together, these results further support PARL
as a key coordinator of mitophagy and mitochondrial biogenesis.
iii
ACKNOWLEDGEMENTS
I entered research only thinking about studying mitochondria. It doesn’t escape me
how lucky I am to have gotten to study the organelle that I love in such a supportive and
academically rigorous environment. The largest stroke of luck was meeting my
supervisor, Dr. Angus McQuibban, who took a chance on me, both as an undergraduate
and graduate student. He has been equal parts optimistic and analytical, and I’ve learned
a lot from him, both as a researcher and as a person. I am incredibly grateful for his
patience, time, guidance, honesty, and support.
I would also like to thank my supervisory committee members, Dr. Alex Palazzo
and Dr. Anurag Tandon. Alex and Anurag have been incredibly generous with their
reagents, but more importantly with invaluable their scientific suggestions and guidance.
Alex has always kept his door open for me when I was stumped and has given me
excellent scientific and life advice. Likewise, Anurag’s unique expertise and perspectives
have been instrumental to my thesis.
Additionally, I would like to extend my gratitude to all the past and present
members of the McQuibban lab, who’ve shared their intelligence, enthusiasm, and
cheerfulness with me. I’m incredibly lucky to have met them. I am especially thankful to
the original Team PARL: Dr. Guang Shi and Navdeep Deol. Guang was my first mentor
when I was a clueless undergrad and has continued to brainstorm with me and give me
countless pep talks when I was pessimistic (i.e. often). And thank you to Dr. Eliana Chan,
whose kind words of encouragement continue to be a strong source of motivation for me.
My gratitude also extends to the many friends and professors I’ve met along the
way in the University of Toronto research community who’ve shared their knowledge,
time, concerns, laughter, reagents, advice, and unwavering support.
Finally, I’d like to thank my parents and family. My parents, who’ve instilled in me
an enthusiasm for learning, are going grey from constantly worrying for me. Nevertheless
they are also constantly and selflessly supporting me and encouraging me to follow my
passions. Thank you for loving and trusting me, I am going to do my absolute best to be
a daughter you can be proud of.
iv
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ..……………….…………………………………………………………………………….iii
TABLE OF CONTENTS …..….………………………………………………………………………………………….iv
LIST OF FIGURES ………………………………………………………………………………….………..……………vii
LIST OF ABBREVIATIONS…………………………......………………………………………………..…………viii
CHAPTER 1: INTRODUCTION ................................................................................................ 1
1.1 Mitochondrial Biology ...................................................................................................................... 1
1.1.1 The Mitochondrial Genome .......................................................................................... 1
1.1.2 Mitochondrial Organization ........................................................................................... 2
1.2 Mitochondrial Function ................................................................................................................... 4
1.2.1 Energy Production ........................................................................................................... 4
1.2.2 Cell Death .......................................................................................................................... 5
1.3 Mitochondrial Dysfunction in Parkinson’s Disease ................................................................ 6
1.4 Mitochondrial Quality Control ....................................................................................................... 7
1.4.1 Mitochondrial Dynamics ................................................................................................ 8
1.4.2 PINK1/Parkin-mediated Mitophagy ............................................................................ 9
1.4.3 Mitochondrial Biogenesis ............................................................................................ 13
1.4.4 Coordination of Mitophagy and Mitochondrial Biogenesis ................................ 17
1.4.4.1 Parkin................................................................................................................ 17
1.4.4.2 PGC-1α ............................................................................................................ 18
1.4.4.3 AMPK................................................................................................................ 18
1.5 The Mitochondrial Rhomboid Protease, PARL ..................................................................... 19
1.5.1 Identification of the Rhomboid Superfamily ........................................................... 19
1.5.2 Rhomboid Structure ...................................................................................................... 20
1.5.3 Identification of the Mitochondrial Rhomboid ........................................................ 21
v
1.5.4 The Mammalian Mitochondrial Rhomboid, PARL ............................................... 23
1.5.4.1 PARL α/β/γ Cleavage .................................................................................. 23
1.5.4.2 The Role of PARL in Mitochondrial Morphology ................................. 27
1.5.4.3 The Role of PARL in Apoptosis ................................................................ 27
1.5.4.4 The Role of PARL in Mitophagy and Parkinson’s disease ............... 28
1.5.4.5 The Role of PARL in Mitochondrial Biogenesis ................................... 29
1.6 Thesis Rationale ................................................................................................................ 30
CHAPTER 2: MATERIALS AND METHODS ................................................................ 31
2.1 Reagents ........................................................................................................................................... 31
2.1.1 Cell Culture and Transfection .................................................................................... 31
2.1.2 Chemical Reagents and Antibodies ......................................................................... 31
2.1.3 Plasmids ........................................................................................................................... 32
2.2 Subcellular Fractionations ........................................................................................................... 32
2.2.1 Abcam Subcellular Fractionation .............................................................................. 32
2.2.2 CSK Subcellular Fractionation................................................................................... 33
2.3 Chromatin Fractionations ............................................................................................................. 33
2.3.1 DNase-based Chromatin Fractionation .................................................................. 33
2.3.2 Acid-based Chromatin Fractionation ....................................................................... 34
2.3 Immunoprecipitation ...................................................................................................................... 34
2.4 Western Blotting ............................................................................................................................. 35
2.4.1 Protein Precipitation ...................................................................................................... 35
2.4.2 SDS-PAGE and Western Blotting ............................................................................ 35
CHAPTER 3: RESULTS ............................................................................................................. 36
3.1 Over-expressed Pβ localizes to the nucleus ......................................................................... 36
3.2 Endogenous Pβ localizes to the nucleus ................................................................................ 40
3.3 Endogenous Pβ associates with chromatin in SH-SY5Ys ................................................. 42
3.4 MG132 does not affect Pβ expression or localization ......................................................... 47
3.5 Endogenous PARL β cleavage occurs in absence of
mitochondrial stress in SH-SY5Ys ................................................................................................... 49
vi
CHAPTER 4: DISCUSSION ..................................................................................................... 51
4.1 Brief Summary of Results ............................................................................................................ 51
4.2 Model: PARL as a Coordinator of Mitophagy and Mitochondrial Biogenesis .............. 52
4.3 Perspectives .................................................................................................................................... 54
4.3.1 Pβ Translocates to the Nucleus ................................................................................ 54
4.3.2 Pβ Associates with Chromatin ................................................................................... 55
4.3.3 Experiments in SH-SY5Ys Produce Variable Results........................................ 56
4.3.4 Pβ: a Peptide with Purpose?...................................................................................... 57
4.4 Future Directions ............................................................................................................................ 58
4.4.1 What is the Phosphatase Responsible for β Cleavage? ................................... 58
4.4.2 What Allows Pβ Export from Mitochondria? .......................................................... 59
4.4.3 Does Pβ Undergo any Post-Cleavage Modifications? ....................................... 60
4.4.4 Does Pβ Interact with Other Proteins? ................................................................... 61
4.4.5 What Genes does Pβ Bind to? .................................................................................. 63
4.4.6 What is the Effect of Pβ on Mitochondrial Biogenesis? ..................................... 64
4.5 Conclusions ..................................................................................................................................... 65
REFERENCES ...................................................................................... Error! Bookmark not defined.66
APPENDIX .............................................................................................................................................. 66
vii
LIST OF FIGURES
Figure 1-1: Overview of mitochondrial structure and morphology........................... 2
Figure 1-2: Representation of PINK1/Parkin-mediated mitophagy ......................... 10
Figure 1-3 Representation of Mitochondrial Biogenesis ......................................... 16
Figure 1-4: PARL β cleavage is a disease-relevant regulatory event ..................... 26
Figure 3-1: Overexpressed Pβ localizes to the nucleus in HEK293s ...................... 38
Figure 3-2: Previous work from our lab demonstrates that PARL β cleavage
. is sensitive to OlA treatment in SH-SY5Ys ............................................ 40
Figure 3-3: Endogenous Pβ localizes to the nucleus in SH-SY5Ys ........................ 42
Figure 3-4: Overexpressed Pβ does not associate with chromatin in HEK293s ... 44
Figure 3-5: Endogenous Pβ associates with chromatin in SH-SY5Ys .................... 46
Figure 3-6: MG132 does not affect Pβ detection or localization in SH-SY5Ys ....... 48
Figure 3- 7: Endogenous PARL β cleavage occurs in the
. absence of mitochondrial stress in SH-SY5Ys ..................................... 50
Figure 4-1: Model of PARL coordination of mitophagy and
. mitochondrial biogenesis ........................................................................ 52
Figure 4-2: Pβ doublet and phosphorylated/unphosphorylated Pβ . .
. run at similar molecular weights ............................................................. 60
Table 1- 1: List of mitochondrial rhomboids and their putative substrates............ 22
viii
LIST OF ABBREVIATIONS
ΔΨm Mitochondrial membrane potential
Aβ42 Amyloid β 42
ABCB8/10 ATP-binding cassette (ABC) B8/B10
ADP Adenosine diphosphate
AMP Adenosine monophosphate
AMPK Adenosine monophosphate (AMP) kinase
ATP Adenosine triphosphate
CCCP Cyanide m-chlorophenyl hydrazone
Ccp1 Cytochrome c peroxidase 1
CICD Caspase-independent cell death
ChIP Chromatin immunoprecipitation
CRISPR Clustered regularly interspaced short palindromic repeats
DAPI 4',6-diamidino-2-phenylindole
DMSO Dimethyl sulfoxide
DRP1 Dynamin-related protein 1
Dyn2 Dynamin 2
EGF Epidermal growth factor
EMSA Electrophoretic mobility shift assay
ER Endoplasmic reticulum
ETC Electron transport chain
FADH2 Flavin adenine dinucleotide (hydroquinone form)
Fis1 Mitochondrial fission 1 protein
FOXO3 Forkhead box O3
HD Huntington’s disease
HtrA2 High-temperature requirement protein A2
ix
IMM Inner mitochondrial membrane
IMS Intermembrane space
IP Immunoprecipitation
MDL1 Multi-drug resistance-like 1
MiD49/51 Mitochondrial dynamics protein of 49/51 kDa
Mff Mitochondrial fission factor
Mgm1 Mitochondrial genome maintenance 1
MFN1/2 Mitofusin 1/2
MPP Mitochondrial processing peptidase
MPP+ 1-methyl-4-phenylpyridinium
MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine
MTS Mitochondrial targeting sequence
NADH Nicotinamide adenine dinucleotide (reduced)
NLS Nuclear localization sequence
NRF1/2 Nuclear respiratory factor 1/2
OlA Oligomycin A
OMM Outer mitochondrial membrane
OPA1 Dominant optic atrophy 1
OXPHOS Oxidative phosphorylation
Pβ PARL-β
PARL Presenilins-associated rhomboid-like
PD Parkinson’s disease
PDK2 Pyruvate dehydrogenase kinase 2
PDP1/2 Pyruvate dehydrogenase phosphatase 1/2
PGAM5 Phosphoglycerate mutase 5
PGC-1α/β Proliferator-activated receptor γ (PPARγ) coactivator-1 (PGC-1) α/β
PINK1 Phosphatase and tensin homolog (PTEN)-induced putative kinase 1
PKA Protein kinase A
x
PRC PGC-1-related coactivator
Rbd1 Rhomboid-1
ROS Reactive oxygen species
SIRT1 Silent information regulator 2 (SIR2) protein 1
STS Staurosporine
TIM Translocase of the inner membrane
TFAM Transcription factor A, mitochondrial
TFEB Transcription factor EB
TFB1M/TFB2M Transcription factor B1/2, mitochondrial
TMH Transmembrane helix
TOM Translocase of the outer membrane
UBL Ubiquitin-like
ULK1 Unc-51-like autophagy activating kinase 1
VDAC Voltage-dependent anion channel
WT Wild type
1
CHAPTER 1
INTRODUCTION
1.1 Mitochondrial Biology
The innocuously named mitochondria (coined by German anatomist Carl Benda in
1898; from the Greek mitos, “thread” and chondrion, “granule”) are central to complex
eukaryotic life as we know it1. Proper understanding of this vital organelle requires
understanding of its origin: mitochondria are derived from a bacterium of α proteobacterial
ancestry that was engulfed by a host cell of archaeal origin2–4. This ancient endosymbiotic
event occurred roughly 1.6 billion years ago and gave rise to all known eukaryotes5–8.
The endosymbiotic origin of mitochondria is evidenced most obviously by their unique
retention of genetic information and double membrane composition.
1.1.1 The Mitochondrial Genome
As semi-autonomous organelles, mitochondria possess their own genomes9–11.
Owing to their bacterial origin, mitochondrial DNA (mtDNA) in almost all multicellular
organisms is circular12. Human mtDNA is a 16 569 bp circular DNA molecule that tightly
sequences 37 genes: two rRNAs, 22 tRNAs, and 13 polypeptides coding for core
hydrophobic subunits of enzyme complexes in the oxidative phosphorylation (OXPHOS)
system13. OXPHOS is made up of the electron transport chain (ETC) (also known as the
2
respiratory chain; composed of Complexes I-IV) and ATP synthase (also known as
Complex V)11,13. The vast majority of mitochondrial proteins, including the machinery
required to transcribe and translate mtDNA, is encoded by the nuclear genome and
imported into mitochondria9–11.
1.1.2 Mitochondrial Organization
The double membrane structure of the mitochondrion was first visualized by
Palade and Sjöstrand independently through several high-resolution electron
micrographs, which were published in 1952 and 195314–17. These images revealed two
membranes dividing mitochondria into four distinct compartments: the outer mitochondrial
A
Elongated Mitochondrial Morphology Fragmented Mitochondrial Morphology
B
Figure 1-1: Overview of mitochondrial structure and morphology: A Transmission
electron micrograph of a mitochondrion. Mitochondria are composed of an outer
mitochondrial membrane (OMM), intermembrane space (IMS), inner mitochondrial
membrane (IMM) which forms cristae, and mitochondrial matrix. Adapted with
permission4. B Representative confocal immunofluorescence microscopy images of
mitochondrial morphology in mouse embryonic fibroblasts (MEFs), visualized by TOM20
immunostaining. Nuclei were stained with DAPI. When treated with vehicle control,
DMSO, elongated mitochondrial morphology is maintained. When treated with 100ng/mL
rotenone for 1 hour, mitochondrial morphology becomes fragmented. Reprinted with
permission50.
3
membrane (OMM); the intermembrane space (IMS), which is contained between the two
membranes; the inner mitochondrial membrane (IMM), which is folded in on itself to form
many ridges termed cristae; and the mitochondrial matrix, which is enclosed by the IMM
(Fig.1-1A)14–17.
However, these electron micrographs did not immediately expose the degree of
specialization of the two mitochondrial membranes. In the human liver, an estimated 6%
of total mitochondrial protein is located in the OMM18. Of this 6%, many proteins
embedded in the OMM are porins (transport proteins that form large aqueous channels)
and voltage-dependent anion channels (VDAC)18,19. As a consequence, ions and small
uncharged molecules less than 5 kilodaltons (kDa) freely pass through the OMM18,19 The
majority of mitochondrial proteins larger than 5 kDa contain an N-terminal mitochondrial
targeting sequence (MTS) that is comprised of an amphipathic α helix with a +3 to +6 net
charge20. The MTS is recognized by the translocase of the outer membrane (TOM), which
is the general transporter protein complex in the OMM21. Due to the porous nature of the
OMM, the IMS is chemically similar to the cytosol at a pH of approximately 719.
At first glance, the most prominent feature of the IMM is its convolutedness as it
forms many cristae which project into the mitochondrial matrix15,19. These convolutions
are so abundant that in the human liver, the IMM constitutes approximately one third of
total cell membrane18.
The other defining feature of the IMM is its extreme impermeability19,20. Unlike the
OMM, ions and other molecules require specific membrane-spanning transport
complexes to enter or exit the IMM18,21. In the human liver, these transport complexes
contribute to the 21% of total mitochondrial proteins found in the IMM18,21. In particular,
4
the high proportion of cardiolipin (up to 20% of the IMM), a phospholipid that is
characterized by four fatty acid chains rather than the conventional two, is a key
contributor to the IMM’s impermeability19,22. As a result, an electrochemical mitochondrial
membrane potential (ΔΨm) of approximately 180 mV is generated across the IMM by
many copies of the IMM-embedded ETC chain19. Consequently, the pH of the
mitochondrial matrix is approximately 7.919. In addition to being the driving force of ATP
production for aerobically respiring cells, maintenance of ΔΨm also determines the import
of many proteins into or across the IMM, including the OXPHOS machinery itself23. A
leading hypothesis is that ΔΨm electrophoretically positions the positively charged MTS
to initiate import across or into the IMM through the translocase of the inner mitochondrial
membrane (TIM)23.
1.2 Mitochondrial Function
Often referred to as “the Powerhouse of the Cell”, mitochondria are indeed critical
to energy production, as well as many other key cellular processes including metabolism
of fatty acids and amino acids, calcium signalling, heat production, various signalling
pathways, and cell death2. For the sake of brevity, only two of the mitochondrion’s many
important functions, energy production and cell death, are highlighted below.
1.2.1 Energy Production
As the generators of more than 90% of our cellular energy, the most prominent
responsibility of mitochondria is to produce energy in the currency of ATP by aerobic
respiration24,25. Ideally, pyruvate, the byproduct of glycolysis, is metabolized through the
tricarboxylic acid (TCA) cycle (also known as the Krebs cycle or the citric acid cycle) in
5
the mitochondrial matrix24. Although not as preferred, fatty acids and amino acids may
also feed into the TCA cycle24. Electron-rich reduced forms of nicotinamide adenine
dinucleotide (NADH) and flavin adenine dinucleotide (hydroquinone form) (FADH2) that
are produced by the TCA cycle and glycolysis transfer electrons to the ETC18. Energy
released by electrons passed down the ETC by a series of redox reactions is used to
pump H+ ions across the IMM to the IMS to generate and maintain the electrochemical
gradient, ΔΨm26,27. H+ ions are then channeled back into the matrix by ATP synthase,
which uses the electromotive force to drive phosphorylation of adenosine diphosphate
(ADP) to ATP19.
1.2.2 Cell Death
Mitochondria are less commonly referred to as the judge and executioner of the
cell28,29. In mammals, the best characterized mitochondria-centric cell death pathway is
intrinsic apoptosis, which is occasionally termed mitochondrial apoptosis29,30. Intrinsic
apoptosis is a controlled cell death pathway that activates in response to non-receptor-
mediated stimuli such as toxins, viral infections, and free radicals31. As the convergence
point for many apoptosis-inducing cues, mitochondria regulate apoptosis through
mitochondrial outer membrane permeabilization (MOMP), which is mediated by
oligomerization and pore formation by the proapoptotic proteins Bax and Bak32,33. MOMP
is considered the point of no return as it commits the cell to death30. This event releases
IMS proteins that promote apoptosis29. The most important of these is cytochrome c,
which activates the caspase protease cascade in the cytosol, which ultimately leads to
cell death32. In the absence of caspase activity, MOMP still results in cell death through
an ill-defined mechanism termed caspase-independent cell death (CICD)34.
6
1.3 Mitochondrial Dysfunction in Parkinson’s Disease
The importance of mitochondrial function in the eukaryotic cell is emphasized by
the commonality of mitochondrial dysfunction in various diseases3. Briefly, a few lines of
evidence implicating mitochondrial dysfunction in Parkinson’s disease (PD) etiology are
emphasized below.
PD is the most common neurodegenerative movement disorder; it affects a
growing estimate of 10 million people worldwide35,36. PD is characterized by progressive
deterioration of dopaminergic neurons in the substantia nigra, which contributes to
cardinal PD motor impairments36. Neurons are particularly sensitive to mitochondrial
dysfunction due to their high energetic demand, their need for high calcium buffering
capacity due to action potential-driven calcium influxes, and because their predominant
mode of energy production is by OXPHOS37. Dopaminergic neurons in the substantia
nigra are especially sensitive to mitochondrial stress, although the exact reasons remain
to be determined38.
The first causative association of mitochondrial dysfunction in PD pathogenesis
occurred when accidental infusions of the neurotoxin 1-methyl-4-phenyl-1,2,3,6-
tetrahydropyridine (MPTP) induced selective dopaminergic neurodegeneration and
resultant rapid onset of PD-like symptoms39,40. Although little evidence suggests that
MPTP itself is toxic, researchers later found that in glial cells, MPTP could be oxidized to
produce 1-methyl-4-phenylpyridinium (MPP+), which selectively inhibits Complex I of the
ETC39,40. Other Complex I inhibitors such as rotenone, pyridaben, trichloroethylene, and
fenpyroximate also cause dopaminergic neurodegeneration in various animal models41.
7
Consistent with this, Complex I activity is impaired in the substantia nigra of PD patients,
likely due in part to oxidative stress41. Notably, dopamine is a relatively unstable
neurotransmitter that can oxidize to generate dopamine quinone and reactive oxygen
species (ROS) which may in turn impair Complexes I and III of the ETC42. Aside from
obvious perturbations in the ETC and consequent energy production, Complex I
impairment also increases superoxide formation42. In line with this, postmortem brain
samples from PD patients have shown evidence of oxidative damage43.
Mutations in numerous genes that cause mitochondrial dysfunction also cause
familial forms of PD. PD-linked mutations in Parkin, PTEN-induced kinase 1 (PINK1), α-
synuclein, DJ-1, UCHL-1, LRRK2, NURR1, VPS35, and HtrA2 are all directly or indirectly
linked to abnormal mitochondrial function41. Some of these mutations are suggested to
affect core mitochondrial functions such as mitochondrial import or the ETC; still others
disrupt critical mitochondrial quality control pathways that protect the mitochondrial
network, and thus the cell, from damage41.
1.4 Mitochondrial Quality Control
The severe consequences of impaired mitochondrial function have driven the
evolution of several quality control mechanisms to maintain mitochondrial homeostasis.
These quality control systems vary dramatically in scale. For example, the
mitochondrion’s own proteolytic system degrades misfolded and oxidatively denatured
proteins within the mitochondrion44. Conversely, oxidized, damaged proteins may also be
enriched in mitochondrial-derived vesicles (MDVs) that bud off mitochondria and are
ultimately degraded by the lysosome45. Lastly, whole, severely damaged mitochondria
8
may be degraded by a specialized autophagic pathway termed mitophagy46. Highlighted
below are a few mitochondrial quality control pathways that affect the entire
mitochondrion.
1.4.1 Mitochondrial Dynamics
Between 1914 and 1915, Lewis and Lewis first described a key characteristic of
mitochondria: their dynamic network1,47. Of note, mitochondrial fission and fusion are
constant, regulated processes that are critical components of multiple mitochondrial and
cellular functions, including other mitochondrial quality control pathways48–50.
Mitochondrial fusion is suggested to be a first line of defense by diluting mitochondrial
damage across the mitochondrial network48. Conversely, mitochondrial fission resulting
in fragmentation is associated with dissipation of ΔΨm; it separates severely damaged
mitochondria to be subsequently degraded (Fig.1-1B)48,51. Fission facilitates and,
according to multiple studies, is required for mitophagy48,49.
In mammals, mitochondria fusion is mediated by dynamin-like GTPases:
membrane-bound mitofusin 1 (MFN1) and MFN2 for the OMM; and various isoforms of
optic atrophy 1 (OPA1) for the IMM48. In response to mitochondrial depolarization, long
isoforms of OPA1 are cleaved by the inducible protease OMA1 to inhibit fusion and thus
encourage mitochondrial fragmentation51,52. Additionally, initiation of mitophagy results in
MFN1/2 ubiquitination and proteasomal degradation, which further fragments damaged
mitochondria for eventual degradation53–55.
Mammalian mitochondrial fission is also driven by a pair of cytosolic dynamin-like
GTPases: Dynamin-related protein 1 (Drp1) and Dynamin 2 (Dyn2)56,57. Sites of
mitochondrial fission are initially marked by contact with the endoplasmic reticulum,
9
followed by recruitment of Drp1 by mitochondrial OMM receptor proteins: fission protein
1 (Fis1); mitochondrial fission factor (Mff); mitochondrial dynamics protein of 49 kDa
(MiD49); and MiD5158,59. Drp1 assembles on the OMM into a helical ring-like structure
that constricts the mitochondrion to a diameter of approximately 100nm48,56. Dyn2
subsequently completes mitochondrial constriction until fission occurs57. In addition to
fusion machinery degradation, mitophagy initiation also results in displacement of protein
kinase A (PKA), which inhibits Drp1 by phosphorylation, from mitochondria60. Drp1 and
fission machinery is also implicated in other processes, including apoptosis61,62
1.4.2 PINK1/Parkin-mediated Mitophagy
First reported and named in 2005 by Lemasters, mitophagy, which results in whole
degradation of mitochondria, is considered to be the last line of defense in mitochondrial
quality control63. Mitophagy is a mitochondria-specific subcategory of macroautophagy,
which is characterized by the engulfment of cargo by a double-membraned vesicle, the
autophagosome, which then fuses with the lysosome for degradation63,64. Since its fairly
recent discovery, mitophagy has burgeoned as a research field: multiple mitophagy
mechanisms have been identified and their pathophysiological roles in development and
disease have been heavily scrutinized46,64. The best studied mitophagy pathway is
PINK1/Parkin-mediated mitophagy, which is triggered by mitochondrial depolarization64.
There are some indications that PINK1/Parkin-mediated mitophagy also occurs under
basal conditions, however a recent 2018 study in PINK1 knockout mice suggests that this
pathway is unessential to basal mitophagy64,65. Much of this attention has stemmed from
PINK1 and Parkin’s implication in PD; mutations in the E3 ubiquitin ligase Parkin and the
10
mitochondrial Serine/threonine kinase PINK1 are the most common causes of autosomal
recessive PD66–68.
Suggestions that PINK1 and Parkin participate in the same mitochondrial
maintenance pathway were first raised by genetic studies in Drosophila melanogaster68–
72. Initial studies demonstrated that Parkin over-expression could partially rescue PINK1
deletion mutants but not vice versa, suggesting that PINK1 acts upstream of Parkin69–71.
Figure 1-2: Representation of PINK1/Parkin-mediated mitophagy: A PINK1/Parkin-
mediated mitophagy is inhibited in healthy polarized mitochondria by PINK1 import into
mitochondria for processing by MPP and PARL proteases, which releases cleaved PINK1
to the cytosol where it is rapidly degraded. B In damaged depolarized mitochondria,
PINK1 is instead stabilized on the OMM where it phosphorylates OMM proteins, ubiquitin
and Parkin, which is recruited to the OMM. Parkin in turn ubiquitinates OMM proteins,
which recruit the autophagic machinery necessary to target the damaged mitochondrion
for degradation.
A
B
11
The pathway was shown to be conserved and further elucidated in the mammalian
system73–75.
In healthy mitochondria, endogenous PINK1 protein levels are constitutively low
due to rapid degradation (Fig.1-2A)48. PINK1 is imported and anchored to the IMM by the
TOM and TIM transporters by its MTS, which is subsequently cleaved off by the
mitochondrial processing peptidase (MPP) in the matrix72,76. The serine protease,
presenilins-associated rhomboid-like (PARL) then cleaves PINK1 between A103 and
F104 in the IMM77–80. PARL-cleaved PINK1 is untethered from the IMM and relocalizes
to the cytosol, where it is rapidly degraded by the proteasome according to the N-end
rule77–81. Recently, one study has also proposed that the PINK1 cleavage product binds
to Parkin in the cytosol to inhibit Parkin mitochondrial localization and resultant
mitophagy82. Under normal conditions, Parkin exists in a compact native autoinhibited
conformation in the cytosol that is mediated by tight intramolecular association between
its ubiquitin-like (UBL) domain and C-terminal region83. The importance of this regulation
is highlighted by pathogenic Parkin mutations, K27N, R33Q, R42P, and A46P in the UBL
domain, that disrupt this autoinhibition83.
Mitochondrial damage leading to mitochondrial depolarization inhibits PINK1
import to the IMM (Fig1-2B)23,76,77. Instead, PINK1 is stabilized on the OMM of the
damaged mitochondrion with its kinase domain facing the cytosol by TOM, although
mechanistic details are still under active investigation76,84,85. Multiple studies have shown
that PINK1 kinase activity is required to recruit and activate Parkin84–86. Stabilized PINK1
phosphorylates Parkin’s linker region between the In-Between Ring and RING2 domains
at T175 and T217, which activates Parkin E3 ligase activity and recruits Parkin to
12
mitochondria74,87,88. PINK1 also phosphorylates both Parkin’s UBL domain and ubiquitin
at S6589–92. PINK1 phosphorylation of S65 in Parkin’s UBL domain is proposed to prime
Parkin for further activation by S65-phosphorylated ubiquitin (p-Ub)90. Rigorous
biophysical and structural studies collectively suggest that p-Ub binds to phosphorylated
Parkin with high affinity to allosterically induce conformational changes that promote its
E2 recruitment and further stimulate Parkin E3 ligase activity93–96. PINK1 is suggested to
phosphorylate monoubiquitin and/or polyubiquitin chains covalently conjugated to OMM
proteins at basal levels to further recruit Parkin, which has a high affinity for p-Ub97,98.
Recruited Parkin further ubiquitinates OMM proteins that are phosphorylated by PINK1,
thus forming a positive feedback loop84,97,98.
PINK1 has also been suggested to directly phosphorylate a number of other OMM
proteins. Of note, one study reported Miro1, a component of the primary motor/adaptor
complex that links mitochondria to the microtubule cytoskeleton, as a direct PINK1
substrate99. However, two other studies have been unable to replicate this result100,101.
Nevertheless, these studies agree that PINK1 and Parkin mediate Miro1 proteasomal
degradation to inhibit mitochondrial motility. Another study identified the OMM fusion
protein MFN2 as a PINK1 substrate at T111 and S442102. Chen and Dorn demonstrated
that PINK1-dependent MFN2 phosphorylation facilitates Parkin recruitment and resultant
mitophagy102. Others report MFN1/2 as targets for PINK1/Parkin-mediated proteasomal
degradation to promote mitochondrial fragmentation, which is a necessary primer for
mitophagy53–55.
Once recruited, Parkin conjugates OMM proteins with K48- and K63-linked
ubiquitin chains54,103. Sarraf et al. identified 36 Parkin OMM substrates with high
13
confidence, suggesting that chain-linkage types and density rather than specific
substrates target the damaged mitochondrion for mitophagic degradation103. This theory
is supported by the observation that ectopic PINK1 expression on peroxisomes was
sufficient to recruit Parkin and trigger pexophagy (peroxisome-specific autophagy)85. To
date, six ubiquitin-binding autophagy receptor proteins associated with mitophagy have
been identified: NBR1, NDP53, OPTN, p62/SQSTM1, TAX1BP1, and TOLLIP104. Studies
suggest that NDP52 and OPTN are essential and TAX1BP1 is important for
PINK1/Parkin-mediated mitophagy105,106. These receptors recruit autophagy machinery
necessary for autophagosome formation and eventual lysosomal degradation107.
1.4.3 Mitochondrial Biogenesis
Multiple studies have demonstrated that mitophagy has the capacity to clear most
or all mitochondria in the cell73,108,109. While mitophagy protects the cell from excessive
mitochondrial damage, persistent mitophagy resulting in mitochondrial depletion has an
equal repercussion: cell death109. Therefore it is critical for the cell to replace damaged
mitochondria by activation of the mitochondrial biogenesis program. Due to the
mitochondrion’s endosymbiotic origin, biogenesis of these organelles presents unique
challenges: firstly, mitochondria cannot be made de novo; secondly, mitochondrial genes
reside in both mitochondrial and nuclear genomes. As a result, mitochondrial biogenesis
is a complex, highly regulated coordination of several distinct processes including mtDNA
expression, synthesis and import of nuclear-encoded proteins, coordinated assembly of
mitochondrial complexes, expansion of OMM and IMM, and mtDNA replication110–112.
Mitochondrial biogenesis is regulated mainly at the level of transcription (Fig1-3).
The core controllers that modulate mitochondrial biogenesis are the proliferator-activated
14
receptor γ (PPARγ) coactivator-1 (PGC-1) family of transcriptional coactivators and the
transcription factors, nuclear respiratory factor 1 (NRF1) and NRF2113,114. The PGC-1
family is composed of PGC-1α, PGC1-β, and PGC-1-related coactivator (PRC)115. While
the PGC-1 family regulates overlapping mitochondrial gene expression programs, they
significantly differ in their physiological expression and modes of regulation115–117. PGC-
1α, the founding member of the family, is the best studied and suggested to be the most
regulated (Fig1-3)116,118; however, this observation may in part due to the emphasis of
study in adipocyte and muscle cell differentiation119. Both PGC-1α/β are ubiquitously
expressed, but at especially high levels in tissues with high metabolic demands, such as
heart, skeletal muscle, kidney, and brain tissue120–122. In contrast, PRC, the least
characterized member of the family, appears to be restricted to regulating mitochondrial
biogenesis in proliferating cells123. PGC-1α, and to a lesser extent PGC-1β, are
considered master regulators of mitochondrial biogenesis as they increase expression of
various key transcription factors, including NRF1/2, and act as their transcriptional
coactivators to stimulate activity (Fig1-3)124–126. While PGC-1α/β share many overlapping
mitochondrial gene targets, they have been shown through multiple studies to be
activated independently and affect mitochondrial biogenesis in an additive and
independent manner127,128.
Upon activation, the transcription factors NRF1/2 stimulate gene expression of
multiple key mitochondrial structures, including OXPHOS, mitochondrial transcription,
translation, protein import, and assembly machinery113,119,129,130. Critically, NRF1/2
coordinate nuclear and mitochondrial gene expression to facilitate OXPHOS assembly.
As their name suggests, the nuclear respiratory factors NRF1/2 bind to the promoters and
15
activate expression of the nuclear genes that encode subunits of the five respiratory
OXPHOS complexes and cytochrome c in a partially redundant manner131–133. NRF1/2
also regulate mitochondrial gene expression by directly activating genes encoding
mitochondrial transcription factor A (TFAM), mitochondrial transcription factor B1
(TFB1M), and TFB2M, which are crucial regulators of mtDNA transcription and
replication, and mitochondrial ribosome assembly (Fig1-3)129,131. As the majority of
mitochondrial proteins are nuclear-encoded, the synthesis of mitochondrial import
machinery is a crucial component of mitochondrial biogenesis. Importantly, NRF1/2 also
activate expression of TOMM20, a key receptor subunit of the main mitochondrial
translocase TOM that is involved with initial precursor protein recognition130,131.
Mitochondrial biogenesis is another mitochondrial quality control pathway whose
dysfunction is implicated in the pathogenesis of multiple neurodegenerative diseases.
PGC-1α and its downstream effectors are down-regulated in brain tissue of PD,
Alzheimer’s disease (AD), and Huntington’s disease (HD) patients114,134. Decrease in
PGC-1α in PD is partially owed to repressive PGC-1α promoter methylation134.
Additionally, one study demonstrated that polymorphisms in NRF1 and TFAM genes
significantly correlated with HD age of onset135.
16
Figure 1-3: Representation of Mitochondrial Biogenesis: Mitochondrial biogenesis is
controlled by many transcriptional regulators. One of these key master regulators, PGC-
1α, is activated by AMPK phosphorylation and SIRT1 deacetylation. In conjunction with
various transcription factors, including NRF1/2, PGC-1α/β upregulate nuclear
mitochondrial gene expression. The mitochondrial transcription factor Tfam, as well as
TFB1/2M, is also expressed and activate mtDNA transcription with PGC-1α. Coordinated
nuclear and mitochondrial protein expression, as well as protein import, complex
assembly, membrane expansion and mtDNA replication are necessary processes in
mitochondrial biogenesis.
17
1.4.4 Coordination of Mitophagy and Mitochondrial Biogenesis
The mitochondrial content of the cell is controlled by the balance between the
opposing processes of mitophagy and mitochondrial biogenesis. However, as mitophagy
and mitochondrial biogenesis have only gained attention within recent decades, the
additional regulatory layer of coordination between the two processes is still not fully
understood. While certain known coordinating mechanisms favor one pathway and
repress the other, the pathways highlighted below share the common characteristic of
activating both mitophagy and mitochondrial biogenesis to allow for efficient mitochondrial
turnover.
1.4.4.1 Parkin
The E3 ubiquitin ligase Parkin has been extensively studied in the context of
mitophagy; however, its participation in mitochondrial biogenesis was also determined in
the same time period69–71,136. Work from Kuroda et al. suggests that Parkin promotes
mitochondrial biogenesis by interacting with and enhancing TFAM mtDNA transcriptional
activity136. Moreover, a recent study from Shin et al. re-identified the Parkin interacting
substrate, PARIS (ZNF746), which is repressed by Parkin ubiquitination and degraded by
the ubiquitin-proteasome system137,138. PARIS inhibits mitochondrial biogenesis by
binding to PGC-1α’s promoter region to repress PGC-1α and its target genes (Fig1-3)137.
The authors emphasized the importance of PARIS in mitochondrial homeostasis and PD
by demonstrating that mice over-expressing PARIS displayed progressive loss of
dopaminergic neurons, which could be rescued by Parkin or PGC-1α over-expression.
Parkin inactivation in sporadic PD patients139–143 is suggested to contribute to
18
mitochondrial dysfunction by disrupting PINK1/Parkin-mediated mitophagy and by PARIS
accumulation resulting in PGC-1α repression110,144.
1.4.4.2 PGC-1α
Likewise, although PGC-1α is often described as a master regulator of
mitochondrial biogenesis, new evidence suggests that it also acts as an autophagy
regulator. In one HD mouse model study, researchers found that PGC-1α over-
expression ameliorated neurodegeneration and huntingtin aggregation by upregulation of
mitochondrial biogenesis and by activation of transcription factor EB (TFEB), a master
regulator of the autophagy-lysosome pathway145. Additionally, another study found that
acute exercise-induced mitophagy in skeletal muscle was impaired in PGC-1α -/- mice146.
In particular, PGC-1α appeared to mediate expression of autophagy factors LC3B and
p62 independent of TFEB or Forkhead box O3 (FOXO3), a PGC-1α-associated
transcriptional regulator of autophagy146. This suggests that in addition to regulating
mitochondrial biogenesis, PGC-1α regulates autophagy through known and yet-to-be
elucidated mechanisms.
1.4.4.3 AMPK
AMP-activated kinase (AMPK) is activated in response to high cellular AMP levels,
which may indicate nutrient deprivation and environmental stress110,147. Once activated,
AMPK stimulates mitochondrial biogenesis by activating PGC-1α through direct
phosphorylation and by promoting PGC-1α deacetylation by Silent Information Regulator
2 (SIR2) protein 1 (SIRT1) (Fig1-3)148,149. Recently, AMPK was also shown to mediate
mitophagy by directly phosphorylating the DRP1 receptor MFF to promote mitochondrial
fragmentation50. Additionally, the autophagy-initiating kinase, Unc-51-like autophagy
activating kinase 1 (ULK1) is also a direct AMPK activation target150,151. Egan et al.
19
showed mitophagy defects in ULK1- and AMPK-deficient primary murine hepatocytes,
although the mechanism of ULK1-mediated mitophagy is not yet fully understood150–152.
1.5 The Mitochondrial Rhomboid Protease, PARL
The mitochondrial rhomboid protease PARL is commonly described as a key
protease of PINK1 that prevents aberrant mitophagy of healthy mitochondria77–80. Work
from our group and others has revealed that PARL plays a critical but not entirely
understood role in multiple mitochondrial and cellular functions.
1.5.1 Identification of the Rhomboid Superfamily
The first rhomboid protease, Rhomboid-1, was identified in 1984 in a genetic
screen where researchers identified a mutation in Drosophila embryos that resulted in an
abnormal rhombus-like head skeleton153. Rhomboid-1 and its homologues are
predominantly characterized in the activation of epidermal growth factors (EGFs)154. It
was later shown that Rhomboid-1 activated the EGF-like protein Spitz by cleaving it in its
transmembrane domain155–157. Thus, Rhomboid-1 and its six Drosophila homologues
became the founding members of the well-conserved rhomboid superfamily of
intramembrane proteases157–159. Rhomboid homologues have since been found in nearly
every sequenced genome across virtually all life forms and constitute the most
widespread family of intramembrane proteases157–159. The rhomboid superfamily is
composed of proteolytically active RHO secretory pathway rhomboids and PARL
mitochondrial rhomboids, and proteolytically inactive iRhoms and Derlin proteins159.
20
1.5.2 Rhomboid Structure
Rhomboids are the best mechanistically characterized intramembrane proteases
but are still not well understood160. Much of our structural and mechanistic understanding
is gleaned from seven crystal structures of GlpG, the rhomboid homologue in Escherichia
coli, which were solved just over a decade ago161–163. All active prokaryotic and eukaryotic
rhomboids share a catalytic domain comprised of six transmembrane helices (TMH)164.
These crystal structures reveal that the bacterial rhomboid is almost entirely immersed in
the detergent micelle with its universally conserved catalytic serine on TMH-4 (S277 in
human PARL) submerged approximately 10 Å from the presumed membrane surface161–
164. Molecular dynamics studies indicate that although proteolysis occurs in the
membrane, water molecules necessary for catalysis are still able to access the active site,
which is composed of a catalytic dyad, serine on TMH-4 and histidine on TMH-6 (H335
in human PARL)165–167.
Most eukaryotic members of the PARL and RHO subfamilies possess seven
TMHs, having gained an additional TMH at the N-terminus (PARL subfamily) or at the C-
terminus (RHO family)158. One group has noted the difficulty in expressing PARL’s 6 TMH
catalytic domain due to issues of topology and misfolding, which suggests that the
additional N-terminal TMH-A may facilitate PARL import and folding164. Homology
modeling of PARL’s 6 TMH core indicates that disruption of PARL’s ‘1+6’ structure may
displace D319, which is implicated in PARL’s catalytic activity164. To date, the structural
and functional contribution of the 7th TMH, TMH-A in PARL, remains an open question.
21
1.5.3 Identification of the Mitochondrial Rhomboid
The first mitochondrial rhomboid protease, Rhomboid-1 (Rbd1), was identified in
2002 in Saccharomyces cerevisiae as a protease of cytochrome c peroxidase 1 (Ccp1)168.
While Ccp1 deletion had minimal consequences, Δrbd1 yeast cells were unable to grow
on glycerol media and displayed prominent mitochondrial abnormalities, including
mitochondrial fragmentation and aggregation, loss of mtDNA nucleoids, and respiratory
defects169. This drastic phenotype was one of the first pieces of evidence that Rbd1 and
its homologues play a critical role in mitochondrial biology. Less than a year after its initial
discovery, Rbd1’s second substrate, mitochondrial genome maintenance 1 (Mgm1), was
identified170. Mgm1, like its mammalian homologue, the IMM fusion GTPase OPA1, is a
key participant in mitochondrial fusion and mtDNA maintenance171. Rbd1-dependent
Mgm1 cleavage and production of short Mgm1 (s-Mgm1) is required to carry out these
functions171. Part of Rbd1’s effect on mitochondrial biology is through Mgm1 cleavage as
expression of s-Mgm1 partially rescues Δrbd1 mitochondrial defects169,170. Importantly,
the Δrbd1 phenotype could be rescued by expression of its human mitochondrial
homologue PARL; this was the first demonstration that mitochondrial rhomboid function
is conserved from yeast to humans169,171.
Mitochondrial Rbd1 homologues in other model organisms, including Drosophila,
became more heavily scrutinized in light of Rbd1’s regulation of mitochondrial biology.
The few Drosophila deficient in the Rbd1 homologue Rhomboid-7 that survived pupation
displayed neurological defects, male sterility, and did not survive past three days into
adulthood172. Notably, rhomboid-7-deficient Drosophila testis and skeletal muscle
displayed mitochondrial abnormalities suggestive of defective mitochondrial fusion172.
Rhomboid-7 silencing in Drosophila S2 cells also resulted in severe mitochondrial
22
fragmentation, similar to opa1-like (homologue of Mgm1 and OPA1) silencing172.
However, evidence of conserved Rhomboid-7 cleavage of Opa1-like is conflicting173,174.
Surprisingly, Rhomboid-7-overexpressing Drosophila displayed similar defects to
Rhomboid-7-deficient Drosophila: increased lethality, neurological defects, and severe
mitochondrial malfunction173. These converging phenotypes suggest the necessity of
regulating Rhomboid-7 proteolytic activity.
Studies of Rhomboid-7 in Drosophila also led to the first line of evidence
connecting the mitochondrial rhomboid to PD174. Whitworth et al. identified three PD-
linked genes as genetic interactors of rhomboid-7: pink1, parkin, and the serine protease
high temperature requirement A2 (htrA2; also known as omi)174. Further work suggests
that Pink1 and HtrA2 are Rhomboid-7 proteolytic substrates and that this cleavage is
required for substrate function174.
Table 1- 1: List of mitochondrial rhomboids and their putative substrates
Species Rhomboid Putative
Substrates Function
Saccharomyces
Cerevisiae Rbd1
Ccp1 -
Mgm1 Mitochondrial Fusion
Drosophila
melanogaster Rhomboid-7
Opa1-Like Mitochondrial Fusion
Pink1 Mitophagy
HtrA2 Apoptosis
Mammals PARL
OPA1 Mitochondrial Fusion
PINK1 Mitophagy
HtrA2 Apoptosis
PGAM5 Apoptosis
Smac Apoptosis
23
1.5.4 The Mammalian Mitochondrial Rhomboid, PARL
The only human mitochondrial rhomboid protease, presenilins-associated
rhomboid-like (PARL), was identified in 2001 in a yeast two-hybrid screen as a putative
interactor of presenilins, which are implicated in AD175. Unlike what PARL’s name
suggests, this interaction was ruled as artefactual as PARL is located in the IMM,
separated by an additional OMM, whereas the presenilins are located in the plasma
membrane; this false positive may be attributed to the yeast two-hybrid system’s poor
suitability for membrane proteins169,171. To correct this misnomer and retain PARL’s
historical name, it has recently been suggested that the meaning of the PARL acronym
be changed to “PINK1/PGAM5-associated rhomboid-like”176.
1.5.4.1 PARL α/β/γ Cleavage
As a eukaryotic mitochondrial rhomboid, mammalian PARL is an IMM protease
with seven TMHs: the evolutionarily conserved 6 TMHs (TMH1-6) containing the catalytic
core, and the additional TMH-A that is appended to PARL’s N-terminus. TMH-A is
suspected to exert some regulatory control on PARL. As a nuclear-encoded protein,
PARL import into the IMM results in removal of its N-terminal MTS by MPP in the matrix;
this event is referred to as α cleavage (Fig 1-4A)164,177,178.
PARL undergoes a sequential cleavage event at its N-terminus in the matrix
between amino acids S77 and A78, which is termed β cleavage (Fig 1-4A)78,177. β
cleavage is dependent on PARL catalytic activity as mutation of PARL’s catalytic serine,
S277G, abolishes β cleavage78,177. However, as PARL cleaves in the IMM and the site of
β cleavage is in the mitochondrial matrix, the protease responsible for β cleavage remains
an active topic of debate. The protease responsible for β cleavage may be PARL itself
24
through some unknown mechanism or an as-of-yet unknown protease whose recruitment
or activity requires PARL proteolytic activity.
Unlike α cleavage, which is a constitutive event, β cleavage is triggered by
mitochondrial stress. Our group has demonstrated that PARL β cleavage is exacerbated
by the mitochondrial stressors, Oligomycin A (OlA), Rotenone, and carbonyl cyanide m-
chlorophenyl hydrazone (CCCP), but not by the endoplasmic reticulum (ER) stressor,
Thapsigargin179. Mechanistically, β cleavage is additively inhibited by phosphorylation of
S65, T69, and S70, N-terminal to the site of β cleavage178. Pyruvate dehydrogenase
kinase 2 (PDK2), a key regulator of energy production and metabolism, was recently
identified as the kinase responsible for PARL phosphorylation and β cleavage inhibition.
Shi and McQuibban hypothesize that PDK2 promotes β cleavage by reducing PARL
phosphorylation rates in response to reduction of mitochondrial energy metabolism179.
The matrix phosphatase responsible for reversing PARL phosphorylation and promoting
β cleavage remains an open question.
Also unlike α cleavage, whose site is highly conserved amongst animal
orthologues of PARL, the β cleavage site is strictly conserved in mammals (Fig 1-
4B)78,177. This suggests that β cleavage may mediate some mammalian-specific
regulation on PARL in response to mitochondrial stress. The importance of PARL β
cleavage in mitochondrial and cellular health is emphasized by our group’s discovery of
the PD-associated missense mutation S77N at PARL’s β cleavage site, which abolishes
this cleavage event (Fig 1-4C)78.
β cleavage results in two moieties: N-terminally cleaved PARL, termed β PARL,
and a 25 amino acid peptide, termed PARL β (Pβ) (Fig 1-4A)177. Our group and others
25
have found that exogenous expression of β PARL results in a fragmented mitochondrial
morphology similar to WT PARL over-expression phenotypes78,178. Fragmented
mitochondrial morphology is not recapitulated when PARL catalytic activity (S277G) or β
cleavage (S77N) is disrupted78,178. Additionally, our group has shown that β cleavage
alters PARL cleavage efficiency of its substrate PINK1179. The effect of PARL β cleavage
on PINK1 of PINK1/Parkin-mediated mitophagy is further expanded below.
Speculations that the second product of PARL β cleavage, the small peptide Pβ,
may carry some as-of-yet unknown role in mitochondrial and cellular biology have
stemmed from its strong conservation in vertebrates and especially in mammals78,177.
Interestingly, Sík et al. identified a non-canonical nuclear localization sequence (NLS) in
Pβ composed of three closely spaced doublets of positively charged amino acids; the first
and second are conserved in vertebrates whereas the third pair is mammalian-specific177.
Indeed, two studies exogenously expressing Pβ-GFP fusion constructs found that Pβ
appeared to partially localize to the nucleus177,180. Sík et al. determined that mutation of
Pβ-GFP’s putative NLS abrogated nuclear localization177. However, the results of these
localization studies are obscured by the usage of Pβ-GFP as GFP itself can localize to
the nucleus to some extent181.
One group has suggested that PARL’s N-terminus undergoes a third sequential
cleavage, this time in the loop region separating TMH-A from the core catalytic domain,
termed ϒ cleavage (Fig 1-4A)164,177. Homology modeling of ϒ PARL suggests that
removal of TMH-A results in structural changes that disrupted PARL proteolytic activity164.
In line with this, exogenous expression of ϒ PARL results in elongated mitochondrial
26
morphology, similar to catalytically dead PARL177. However, our group has had difficulties
recapitulating this data.
A
B C
Figure 1-4: PARL β cleavage is a disease-relevant regulatory event: A A
representation of PARL structure and cleavage events. PARL contains 7 transmembrane
helices (TMH) organized in a “1+6” manner, where the latter 6 make up the conserved
rhomboid catalytic core and the N-terminal TMH is a mitochondrial rhomboid-specific
addition. PARL undergoes 3 cleavage events: constitutive α cleavage; mitochondrial-
stress regulated β cleavage, which is additively inhibited by phosphorylation; and ϒ
cleavage, which is mechanistically paired to β cleavage. B PARL β cleavage site amino
acid sequence alignment by CLUSTALW. S77, the β cleavage site, is highlighted in red.
Alignment demonstrates a high degree of sequence similarity in mammals. S77N
mutation was identified in Parkinson’s disease (PD) patients. C Western blot of FLAG-
tagged PARL constructs in HEK293Ts. S77N abolishes PARL β cleavage.
27
1.5.4.2 The Role of PARL in Mitochondrial Morphology
As previously noted, WT PARL overexpression in cultured cells induces
mitochondrial fragmentation, a phenotype that is dependent on both PARL catalytic
activity and β cleavage78,178. These observations suggest the importance of mammalian
PARL, especially β PARL, the product of β cleavage, in regulation of mitochondrial
dynamics and morphology. However, studies of mitochondrial morphology in Parl -/- mice
are conflicting. Two studies, one in Parl -/- mouse embryonic fibroblasts (MEFs) and one
in PARL-depleted mouse skeletal muscle and cultured human myotubes, found no major
disruption of mitochondrial morphology180,182. The second study observed changes in
mitochondrial cristae structure180. PARL proteolytic activity for the IMM fusion protein
OPA1 is suggested to be conserved as yeast two-hybrid screens and co-
immunoprecipitation experiments indicate interaction182. However, other studies suggest
that PARL is dispensable for OPA1 processing as OPA1 is a substrate for many other
proteases183,184.
1.5.4.3 The Role of PARL in Apoptosis
The implication of PARL in intrinsic apoptosis is also conflicting. One study argued
that PARL is an anti-apoptotic protein by demonstrating that Parl -/- mice had a drastically
reduced life span owing to progressive multisystemic atrophy that was sustained by
increased apoptosis182. Increased apoptosis was attributed to higher susceptibility to
cytochrome c release in Parl -/- MEFs and primary myoblasts in response to several
intrinsic apoptotic inducers, including staurosporine (STS)182. In contrast, a 2017 study
identified PARL as a pro-apoptotic protein. Saita et al. showed that PARL-deficient human
cells were more resistant to apoptotic inducers, including STS185. They demonstrated that
PARL cleaved the pro-apoptotic protein Smac (also known as DIABLO) which
28
subsequently inhibited apoptosis inhibitors to promote caspase activity and resultant
apoptosis185.
PARL may also influence apoptosis through two other substrates: the
mitochondrial kinase phosphoglycerate mutase 5 (PGAM5), which is implicated in
multiple cell death pathways including apoptosis and necroptosis186–188; and HtrA2, a
controversial PARL substrate implicated in apoptosis185,189. However, these connections
remain circumstantial at best. To date, there are no studies observing PARL β cleavage
in cell death pathways.
1.5.4.4 The Role of PARL in Mitophagy and Parkinson’s disease
According to current mitophagy models, PARL’s role in mitophagy extends only to
prevent aberrant mitophagy of healthy polarized mitochondria because it cleaves
imported PINK1 to target it to the cytosol for degradation. While other proteases have
been documented to proteolyze PINK1, PARL likely acts as the favoured PINK1 protease
as PARL ablation or expression of catalytically inactive S277G PARL results in impaired
PINK1 processing78,176,190. One study also noted mitochondrial PINK1 retention and
premature Parkin recruitment in PARL-deficient human cells190.
As the PD-linked S77N mutation disrupts PARL β cleavage, we hypothesized that
β cleavage and resultant β PARL expression may play a role in mitophagy. Indeed,
although S77N PARL retains catalytic activity, exogenous expression of S77N PARL
showed impaired mitochondrial fragmentation and Parkin recruitment in response to
mitochondrial depolarization by treatment with the ionophore, CCCP, in comparison to
WT PARL-expressing cells78. Recent work from Shi and McQuibban demonstrated that β
PARL was less efficient at cleaving PINK1 in comparison to S77N PARL179. WT PARL,
which exists as both full length and β PARL when over-expressed, showed intermediate
29
PINK1 cleavage efficiency179. Furthermore, PARL β cleavage was responsive to a
number of stresses that may occur prior to depolarization, including ATP depletion by the
ATP synthase inhibitor, OlA179. Of note, the PARL kinase, PDK2, is highly sensitive to
ATP depletion, owing to its role in metabolism179. Thus, we hypothesize that PARL β
cleavage initiates PINK1/mediated mitophagy prior to ΔΨm depletion through β PARL’s
reduced proteolytic efficiency for PINK1, leading to PINK1 OMM stabilization.
Interestingly, over-expression of β PARL but not S77N PARL induced mitochondrial
fragmentation, a necessary prerequisite of mitophagy78. Assuming inefficient PINK1
processing results in stabilization on the OMM, PINK1 may drive PARL-mediated
mitochondrial fragmentation by phosphorylating and targeting MFN1/2 for degradation.
1.5.4.5 The Role of PARL in Mitochondrial Biogenesis
One study conducted in 2010 by Civitarese et al. has connected PARL to
mitochondrial biogenesis. The authors showed that Parl knockdown in mouse skeletal
muscle cells resulted in decreased mitochondrial mass and concomitant decreased
protein expression in PGC-1α, OPA1, and MFN1/2180. Surprisingly, transfection of
untagged Pβ in human myotubes increased mRNA expression of the mitochondrial
biogenesis genes, PGC-1β and NRF1; mitochondrial fusion genes, MFN1/2; and PARL
itself180. In addition, Pβ-transfected myotubes also displayed increased protein
expression of the OPA1 and SIRT1, a PGC-1α activator180. Pβ treatment also appeared
to increase mitochondrial mass and oxygen consumption, in line with increased
mitochondrial biogenesis180. However, the mechanism by which the 25 amino acid
peptide Pβ may activate mitochondrial biogenesis remains unresolved.
30
1.6 Thesis Rationale
Mounting evidence suggests that PARL plays a crucial but as-of-yet unclear role
in mitochondrial and cellular biology. Specifically, recent reports indicate that PARL β
cleavage coordinates two critical mitochondrial quality control processes, mitophagy and
mitochondrial biogenesis, through its cleavage products, β PARL and Pβ, respectively.
However, Pβ’s putative role in mitochondrial biogenesis remains poorly characterized.
This study sought to delineate the mechanism of Pβ regulation of mitochondrial
biogenesis by identifying its expression and subcellular localization in cells and its
potential interactions. In this thesis, I demonstrated that Pβ localizes to the nucleus, where
it associates with chromatin. My work suggests that Pβ may act at the transcriptional level
to upregulate mitochondrial biogenesis and thus enforce mitochondrial quality control.
31
Chapter 2
MATERIAL AND METHODS
2.1 Reagents
2.1.1 Cell Culture and Transfection
HEK293 cell lines were cultured in Dulbecco’s Modified Essential Medium (DMEM,
Sigma) supplemented with 10% fetal bovine serum (FBS, Sigma) at 37˚C in 5% (v/v) CO2.
SH-SY5Y cell lines were cultured in DMEM/F12 with L-Glutamine (Sigma), 15mM HEPES
(Gibco) supplemented with 10% FBS at 37˚C in 5% (v/v) CO2. Both adherent and floating
cell populations were maintained. HEK293s were transiently transfected using
XtremeGENE9 (Roche) according to manufacturer’s instructions.
2.1.2 Chemical Reagents and Antibodies
Oligomycin A treatment was conducted for 24 hours to induce mitochondrial stress.
5μM MG132 treatment was conducted for 16 hours in SH-SY5Y cells to stabilize Pβ signal
by inhibition of the proteasome.
The following antibodies were used: rabbit anti-Pβ (a generous gift from Dr. Lyndal
Bayles, Deakin University), mouse M2 anti-FLAG (Sigma, F1804), rabbit-PARL (Abcam,
ab45231), mouse anti-ATP5α (Abcam, ab95962), mouse anti-actin (Sigma, A3853),
mouse anti-tubulin (Sigma, T9026), rabbit anti-Lamin B1 (Abcam, ab16048), rabbit anti-
ALY (a generous gift from Dr. Alex Palazzo, University of Toronto) rabbit anti-H3 (Sigma,
32
SAB4200651), and rabbit and mouse horseradish peroxidase-conjugated secondary
antibodies (Jackson Labs).
2.1.3 Plasmids
C-terminally 3X FLAG-tagged WT PARL was generated as previously described78.
β PARL was generated by Pβ deletion from WT PARL by inverse PCR, as previously
described179.
2.2 Subcellular Fractionations
2.2.1 Abcam Subcellular Fractionation
Subcellular fractionations were conducted by differential centrifugation using a
method adapted from manufacturer’s instructions for the Mitochondrial Isolation Kit for
Cultured Cells (Abcam, ab110170). Cells were trypsinized, harvested, and washed twice
in chilled PBS buffer. On ice, collected cells were lysed in 10:1 volumes of reagent A (Tris,
trisethanolamine, EDTA, digitonin) for 5 minutes, homogenized by 26½ gauge needle 30
times, and incubated for an additional 5 minutes. A total fraction was collected and
remaining sample was centrifuged at 1000xg for 10 minutes at 4˚C to pellet the nuclear
fraction. The supernatant fraction was subsequently centrifuged at 16 000xg for 15
minutes to separate the pelleted mitochondrial fraction and the cytosolic fraction. The
mitochondrial pellet was washed once in reagent A. The pelleted nuclear fraction was
resuspended in reagent B (Tris, EDTA, digitonin) and homogenized with a 26½ gauge
needle 30 times. The nuclear fraction was centrifuged at 1000xg for 10 min and washed
twice with reagent B. Fractions were protein precipitated if necessary and resuspended
in 2X Lammli sample buffer.
33
2.2.2 CSK Subcellular Fractionation
Subcellular fractionations were conducted using a protocol adapted from Mirzoeva
and Petrini191. Cells were trypsinized, harvested, and washed twice with chilled PBS.
Cells were lysed in cytoskeleton (CSK) buffer (10mM PIPES pH 6.8, 300mM sucrose,
100mM NaCl, 3mM MgCl2, 1mM EGTA, 0.5% Triton X-100, and protease inhibitors) for 7
minutes on ice. A total fraction was obtained prior to centrifugation at 5000xg for 5 minutes
at 4˚C to pellet the nuclear fraction. The nuclear pellet was washed twice in CSK buffer.
The supernatant was centrifuged at 16 000xg for 15 minutes to obtain the pelleted
mitochondrial fraction and the cytoplasmic fraction. The mitochondrial pellet was washed
once with CSK buffer. Fractions were protein precipitated if necessary and resuspended
in 2X Lammli sample buffer.
2.3 Chromatin Fractionations
2.3.1 DNase-based Chromatin Fractionation
Chromatin fractionations were conducted using a protocol adapted from Mirzoeva
and Petrini191. Cells were trypsinized, harvested, and washed twice with chilled PBS.
Cells were lysed in CSK buffer for 7 minutes on ice prior to centrifugation at 5000xg for 5
minutes at 4˚C to obtain the pelleted nuclear fraction and the triton-soluble supernatant.
The triton-soluble fraction was centrifuged at 16 000xg for 15 minutes to obtain the
pelleted mitochondrial fraction and the cytoplasmic fraction. The mitochondrial pellet was
washed once with CSK buffer. The nuclear pellet was washed once with CSK buffer and
incubated in CSK buffer and 1:5 volumes of DNase I (New England Biolabs) at 37˚C for
1 hour. The fraction was then centrifuged at 5000xg for 5 minutes at 4˚C. The supernatant
was taken as the DNase-soluble fraction and the pellet was taken as the DNase-insoluble
34
nuclear pellet. Fractions were protein precipitated if necessary and resuspended in 2X
Lammli sample buffer.
2.3.2 Acid-based Chromatin Fractionation
Chromatin fractionations were adapted from a previously described protocol by
Huang et al.192. Cells were trypsinized, harvested, and washed twice with chilled PBS.
Cells were lysed in 5 volumes of lysis buffer (10mM HEPES pH 7.4, 10mM KCl, 0.05%
NP-40, and protease and phosphatase inhibitors) for 20 minutes on ice prior to
centrifugation at 2000xg for 10 minutes at 4˚C to obtain a pelleted nuclear fraction and a
cytosolic supernatant. The pelleted nuclear fraction was subsequently washed once in
lysis buffer prior to incubation in low salt buffer (10mM Tris-HCl pH 7.4, 0.2mM MgCl2,
1% Triton-X 100 and protease and phosphatase inhibitors) for 15 minutes on ice. The
lysate was centrifuged at 5000xg for 10 minutes at 4˚C to obtain the pellet and the
supernatant containing nucleoplasmic proteins. The pelleted fraction was incubated in 5
volumes of HCl 0.2N for 20 minutes on ice and centrifuged at 15000xg to obtain an
insoluble nuclear pellet fraction and the supernatant containing chromatin-associated
proteins. The collected supernatant was neutralized with the same volume of 1M Tris HCl
pH 8. Fractions were protein precipitated if necessary and resuspended in 2X Lammli
sample buffer.
2.3 Immunoprecipitation
Cells were trypsinized, harvested, and washed twice with chilled PBS. Collected
cells were subsequently lysed with IP lysis buffer (150mM NaCl, 10mM Tris-HCl, 1mM
EDTA, 1% TX-100, 0.5% NP-40, and protease inhibitors) at 4˚C for 25 minutes and
centrifuged at 1500xg for 10 minutes. To immunoprecipitate PARL, 1:100 rabbit
35
polyclonal anti-PARL was incubated with supernatant at 4˚C overnight, followed by
incubation with protein A magnetic beads (Bio-Rad, ab214286) at 4˚C for 2 hours,
according to manufacturer’s instructions.
2.4 Western Blotting
2.4.1 Protein Precipitation
Protein was precipitated as previously described by Wessel and Flügge193. Briefly,
sample volume was raised to 600μL with ddH2O and 600μL methanol and 100μL
chloroform were added. The resulting sample was mixed thoroughly followed by
centrifugation at 10 000xg for 5 minutes at room temperature (RT). The upper layer was
extracted and 600μL methanol was added. The two phases were carefully mixed by low
vortexing or by tilting the tube lengthwise. Mixed samples were centrifuged at 16 000xg
for 5 minutes at RT. The supernatant was removed and the protein pellets were dried at
42˚C. Dried pellets were subsequently resuspended in 2X Laemmli buffer.
2.4.2 SDS-PAGE and Western Blotting
Cell lysates were resuspended in 2X Laemmli buffer followed by 15 minute
incubation at 95˚C or 65˚C for PARL to avoid aggregation. Samples were electrophoresed
on 15% polyacrylamide gels or 4-20% Mini-PROTEAN® TGX™ Precast Protein Gels
(Biorad, ab 456-1094) for endogenous Pβ. Gels were transferred for 45min for Pβ
detection or 1 hour for PARL detection at 110V onto methanol-activated PVDF
membranes. Membranes were blocked in 5% bovine serum albumin (BSA) in TBST for 1
hour, incubated in 1˚ antibody in 1% BSA overnight, and 2˚ antibody in 1% BSA for 2
hours at room temperature. Chemiluminescence was detected via Clarity Western ECL
Substrate (Biorad, 170-5061) and Versadoc imager (Biorad).
36
Chapter 3
RESULTS
3.1 Over-expressed Pβ localizes to the nucleus
Pβ contains a putative non-canonical vertebrate-specific nuclear localization
sequence (NLS), which has lead two groups to demonstrate partial nuclear localization
of the small peptide through fluorescence microscopy experiments over-expressing GFP
fusion constructs177,180. However, these results are obscured by the usage of Pβ-GFP as
GFP itself can localize to the nucleus to some extent181. Furthermore, as these constructs
are expressed in the cytoplasm, there is currently no published evidence that the
mitochondrial peptide is exported from mitochondria. To address these issues, I
determined untagged Pβ subcellular localization. As PARL β cleavage is an N-terminal
event, C-terminally 3XFLAG-tagged PARL was transiently expressed in HEK293s. PARL-
FLAG localizes to the IMM and produces untagged Pβ in the mitochondrial matrix upon
β cleavage. Because mitochondrial stress instigates PARL β cleavage, HEK293s were
treated with 2.5μM Oligomycin A (OlA), an ATP synthase inhibitor and potent
mitochondrial stressor, or DMSO as control for 24 hours. I was unable to detect free Pβ
localization by immunofluorescence microscopy due to the simultaneous recognition of
full-length PARL in mitochondria (data not shown). Therefore, I conducted two separate
37
subcellular fractionations which isolated total, cytoplasmic, mitochondrial and nuclear
fractions to rigorously determine free Pβ subcellular localization. Fractionations were
verified by mitochondrial ATP5α, a subunit of ATP synthase that faces the mitochondrial
matrix, and the nuclear lamina protein, Lamin B1. Pβ, as detected by Pβ-specific antibody
gifted by Dr. Lyndal Bayles (Deakin University), was largely enriched in the nuclear
fraction in both fractionations, corroborating previous studies suggesting nuclear Pβ
localization (Fig. 3-1A,B)177,180. Little to no Pβ was reliably detectable in the mitochondrial
fraction in subsequent repetitions, which suggests efficient Pβ clearance by efflux and/or
degradation from the mitochondrial matrix.
38
A
B
C
Figure 3-1: Overexpressed Pβ localizes to the nucleus in HEK293s: HEK293 cells were transiently transfected with PARL-FLAG and treated with 2.5μM Oligomycin (OlA) or DMSO for 24 hours. HEK293s were fractionated according to manufacturer’s instructions using the Mitochondrial Isolation Kit for Cultured Cells (Abcam ab110170) (A) or using a fractionation protocol as previously described190 (B). Both fractionations isolated Tot (total), Cyto (cytoplasmic), Mito (mitochondrial) and Nuc (nuclear) fractions. C To determine the effect of increasing mitochondrial stress on Pβ production, HEK293s transiently expressing PARL-FLAG were treated with higher concentrations of OlA, 10μM and 20μM. β PARL-FLAG was also transiently transfected as a control for antibody specificity. Cells were fractionated using Abcam protocol as in Fig 1A. PARL β cleavage was monitored by ratio of full length PARL (upper band) to β PARL (lower band).
39
Surprisingly, Pβ was detected at comparable amounts in both 2.5μM OlA- and
DMSO-treated fractions, contrary to previous reports of cleavage dependency on
mitochondrial damage179. To determine whether the lack of change could be due to
insufficient mitochondrial stress, PARL-transfected HEK293s were treated with higher
concentrations of OlA (10μM and 20μM) for 24 hours and subcellular fractionations were
conducted. PARL β cleavage was monitored by the ratio of full length PARL to β PARL
in response to mitochondrial stress. Notably, nuclear Pβ expression and mitochondrial
PARL β cleavage were prominent and comparable in DMSO- and 10μM OlA-treated
HEK293s (Fig. 3-1C). Preliminary results suggest that while PARL β cleavage
correspondingly increased in cells treated with 20μM OlA, the highest concentration
tested, the expression of the cleavage byproduct Pβ paradoxically decreased. Pβ
decrease in 20μM OlA-treated HEK293s may be due to increased Pβ degradation in
response to increased mitochondrial and thus cellular stress, although it is unclear in
which subcellular compartment this degradation may occur.
As a control for antibody specificity, I also transiently transfected HEK293s with
β PARL, an N-terminally truncated construct where the Pβ sequence has been deleted
in-frame. In these cells, only a lower molecular weight band corresponding to β PARL
was present in the mitochondrial fraction (Fig. 3-1C). No bands corresponding to Pβ were
detectable by western blot, verifying that the doublet visualized by Pβ antibody is Pβ-
specific (Fig. 3-1C).
These results corroborate and extend previous observations of nuclear Pβ-GFP
localization by establishing that overexpressed, untagged Pβ efficiently translocates from
the mitochondrial matrix to the nucleus in HEK293s.
40
3.2 Endogenous Pβ localizes to the nucleus
As Pβ localization studies heavily rely on overexpression systems, I next aimed to
determine the subcellular localization of endogenous Pβ, made possible by the
possession of a Pβ-specific antibody. Experiments observing endogenous Pβ were
conducted in the human neuroblastoma cell line, SH-SY5Y, which was a gracious gift
from Dr. Anurag Tandon (University of Toronto). SH-SY5Ys are a common cell line to
study neurodegenerative diseases, especially PD, in part due to their catecholaminergic
properties194. These properties include tyrosine hydroxylase expression and dopamine
and norepinephrine/noradrenaline production, which are intact in undifferentiated SH-
SY5Ys194,195. Most importantly, we chose this cell line as endogenous PARL and PARL β
cleavage is detectable in SH-SY5Ys179.
Figure 3-2: Previous work from our lab demonstrates that PARL β cleavage is
sensitive to OlA treatment in SH-SY5Ys177: SH-SY5Ys were treated with increasing
concentrations of OlA for 24 hours. PARL was immunoprecipitated to increase signal.
PARL β cleavage was monitored by ratio of full length PARL (upper band) to β PARL
(lower band). ATP5α is the loading control. Reprinted with permission177.
41
Our lab has previously shown that PARL does not undergo β cleavage in SH-
SY5Ys in the absence of mitochondrial stress (Fig. 3-2)179. Previous unpublished results
also suggest that endogenous Pβ is difficult to detect by western blot without the addition
of MG132, a potent proteasome inhibitor, which inhibits Pβ degradation. To induce β
cleavage and ensure Pβ visualization, I treated SH-SY5Ys with 2.5μM OlA, which was
previously shown to be sufficient to initiate PARL β cleavage (Fig.3-2), or DMSO for 24
hours. SH-SY5Ys were also treated with 5μM MG132 for 16 hours to aid Pβ visualization.
Cells were subsequently fractionated using two independent protocols. In agreement with
Pβ overexpression studies, both published and presented above, free endogenous Pβ
was largely enriched in the nuclear fraction in both fractionations (Fig. 3-3A,B).
Surprisingly, Pβ was comparably expressed in DMSO- and OlA-treated cells. This result
is congruous with Pβ overexpression fractionations in HEK193s, but contrary to previous
reports that PARL β cleavage and thus Pβ expression are tightly controlled by induction
with mitochondrial stress in SH-SY5Ys179. Nevertheless, my findings provide evidence
that Pβ translocates from mitochondria to the nucleus in SH-SY5Ys.
42
Figure 3-3: Endogenous Pβ localizes to the nucleus in SH-SY5Ys: SH-SY5Y cells were treated with either 2.5μM OlA or DMSO for 24 hours. Cells were also treated with 5μM MG132 for 16 hours. SH-SY5Ys were fractionated using an Abcam mitochondrial isolation kit for cultured cells (A) or as described previously by Mirzoeva and Petrini (B)9. Both fractionations isolated Tot (total), Cyto (cytoplasmic), Mito (mitochondrial) and Nuc (nuclear) fractions. ATP5α (α subunit of ATP Synthase) is the mitochondrial marker. Lamin B1 (component of nuclear matrix) is the nuclear marker.
A
B
43
3.3 Endogenous Pβ associates with chromatin in SH-SY5Ys
Civitarese et. al. have shown that transfection of naive synthetic Pβ peptide in
mouse cardiomyocytes resulted in transcriptional upregulation of mitochondrial
biogenesis genes, PGC1β and NRF1; mitochondrial fusion genes, MFN1, MFN2, and
OPA1; and PARL itself180. Combined with multiple reports of Pβ nuclear localization, we
and others have hypothesized that Pβ peptide may act as transcriptional upregulator to
activate mitochondrial biogenesis in response to mitochondrial damage. To assess
whether Pβ’s suggested role in nuclear mitochondrial gene expression could occur
directly at the level of DNA, I determined whether Pβ associates with chromatin.
Initially, I aimed to test Pβ chromatin association in HEK293s transiently
transfected with WT PARL and treated with 5μM OlA or DMSO for 24 hours. HEK293s
were subsequently fractionated to obtain nuclear fractions. Chromatin-associated
proteins were eluted from nuclear fractions by DNase I incubation, as previously
documented191. The chromatin-associated fraction was verified by the selective
enrichment of histone octamer subunit H3 and the disenrichment of nuclear structural
protein and insoluble nuclear pellet marker Lamin B1, mitochondrial marker ATP5α, and
cytosolic marker Tubulin. In HEK293s, overexpressed Pβ largely localized to the insoluble
nuclear pellet fraction, suggesting that overexpressed Pβ does not associate with
chromatin (Fig. 3-4). As overexpression studies may be prone to artefactual
mislocalization, I next aimed to determine whether endogenous Pβ associates with
chromatin in SH-SY5Ys.
44
SH-SY5Ys were treated with 5μM OlA or DMSO control for 24 hours and 5μM
MG132 for 16 hours to aid Pβ visualization. I then fractionated cells to determine
chromatin association by DNase I incubation, as previously described. Contrary to data
obtained from overexpression studies in HEK293s, endogenous Pβ was solely detected
in the chromatin-associated fraction (Fig. 3-5A). In line with previous fractionations, Pβ
chromatin association was comparable in DMSO- and 5μM OlA-treated SH-SY5Ys. To
further validate this result, I conducted a second independent fractionation that isolates
chromatin-associated proteins by acid extraction192. SH-SY5Ys were treated with DMSO
Figure 3-4: Overexpressed Pβ does not associate with chromatin in HEK293s:
HEK293 cells were transiently transfected with PARL-FLAG and treated with either 2.5μM
Oligomycin (OlA) or DMSO for 24 hours. HEK293s were fractionated as previously
described by Mirzoeva and Petrini with the additional step of DNase I incubation. The
fractionation resulted in a Tot (total) fraction; a TS (triton soluble) fraction containing
cytosolic and mitochondrial proteins; a DS (DNase I soluble) fraction containing
chromatin-associated proteins; and an NP (nuclear pellet) fraction containing nuclear
DNase I insoluble proteins. ATP5α (α subunit of ATP Synthase) is the mitochondrial
marker. H3 (subunit of histone octamer) is the chromatin-associated marker. Lamin B1
(component of nuclear matrix) is the nuclear marker.
45
or 5μM OlA for 24 hours and MG132 for 16 hours. This fractionation also isolated
nucleoplasmic proteins whose fraction was validated by the enrichment of Aly, a nuclear
export factor196, and disenrichment of other markers: cytosolic Tubulin, mitochondrial
ATP5α, chromatin-associated H3, and the nuclear structural protein, Lamin B1. In
agreement with the previous chromatin fractionation, Pβ was highly enriched in the
chromatin-associated fraction, regardless of presence of mitochondrial stress (Fig. 3-5B).
Taken together, these results advance studies establishing Pβ nuclear localization by
demonstrating that endogenous Pβ peptide associates with chromatin in the nucleus and
may act at the level of transcription to regulate mitochondrial biogenesis.
46
Figure 3-5: Endogenous Pβ associates with chromatin in SH-SY5Ys: A SH-SY5Y
cells were treated with 5μM OlA or DMSO for 24 hours. Cells were also treated with 5μM
MG132 for 16 hours. SH-SY5Ys were fractionated as previously described by Mirzoeva
and Petrini with the additional step of DNase I incubation. The fractionation resulted in a
Tot (total) fraction; a TS (triton soluble) fraction containing cytosolic and mitochondrial
proteins; a DS (DNase I soluble) fraction containing chromatin-associated proteins; and
an NP (nuclear pellet) fraction containing nuclear DNase I insoluble proteins. B A second
fractionation isolating chromatin-associated proteins was conducted on SH-SY5Ys
treated with 5μM OlA or DMSO for 24 hours and MG132 for 16 hours, as previously
described191. The fractionation resulted in a Cyto (cytoplasmic) fraction; a Nuc Plas
(nucleoplasmic) fraction; a Chr (chromatin-associated) fraction; and a Nuc Pellet (nuclear
pellet fraction). ATP5α is the mitochondrial marker. H3 is the chromatin-associated
marker. Lamin B1 is the nuclear pellet marker. Tubulin (major component of cytoskeleton)
is the cytosolic marker. Aly (mRNA export factor) is the nucleoplasmic marker.
B
A
A
B
47
3.4 MG132 does not affect Pβ expression or localization
Our lab has previously shown that endogenous PARL undergoes β cleavage and
subsequent Pβ expression upon mitochondrial stress in SH-SY5Ys (Fig. 3-2)179.
However, as shown in sections 3.2 and 3.3, results in this thesis found no difference in
Pβ production in the presence or absence of OlA, a mitochondrial stressor, at
concentrations that were previously shown to be sufficient and necessary for PARL β
cleavage. One hypothesis is that this incongruity may be due to incubation with MG132,
a common proteasome inhibitor, to increase Pβ stability and detection. It is possible that
treating cells with 5μM MG132 for 16 hours may indirectly cause mitochondrial stress and
subsequent β cleavage and Pβ production. This is supported by previous studies
reporting observations of mitochondrial stress with prolonged treatment of MG132197–200.
Indeed, Maharjan et. al. have shown that an 8 hour treatment with 10μM MG132 in
Chinese hamster ovary cells resulted in loss of ΔΨm and increased mitochondrial ROS200.
To determine whether MG132 treatment affected Pβ production, I treated SH-
SY5Ys with 5μM OlA or DMSO for 24 hours and 5μM MG132 or DMSO for 16 hours. To
test whether PARL β cleavage would increase with additional mitochondrial stress, I also
treated SH-SY5Ys with 20μM OlA for 24 hours and 5μM MG132 for 16 hours. Chromatin
fractionations were subsequently conducted on treated cells. MG132 treatment did not
affect Pβ detection, as previously suggested, nor did it affect Pβ production as I had
hypothesized (Fig. 3-6). Thus, future studies of endogenous Pβ in SH-SY5Ys should omit
MG132 treatment. In agreement with section 3.3, detected Pβ was heavily enriched in
the chromatin-associated fraction regardless of the presence or absence of mitochondrial
stress when compared to the chromatin-associated fraction control, H3 (Fig. 3-6).
48
Additionally, there was no noticeable difference in Pβ detection with the added
mitochondrial stress in the form of 20μM OlA in comparison to 5μM OlA or DMSO control.
Figure 3-6: MG132 does not affect Pβ detection or localization in SH-SY5Ys: SH-
SY5Ys were treated with 5μM OlA, 20μM OlA, or DMSO for 24 hours. Cells were also
treated with 5μM MG132 or DMSO for 16 hours. SH-SY5Ys were fractionated as
previously described by Mirzoeva and Petrini to obtain a TS (triton soluble) fraction
containing cytoplasmic and mitochondrial proteins and DS (DNase soluble) fraction
containing chromatin-associated proteins. ATP5α is the mitochondrial marker. H3 is the
chromatin-associated marker. Actin (major component of cytoskeleton) is the cytosolic
marker.
49
3.5 Endogenous PARL β cleavage occurs in absence
of mitochondrial stress in SH-SY5Ys
Previously, our lab has shown that PARL β cleavage is virtually undetectable in
SH-SY5Ys without mitochondrial stress whereas 2.5μM OlA for 24 hours is sufficient to
induce cleavage (Fig. 3-2)179. However, my results presented thus far have consistently
shown that Pβ, a product of PARL β cleavage, is easily detected in the absence of stress.
Furthermore, Pβ detection is comparable in DMSO, 2.5μM, 5μM, 10μM, and 20μM OlA-
treated conditions. These concentrations are more than sufficient to cause mitochondrial
stress as 1μM OlA treatment in undifferentiated SH-SY5Ys inhibits mitochondrial
respiration201. These results suggest that Pβ production in SH-SY5Ys is insensitive to
mitochondrial stress. As SH-SY5Ys are particularly susceptible to cell line changes, I
hypothesized that PARL β cleavage may be altered in current SH-SY5Ys in comparison
to published data from our group180.
To compare PARL β cleavage in SH-SY5Ys, I treated cells with 5μM OlA or control
DMSO for 24 hours. As previously described179, endogenous PARL was then
immunoprecipitated from cells using an antibody specific to the C-terminus of PARL,
which is capable of detecting full length and N-terminally-cleaved forms of PARL. PARL
immunoprecipitation (IP) is necessary to detect full-length PARL and β PARL and to
decrease relative background. A parallel IP was conducted without PARL antibody to
control for possible nonspecific interactions. As expected, no bands were detected in this
negative control (Fig 3-7). Contrary to previously published results but congruous with
fractionations conducted in this thesis, β PARL was reliably detected in DMSO-treated
SH-SY5Ys, indicating that PARL β cleavage occurs constitutively in the absence of
50
mitochondrial stress (Fig. 3-7). Additionally, β cleavage was comparable in DMSO and
5μM OlA conditions, indicating that PARL β cleavage is not responsive to mitochondrial
stress in SH-SY5Ys (Fig. 3-7).
Figure 3-7: Endogenous PARL β cleavage occurs in the absence of mitochondrial
stress in SH-SY5Ys: SH-SY5Ys were treated with 5μM OlA or DMSO for 24 hours. PARL
was immunoprecipitated (IP) to increase signal. PARL β cleavage was monitored by ratio
of full length PARL (upper band) to β PARL (lower band). ATP5α is the loading control.
51
Chapter 4
CONCLUSIONS & FUTURE DIRECTIONS
4.1 Brief Summary of Results
Previous reports have proposed that the PARL β cleavage product Pβ localizes to
the nucleus and instigates mitochondrial biogenesis177,180. In this thesis I have supported
and extended these findings by demonstrating that free untagged Pβ, which originates in
the mitochondrial matrix, translocates to the nucleus. Importantly, I have established that
endogenous nuclear Pβ localization is maintained in SH-SY5Ys, a common PD model
cell line. A previous study demonstrated that Pβ may upregulate transcription of
mitochondrial biogenesis genes180. To this end, I have provided evidence that
endogenous Pβ interacts with chromatin in the nucleus, which suggests that Pβ affects
nuclear mitochondrial gene expression transcriptionally, although it is unclear whether
this interaction is direct or indirect. Additionally, I have shown that MG132, a proteasome
inhibitor, is not required to stabilize endogenous Pβ in SH-SY5Ys as previously
suggested. Finally, I demonstrated that PARL undergoes β cleavage in current SH-SY5Ys
without the addition of mitochondrial stress, contrary to previous reports179. Together,
these data support the hypothesis that the small mitochondrial peptide Pβ acts as a
transcriptional regulator by demonstrating that endogenous Pβ stably translocates to the
nucleus where it associates with chromatin.
52
Figure 4-1: Model of PARL coordination of mitophagy and mitochondrial
biogenesis: In response to mitochondrial stress, PARL is dephosphorylated and β
cleavage occurs, resulting in β PARL and Pβ. β PARL’s reduced proteolytic activity for
PINK1 results in PINK1 accumulation on damaged mitochondria and initiation of
mitophagy prior to global depolarization. Conversely, Pβ relocalizes from the
mitochondrial matrix to the nucleus where it associates with chromatin to instigate
mitochondrial biogenesis by upregulation of mitochondrial genes, including PGC-1β,
NRF1, and MFN1/2.
53
4.2 Model: PARL as a Coordinator of Mitophagy and
Mitochondrial Biogenesis The coordinated regulation of mitophagy and mitochondrial biogenesis, two
processes that control overall mitochondrial mass in the cell, is critical to maintain both
mitochondrial and cellular health. Our group proposes that through regulated cleavage of
the IMM intramembrane protease, PARL synchronistically activates mitochondrial
biogenesis and mitophagy in response to mitochondrial stress (Fig.4-1).
In healthy, polarized mitochondria, PARL cleaves PINK1 in the IMM, which results
in subsequent PINK1 cytoplasmic relocalization and rapid proteasomal degradation77–80.
The current understanding is that PARL is not involved with the initiation of PINK1/Parkin-
mediated mitophagy as PINK1 import to the IMM is disrupted by mitochondrial
depolarization23,76,77. However, we have previously proposed that PARL may initiate
PINK1/Parkin-mediated mitophagy prior to mitochondrial depolarization179. Our group has
shown that PARL β cleavage is sensitive to various mitochondrial stresses, including ATP
depletion and ROS production179. β PARL, the N-terminally cleaved product of β
cleavage, has reduced catalytic efficiency for PINK1 and instigates mitochondrial
fragmentation, a necessary primer for mitphagy78,179. In our model, increased β PARL
production in response to mitochondrial stress leads to less efficient PINK1 cleavage.
Inefficient PINK1 cleavage results in PINK1 OMM accumulation and consequent
mitophagic initiation prior to global mitochondrial depolarization (Fig.4-1).
The other product of PARL β cleavage, the 25 amino acid peptide Pβ, has also
been proposed to play a role in mitochondrial biogenesis177,180. Treatment of human
myotubes with Pβ resulted in upregulation of mitochondrial biogenesis and mitochondrial
54
fusion genes and increased mitochondrial mass180. Pβ has been proposed to function in
the nucleus, as suggested by two studies determining Pβ-GFP localization177,180. My
thesis supports these studies by demonstrating that untagged, endogenous Pβ stably
translocates from the mitochondrial matrix to the nucleus. More excitingly, data indicates
that Pβ associates with chromatin, which suggests that Pβ’s mechanism of regulating
mitochondrial biogenesis occurs at the transcriptional level (Fig.4-1).
Thus, we propose that in response to mitochondrial stress, PARL β cleavage
simultaneously activates mitophagy via β PARL and mitochondrial biogenesis via Pβ to
ensure mitochondrial turnover to maintain a healthy mitochondrial network.
4.3 Perspectives
4.3.1 Pβ Translocates to the Nucleus
Two studies have shown that Pβ-GFP localizes to the nucleus177,180. These studies
are partially confounded by the use of GFP fusion constructs, as GFP itself has been
documented to localize to the nucleus181, and the usage of constructs expressed in the
cytosol, as it is unclear whether Pβ is capable of exiting mitochondria. These issues were
circumvented by expressing mitochondrial-localized PARL constructs that produce
untagged Pβ upon β cleavage. Fractionation data indicates that Pβ, which is
physiologically produced in the mitochondrial matrix, is enriched in the nuclear fraction,
thus corroborating previously published studies. More excitingly, further experiments
showed that endogenously-expressed Pβ also localizes to the nucleus, indicating that
this process is physiologically conserved. Previous studies from our group suggests that
endogenous Pβ is rapidly degraded by the proteasome. In contrast, my data
55
demonstrates that MG132, a proteasome inhibitor, is dispensable for endogenous Pβ
detection. This suggests that Pβ is not significantly degraded by the proteasome and
instead largely accumulates in the nucleus; however it does not negate the possibility that
Pβ is a substrate for other cytoplasmic peptidases.
4.3.2 Pβ Associates with Chromatin
One report in 2010 by Civitarese et al implicates Pβ in mitochondrial biogenesis,
although its putative mechanism of action has not yet been elucidated180. Data in this
thesis indicates that Pβ peptide associates with chromatin, which suggests that Pβ
transcriptionally regulates mitochondrial biogenesis. Historically, small peptides have
been observed to strongly associate with DNA in spite of chromatin deproteinization with
NaCl, SDS, chloroform/ isoamyl alcohol and phenol202,203. Interestingly, Pβ chromatin
association also appears to be fairly strong as lysis protocols previously documented to
solubize various DNA-bound complexes were unable to extract Pβ from chromatin204–206.
These results immediately raise multiple questions, including what the effect of this
interaction is on immediate gene transcription. One study demonstrated that global
peptide removal from DNA by alkaline extraction resulted in increased in vitro
transcription in comparison to deproteinized DNA preparations202. This study suggests
that the majority of chromatin-bound peptides act in an inhibitory fashion. However, the
majority chromatin-bound peptides in this study are suggested to be approximately
1kDa202, smaller than the 25 amino acid Pβ. If Pβ acts as a transcriptional repressor, it
may increase expression of mitochondrial biogenesis and fusion genes by inhibiting
mitochondrial biogenesis repressors. However, it is also possible that Pβ directly binds
56
chromatin to act as an activator or interacts with an undetermined protein complex to
influence gene expression.
4.3.3 Experiments in SH-SY5Ys Produce Variable Results
Our group has previously demonstrated that PARL β cleavage is tightly controlled
in SH-SY5Ys; it is undetectable by immunoblotting unless induced by various
mitochondrial stresses179. Titration of the ATP synthase inhibitor, OlA, demonstrated that
concentrations as low as 2.5μM were sufficient to trigger PARL β cleavage179. In contrast,
under the same conditions and with the same reagents, I detected equivalent amounts of
PARL β cleavage in SH-SY5Ys treated with or without 5μM OlA. A notable difference
between the two experiments is the source of SH-SY5Ys. The tumour-derived SH-SY5Ys
are notoriously susceptible to cell line changes due to factors including passage number,
confluence, differentiation, and differences in subculturing. A prominent consideration
with SH-SY5Ys is the presence of two morphologically distinct phenotypes that were
inherited from the parental SK-N-SH cell line: neuroblast-like cells and epithelial-like
cells207–209. Another consideration is the existence of both adherent and floating cell
populations209. Both of these characteristic ratios of cell populations may be drastically
altered with differing subculturing methods or due to drift over time. Of note, both
subculturing methods used by our group previously and in this thesis maintained both
floating and adherent cell populations. Nevertheless, if difficulties in reproducing results
in SH-SY5Ys are due to tendency of the cell line to change over time, alternative cell
models should be evaluated to ensure project continuity.
One cell model that should not be pursued is the overexpression system in
HEK293s. Data in this thesis indicates that overexpressed Pβ does not associate with
57
chromatin upon nuclear translocation, as endogenous Pβ in SH-SY5Ys does, but instead
accumulates in the insoluble nuclear fraction in HEK293s. This difference may be due to
disparity in the two cell lines’ expression profiles or in expression levels of Pβ. If it is the
former, this may suggest that Pβ chromatin association is cell line-specific and/or
dependent on other cell-specific actors to mediate its association. If it is the latter, this
may suggest that Pβ chromatin association is saturable.
4.3.4 Pβ: a Peptide with Purpose?
As a potential regulator of mitochondrial biogenesis, Pβ joins the small but recently
growing group of peptides implicated in mitochondrial quality control and homeostasis210–
212. One of the founding members of this group is humanin, a 21 or 24 amino acid peptide
(depending on the location of its translation) expressed from an open reading frame
(ORF) in the mitochondrial 16S rRNA, has been demonstrated to be anti-apoptotic, anti-
inflammatory, and neuroprotective by inhibiting various protein-binding partners210,213,214.
Given their roles in maintaining mitochondrial homeostasis, humanin and other
mitochondrial peptides are targets for therapeutic development against various diseases
and conditions including neurodegeneration and diabetes215,216.
Pβ is not the first peptide produced by proteolysis that has been proposed to
regulate transcription. Amyloid-β42 (Aβ42), a 44 amino acid product of amyloid precursor
protein (APP) proteolysis and a hypothesized central player in Alzheimer’s disease (AD)
pathogenesis, has been demonstrated to localize to the nucleus and is suggested to
directly associate with gene promoters to repress their expression217–219. While Pβ is not
pathogenic, it will be interesting to determine whether any parallels in transcriptional
regulation may be identified in the future.
58
4.4 Future Directions
Work presented in this thesis further characterizes Pβ, a product of PARL β
cleavage, by providing a foundation to elucidate its putative mechanism of action in
affecting mitochondrial biogenesis, a pathway that can replace damaged mitochondria
degraded by mitophagy. However, the work presented in this thesis proposes more
questions than it has answered. Presented below are some of the many questions that
remain.
4.4.1 What is the Phosphatase Responsible for β Cleavage?
The mitochondrial matrix kinase, PDK2, was identified as the kinase responsible
for the phosphorylation of PARL’s N-terminus to inhibit PARL β cleavage. However, the
phosphatase responsible for lifting these repressive post-translational modifications
remains unknown. PARL’s putative phosphatase is a key regulator of PARL β cleavage
and Pβ production, and by extension, a key regulator in mitochondrial quality control and
homeostasis. The most obvious candidate is Pyruvate Dehydrogenase Phosphatase
(PDP), which reverses PDK phosphorylation of Pyruvate Dehydrogenase220. To date, two
isoforms of PDP have been identified: PDP1, which is most highly expressed in the heart,
brain, and testis; and PDP2, which is most highly expressed in the heart, liver, and
kidney220–222. It is possible that like PDK2, only one isoform is responsible for PARL
dephosphorylation. Another possibility is that another unidentified phosphatase located
in the matrix or IMM dephosphorylates PARL. To identify the PARL phosphatase,
matrix/IMM phosphatases may be systematically overexpressed and cells may be
monitored for increased PARL β cleavage by western blot. Phosphatases whose altered
expression affects PARL β cleavage may be validated for PARL interaction by
59
coimmunoprecipitation (co-IP), similar to Shi and McQuibban’s approach to identify
PARL’s kinase, PDK2179.
4.4.2 What Allows Pβ Export from Mitochondria?
As Pβ’s effect on mitochondrial biogenesis likely necessitates its nuclear
localization, mitochondrial Pβ retention or export may serve as an additional layer of
regulation on Pβ activity. As Pβ possesses six highly conserved positively charged
residues, it is an extremely poor candidate for unfacilitated diffusion across the highly
impermeable IMM and almost certainly requires a dedicated transporter. Two identified
putative peptide exporters in the IMM are ATP-binding cassette (ABC) B8 (ABCB8) and
ABCB10, which belong to a highly heterogeneous subfamily of ABC half transporters
involved in intracellular trafficking and compartmentalization of peptides223. ABCB10 and
its orthologues are the better studied of the pair. Studies have shown that the ABCB10
orthologues, multi-drug resistance-like (MDL1) from Saccharomyces cerevisiae and HAF-
1 from Caenorhabditis elegans, are conserved in their function as mitochondrial peptide
exporters224–227. Peptides exported by the yeast MDL1 are estimated to be approximately
0.6-2.1 kDa, the upper limit of which is comparable to Pβ’s expected molecular weight224.
To determine whether ABCB8 and/or ABCB10 facilitates Pβ efflux from mitochondria,
either transporter may be knocked down by siRNA or knocked out by CRISPR/Cas9 gene
editing. Resultant Pβ localization may be observed by subcellular fractionation and
western blot.
Data from this thesis and others show that Pβ is strongly detected in the nuclear
fraction in HEK293s under all conditions except when treated with the highest
concentrations of OlA, which depletes mitochondrial ATP. Under this condition, reduced
Pβ production was observed despite increased PARL β cleavage. We hypothesize that
60
the paradoxical reduction in Pβ detection at high levels of mitochondrial stress reduces
Pβ-mediated mitochondrial biogenesis in response to significant mitochondrial damage,
in part because mitochondrial biogenesis is a highly energy-consuming process. If ATP-
dependent ABCB8/10 are Pβ exporters, nuclear Pβ reduction may be a result of impaired
efflux from the mitochondrial matrix due to mitochondrial ATP depletion followed by Pβ
degradation by proteases in the matrix.
Mitochondrial matrix peptide export is largely focused on traversing the IMM.
Peptides are hypothesized to exit mitochondria by diffusion through OMM porins or TOM,
although these mechanisms require clarification223,228–230. As a mitochondrial peptide, Pβ
may be exported across the OMM in a similar fashion.
4.4.3 Does Pβ Undergo any Post-Cleavage Modifications?
A consistent observation when visualizing Pβ by western blot is the recognition of
two specific bands. Importantly, these bands ran at a similar molecular weight to purified
phosphorylated and unphosphorylated Pβ (Fig.4-2). This led us to speculate that Pβ
exists in two populations in the nucleus – phosphorylated and unphosphorylated. When
A B
Figure 4-2: Pβ doublet and phosphorylated/unphosphorylated Pβ run at similar molecular weights: A Western blot of PARL β cleavage and Pβ production in HEK293s expressing WT PARL or β PARL. A Pβ doublet is detectable in cells expressing WT PARL, which undergoes β cleavage, but not in cells expressing β PARL, which does not undergo β cleavage. B Western blot of purified synthetic phosphorylated and unphosphorylated Pβ, which run at a similar molecular weight as the Pβ doublet detected in cell lysates.
61
attached to PARL, Pβ’s phosphorylation sites, S65, T69, S70, additively inhibit PARL β
cleavage178. Thus, we hypothesize that putative Pβ phosphorylation likely occurs post-
cleavage. To determine whether the upper Pβ-specific band is due to phosphorylation,
cell lysates may be dephosphorylated by incubation with non-specific phosphatases such
as calf intestinal alkaline phosphatase (CIAP) or protein phosphatase-1 (PP1) prior to
SDS-PAGE and monitored for decrease of the upper Pβ-specific band by western blot.
Alternatively, PARL constructs where phosphorylation sites have been mutated to non-
phosphorylatable alanine may be generated and monitored by western blot to determine
whether Pβ produced by these constructs is visualized as a doublet or a singlet. As a
more unbiased approach, Pβ may be immunoprecipitated from cell lysates prepared
using strong detergents and post-translational modifications may be identified by mass
spectrometry231,232.
If a subpopulation of Pβ is phosphorylated, an immediate concern, aside from the
identity of the putative kinase, is whether phosphorylation alters Pβ activity. To this end,
future experiments should include conditions where Pβ phosphorylation is inhibited. As
overexpression data in HEK293s differs from endogenous data in SH-SY5Ys, it would be
necessary to generate cell lines wherein PARL phosphorylation sites are mutated to
alanine rather than rely on overexpression systems. These missense mutations may be
generated via the CRISPR-Cas9 gene-editing system and homologous repair
incorporating templates containing our mutations of interest.
4.4.4 Does Pβ Interact with Other Proteins?
One method to determine Pβ mechanism and function is to identify its potential
protein interactors. As Pβ associates with chromatin, an immediate question is whether
this interaction is mediated by other proteins. While certain peptides are proposed to bind
62
directly to DNA to inhibit transcription, we cannot negate the possibility that Pβ’s putative
role in transcriptional regulation may be mediated by association with transcription
factors, modulators, scaffolds, or other proteins202,217,218. Ideally, Pβ interactors would be
identified by Pβ immunoprecipitation followed by mass spectrometry analysis (IP-MS).
However, I have been unable to successfully immunoprecipitate Pβ from chromatin-
associated fractions (data not shown). It is possible that the epitope that Pβ antibody
recognizes is sterically unavailable when Pβ is bound to its interactor. This likelihood is
increased due to Pβ’s comparatively small size. Alternatively, Pβ interactors may be
identified by affinity chromatography. Briefly, synthesized Pβ may be immobilized on
resin, followed by pull down assays with whole cell lysates. Eluted proteins may be
identified by MS and validated for physiological Pβ interaction by co-IP. To determine
what residues or post-translational modifications mediate these interactions, parallel
experiments may be conducted with Pβ synthesized with mutated key residues or
additional modifications.
Another method to identify Pβ interactors involves size exclusion chromatography
(SEC) in cells where Pβ is expressed or abolished. Proteins in SEC fractions where Pβ
is expected to be eluted may be identified by MS and compared to identify putative Pβ
interactors, which would then be validated by co-IP. A benefit of this approach in
comparison to affinity chromatography is the likelier identification of physiological
interactors.
In addition to identifying putative facilitators of Pβ chromatin association, both
suggested methods should recognize interactors that may be involved in Pβ transport
and stability in the mitochondria, cytosol and nucleus. Depending on the sensitivity of
63
these assays, Pβ modulators, such as its putative kinase or phosphatase, may also be
identified.
4.4.5 What Genes Associate with Pβ?
Another immediate goal that arises from observations of Pβ chromatin association
is to identity Pβ-binding sequences. While human myotubes transfected with Pβ showed
increased expression of select mitochondrial biogenesis and fusion genes (PGC-1β,
NRF1, MFN1/2), it is unclear whether upregulation of these genes is due to direct or
indirect activation. To identify Pβ-associated genes, chromatin immunoprecipitation
(ChIP) experiments may be conducted to identify Pβ-associated DNA sequences via
high-throughput sequencing (ChIP-seq). This data will help to determine Pβ DNA-binding
specificity and characterize possible Pβ consensus sequences or motifs. Importantly, the
category of associated genes will shed light on Pβ’s control of mitochondrial biogenesis.
Furthermore, this data will determine whether Pβ regulates multiple mitochondrial
biogenesis genes or mediates their upregulation indirectly by associating with master
regulator genes like PGC-1β.
Of note, I was unable to immunoprecipitate endogenous Pβ from SH-SY5Ys
treated with 0.75% or 1% formaldehyde using a protocol adapted from Donner et al. using
Pβ-specific antibody233. A possible solution is to express a tagged version of Pβ, such as
Pβ-GFP, which has been demonstrated to localize to the nucleus. Using this system, Pβ
may be immunoprecipitated by its epitope tag. Importantly, tagged Pβ must be validated
for nuclear localization and chromatin association as tags may interfere with these
activities. For instance, Pβ tagged with 3XFLAG at the N- or C-terminus is exclusively
cytosolic (data not shown) and thus is a poor construct to characterize Pβ.
64
Chromatin fractionations and ChIP experiments are not reliable methods to
establish direct Pβ DNA binding, despite novel proposed bioinformatics methods to
distinguish direct and indirect interactions from ChIP-seq data218. To determine whether
Pβ can directly associate with DNA, an in vitro electrophoretic mobility shift assay (EMSA;
also known as gel shift assay) may be conducted with synthesized Pβ and labelled DNA
probes whose sequences are identified by ChIP-Seq as putative Pβ-associated sites. If
Pβ directly associates with these sequences, a band shift should be apparent when both
Pβ and the probe are present compared to the probe alone.
If Pβ-DNA direct interaction is verified by EMSA, this technique will be a powerful
tool to identify the core amino acid and nucleotide residues responsible for Pβ chromatin
association. As both Pβ peptide and the DNA probe would be synthesized, both may be
systematically mutated and tested by EMSA for changes in band shifts. Additional post-
translational modifications, such as phosphorylation, may also be manipulated.
4.4.6 What is the Effect of Pβ on Mitochondrial Biogenesis?
Although Civitarese et al. have identified a handful of mitochondrial genes whose
increased expression is dependent on Pβ, the full scope of Pβ-mediated gene expression
remains to be elucidated. To better clarify Pβ’s role in mitochondrial biogenesis, we
propose to employ RNA-sequencing (RNA-Seq), which is a less biased approach to
compare transcriptome profiles of Pβ-expressing and Pβ-deficient cells. As
overexpressed Pβ does not appear to associate with chromatin, I intend to pursue this
endeavor in cells expressing endogenous levels of Pβ. For comparison, cell lines with
abolished Pβ expression must be established. Using the CRISPR/Cas9 gene-editing
system combined with homologous repair using designed templates, PARL β cleavage,
and thus Pβ production, may be abolished by introducing the PD-linked substitution S77N
65
(generating full length PARL) or by deleting Pβ sequence in-frame (generating β-PARL).
Alternatively, mutations of Pβ’s putative NLS (R54T, K55S, R58T, K59S177) may be
introduced to prevent nuclear Pβ localization while simultaneously maintaining PARL β
cleavage and protease activity. The transcriptome profiles of these cell lines in
comparison to WT cells will also help delineate transcriptional changes due to Pβ
production versus PARL activity. Upregulated mitochondrial gene transcripts should be
validated for consequent increases in mitochondrial protein expression by western blot.
In turn, Pβ-dependent increases in mitochondrial biogenesis should be verified by various
mitochondrial biogenesis assays as described by Civitarese et al180.
4.5 Conclusions
The importance of PARL β cleavage in mitochondrial and cellular health is
emphasized by the PD-linked mutation, S77N, which abolishes this N-terminal cleavage
event and expression of its products. One of these products, the 25 amino acid peptide
Pβ, is suggested to localize to the nucleus to regulate mitochondrial biogenesis. In this
thesis, I have demonstrated that endogenous Pβ is exported from mitochondria and
accumulates in the nucleus. Additionally, data suggests that Pβ associates with
chromatin, offering a potential mechanism of mitochondrial biogenesis regulation. These
exciting advances in characterizing Pβ peptide are accompanied by new, pressing
questions whose imminent answers will shed light on coordination of mitochondrial quality
control pathways to maintain mitochondrial health, and ultimately cellular and human
health.
66
REFERENCES
1. Ernster, L. & Schatz, G. Mitochondria: a historical review. J. Cell Biol. 91, 227s–
255s (1981).
2. Friedman, J. R. & Nunnari, J. Mitochondrial form and function. Nature 505, 335–343 (2014).
3. Camilleri, A. & Vassallo, N. The centrality of mitochondria in the pathogenesis and treatment of Parkinson’s disease. CNS Neurosci. Ther. 20, 591–602 (2014).
4. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. Molecular biology of the cell (4th ed.). (Garland Science, 2003).
5. Bonen, L., Cunningham, R.S., Gray, M.W. & Doolittle, W.F. Wheat embryo mitochondrial 18S ribosomal RNA: evidence for its prokaryotic nature. Nucleic Acids Res. 4, 663–671 (1977).
6. Yang, D., Oyaizu, Y., Oyaizu, H., Olsen, G.J. & Woese, C.R. Mitochondrial origins. Proc. Natl. Acad. Sci. U. S. A. 82, 4443–4447 (1985).
7. Schwartz, W., & Lynn Margulis, Origin of eukaryotic cells. Evidence and research implications for a theory of the origin and evolution of microbial, plant, and animal cells on the Precambrian earth. Journal of Basic Microbiology. 13 (2), (1973).
8. Archibald, J.M. Endosymbiosis and eukaryotic cell evolution. Curr. Biol. 25, R911–R921 (2015).
9. Taanman, J.W. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta BBA - Bioenerg. 1410, 103–123 (1999).
10. Hällberg, B.M. & Larsson, N.G. Making proteins in the powerhouse. Cell Metab. 20, 226–240 (2014).
11. Gustafsson, C.M., Falkenberg, M. & Larsson, N.G. Maintenance and expression of mammalian mitochondrial DNA. Annu. Rev. Biochem. 85, 133–160 (2016).
12. Kayal, E., Bentlage, B., Collins, A. G., Kayal, M., Pirro, S. & Lavrov, D. V. Evolution of linear mitochondrial genomes in medusozoan cnidarians. Genome Biol. Evol. 4, 1–12 (2012).
13. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R. & Young, I.G. Sequence and organization of the human mitochondrial genome. Nature 290, 457–465 (1981).
14. Palade, G.E. The fine structure of mitochondria. Anat. Rec. 114, 427–451 (1952).
15. Palade, G.E. An electron microscope study of the mitochondrial structure. J. Histochem. Cytochem. Off. J. Histochem. Soc. 1, 188–211 (1953).
67
16. Sjöstrand, F.S. The ultrastructure of the outer segments of rods and cones of the eye as revealed by the electron microscope. J. Cell. Comp. Physiol. 42, 15–44 (1953).
17. Sjostrand, F.S. Electron microscopy of mitochondria and cytoplasmic double membranes. Nature 171, 30–32 (1953).
18. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. The Mitochondrion Molecular biology of the cell (4th ed.). (Garland Science, 2003).
19. Kühlbrandt, W. Structure and function of mitochondrial membrane protein complexes. BMC Biol. 13, (2015).
20. Vögtle, F.N., Wortelkamp, S., Zahedi, R.P., Becker, D., Leidhold, C., Gevaert, K., Kellermann, J., Voos, W., Sickmann, A., Pfanner, N. & Meisinger, C. Global Analysis of the Mitochondrial N-Proteome Identifies a Processing Peptidase Critical for Protein Stability. Cell 139, 428–439 (2009).
21. Chacinska, A., Koehler, C.M., Milenkovic, D., Lithgow, T. & Pfanner, N. Importing mitochondrial proteins: machineries and mechanisms. Cell 138, 628–644 (2009).
22. Paradies, G., Paradies, V., De Benedictis, V., Ruggiero, F.M. & Petrosillo, G. Functional role of cardiolipin in mitochondrial bioenergetics. Biochim. Biophys. Acta BBA - Bioenerg. 1837, 408–417 (2014).
23. Kulawiak, B., Höpker, J., Gebert, M., Guiard, B., Wiedemann, N. & Gebert, N. The mitochondrial protein import machinery has multiple connections to the respiratory chain. Biochim. Biophys. Acta BBA - Bioenerg. 1827, 612–626 (2013).
24. Akram, M. Citric acid cycle and role of its intermediates in metabolism. Cell Biochem. Biophys. 68, 475–478 (2014).
25. Sorriento, D., Pascale, A.V., Finelli, R., Carillo, A.L., Annunziata, R., Trimarco, B. & Iaccarino, G. Targeting Mitochondria as Therapeutic Strategy for Metabolic Disorders. Sci. World J. 2014, (2014).
26. Mitchell, P. Coupling of phosphorylation to electron and hydrogen transfer by a chemi-osmotic type of mechanism. Nature 191, 144–148 (1961).
27. Mitchell, P. & Moyle, J. Estimation of membrane potential and pH difference across the cristae membrane of rat liver mitochondria. Eur. J. Biochem. 7, 471–484 (1969).
28. Higgins, G.C. & Coughlan, M.T. Mitochondrial dysfunction and mitophagy: the beginning and end to diabetic nephropathy? Br. J. Pharmacol. 171, 1917–1942 (2014).
29. Bhola, P.D. & Letai, A. Mitochondria – judges and executioners of cell death sentences. Mol. Cell 61, 695–704 (2016).
30. Tait, S.W.G. & Green, D.R. Mitochondrial regulation of cell death. Cold Spring Harb. Perspect. Biol. 5, (2013).
31. Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 35, 495–516 (2007).
68
32. Gross, A., Jockel, J., Wei, M.C. & Korsmeyer, S.J. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. EMBO J. 17, 3878–3885 (1998).
33. Wei, M.C., Lindsten, T., Mootha, V.K., Weiler, S., Gross, A., Ashiya, M., Thompson, C.B. & Korsmeyer, S.J. tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev. 14, 2060–2071 (2000).
34. Tait, S.W.G. & Green, D.R. Caspase-independent cell death: leaving the set without the final cut. Oncogene 27, 6452–6461 (2008).
35. Government of Canada, S.C. Leading Causes of Death in Canada. (2012). at <http://www5.statcan.gc.ca/olc-cel/olc.action?ObjId=84-215-X&ObjType=2&lang=en&limit=0>.
36. Ryan, B.J., Hoek, S., Fon, E.A. & Wade-Martins, R. Mitochondrial dysfunction and mitophagy in Parkinson’s: from familial to sporadic disease. Trends Biochem. Sci. 40, 200–210 (2015).
37. Demetrius, L.A. & Simon, D.K. An inverse-Warburg effect and the origin of Alzheimer’s disease. Biogerontology 13, 583–594 (2012).
38. Villacé, P., Mella, R.M. & Kortazar, D. Mitochondria in the context of Parkinson’s disease. Neural Regen. Res. 12, 214–215 (2017).
39. Langston, J.W., Ballard, P., Tetrud, J.W. & Irwin, I. Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science 219, 979–980 (1983).
40. Burns, R.S., LeWitt, P.A., Ebert, M.H., Pakkenberg, H. & Kopin, I.J. The clinical syndrome of striatal dopamine deficiency. Parkinsonism induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). N. Engl. J. Med. 312, 1418–1421 (1985).
41. Bose, A. & Beal, M.F. Mitochondrial dysfunction in Parkinson’s disease. J. Neurochem. 139 Suppl 1, 216–231 (2016).
42. Liang, C.L., Wang, T.T., Luby-Phelps, K. & German, D.C. Mitochondria mass is low in mouse substantia nigra dopamine neurons: implications for Parkinson’s disease. Exp. Neurol. 203, 370–380 (2007).
43. Dauer, W. & Przedborski, S. Parkinson’s disease: mechanisms and models. Neuron 39, 889–909 (2003).
44. Marcillat, O., Zhang, Y., Lin, S.W. & Davies, K.J. Mitochondria contain a proteolytic system which can recognize and degrade oxidatively-denatured proteins. Biochem. J. 254, 677–683 (1988).
45. Soubannier, V., Rippstein, P., Kaufman, B.A., Shoubridge, E.A. & McBride, H.M. Reconstitution of mitochondria derived vesicle formation demonstrates selective enrichment of oxidized cargo. PLOS ONE 7, e52830 (2012).
46. Ding, W.X. & Yin, X.M. Mitophagy: mechanisms, pathophysiological roles, and analysis. Biol. Chem. 393, 547–564 (2012).
69
47. Lewis, M.R., & Lewis, W.H. Mitochondria (and other cytoplasmic structures) in tissue cultures. Developmental Dynamics. 17 (3), 339-401 (1915).
48. Twig, G. & Shirihai, O.S. The interplay between mitochondrial dynamics and mitophagy. Antioxid. Redox Signal. 14, 1939–1951 (2011).
49. Tanaka, A., Harwig, M., Xu, S., P Narendra, D., Suen, D.F., Karbowski, M. & Youle, R. Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J. Cell Biol. 191, 1367–80 (2010).
50. Toyama, E. Q., Herzig, S., Courchet, J., Lewis, T.L., Losón, O.C., Hellberg, K., Young, N.P., Chen, H., Polleux, F., Chan, D.C. & Shaw, R.J. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science 351, 275–281 (2016).
51. Ehses, S., Raschke, I., Mancuso, G., Bernacchia, A., Geimer, S., Tondera, D., Martinou, J.-C., Westermann, B., Rugarli, E.I. & Langer, T. Regulation of OPA1 processing and mitochondrial fusion by m-AAA protease isoenzymes and OMA1. J. Cell Biol. 187, 1023–1036 (2009).
52. Head, B., Griparic, L., Amiri, M., Gandre-Babbe, S. & Bliek, A.M. van der. Inducible proteolytic inactivation of OPA1 mediated by the OMA1 protease in mammalian cells. J. Cell Biol. 187, 959–966 (2009).
53. Gegg, M.E., Cooper, J.M., Chau, K.Y., Rojo, M., Schapira, A.H.V. & Taanman, J.W. Mitofusin 1 and mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent manner upon induction of mitophagy. Hum. Mol. Genet. 19, 4861–4870 (2010).
54. Chan, N.C., Salazar, A.M., Pham, A.H., Sweredoski, M.J., Kolawa, N.J., Graham, R.L.J., Hess, S. & Chan, D.C. Broad activation of the ubiquitin–proteasome system by Parkin is critical for mitophagy. Hum. Mol. Genet. 20, 1726–1737 (2011).
55. Poole, A.C., Thomas, R.E., Yu, S., Vincow, E.S. & Pallanck, L. The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway. PLOS ONE 5, e10054 (2010).
56. Praefcke, G.J.K. & McMahon, H.T. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. 5, 133–147 (2004).
57. Lee, J.E., Westrate, L.M., Wu, H., Page, C. & Voeltz, G.K. Multiple dynamin family members collaborate to drive mitochondrial division. Nature 540, 139–143 (2016).
58. Friedman, J.R., Lackner, L.L., West, M., DiBenedetto, J.R., Nunnari, J. & Voeltz, G.K. ER tubules mark sites of mitochondrial division. Science 334, 358–362 (2011).
59. Losón, O.C., Song, Z., Chen, H. & Chan, D.C. Fis1, Mff, MiD49, and MiD51 mediate Drp1 recruitment in mitochondrial fission. Mol. Biol. Cell 24, 659–667 (2013).
60. Pryde, K.R., Smith, H.L., Chau, K.Y. & Schapira, A.H.V. PINK1 disables the anti-fission machinery to segregate damaged mitochondria for mitophagy. J. Cell Biol. 213, 163–171 (2016).
70
61. Kageyama, Y., Hoshijima, M., Seo, K., Bedja, D., Sysa-Shah, P., Andrabi, S. A., Chen, W., Höke, A., Dawson, V. L., Dawson, T. M., Gabrielson, K., Kass, D. A., Iijima, M. & Sesaki, H. Parkin-independent mitophagy requires Drp1 and maintains the integrity of mammalian heart and brain. EMBO J. 33, 2798–2813 (2014).
62. Prudent, J., Zunino, R., Sugiura, A., Mattie, S., Shore, G. C. & McBride, H. M. MAPL SUMOylation of Drp1 stabilizes an ER/Mitochondrial platform required for cell death. Mol. Cell 59, 941–955 (2015).
63. Lemasters, J. J. Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuvenation Res. 8, 3–5 (2005).
64. Palikaras, K., Daskalaki, I., Markaki, M. & Tavernarakis, N. Mitophagy and age-related pathologies: Development of new therapeutics by targeting mitochondrial turnover. Pharmacol. Ther. 178, 157–174 (2017).
65. McWilliams, T. G., Prescott, A. R., Montava-Garriga, L., Ball, G., Singh, F., Barini, E., Muqit, M. M. K., Brooks, S. P. & Ganley, I. G. Basal mitophagy occurs independently of PINK1 in mouse tissues of high metabolic demand. Cell Metab. 0, (2018).
66. Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. & Shimizu, N. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605–608 (1998).
67. Valente, E. M., Abou-Sleiman, P. M., Caputo, V., Muqit, M. M. K., Harvey, K., Gispert, S., Ali, Z., Del Turco, D., Bentivoglio, A. R., Healy, D. G., Albanese, A., Nussbaum, R., González-Maldonado, R., Deller, T., Salvi, S., Cortelli, P., Gilks, W. P., Latchman, D. S., Harvey, R. J., Dallapiccola, B., Auburger, G. & Wood, N. W. Hereditary early-onset Parkinson’s disease caused by mutations in PINK1. Science 304, 1158–1160 (2004).
68. Fitzgerald, J. C. & Plun-Favreau, H. Emerging pathways in genetic Parkinson’s disease: autosomal-recessive genes in Parkinson’s disease--a common pathway? FEBS J. 275, 5758–5766 (2008).
69. Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., Yoo, S. J., Hay, B. A. & Guo, M. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441, 1162–1166 (2006).
70. Park, J., Lee, S. B., Lee, S., Kim, Y., Song, S., Kim, S., Bae, E., Kim, J., Shong, M., Kim, J.-M. & Chung, J. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, 1157–1161 (2006).
71. Yang, Y., Gehrke, S., Imai, Y., Huang, Z., Ouyang, Y., Wang, J.-W., Yang, L., Beal, M. F., Vogel, H. & Lu, B. Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc. Natl. Acad. Sci. U. S. A. 103, 10793–10798 (2006).
72. Greene, J. C., Whitworth, A. J., Kuo, I., Andrews, L. A., Feany, M. B. & Pallanck, L. J. Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc. Natl. Acad. Sci. U. S. A. 100, 4078–4083 (2003).
71
73. Narendra, D., Tanaka, A., Suen, D.F. & Youle, R. J. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J. Cell Biol. 183, 795–803 (2008).
74. Kim, Y., Park, J., Kim, S., Song, S., Kwon, S.K., Lee, S.H., Kitada, T., Kim, J.M. & Chung, J. PINK1 controls mitochondrial localization of Parkin through direct phosphorylation. Biochem. Biophys. Res. Commun. 377, 975–980 (2008).
75. Exner, N., Treske, B., Paquet, D., Holmström, K., Schiesling, C., Gispert, S., Carballo-Carbajal, I., Berg, D., Hoepken, H.-H., Gasser, T., Krüger, R., Winklhofer, K. F., Vogel, F., Reichert, A. S., Auburger, G., Kahle, P. J., Schmid, B. & Haass, C. Loss-of-function of human PINK1 results in mitochondrial pathology and can be rescued by parkin. J. Neurosci. Off. J. Soc. Neurosci. 27, 12413–12418 (2007).
76. Fallaize, D., Chin, L.S. & Li, L. Differential submitochondrial localization of PINK1 as a molecular switch for mediating distinct mitochondrial signalling pathways. Cell. Signal. 27, 2543–2554 (2015).
77. Jin, S. M., Lazarou, M., Wang, C., Kane, L. A., Narendra, D. P. & Youle, R. J. Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J. Cell Biol. 191, 933–942 (2010).
78. Shi, G., Lee, J. R., Grimes, D. A., Racacho, L., Ye, D., Yang, H., Ross, O. A., Farrer, M., McQuibban, G. A. & Bulman, D. E. Functional alteration of PARL contributes to mitochondrial dysregulation in Parkinson’s disease. Hum. Mol. Genet. 20, 1966–1974 (2011).
79. Deas, E., Plun-Favreau, H., Gandhi, S., Desmond, H., Kjaer, S., Loh, S. H. Y., Renton, A. E. M., Harvey, R. J., Whitworth, A. J., Martins, L. M., Abramov, A. Y. & Wood, N. W. PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum. Mol. Genet. 20, 867–879 (2011).
80. Meissner, C., Lorenz, H., Weihofen, A., Selkoe, D. J. & Lemberg, M. K. The mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1 trafficking. J. Neurochem. 117, 856–867 (2011).
81. Takatori, S., Ito, G. & Iwatsubo, T. Cytoplasmic localization and proteasomal degradation of N-terminally cleaved form of PINK1. Neurosci. Lett. 430, 13–17 (2008).
82. Fedorowicz, M. A., de Vries-Schneider, R. L. A., Rüb, C., Becker, D., Huang, Y., Zhou, C., Alessi Wolken, D. M., Voos, W., Liu, Y. & Przedborski, S. Cytosolic cleaved PINK1 represses Parkin translocation to mitochondria and mitophagy. EMBO Rep. 15, 86–93 (2014).
83. Chaugule, V. K., Burchell, L., Barber, K. R., Sidhu, A., Leslie, S. J., Shaw, G. S. & Walden, H. Autoregulation of Parkin activity through its ubiquitin-like domain. EMBO J. 30, 2853–2867 (2011).
84. Pickrell, A. M. & Youle, R. J. The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease. Neuron 85, 257–273 (2015).
72
85. Lazarou, M., Jin, S. M., Kane, L. A. & Youle, R. J. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev. Cell 22, 320–333 (2012).
86. Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C. A., Sou, Y.-S., Saiki, S., Kawajiri, S., Sato, F., Kimura, M., Komatsu, M., Hattori, N. & Tanaka, K. PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J. Cell Biol. 189, 211–221 (2010).
87. Kondapalli, C., Kazlauskaite, A., Zhang, N., Woodroof, H. I., Campbell, D. G., Gourlay, R., Burchell, L., Walden, H., Macartney, T. J., Deak, M., Knebel, A., Alessi, D. R. & Muqit, M. M. K. PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65. Open Biol. 2, 120080 (2012).
88. Shiba-Fukushima, K., Imai, Y., Yoshida, S., Ishihama, Y., Kanao, T., Sato, S. & Hattori, N. PINK1-mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Sci. Rep. 2, 1002 (2012).
89. Kane, L. A., Lazarou, M., Fogel, A. I., Li, Y., Yamano, K., Sarraf, S. A., Banerjee, S. & Youle, R. J. PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J. Cell Biol. 205, 143–153 (2014).
90. Kazlauskaite, A., Kondapalli, C., Gourlay, R., Campbell, D. G., Ritorto, M. S., Hofmann, K., Alessi, D. R., Knebel, A., Trost, M. & Muqit, M. M. K. Parkin is activated by PINK1-dependent phosphorylation of ubiquitin at Ser65. Biochem. J. 460, 127–139 (2014).
91. Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., Endo, T., Fon, E. A., Trempe, J.-F., Saeki, Y., Tanaka, K. & Matsuda, N. Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162–166 (2014).
92. Ordureau, A., Sarraf, S. A., Duda, D. M., Heo, J.-M., Jedrychowski, M. P., Sviderskiy, V. O., Olszewski, J. L., Koerber, J. T., Xie, T., Beausoleil, S. A., Wells, J. A., Gygi, S. P., Schulman, B. A. & Harper, J. W. Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Mol. Cell 56, 360–375 (2014).
93. Kazlauskaite, A., Martínez-Torres, R. J., Wilkie, S., Kumar, A., Peltier, J., Gonzalez, A., Johnson, C., Zhang, J., Hope, A. G., Peggie, M., Trost, M., van Aalten, D. M. F., Alessi, D. R., Prescott, A. R., Knebel, A., Walden, H. & Muqit, M. M. K. Binding to serine 65-phosphorylated ubiquitin primes Parkin for optimal PINK1-dependent phosphorylation and activation. EMBO Rep. 16, 939–954 (2015).
94. Kumar, A., Aguirre, J. D., Condos, T. E. C., Martinez-Torres, R. J., Chaugule, V. K., Toth, R., Sundaramoorthy, R., Mercier, P., Knebel, A., Spratt, D. E., Barber, K. R., Shaw, G. S. & Walden, H. Disruption of the autoinhibited state primes the E3 ligase parkin for activation and catalysis. EMBO J. 34, 2506–2521 (2015).
73
95. Wauer, T., Simicek, M., Schubert, A. & Komander, D. Mechanism of phospho-ubiquitin-induced PARKIN activation. Nature 524, 370–374 (2015).
96. Yamano, K., Queliconi, B. B., Koyano, F., Saeki, Y., Hirokawa, T., Tanaka, K. & Matsuda, N. Site-specific interaction mapping of phosphorylated ubiquitin to uncover parkin activation. J. Biol. Chem. 290, 25199–25211 (2015).
97. Neutzner, A., Benard, G., Youle, R. J. & Karbowski, M. Role of the ubiquitin conjugation system in the maintenance of mitochondrial homeostasis. Ann. N. Y. Acad. Sci. 1147, 242–253 (2008).
98. Bragoszewski, P., Turek, M. & Chacinska, A. Control of mitochondrial biogenesis and function by the ubiquitin–proteasome system. Open Biol. 7, (2017).
99. Wang, X., Winter, D., Ashrafi, G., Schlehe, J., Wong, Y. L., Selkoe, D., Rice, S., Steen, J., LaVoie, M. J. & Schwarz, T. L. PINK1 and parkin target miro for phosphorylation and degradation to arrest mitochondrial motility. Cell 147, 893–906 (2011).
100. Liu, S., Sawada, T., Lee, S., Yu, W., Silverio, G., Alapatt, P., Millan, I., Shen, A., Saxton, W., Kanao, T., Takahashi, R., Hattori, N., Imai, Y. & Lu, B. Parkinson’s disease–associated kinase PINK1 regulates miro protein level and axonal transport of mitochondria. PLOS Genet. 8, e1002537 (2012).
101. Kazlauskaite, A., Kelly, V., Johnson, C., Baillie, C., Hastie, C. J., Peggie, M., Macartney, T., Woodroof, H. I., Alessi, D. R., Pedrioli, P. G. A. & Muqit, M. M. K. Phosphorylation of parkin at serine65 is essential for activation: elaboration of a miro1 substrate-based assay of Parkin E3 ligase activity. Open Biol. 4, 130213 (2014).
102. Chen, Y. & Dorn, G. W. PINK1-phosphorylated mitofusin 2 is a parkin receptor for culling damaged mitochondria. Science 340, 471–475 (2013).
103. Sarraf, S. A., Raman, M., Guarani-Pereira, V., Sowa, M. E., Huttlin, E. L., Gygi, S. P. & Harper, J. W. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372–376 (2013).
104. Yamano, K., Matsuda, N. & Tanaka, K. The ubiquitin signal and autophagy: an orchestrated dance leading to mitochondrial degradation. EMBO Rep. 17, 300–316 (2016).
105. Lazarou, M., Sliter, D. A., Kane, L. A., Sarraf, S. A., Wang, C., Burman, J. L., Sideris, D. P., Fogel, A. I. & Youle, R. J. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314 (2015).
106. Heo, J.-M., Ordureau, A., Paulo, J. A., Rinehart, J. & Harper, J. W. The PINK1-PARKIN mitochondrial ubiquitylation pathway drives a program of OPTN/NDP52 recruitment and TBK1 activation to promote mitophagy. Mol. Cell 60, 7–20 (2015).
107. Glick, D., Barth, S. & Macleod, K. F. Autophagy: cellular and molecular mechanisms. J. Pathol. 221, 3–12 (2010).
74
108. Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D.-F., Gautier, C. A., Shen, J., Cookson, M. R. & Youle, R. J. PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 8, e1000298 (2010).
109. Kubli, D. A. & Gustafsson, Å. B. Mitochondria and mitophagy: the yin and yang of cell death control. Circ. Res. 111, 1208–1221 (2012).
110. Palikaras, K. & Tavernarakis, N. Mitochondrial homeostasis: the interplay between mitophagy and mitochondrial biogenesis. Exp. Gerontol. 56, 182–188 (2014).
111. Garnier, A., Fortin, D., Zoll, J., N’Guessan, B., Mettauer, B., Lampert, E., Veksler, V. & Ventura-Clapier, R. Coordinated changes in mitochondrial function and biogenesis in healthy and diseased human skeletal muscle. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 19, 43–52 (2005).
112. Shiota, T., Traven, A. & Lithgow, T. Mitochondrial biogenesis: cell-cycle-dependent investment in making mitochondria. Curr. Biol. 25, R78–R80 (2015).
113. Kelly, D. P. & Scarpulla, R. C. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 18, 357–368 (2004).
114. Uittenbogaard, M. & Chiaramello, A. Mitochondrial biogenesis: a therapeutic target for neurodevelopmental disorders and neurodegenerative diseases. Curr. Pharm. Des. 20, 5574–5593 (2014).
115. Villena, J. A. New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. FEBS J. 282, 647–672 (2015).
116. Martínez-Redondo, V., Pettersson, A. T. & Ruas, J. L. The hitchhiker’s guide to PGC-1α isoform structure and biological functions. Diabetologia 58, 1969–1977 (2015).
117. Ramamoorthy, T. G., Laverny, G., Schlagowski, A.-I., Zoll, J., Messaddeq, N., Bornert, J.-M., Panza, S., Ferry, A., Geny, B. & Metzger, D. The transcriptional coregulator PGC-1β controls mitochondrial function and anti-oxidant defence in skeletal muscles. Nat. Commun. 6, ncomms10210 (2015).
118. Fernandez-Marcos, P. J. & Auwerx, J. Regulation of PGC-1α, a nodal regulator of mitochondrial biogenesis. Am. J. Clin. Nutr. 93, 884S–90 (2011).
119. Scarpulla, R. C. Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol. Rev. 88, 611–638 (2008).
120. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M. & Spiegelman, B. M. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829–839 (1998).
121. Esterbauer, H., Oberkofler, H., Krempler, F. & Patsch, W. Human peroxisome proliferator activated receptor gamma coactivator 1 (PPARGC1) gene: cDNA sequence, genomic organization, chromosomal localization, and tissue expression. Genomics 62, 98–102 (1999).
122. Lin, J., Puigserver, P., Donovan, J., Tarr, P. & Spiegelman, B. M. Peroxisome proliferator-activated receptor gamma coactivator 1beta (PGC-1beta ), a novel
75
PGC-1-related transcription coactivator associated with host cell factor. J. Biol. Chem. 277, 1645–1648 (2002).
123. Andersson, U. & Scarpulla, R. C. Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcription in mammalian cells. Mol. Cell. Biol. 21, 3738–3749 (2001).
124. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C. & Spiegelman, B. M. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98, 115–124 (1999).
125. Handschin, C., Kobayashi, Y. M., Chin, S., Seale, P., Campbell, K. P. & Spiegelman, B. M. PGC-1alpha regulates the neuromuscular junction program and ameliorates Duchenne muscular dystrophy. Genes Dev. 21, 770–783 (2007).
126. Shao, D., Liu, Y., Liu, X., Zhu, L., Cui, Y., Cui, A., Qiao, A., Kong, X., Liu, Y., Chen, Q., Gupta, N., Fang, F. & Chang, Y. PGC-1 beta-regulated mitochondrial biogenesis and function in myotubes is mediated by NRF-1 and ERR alpha. Mitochondrion 10, 516–527 (2010).
127. Srivastava, S., Barrett, J. N. & Moraes, C. T. PGC-1alpha/beta upregulation is associated with improved oxidative phosphorylation in cells harboring nonsense mtDNA mutations. Hum. Mol. Genet. 16, 993–1005 (2007).
128. Wareski, P., Vaarmann, A., Choubey, V., Safiulina, D., Liiv, J., Kuum, M. & Kaasik, A. PGC-1α and PGC-1β regulate mitochondrial density in neurons. J. Biol. Chem. 284, 21379–21385 (2009).
129. Gleyzer, N., Vercauteren, K. & Scarpulla, R. C. Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2) and PGC-1 family coactivators. Mol. Cell. Biol. 25, 1354–1366 (2005).
130. Blesa, J. R., Prieto-Ruiz, J. A., Hernández, J. M. & Hernández-Yago, J. NRF-2 transcription factor is required for human TOMM20 gene expression. Gene 391, 198–208 (2007).
131. Scarpulla, R. C. Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells. Gene 286, 81–89 (2002).
132. Scarpulla, R. C. Nuclear control of respiratory gene expression in mammalian cells. J. Cell. Biochem. 97, 673–683 (2006).
133. Virbasius, J. V. & Scarpulla, R. C. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene. Mol. Cell. Biol. 11, 5631–5638 (1991).
134. Su, X., Chu, Y., Kordower, J. H., Li, B., Cao, H., Huang, L., Nishida, M., Song, L., Wang, D. & Federoff, H. J. PGC−1α promoter methylation in Parkinson’s disease. PLoS ONE 10, (2015).
135. Taherzadeh-Fard, E., Saft, C., Akkad, D. A., Wieczorek, S., Haghikia, A., Chan, A., Epplen, J. T. & Arning, L. PGC-1alpha downstream transcription factors NRF-1 and
76
TFAM are genetic modifiers of Huntington disease. Mol. Neurodegener. 6, 32 (2011).
136. Kuroda, Y., Mitsui, T., Kunishige, M., Shono, M., Akaike, M., Azuma, H. & Matsumoto, T. Parkin enhances mitochondrial biogenesis in proliferating cells. Hum. Mol. Genet. 15, 883–895 (2006).
137. Shin, J.-H., Ko, H. S., Kang, H., Lee, Y., Lee, Y.-I., Pletinkova, O., Troconso, J. C., Dawson, V. L. & Dawson, T. M. PARIS (ZNF746) repression of PGC-1α contributes to neurodegeneration in Parkinson’s disease. Cell 144, 689–702 (2011).
138. Zhang, Y., Gao, J., Chung, K. K., Huang, H., Dawson, V. L. & Dawson, T. M. Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc. Natl. Acad. Sci. U. S. A. 97, 13354–13359 (2000).
139. Chung, K. K. K., Thomas, B., Li, X., Pletnikova, O., Troncoso, J. C., Marsh, L., Dawson, V. L. & Dawson, T. M. S-nitrosylation of parkin regulates ubiquitination and compromises parkin’s protective function. Science 304, 1328–1331 (2004).
140. Yao, D., Gu, Z., Nakamura, T., Shi, Z.-Q., Ma, Y., Gaston, B., Palmer, L. A., Rockenstein, E. M., Zhang, Z., Masliah, E., Uehara, T. & Lipton, S. A. Nitrosative stress linked to sporadic Parkinson’s disease: S-nitrosylation of parkin regulates its E3 ubiquitin ligase activity. Proc. Natl. Acad. Sci. U. S. A. 101, 10810–10814 (2004).
141. Ko, H. S., Kim, S. W., Sriram, S. R., Dawson, V. L. & Dawson, T. M. Identification of far upstream element-binding protein-1 as an authentic Parkin substrate. J. Biol. Chem. 281, 16193–16196 (2006).
142. Ko, H. S., Lee, Y., Shin, J.-H., Karuppagounder, S. S., Gadad, B. S., Koleske, A. J., Pletnikova, O., Troncoso, J. C., Dawson, V. L. & Dawson, T. M. Phosphorylation by the c-Abl protein tyrosine kinase inhibits parkin’s ubiquitination and protective function. Proc. Natl. Acad. Sci. U. S. A. 107, 16691–16696 (2010).
143. Vandiver, M. S., Paul, B. D., Xu, R., Karuppagounder, S., Rao, F., Snowman, A. M., Ko, H. S., Lee, Y. I., Dawson, V. L., Dawson, T. M., Sen, N. & Snyder, S. H. Sulfhydration mediates neuroprotective actions of parkin. Nat. Commun. 4, 1626 (2013).
144. Dawson, T. M. & Dawson, V. L. Parkin plays a role in sporadic Parkinson’s disease. Neurodegener. Dis. 13, 69–71 (2014).
145. Tsunemi, T., Ashe, T. D., Morrison, B. E., Soriano, K. R., Au, J., Vázquez Roque, R. A., Lazarowski, E. R., Damian, V. A., Masliah, E. & La Spada, A. R. PGC-1α rescues Huntington’s disease proteotoxicity by preventing oxidative stress and promoting TFEB function. Sci. Transl. Med. 4, 142ra97 (2012).
146. Vainshtein, A., Tryon, L. D., Pauly, M. & Hood, D. A. Role of PGC-1α during acute exercise-induced autophagy and mitophagy in skeletal muscle. Am. J. Physiol. - Cell Physiol. 308, C710–C719 (2015).
77
147. Komen, J. C. & Thorburn, D. R. Turn up the power - pharmacological activation of mitochondrial biogenesis in mouse models. Br. J. Pharmacol. 171, 1818–1836 (2014).
148. Jäger, S., Handschin, C., St-Pierre, J. & Spiegelman, B. M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl. Acad. Sci. U. S. A. 104, 12017–12022 (2007).
149. Cantó, C., Gerhart-Hines, Z., Feige, J. N., Lagouge, M., Noriega, L., Milne, J. C., Elliott, P. J., Puigserver, P. & Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 458, 1056–1060 (2009).
150. Egan, D., Kim, J., Shaw, R. J. & Guan, K.-L. The autophagy initiating kinase ULK1 is regulated via opposing phosphorylation by AMPK and mTOR. Autophagy 7, 643–644 (2011).
151. Egan, D. F., Shackelford, D. B., Mihaylova, M. M., Gelino, S., Kohnz, R. A., Mair, W., Vasquez, D. S., Joshi, A., Gwinn, D. M., Taylor, R., Asara, J. M., Fitzpatrick, J., Dillin, A., Viollet, B., Kundu, M., Hansen, M. & Shaw, R. J. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456–461 (2011).
152. Garcia, D. & Shaw, R. J. AMPK: Mechanisms of cellular energy sensing and restoration of metabolic balance. Mol. Cell 66, 789–800 (2017).
153. Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C. & Kluding, H. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilhelm Rouxs Arch. Dev. Biol. 193, 283–295 (1984).
154. Urban, S., Lee, J. R. & Freeman, M. A family of Rhomboid intramembrane proteases activates all Drosophila membrane-tethered EGF ligands. EMBO J. 21, 4277–4286 (2002).
155. Wasserman, J. D., Urban, S. & Freeman, M. A family of rhomboid-like genes: Drosophila rhomboid-1 and roughoid/rhomboid-3 cooperate to activate EGF receptor signaling. Genes Dev. 14, 1651–1663 (2000).
156. Lee, J. R., Urban, S., Garvey, C. F. & Freeman, M. Regulated intracellular ligand transport and proteolysis control EGF signal activation in Drosophila. Cell 107, 161–171 (2001).
157. Urban, S., Lee, J. R. & Freeman, M. Drosophila rhomboid-1 defines a family of putative intramembrane serine proteases. Cell 107, 173–182 (2001).
158. Koonin, E. V., Makarova, K. S., Rogozin, I. B., Davidovic, L., Letellier, M.-C. & Pellegrini, L. The rhomboids: a nearly ubiquitous family of intramembrane serine proteases that probably evolved by multiple ancient horizontal gene transfers. Genome Biol. 4, R19 (2003).
159. Strisovsky, K. Rhomboid protease inhibitors: Emerging tools and future therapeutics. Semin. Cell Dev. Biol. 60, 52–62 (2016).
160. Urban, S. A guide to the rhomboid protein superfamily in development and disease. Semin. Cell Dev. Biol. 60, 1–4 (2016).
78
161. Wang, Y., Zhang, Y. & Ha, Y. Crystal structure of a rhomboid family intramembrane protease. Nature 444, 179–180 (2006).
162. Wu, Z., Yan, N., Feng, L., Oberstein, A., Yan, H., Baker, R. P., Gu, L., Jeffrey, P. D., Urban, S. & Shi, Y. Structural analysis of a rhomboid family intramembrane protease reveals a gating mechanism for substrate entry. Nat. Struct. Mol. Biol. 13, 1084–1091 (2006).
163. Ben-Shem, A., Fass, D. & Bibi, E. Structural basis for intramembrane proteolysis by rhomboid serine proteases. Proc. Natl. Acad. Sci. U. S. A. 104, 462–466 (2007).
164. Jeyaraju, D. V., McBride, H. M., Hill, R. B. & Pellegrini, L. Structural and mechanistic basis of Parl activity and regulation. Cell Death Differ. 18, 1531–1539 (2011).
165. Bondar, A.-N., del Val, C. & White, S. H. Rhomboid protease dynamics and lipid interactions. Struct. Lond. Engl. 1993 17, 395–405 (2009).
166. Erez, E., Fass, D. & Bibi, E. How intramembrane proteases bury hydrolytic reactions in the membrane. Nature 459, 371–378 (2009).
167. Ha, Y. Structure and mechanism of intramembrane protease. Semin. Cell Dev. Biol. 20, 240–250 (2009).
168. Esser, K., Tursun, B., Ingenhoven, M., Michaelis, G. & Pratje, E. A novel two-step mechanism for removal of a mitochondrial signal sequence involves the mAAA complex and the putative rhomboid protease Pcp1. J. Mol. Biol. 323, 835–843 (2002).
169. McQuibban, G. A., Saurya, S. & Freeman, M. Mitochondrial membrane remodelling regulated by a conserved rhomboid protease. Nature 423, 537–541 (2003).
170. Herlan, M., Vogel, F., Bornhovd, C., Neupert, W. & Reichert, A. S. Processing of Mgm1 by the rhomboid-type protease Pcp1 is required for maintenance of mitochondrial morphology and of mitochondrial DNA. J. Biol. Chem. 278, 27781–27788 (2003).
171. Chan, E. Y. L. & McQuibban, G. A. The mitochondrial rhomboid protease: Its rise from obscurity to the pinnacle of disease-relevant genes. Biochim. Biophys. Acta BBA - Biomembr. 1828, 2916–2925 (2013).
172. McQuibban, G. A., Lee, J. R., Zheng, L., Juusola, M. & Freeman, M. Normal Mitochondrial Dynamics Requires Rhomboid-7 and Affects Drosophila Lifespan and Neuronal Function. Curr. Biol. 16, 982–989 (2006).
173. Rahman, M. & Kylsten, P. Rhomboid-7 over-expression results in Opa1-like processing and malfunctioning mitochondria. Biochem. Biophys. Res. Commun. 414, 315–320 (2011).
174. Whitworth, A. J., Lee, J. R., Ho, V. M.-W., Flick, R., Chowdhury, R. & McQuibban, G. A. Rhomboid-7 and HtrA2/Omi act in a common pathway with the Parkinson’s disease factors Pink1 and Parkin. Dis. Model. Mech. 1, 168–174; discussion 173 (2008).
79
175. Pellegrini, L., Passer, B. J., Canelles, M., Lefterov, I., Ganjei, J. K., Fowlkes, B. J., Koonin, E. V. & D’Adamio, L. PAMP and PARL, two novel putative metalloproteases interacting with the COOH-terminus of Presenilin-1 and -2. J. Alzheimers Dis. 3, 181–190 (2001).
176. Spinazzi, M. & De Strooper, B. PARL: The mitochondrial rhomboid protease. Semin. Cell Dev. Biol. 60, 19–28 (2016).
177. Sík, A., Passer, B. J., Koonin, E. V. & Pellegrini, L. Self-regulated cleavage of the mitochondrial intramembrane-cleaving protease PARL yields Pbeta, a nuclear-targeted peptide. J. Biol. Chem. 279, 15323–15329 (2004).
178. Jeyaraju, D. V., Xu, L., Letellier, M.-C., Bandaru, S., Zunino, R., Berg, E. A., McBride, H. M. & Pellegrini, L. Phosphorylation and cleavage of presenilin-associated rhomboid-like protein (PARL) promotes changes in mitochondrial morphology. Proc. Natl. Acad. Sci. U. S. A. 103, 18562–18567 (2006).
179. Shi, G. & McQuibban, G. A. The Mitochondrial Rhomboid Protease PARL Is Regulated by PDK2 to Integrate Mitochondrial Quality Control and Metabolism. Cell Rep. 18, 1458–1472 (2017).
180. Civitarese, A. E., MacLean, P. S., Carling, S., Kerr-Bayles, L., McMillan, R. P., Pierce, A., Becker, T. C., Moro, C., Finlayson, J., Lefort, N., Newgard, C. B., Mandarino, L., Cefalu, W., Walder, K., Collier, G. R., Hulver, M. W., Smith, S. R. & Ravussin, E. Regulation of skeletal muscle oxidative capacity and insulin signaling by the mitochondrial rhomboid protease PARL. Cell Metab. 11, 412–426 (2010).
181. Seibel, N. M., Eljouni, J., Nalaskowski, M. M. & Hampe, W. Nuclear localization of enhanced green fluorescent protein homomultimers. Anal. Biochem. 368, 95–99 (2007).
182. Cipolat, S., Rudka, T., Hartmann, D., Costa, V., Serneels, L., Craessaerts, K., Metzger, K., Frezza, C., Annaert, W., D’Adamio, L., Derks, C., Dejaegere, T., Pellegrini, L., D’Hooge, R., Scorrano, L. & De Strooper, B. Mitochondrial rhomboid PARL regulates cytochrome c release during apoptosis via OPA1-dependent cristae remodeling. Cell 126, 163–175 (2006).
183. Ishihara, N., Fujita, Y., Oka, T. & Mihara, K. Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J. 25, 2966–2977 (2006).
184. Anand, R., Wai, T., Baker, M. J., Kladt, N., Schauss, A. C., Rugarli, E. & Langer, T. The i-AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J. Cell Biol. 204, 919–929 (2014).
185. Saita, S., Nolte, H., Fiedler, K. U., Kashkar, H., Venne, A. S., Zahedi, R. P., Krüger, M. & Langer, T. PARL mediates Smac proteolytic maturation in mitochondria to promote apoptosis. Nat. Cell Biol. 19, 318–328 (2017).
186. Sekine, S., Kanamaru, Y., Koike, M., Nishihara, A., Okada, M., Kinoshita, H., Kamiyama, M., Maruyama, J., Uchiyama, Y., Ishihara, N., Takeda, K. & Ichijo, H. Rhomboid protease PARL mediates the mitochondrial membrane potential loss-induced cleavage of PGAM5. J. Biol. Chem. 287, 34635–34645 (2012).
80
187. Wang, Z., Jiang, H., Chen, S., Du, F. & Wang, X. The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell 148, 228–243 (2012).
188. Zhuang, M., Guan, S., Wang, H., Burlingame, A. L. & Wells, J. A. Substrates of IAP ubiquitin ligases identified with a designed orthogonal E3 ligase, the NEDDylator. Mol. Cell 49, 273–282 (2013).
189. Yoshioka, H., Katsu, M., Sakata, H., Okami, N., Wakai, T., Kinouchi, H. & Chan, P. H. The role of PARL and HtrA2 in striatal neuronal injury after transient global cerebral ischemia. J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 33, 1658–1665 (2013).
190. Meissner, C., Lorenz, H., Hehn, B. & Lemberg, M. K. Intramembrane protease PARL defines a negative regulator of PINK1- and PARK2/Parkin-dependent mitophagy. Autophagy 11, 1484–1498 (2015).
191. Mirzoeva, O. K. & Petrini, J. H. J. DNA replication-dependent nuclear dynamics of the Mre11 complex1 1 NIH GM56888 and the DOE ER62859. Mol. Cancer Res. 1, 207–218 (2003).
192. Huang, J., Huen, M. S. Y., Kim, H., Leung, C. C. Y., Glover, J. N. M., Yu, X. & Chen, J. RAD18 transmits DNA damage signalling to elicit homologous recombination repair. Nat. Cell Biol. 11, 592–603 (2009).
193. Wessel, D. & Flügge, U. I. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138, 141–143 (1984).
194. Krishna, A., Biryukov, M., Trefois, C., Antony, P. M. A., Hussong, R., Lin, J., Heinäniemi, M., Glusman, G., Köglsberger, S., Boyd, O., van den Berg, B. H. J., Linke, D., Huang, D., Wang, K., Hood, L., Tholey, A., Schneider, R., Galas, D. J., Balling, R. & May, P. Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease. BMC Genomics 15, 1154 (2014).
195. Filograna, R., Civiero, L., Ferrari, V., Codolo, G., Greggio, E., Bubacco, L., Beltramini, M. & Bisaglia, M. Analysis of the catecholaminergic phenotype in human SH-SY5Y and BE(2)-M17 neuroblastoma cell lines upon differentiation. PloS One 10, e0136769 (2015).
196. Huang, H.C., Lee, C.P., Liu, H.K., Chang, M.F., Lai, Y.H., Lee, Y.C. & Huang, C. Cellular nuclear export factors TAP and Aly are required for HDAg-L-mediated assembly of hepatitis delta virus. J. Biol. Chem. 291, 26226–26238 (2016).
197. Lee, C. S., Han, E. S., Park, E. S. & Bang, H. Inhibition of MG132-induced mitochondrial dysfunction and cell death in PC12 cells by 3-morpholinosydnonimine. Brain Res. 1036, 18–26 (2005).
198. Radke, S., Chander, H., Schäfer, P., Meiss, G., Krüger, R., Schulz, J. B. & Germain, D. Mitochondrial protein quality control by the proteasome involves ubiquitination and the protease Omi. J. Biol. Chem. 283, 12681–12685 (2008).
81
199. Han, Y. H., Moon, H. J., You, B. R. & Park, W. H. The effect of MG132, a proteasome inhibitor on HeLa cells in relation to cell growth, reactive oxygen species and GSH. Oncol. Rep. 22, 215–221 (2009).
200. Maharjan, S., Oku, M., Tsuda, M., Hoseki, J. & Sakai, Y. Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition. Sci. Rep. 4, srep05896 (2014).
201. Schneider, L., Giordano, S., Zelickson, B. R., Johnson, M., Benavides, G., Ouyang, X., Fineberg, N., Darley-Usmar, V. M. & Zhang, J. Differentiation of SH-SY5Y cells to a neuronal phenotype changes cellular bioenergetics and the response to oxidative stress. Free Radic. Biol. Med. 51, 2007–2017 (2011).
202. Gianfranceschi, G. L., Barra, D., Bossa, F., Coderoni, S., Paparelli, M., Venanzi, F., Cicconi, F. & Amici, D. Small peptides controlling transcription in vitro are bound to chromatin DNA. Biochim. Biophys. Acta BBA - Gene Struct. Expr. 699, 138–148 (1982).
203. Liew, C. C. Progress in Nonhistone Protein Research. (CRC Press, 1985).
204. Shen, Z., Sathyan, K. M., Geng, Y., Zheng, R., Chakraborty, A., Freeman, B., Wang, F., Prasanth, K. V. & Prasanth, S. G. A WD-repeat protein stabilizes ORC binding to chromatin. Mol. Cell 40, 99–111 (2010).
205. Paggi M.G., Felsani, A., & Giordano, A. Growth control by the retinoblastoma gene family. Tumor Suppressor Genes - Volume 1: Pathways and Isolation . 3-19 (Springer, 2003).
206. Guo, R., Xu, D. & Wang, W. Identification and analysis of new Proteins involved in the DNA Damage Response network of Fanconi anemia and Bloom syndrome. Methods San Diego Calif 48, 72–79 (2009).
207. Ross, R. A., Spengler, B. A. & Biedler, J. L. Coordinate morphological and biochemical interconversion of human neuroblastoma cells. J. Natl. Cancer Inst. 71, 741–747 (1983).
208. Encinas, M., Iglesias, M., Liu, Y., Wang, H., Muhaisen, A., Ceña, V., Gallego, C. & Comella, J. X. Sequential treatment of SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells. J. Neurochem. 75, 991–1003 (2000).
209. Kovalevich, J. & Langford, D. Considerations for the use of SH-SY5Y neuroblastoma cells in neurobiology. Neuronal Cell Cult. 9–21 (Springer, 2013).
210. Hashimoto, Y., Niikura, T., Tajima, H., Yasukawa, T., Sudo, H., Ito, Y., Kita, Y., Kawasumi, M., Kouyama, K., Doyu, M., Sobue, G., Koide, T., Tsuji, S., Lang, J., Kurokawa, K. & Nishimoto, I. A rescue factor abolishing neuronal cell death by a wide spectrum of familial Alzheimer’s disease genes and Abeta. Proc. Natl. Acad. Sci. U. S. A. 98, 6336–6341 (2001).
211. Lee, C., Zeng, J., Drew, B. G., Sallam, T., Martin-Montalvo, A., Wan, J., Kim, S.-J., Mehta, H., Hevener, A. L., de Cabo, R. & Cohen, P. The mitochondrial-derived
82
peptide MOTS-c promotes metabolic homeostasis and reduces obesity and insulin resistance. Cell Metab. 21, 443–454 (2015).
212. Cobb, L. J., Lee, C., Xiao, J., Yen, K., Wong, R. G., Nakamura, H. K., Mehta, H. H., Gao, Q., Ashur, C., Huffman, D. M., Wan, J., Muzumdar, R., Barzilai, N. & Cohen, P. Naturally occurring mitochondrial-derived peptides are age-dependent regulators of apoptosis, insulin sensitivity, and inflammatory markers. Aging 8, 796–809 (2016).
213. Guo, B., Zhai, D., Cabezas, E., Welsh, K., Nouraini, S., Satterthwait, A. C. & Reed, J. C. Humanin peptide suppresses apoptosis by interfering with Bax activation. Nature 423, 456–461 (2003).
214. Ikonen, M., Liu, B., Hashimoto, Y., Ma, L., Lee, K.-W., Niikura, T., Nishimoto, I. & Cohen, P. Interaction between the Alzheimer’s survival peptide humanin and insulin-like growth factor-binding protein 3 regulates cell survival and apoptosis. Proc. Natl. Acad. Sci. U. S. A. 100, 13042–13047 (2003).
215. Lee, C., Yen, K. & Cohen, P. Humanin: a harbinger of mitochondrial-derived peptides? Trends Endocrinol. Metab. TEM 24, 222–228 (2013).
216. Lee, C., Kim, K. H. & Cohen, P. MOTS-c: A novel mitochondrial-derived peptide regulating muscle and fat metabolism. Free Radic. Biol. Med. 100, 182–187 (2016).
217. Maloney, B. & Lahiri, D. K. The Alzheimer’s amyloid β-peptide (Aβ) binds a specific DNA Aβ-interacting domain (AβID) in the APP, BACE1, and APOE promoters in a sequence-specific manner: characterizing a new regulatory motif. Gene 488, 1–12 (2011).
218. Barucker, C., Harmeier, A., Weiske, J., Fauler, B., Albring, K. F., Prokop, S., Hildebrand, P., Lurz, R., Heppner, F. L., Huber, O. & Multhaup, G. Nuclear translocation uncovers the amyloid peptide Aβ42 as a regulator of gene transcription. J. Biol. Chem. 289, 20182–20191 (2014).
219. Multhaup, G., Huber, O., Buée, L. & Galas, M.-C. Amyloid precursor protein (APP) metabolites APP intracellular fragment (AICD), Aβ42, and tau in nuclear roles. J. Biol. Chem. 290, 23515–23522 (2015).
220. Maj, M. C., Cameron, J. M. & Robinson, B. H. Pyruvate dehydrogenase phosphatase deficiency: orphan disease or an under-diagnosed condition? Mol. Cell. Endocrinol. 249, 1–9 (2006).
221. Huang, B., Gudi, R., Wu, P., Harris, R. A., Hamilton, J. & Popov, K. M. Isoenzymes of pyruvate dehydrogenase phosphatase. DNA-derived amino acid sequences, expression, and regulation. J. Biol. Chem. 273, 17680–17688 (1998).
222. Huang, B., Wu, P., Popov, K. M. & Harris, R. A. Starvation and diabetes reduce the amount of pyruvate dehydrogenase phosphatase in rat heart and kidney. Diabetes 52, 1371–1376 (2003).
223. Herget, M. & Tampé, R. Intracellular peptide transporters in human-compartmentalization of the ‘peptidome’. Pflugers Arch. 453, 591–600 (2007).
83
224. Young, L., Leonhard, K., Tatsuta, T., Trowsdale, J. & Langer, T. Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291, 2135–2138 (2001).
225. Augustin, S., Nolden, M., Müller, S., Hardt, O., Arnold, I. & Langer, T. Characterization of peptides released from mitochondria; evidence for constant proteolysis and peptide efflux. J. Biol. Chem. 280, 2691–2699 (2005).
226. Kambacheld, M., Augustin, S., Tatsuta, T., Müller, S. & Langer, T. Role of the novel metallopeptidase MoP112 and saccharolysin for the complete degradation of proteins residing in different subcompartments of mitochondria. J. Biol. Chem. 280, 20132–20139 (2005).
227. Haynes, C. M., Yang, Y., Blais, S. P., Neubert, T. A. & Ron, D. The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans. Mol. Cell 37, 529–540 (2010).
228. Mannella, C. A. The ‘ins’ and ‘outs’ of mitochondrial membrane channels. Trends Biochem. Sci. 17, 315–320 (1992).
229. Hill, K., Model, K., Ryan, M. T., Dietmeier, K., Martin, F., Wagner, R. & Pfanner, N. Tom40 forms the hydrophilic channel of the mitochondrial import pore for preproteins [see comment]. Nature 395, 516–521 (1998).
230. Arnold, I., Wagner-Ecker, M., Ansorge, W. & Langer, T. Evidence for a novel mitochondria-to-nucleus signalling pathway in respiring cells lacking i-AAA protease and the ABC-transporter Mdl1. Gene 367, 74–88 (2006).
231. Larsen, M. R., Trelle, M. B., Thingholm, T. E. & Jensen, O. N. Analysis of posttranslational modifications of proteins by tandem mass spectrometry. BioTechniques 40, 790–798 (2006).
232. Parker, C. E., Mocanu, V., Mocanu, M., Dicheva, N. & Warren, M. R. Mass spectrometry for post-translational modifications. Neuroproteomics (CRC Press/Taylor & Francis, 2010).
233. Donner, A. J., Ebmeier, C. C., Taatjes, D. J. & Espinosa, J. M. CDK8 is a positive regulator of transcriptional elongation within the serum response network. Nat. Struct. Mol. Biol. 17, 194–201 (2010).
84
APPENDIX
Pβ Deletion Outline Using CRISPR/Cas9 System
score sequence
Guide #1 80 GTCCCTGGGTCTGATCTTCGAGG
Guide #2 78 AACCTCGAAGATCAGACCCAGGG
Guide #3 76 AACCTCGAAGATCAGACCCAGGG
Guide #4 73 TATGCTTCACCACTTGTCCCTGG
tgtgtgtcaccttttccagaaaggttgaattttgtggctttgaattctgtctgagagtaggagtcttggctgtttttggact
gtagagtgagaataaattgagatggtgatgatgcaggccaagtggaggttcatagaagttgatatttgcaagacgctactgt
gtttctcatctgttatttttgccccatagGTTTAACTTCTTTATTCAACAAAAATGCGGATTCAGAAAAGCACCCAGGAAGG
TTGAACCTCGAAGATCAGACCCAGGGACAAGTGGTGAAGCATACAAGAGAAGTGCTTTGATTCCTCCTGTGGAAGAAACAGTCTTTTATCCTTCTCCCTATCCTATAAGGAGTCTCATAAAACCTTTATTTTTTACTGTTGGGgtaagagctcactttgctag
gagttacctaccttgctagaaatgcagtgttaaagtactttgtcccatttgggctcccttaaagtaaggacaggtagagggg
ggatcaaaaagagctgggctcatgaattctaattatagagtctgaatttttttttttttttttgagacggagtctcactctg
Appendix 1-1: Pβ-targeted gRNAs knock down overexpressed PARL-FLAG in HEK293s: A Top CRISPR gRNA design hits for second exon of PARL, which includes Pβ nucleotide sequence, as generated by the CRISPR Design Tool (http://crispr.mit.edu/). Scores are calculated by faithfulness of on-target activity minus off-target hit scores. B PARL second exon is highlighted. Pβ nucleotide sequence is underlined. The estimated Cas9 cleavage site if Guide #1 or #2 is used is coloured corresponding to the gRNA in A. C pX458 plasmids containing Cas9-GFP and Pβ-targeted gRNAs corresponding to Guides #1 (gRNA1.1 and 1.2) and #2 (gRNA 2.1 and 2.2) were cotransfected with PARL-FLAG in HEK293s. Pβ-targeted gRNAs decrease PARL-FLAG expression in comparison to cells cotransfected with pX458 alone (empty).
A
B
C
85
β PARL ssODN: gacgctactgtgtttctcatctgttatttttgccccataggtttaacttctttattcaacaaaa
atgcggagctttgattcctcctgtggaagaaacagtcttttatccttctccctatcctataagg
agtctcataaaac
S77N PARL ssODN: ttttatgagactccttataggatagggagaaggataaaagactgtttcttccacaggaggaatc
aaagcatttctcttgtatgcttcaccacttgtgcctgggtctgatcttcgaggttcaaccttcctgggtgcttttc
Appendix 1-2: Pβ deletion homologous repair templates: A A homologous repair template to selectively delete Pβ sequence and generate β PARL was designed by sequencing a single-stranded oligodeoxynucleotides (ssODN) combining the 70 nucleotides immediately upstream and downstream of Pβ sequence. B A homologous repair template to introduce S77N mutation which abolishes β cleavage and generates full-length PARL was produced from a 140 nucleotide sequence encompassing S77, the expected Cas9 cleavage site, gRNA PAM sequence. Two point mutations were introduced: CT (resulting in S77N mutation) and CG (to mutate gRNA PAM sequence to inhibit Cas9 cleavage after homologous repair).
A
B
86
tgtgtgtcaccttttccagaaaggttgaattttgtggctttgaattctgtctgagagtaggagtcttggctgtttttggact
gtagagtgagaataaattgagatggtgatgatgcaggccaagtggaggttcatagaagttgatatttgcaagacgctactgt
gtttctcatctgttatttttgccccatagGTTTAACTTCTTTATTCAACAAAAATGCGGATTCAGAAAAGCACCCAGGAAGG
TTGAACCTCGAAGATCAGACCCAGGGACAAGTGGTGAAGCATACAAGAGAAGTGCTTTGATTCCTCCTGTGGAAGAAACAGT
CTTTTATCCTTCTCCCTATCCTATAAGGAGTCTCATAAAACCTTTATTTTTTACTGTTGGGgtaagagctcactttgctagg
agttacctaccttgctagaaatgcagtgttaaagtactttgtcccatttgggctcccttaaagtaaggacaggtagaggggg
gatcaaaaagagctgggctcatgaattctaattatagagtctgaatttttttttttttttttgagacggagtctcactctgg
Pb pcr for: ggc caa gtg gag gtt cat ag Pb pcr rev: ggt agg taa ctc cta gca aag tga Length: 20nt Tm: 55.4C GC%: 55.0% Length: 24nt Tm: 55.8C GC%: 45.8% Pb pcr2 fwd: gca aga cgc tac tgt gtt tct c Pb pcr2 rev: ccc cct cta cct gtc ctt act t Length: 22nt Tm: 56.1C GC%: 50% Length: 22nt Tm: 57.6C GC%: 54.5% Pb possible rev: tcc aca gga gga atc aaa gc Length: 20nt Tm: 60.2C GC%: 50%
Appendix 1-3: Genomic DNA primer test was designed to validate β PARL clones: A PARL second exon is CAPITALIZED. Pβ nucleotide sequence is highlighted. Primers were designed to flank Pβ upstream and downstream and are colour-coded and mapped to PARL second exon and immediately surrounding intron region. B Primer pairs amplified fragments from WT SH-SY5Y genomic DNA at sizes corresponding to expected sizes. If Pβ nucleotide sequence is deleted in β PARL clones, bands are expected to run roughly 75 bp faster.
A
B
Recommended