MiltOnNotes Volume One

MILTONOTES

Volume One

An open-eared exploration of composition in theory & practice.

Sound, Music & Technology

Milton Mermikidesm.mermikides@surrey.ac.uk

MILTONOTESAn open-eared exploration of

composition in theory & practice.

Listening list:

or subscribe to miltonline on spotify

follow me on twitter @miltonline

for music and more

This episode

Entire serieshttp://open.spotify.com/user/miltonline/playlist/35NLay3D8FdSFU45xYYjcv

http://open.spotify.com/user/miltonline/playlist/0eOohflrVSkPXRUb4URBxa

Key Historical Events inContemporary Computer Music

Dawn of Music Notation

Iraq:1800BC Cuneiform (melody in 3rds)

The representation of music

Ancient Greece: c.600BC Pitch and rhythm

Teaching behind the veil-readopted by Schaeffer as the veil of speakersThe concept of sound as divorced from source

The appreciation of sound for its own sake regardless of originA numerical basis of sound

c. 500BC Acousmaticἀκουσματικοί

Pythagorus, Ionian philosopher, mathematician and musician (c.570-c.495BC)

Development of Music Notation

Byzantine Empire : c. 390AD differential pitch

The grid

Middle Ages Europe: c.850AD Grid system

Randomness in Music

Mozart’s Dice Game (1787)

A Musical game for composing minuets and trios from dice rollshttp://sunsite.univie.ac.at/Mozart/dice/

1857 E. Leon Scott’s Phonautograph

Sound can now be made permanent, with one slight problem.

1861 Philip Reis’ Telephone

Sound can now be transmitted across distances rapidly

1863 Helmholtz publishesOn the Sensation of Tone as a Physiological Basis

for the Theory of Music

Basis of additive synthesisAny sound can - in theory - be constructed

1874 Elisha Gray’s Musical Telegraph

Transmission of electronic polyphonic music

1876 Thomas Edison’s Phonograph

Sound can be recorded and reproduced

Solidified sound wave

Ocean of Sound and the birth of Ambient music

1889 Claude Debussy at L’Exposition Universelle

1895 Thaddeus Cahill’s Telharmonium

The first synthesiser

1907 Busoni’s Sketch of a New Aesthetic of Music

The promise of electronic music

1913 Russolo’s The Art of Noises

The democratising of all sound and the destruction of musical elitism

1913 Russolo’s The Art of Noises

Wicked noise-makers

1915 Varèse moves to New York in search of a new music

An organiser of sound

I dream of instruments obedient to my thoughts and which with their contribution of a whole new world of unsuspected sounds, will lend themselves to the exigencies of my inner rhythm

Our musical alphabet must be enriched, I refuse to limit myself to sounds that have already been heard...What I am looking for is new mechanical mediums which will lend themselves to every expression of thought and keep up with thought

1915 Lee De Forest patents vacuum tube

Miniaturisation of electronics

1929 RCA releases the Theremin

Commercialisation of electronic instrument and in the 1930s the Terpsitone and Rhythmicon

1924 Respighi’s The Pines of Rome

Blending of live and pre-recorded music

1930 Hindemith and Toch’s Grammophonmusik

Audio manipulation

1948 Schaeffer’s Etude aux Chemin de FerMusique Concrète

Found sound, sampling, looping, filtering reverb and the ‘sound object’

1948 Nancarrow’s Studies for Player Piano

Bionic virtuosity

1952 Cage’s 4’33”

All sound considered

4’33” live version

1952 Luening and Ussachevsky

Live effects

1956 Louis & Bebe Barron’s Forbidden Planet score

A working electronic music studio

1957 The IIliac Suite The Birth of Computer Music

Live effects

1958 Varèse’s Poème Electronique

Major display of electronic work a graphic score with a familiar look

1958 Dissevelt’s Whirling

Birth of pop electronic music

1959 Cindy Electronium

Raymond Scott (1908-94) was a Jazz musician, jingle writer, electronic artist and inventor, and one of the earliest to fully adopt the

music technology as a useful -and profitable-part of the composer tool-kit rather than esoteric experimentalism - similarly Stevie Wonderin the early 70s embraced the studio to make more efficient the

compositional process

1964 The Moog

The development of synthesis

1971 NHK first digital recording

The extraordinary rate of development of processors allows sound to bemanipulated beyond physical constraints. And what used to be housed

in 200 tons of hardware can be emulated while checking email.If cars developed like computers they would travel at 470,000 mph, get 100,000 miles to the litre, cost 2p, and could balance on a matchstick.

1983 MIDI patented

A musical language for computers

Applied vs. ‘Pure Music’

How does computer composing differ from composing?

Additional Reading

Holmes, T., (2008) Electronic and Experimental Music, revised 3rd edition. New York: Routledge.

Manning, P. (2004) Electronic and Computer Music .Oxford: Clarendon Press.

Toop, D. (2001) Ocean of Sound. Serpent’s Tail.

MILTONOTES

Pulse, Tempo & Metre

http://open.spotify.com/user/miltonline/playlist/17tSOtdKr1SWxaHx6gLmIV

Listening list:

for music and more

This episode

Musical events in time

All music has some duration, and the occurrence of musical events over time-

rhythm. When there appears to be some

underlying regularity of events thisis the pulse or beat.

Generally ranging from 20-330bpm

Tempo■ Larghissimo — very, very slow (20 bpm and below)■ Grave — slow and solemn (20–40 bpm)■ Lento — slowly (40–60 bpm)■ Largo — broadly (40–60 bpm)■ Larghetto — rather broadly (60–66 bpm)■ Adagio — slow and stately (literally, "at ease") (66–76 bpm)■ Adagietto — rather slow (70–80 bpm)■ Andante Moderato — a bit slower than andante■ Andante — at a walking pace (76–108 bpm)■ Andantino – slightly faster than andante■ Moderato — moderately (101–110 bpm)■ Allegretto — moderately fast (but less so than allegro)■ Allegro moderato — moderately quick (112–124 bpm)■ Allegro — fast, quickly and bright (120–139 bpm)■ Vivace — lively and fast (≈140 bpm) (quicker than allegro)■ Vivacissimo — very fast and lively■ Allegrissimo — very fast■ Presto — very fast (168–200 bpm)■ Prestissimo — extremely fast (more than 200bpm)

Musical events in time

Some pieces or musical moments has no, little or an ambiguous sense of pulse.This will occur when there is insufficient regularity and/or if note events are ill-

defined

Zero gravitation, John Adams

Exercise 1: Compose an introduction to a piece where no pulse gives way to ambiguous and then clear pulse

Tempo feel

Even when pulse exists, it may be experienced at more than one level.This can be exploited as half-time or

double-time feel. Where the music moves at the same rate, but the sense of pulse can alter.

Ray Charles, Wynton Marsalis

Exercise 2: Compose a musical section and arrange it with normal, half and double-time feel.

Tempo Changes

Fixed SmallNatural

Fluctuations

GradualChanges

Sudden Shifts

Direction,shape,extent

duration.

rubatorallentandoritardendo

ritenutoaccelerandoprecipitando

During performance,unconscious or not.

Metronomic

Boulez’s conveyor belt

Adjacent tempi canexist in

simple rational relationships (double-time, half-time)

more complex rational (e.g. 3:4, 5:4)or irrational

Natural fluctuations inJames Brown, ‘I Got You’ Millyard SOS

Tempo Curves

■ Accelerando — speeding up (abbreviation: accel.)■ Allargando — growing broader; decreasing tempo, usually near the end of a piece■ Calando — going slower (and usually also softer)■ Doppio movimento — double speed■ Meno mosso — less movement or slower■ Mosso — movement, more lively, or quicker, much like più mosso, but not as extreme■ Più mosso — more movement or faster■ Precipitando — hurrying, going faster/forward■ Rallentando — gradual slowing down (abbreviation: rall.)■ Ritardando — less gradual slowing down (more sudden decrease in tempo than rallentando)(abbreviation: rit. or more

specifically, ritard.)■ Ritenuto — slightly slower; temporarily holding back. (Note that the abbreviation for ritenuto can also be rit. Thus a more

specific abbreviation is riten. Also sometimes ritenuto does not reflect a tempo change but a character change instead.)■ Rubato — free adjustment of tempo for expressive purposes■ Stretto — in faster tempo, often near the conclusion of a section. ■ Stringendo — pressing on faster (literally "tightening")

(From wiki) what curves in terms of shape, duration, extent and direction might be associated with these terms?

Metric modulation

A shift from one tempo (or meter) to another via a pivotal note value

For example

200bpm 100 bpm2:1

Metric modulation

100bpm 150 bpm

q=q.2:3

Metric modulation

100bpm 150 bpm

q=q.2:3

Metric modulation

100bpm 80 bpm5:4

Metric modulation

Tempo I

Tempo II

Tempo III

Tempo I

Exercise 3: Construct this tempo map in a short piece.Tempo I,II,III should exist in rational relationships of your

choosing, and modulations should be pivotal.Complete with melodic and harmonic elements.

Metric modulation Exercise 2&3from String Quartet No.1 Elliot Carter

Exercise 4a: Sequence this metric modulation passage, using melodic and harmonic elements.4b: Design, notate as above and sequence your own metric modulation sequence

Polytempo and Xenochrony

It is possible for two or more tempi to exist at once,even if they have a very complex relationship.

Charles Ives introduced the idea of polytempo and Zappa coined the term Xenochrony to describe

the studio equivalent of superimposing different tempi.

Exercise 5: Create a sequence with two superimposed tempi

Pulses or beats almost always existin logical groups and in a hierarchy of strengths.

This meter or time signature indicates how many beats - and what type of beat -exist in each measure.

Listening examples.

Grouping in 2s and 3s

Exercise 6:Write a 4-bar groove in 4/4 and reinterpret in 5/8 or 5/4 and 7/8 and 7/4

Be fully aware of 2 and 3 groupings

An introduction

Exercise 6:Write a 4-bar groove in 4/4 and reinterpret in 5/8 or 5/4 and 7/8 and 7/4

Be fully aware of 2 and 3 groupings

Exercise 5: Create a sequence with two superimposed tempi

Exercise 4a: Sequence this metric modulation passage, using melodic and harmonic elements.4b: Design, notate as above and sequence your own metric modulation sequence

Tempo I

Tempo II

Tempo III

Tempo I

Exercise 3: Construct this tempo map in a short piece.Tempo I,II,III should exist in rational relationships of your choosing, and modulations should be pivotal.

Complete with melodic and harmonic elements.

Exercise 1: Compose an introduction to a piece where no pulse gives way to ambiguous and then clear pulse

Exercise 2: Compose a musical section and arrange it with normal, half and double-time feel.

Lecture 1 Compositional Exercises

MILTONOTES

Meters, Patterns & Polymeter

Listening list:

for music and more

This episode

http://open.spotify.com/user/miltonline/playlist/2PUE08bmuKp9l7RL95NtSz

The Music There Is

@miltonline

The Music There Is

Tc There Is

The Music You’ve Heard

Make it a mission to expand this

The Music You Like butDon’t Understand

The Music You Like and Understand

The Music You Don’t Like But Understand

The Music You Don’t Like and Don’t Understand

Educational

Inspiring

Understand =anything from being virtuosic in the idiom to appreciating

the mechanics, skill and artistry within it

Your best moves

NB. this circle is a continuum not 4 distinct spaces

There’s always more to learn and don’t take your musical

taste too seriously

Tc There Is

.So make this bigger,

and move left and up within it.

@miltonline

A Hierarchy of Pulse

The concept of pulse - an underlying unit of rhythmic regularity - has been established in Lecture 1. This

regularity may occur at different levels, a concept that can be exploited in, for example half-time or double-time feel, but there is usually one predominant ‘tap-

along’ pulse.However, this string of pulses - beats - are rarely

entirely equal. There is a hierarchy.

Types of Meters, Beats and Bars

Pulses or beats almost always existin logical groups and in a hierarchy of strengths.

This meter or time signature indicates how many beats - and what type of beat -exist in each measure.

For example 4/4 120bpmThe crotchet is the predominant common pulse and they are grouped in 4 beats.

7/8 would imply that quavers are the common beats and are grouped in 7s

Types of Meters, Beats and Bars

What determines the groups?

Dynamic emphasis

Rhythmic repetition

Harmonic and melodic implications

Listening and transcribing

What determines a bar?

What repetition, harmonic and melodic exist?

Can the rhythm be broken logically into 2-beat and 3-beat division.

16 examples

Son Clave

Rumba Clave

Bossa Clave

Bulgarian Folk Dance

The exploration of meter in folk music is hugely extensive. In Bulgaria folk music alone,a rich history of dance forms has amassed many metric forms.

Many may be considered additive, formed by an extension of beats.Here are 5 to transcribe

Paydushko horo

Chetvorno horo

Rachenitsa

Petrunino horo

Yovino Horo

Bulgarian Folk Dance

The exploration of meter in folk music is hugely extensive. In Bulgaria folk music alone,a rich history of dance forms has amassed many metric forms.

Here are 5: Transcribe your own.

Paydushko horo (2+3; 5/16 or 5/8)

Chetvorno horo 3+2+2 or 3+4; 7/16)

Rachenitsa (2+2+3 or 4+3; 7/16)

Petrunino horo (3+3+2+3=11/16)

Yovino Horo (3+3+ 2+2+3+ 2+2+3+ 2+2+2+2+3+2+2=35/16)

Playing with beat divisions: Hemiola

A meter can stay constant while groupings change.A hemiola is a musical figure where 2 groups of 3 notes

are followed or replaced with 3 groups of 2,implying-for example - a 6/8 to 3/4 change

Compás

Here we look at a more complex rhythmic interaction fromthe Flamenco style

The Flamenco compàs is a metric structureThere are several types- many of them containing 12 beats.

They are fully absorbed by the performers and this anchored, mutually felt rhythmic pattern

allows for a high degree of rhythmic sophistication

Compás

Soleares

1 2 3 4 5 6 7 8 9 10 11 12

This is the basic pattern but there is a huge repertoire of counter-rhythm hand claps, endings and rhythmic devices

Compás

Siguriyas

8 9 10 11 12 1 2 3 4 5 6 7

ShortLong

A ‘rhythmic mode’ of Soleares

Compás

Alegrias

12 + 1 + 2 + 3 + 4 + 5 + 6 + 7 + 8 + 9 + 10 + 11 +

Exercise 1: Clave/Compas. Select or better still, research/transcribe a metric template (from Bulgarian, South-American, Flamenco or other sources) and construct a groove/piece using the rhythmic structure.

Changing Meter

Meters can change, sometimes this is quite natural and can go unnoticedsimply adapting to accommodate a melody.

Beatles All you Need is Love.

7/4 (or 4 + 3) bars are used very naturally

Changing Meter

An example from the ‘classical’ repertoire is Mussorgsky’sPictures at an Exhibition (Promenade)

Notice how a simple melodic motif is developed perfectly accessibly using changing meters.

Exercise 2: Compose or select a clear melodic phrase, and use meters of different lengths to develop and reinterpret the melody into a longer

piece.

Changing Meter

Meter changes can be extreme lurching the pulse and messing with your musical brain.

Dream Theater Erotomania

From guitar entry

5/4 (3 bars) + 9/8 (1 bar)5/4 (3 bars) + 9/8 (1 bar)

5/4 (3 bars) + 3/4 (2 bars) + 2/4 (1 bar)5/4 (3 bars) + 3/4 (2 bars) + 2/4 (1 bar)

repeats

11/8 (3+3+3+2)10/8 (3+3+2+2)

4/4 (2 bars)

Solo in 5/4 etc.

Changing Meter

Complex changing meters has a long history,let’s look at the Sacrificial Dance from Stravinsky’s

seminal 1913 ballet The Rite of Spring

Exercise 3: Using the Sacrificial Dance (pick at least 2 consecutive pages) as a metric template, compose meter-specific material, and then compose material that occurs less dependently on the structure. The overall metric

implication may well be-for example 4/4 -with Stravinsky’smeter pattern embedded in some layer, or the meter pattern may be overt.

Polymeter

(not polyrhythm)Multiple meters may be implied at the same time.

SImple examples may be a delay set to a triplet or dotted quaver.Often, during solos, a soloist can use phrase that imply

different meters over an underlying groove, or rhythmic hits(Hancock -Hang Up Your Hang Ups 5:30 onwards)

However many compositional examples exist even from pop music:The Cars Touch and Go has in the verse a 5/4 bass and drum pattern and a

simultaneous 4/4 in the vocals and keys.

The use of polymeter in 20th Century ‘classical’ and contemporary metal is wide-spread.

For example, Ligeti’s Arc-en-ciel implies different and changing meters (as well as polyrhythms) in each hand.

Here are some more examples.

Polymeter

Hindemith - String Quartet no.3-II (0:05-0:19)analysis by Timothy Daust

Polymeter

Messiaen - La Verbe (2:18-2:23)analysis by Timothy Daust

Polymeter

Meshuggah - Rational Gaze (0:00-0:29)all Meshuggah analyses by Jonathan Pieslak

PolyMeter

Meshuggah - Stengah (0:16-0:48)

PolyMeter

Meshuggah - Humiliative (3:50-4:04)

PolyMeter

Meshuggah - New Millenium Cyanide Christ (0:00-0:25)

4+4+3 ostinato

Benjamin Britten, Peter Grimes -Interlude IVAll Britten analyses 2008 Timothy Daoust

Benjamim Britten, Peter Grimes - Interlude IV (1:16)

Same passage re-scored

Exercise 4: Compose a piece with at least 2 simultaneous metric implications, make sure you understand how it interlocks.

Exercise 1: Clave/Compas. Select or better still, research/transcribe a metric template (from Bulgarian, South-American, Flamenco or other sources) and

construct a groove/piece using the rhythmic structure.

Exercise 2: Compose or select a clear melodic phrase, and use meters of different lengths to develop and reinterpret the melody into a longer piece.

Exercise 4: Compose a piece with at least 2 simultaneous metric implications, make sure you understand how it interlocks.

Exercise 3: Using the Sacrificial Dance (pick at least 2 consecutive pages) as a metric template, compose meter-specific material, and then compose material that occurs less dependently on the structure. The overall metric implication

may well be-for example 4/4 -with Stravinsky’smeter pattern embedded in some layer, or the meter pattern may be overt.

MILTONOTES

Elements of Groove

Listening list:

for music and more

http://open.spotify.com/user/miltonline/playlist/7El79d9SdfBxnSwNruyAeD

Elements of Groove

Ensemble and feel

Another enormous topic, but we will focus attention on two extraordinary rhythmic ensemble disciplines:

Rhythmic patterns of Ashanti people of GhanaHartigan (1995)

andan analysis of several drum/bass/guitar grooves of

the James Brown Rhythm Sections (1968-1973)Slutsky & Silverman (1997)

Elements of Groove

Swing will be defined here as the difference in length betweenan on-beat and off-beat quaver (and on-beat and off-beat semiquaver). Rather than just a straight vs. triplet swung

concept of swing.

Elements of Groove

Latency

Elements of Groove

Time-feel

Elements of Groove

Syncopation

Syncopation is the emphasis of ‘weaker’ beats. By weaker beats we generally mean off-beat quavers and

semiquavers. Although stressing beats 2 & 4 over1 & 2 also falls into this category.

How can off-beats be relatively more emphasised than anon-beat?

No on-beat, or tied on-beat.Louder more articulated offbeat

Melodic/Harmonic emphasis

Elements of Groove

Identify the syncopated features

Elements of Groove

Rhythmic Repetition

An addition to feel, interesting rhythmic/melodic components can sense a groove through repetition.

Repeating phrase present a time-feel, and also create a sense of expectation allowing for musical variation.

Notice the repeated and slightly varied rhythmic device

Elements of Groove

Rhythmic DisplacementRepeating rhythmic figures tend to occur at 1, 2 or 4 bar

intervals. However a rhythmic figure can be repeated on a different beat of the bar. A simple displacement maybe 2

beats, where the beats ‘strength’ is similar. Three beatdisplacements also occur as well as at other subdivisions,

and create a subtle infectious polymetric feel.

Elements of Groove

Rhythmic Displacement

3 - beat (dotted minim) displacement

dotted semi-quaver displacement - disrupting any swing/weighting that may exist

Rhythmic/melodic figures can also be repeated and displaced between instruments

Elements of Groove

Elements of Ensemble Groove

Repetition/displacement of figures between instruments

Time-feel: What is the overall feel of the ensemble, Is feel (swing etc.) the same between instruments?

Are there any moments when a rhythmic gap in some instruments allowsanother instrument to feature? Is there a rhythmic interplay?

Are there moments when more than one instrument synchronise material and play a similar rhythmic/melodic figure (a sort of tutti)?

What are the roles of each instrument? Time-keeping, feel, texture, rhyhmic interest.Do these roles change?

West African Drumming

Ashanti People of Ghana

A richly syncopated drum tradition whose influencemay be heard in Cuban Son and Rumba, Haitian Vodun, Merengue of Dominican Republic, Brazilian samba and

American Jazz.

West African Drumming

Sikyi (Si-chee) Ashanti People of Ghana 1

Sikyi : Ashanti People of Ghana 2

Adowa : Ashanti People of Ghana 1

Adowa : Ashanti People of Ghana 2

Gahu : Ashanti People of Ghana 1

Gahu : Ashanti People of Ghana 2

Akom Style 1: Ashanti People of Ghana

Akom Style 2 (3/4)

Metric Illusions

Akom Style 2 (6/8)

Metric Illusions

Groove

James Brown Rhythm Section (1960-1973)

Identify the elements of time-feel, syncopation, repetition, displacement

and ensemble techniques in theseseminal grooves.

Imitate, assimilate, innovate.

Think (1960)

I Don’t Mind (1962)

Out Of Sight (1964)

I Got You (1965)

Don’t Be A Dropout (1966)

Cold Sweat Pt. 1 (1967)

I Can’t Stand Myself Pt. 1 (1967)

I Got The Feelin’ (1968) - Verse

I Got The Feelin’ (1968) - Bridge

Licking Stick (1968)

Give It Up or Turnit A Loose (1968) - Verse

Give It Up or Turnit A Loose (1968) - Bridge

Mother Popcorn (1969) - Verse

Mother Popcorn (1969) - Bridge

Funky Drummer (1969) - Pattern 1

Funky Drummer (1969) - Pattern 2

Get Up (1970) - Verse

Get Up (1970) - Bridge

Got To Getcha (1970) - Verse

Got To Getcha (1970) - Bridge

Funky Women (1970)

Super Bad Pts. 1 & 2 (1970) - Verse (1/2)

Super Bad Pts. 1 & 2 (1970) - Verse (2/2)

Super Bad Pts. 1 & 2 (1970) - Bridge

Talkin’ Loud & Sayin’ Nothing (1970) - Verse

Talkin’ Loud & Sayin’ Nothing (1970) - Bridge (1/2)

Talkin’ Loud & Sayin’ Nothing (1970) - Bridge (2/2)

Give It Up or Turnit A Loose ‘Live’ (1970) - Verse

Give It Up or Turnit A Loose ‘Live’ (1970) - Bridge

Hot Pants Pt. 1 (1971)

Make It Funky Pt. 1 (1971)

Papa Don’t Take No Mess Pt. 1 (1973)

The Payback (1973) - Intro

The Payback (1973) - Verse

Exercise 1: Sequence the elements of an Ashanti Time-line of your choice.Make sure you can identify and have absorbed every part.

Exercise 2: Create a piece using some (not necessarily all) of the elements from Exercise 1. You may wish to turn one pattern into a bass-line and bind some of the

others to other melodic, harmonic and rhythmic instruments.

Exercise 4: Using features which you have absorbed from the James Brown templates, create your own 2, 4 or 8 bar groove, paying particular attention to

time-feel. syncopation, repetition, displacement and ensemble mechanics.

Exercise 3: Recreate as accurately as possible with MIDI one of the sample James Brown grooves, paying particular attention to articulation and swing values.

MILTONOTES

Melodic Structures

Listening list:

for music and more

This episode

Entire serieshttp://open.spotify.com/user/miltonline/playlist/1vWvLOvDYElkzQkuZr7Fp7

http://open.spotify.com/user/miltonline/playlist/7El79d9SdfBxnSwNruyAeD

Quick intermission before our scheduled

Episode

Conceptualise (or fully compose) piecesbased on each of the following images

This species of ant survive floods by hugging each other. The cluster floats but they would drown as individuals

Review

All episodes interlink, so frequent reviewing and re-contextualising of information is highly

beneficial

Polymeter Use

Alignments

When a polymeter appears there will be a point in time when the barlines coincide. The effect of

this event may be used musically.

Polymeter Use

Break out Clauses

A polymetric phrase may be held indefinitely, but often the implications is broken by added or

subtracted beats torealign the measures.

Polymeter Use

Melodic/Harmonic Adjustments

As polymetric phrases fall out of sync, some phrase can be adjusted at some point in their cycle to accommodate their new harmonic/

melodic environment

Polymeter Use

Lateral thinking of polymeter

A single line may embody several musical features subject to meter, and hence polymeter:

Note phrasing, dynamic emphasis, melodic emphasis, delay rate, pan rate, filter rate, trem

rate and so on.

MILTONOTES

Melodic Structures

Here we look deeply into the construction ofmelodies from a ‘classical’ perspective although its implications run beyond stylistic constraints

Arnold Schoenberg (1874-51)

A radical traditionalist2nd Viennese School,

Fundamentals of CompositionHarmonielehre

Melodic StructuresThe Phrase

The smallest structural unit is the phrase, a kind of musical molecule consisting a number of integrated

musical events possessing a certain completeness and well adapted to combination with other similar units.

...a unit approximating what one could sing in a single breath. Its ending suggests a form of punctuation such

as a comma. Often some features appear more than once in a phrase. Such ‘motivic’ characteristics will be

discussed [later]

Concentrated in one voice, implies an inherent harmony

Even with elaborate melodies, harmony (usually I and V) is clear.

Length of phrases can vary widely, depending on metre and tempo

Melodic StructuresThe Phrase from Chords

Phrases are often derived from skeletal chord forms

Simple elaborations of skeletal chord forms

Passing notes to chord forms

Melodic StructuresThe Phrase from Chords, Elaborated

Passing notes and note repetitions toelaborated chord forms

Phrase embellishment

Appoggiaturas and changing tones.

Exercise 1a-f Compose 2 different simple phrases using chord tones of 1-3 chords in a major key(1a,1b), a minor key (1c,1d) and the dorian mode (1e,1f). Keep them very simple, clear and memorable.

Exercise 2a-c Pick one phrase from each of the major, minor and dorian sets and elaborate using appoggiaturas, upbeats and other available devices.

Melodic StructuresThe Motive (Motif)

If a phrase is a molecule, the motif is the atom, the ‘smallest common multiple and greatest common factor’ providing unity, and through repetition, variation and recombination can form higher structures in the phrase and piece

Often the use of the motif is intuitive, though it needn’t be. It forms the invisible musical glue

that can unifies and forms higher level structures

Usually defined by a simple rhythmic and intervallic structure, a motif is maintained by

repetition of which there is:

Exact and Modified Variations.

Variations preserve some musical features and alter others

Note the simplicity of the motif, and how variations are slight but in different features

Melodic StructuresMotivic Transformations

Exercise 3 Write a simple motif, and create 12 variants (using for example, transpositions, elaborations, inversions, retrogrades, retrograde inversions, rhythmic changes, omissions and so on).

Exercise 4 Construct a phrase (or 2 or 3) using combined variant forms of your motif from Exercise 3. Try and outline a harmonic sequence.

Melodic Structures

Melodic Structures from Phrases and Motifs

Although it may pain Schoenberg, let’s look at phrase and motif construction over the course of

a whole piece in the work of the French composer of stunningly progressive minimal

work, Erik Satie (1866-1925)

Melodic AnalysisGnossienne I - P1

2 scales, 3 chords, 1 piece

Exercise 5 Listen to, and examine the score of, Gnossienne I (or any Satie piece) See if you can identify key motifs (and variations) through phrases, as well as phrases and their repetitions and variations are put together to make the whole piece.

Exercise 6 From the techniques observed in Exercise 4, choose a scale or 2, 3 or so chords, simple rhythms and limited motivic material, and a series of phrases. Create a short piece with a series of melodic phrases.

Exercise 1a-f Compose 2 different simple phrases using chord tones of 1-3 chords in a major key(1a,1b), a minor key (1c,1d) and the dorian mode (1e,1f). Keep them very simple, clear and memorable.

Exercise 2a-c Pick one phrase from each of the major, minor and dorian sets and elaborate using appoggiaturas, upbeats and other available devices.

Exercise 3 Write a simple motif, and create 12 variants (using for example, transpositions, elaborations, inversions, retrogrades, retrograde inversions, rhythmic changes, omissions and so on).

Exercise 4 Construct a phrase (or 2 or 3) using combined variant forms of your motif from Exercise 3. Try and outline a harmonic sequence

Exercise 5 Listen to, and examine the score of, Gnossienne I (or any Satie piece) See if you can identify key motifs (and variations) through phrases, as well as phrases and their repetitions and variations are put together to make the whole piece.

Exercise 6 From the techniques observed in Exercise 4, choose a scale or 2, 3 or so chords, simple rhythms and limited motivic material, and a series of phrases. Create a short piece with a series of melodic phrases.

MILTONOTES

Phrase, Contour & Melodic Forms

Listening list:

for music and more

This episode

Entire serieshttp://open.spotify.com/user/miltonline/playlist/7El79d9SdfBxnSwNruyAeD

http://open.spotify.com/user/miltonline/playlist/0IIbAhOvRgGeKhtqc8NXaZ

The concepts of motif and phrase have been defined, as well as principles behind their

construction and transformation. Let’s see how these manifest to form successful melodies in the real world and how we might use these ideas in

composition.

Key terms: Motif, Phrase, Endings, Intervals, Phrase Hierarchy, CTs, NCTs, Devices, Range,

Contour, Diatonicism, Parallelism, Leaps & Lines, Accel/decceleration, Melodic forms.

EndingsSimilar

How a phrase ends is often of particular melodic importance. You may notice that different phrases

often have similar endings.Phrase 1

Phrase 2 has unequal length, different starting material but similar motifs and an identical ending, forming a link with Phrase 1

EndingsModified

Conversely, a phrase may be repeated with small modifications to the ending, to create different

degrees of resolution even with similar harmony

Phrase A1 Phrase A2

Phrase A1.2 Phrase A1.3Phrase A1.1 Phrase A1.1

This introduces the concept of phrase hierarchyPhrases made up of smaller phrases which can be modified and recombined

EndingsDegrees of Resolution

Here’s an impression of resolution level of diatonic notes in a major scale devoid of harmony (the same categories work for minor also)

It’s very dependent on content but is a reasonable starting point.Note that the idea of resolution here is independent from consonance/

dissonance - the sound of a note against the underlying harmony.

ChromaticismDegrees of Resolution

These are highly context dependent and not hard rules - there are also other settings other than major or minor that can be established,

but the idea of varying degrees of melodic resolution is fundamental.Again, this about melodic resolution not consonance/dissonance - the latter

being controlled by harmonic context.

Phrase ConstructionDegrees of Resolution

We can now see how a sense of resolution (from stable to unstable) can be established between phrases giving a longer arc to melodic construction.

This is a fundamental concept in 1000s of melodies.

Phrase A1 Phrase A2

from Gnossienne 1 - Satie

Unstable #4Resolution

Stable Root

EndingsDegrees of Resolution

Exercise 1 Write two different phrases that share identical resolving endings

Exercise 2 Write two phrases with the same (or no) harmony, but with a different note choices at the ending, creating different degrees of resolution.

Phrase Endings & HarmonyLinking phrases with similar or

modified endings

Sub-divide into 2 levels of phrases noting areas of stability/instability and how harmony accommodates the melody

modified endings

from Across the Universe - BeatlesNote that melody notes, melodic rhythm and harmony all combine

to create a multi-layer musical experience

modified endings

Note the use of varied phrase endings, motivic editing and transformation with harmony

from Angel Eyes - Matt Dennis

modified endings

Note the use of varied phrase endings, motivic editing and transformation with harmony

Phrase Endings & RhythmStrength of ending

Rhythm contributes to the sense of finality of a phrase (not that a phrase always needs it). The ‘strength’ of the beat on which the phrase ends contributes to a sense of continuity or finality.

1 32 4& & & &

Strong

Weak1 32 4& & & &

Phrases & Rhythm

Exercise 2a Write 3 similar phrases with different strengths of ending

Exercise 2b Write 3 similar phrases but starting on different beats

Melody Contour & Range

Melodic TypologyAlthough there are millions of possible melodies, analysts have proposed

systems to categorise them into various groups. We won’t favour one but at least look at the various identifying features.

Range (Highest to lowest notes)

Contour (Position of highest and lowest notes)

Leap & Line (Stepwise motion or intervallic leaps)

Long Term Goals (A journey between 2 notes) Chopin

Motivic Material(Identifying motifs or articulations)

Scale/Diatonicism/Chromaticism(Set of notes used)

Consonance/Dissonance(How the melody interacts with harmony)

Melody Contour & Range

Melodic Typology

Exercise 3a-b Write a melody with specific ideas for the features identified previously. Write another melody from the previous by changing. 2 of the features

Melody & Harmony

Consonance & Dissonance

In addition, to melodic resolution, there is another important musical layer:The consonance and dissonance of a melody against the harmony.

The most consonant melodic approach is to use only chord tones (CTs)

Melody & Harmony

NCTs of course can be used, and there are techniques for resolving dissonances.Here Passing Tones (PTs), Diatonic Sequences and Chord Tones Pivots.

Melody & Harmony

Melody from a chord sequence.A Theme and Variations concept (Paganini Caprice 24)

This allows the creation of certain canonic forms where material that functions of the same harmony can be superimposed

Melody & Harmony

Exercise 4 Write a 4-bar chord sequence, and an accompanying melody using CTs, create 3 subsequent phrases on the chord sequence

Melody & Harmony

NCTs can be left unresolved as part of a melody and will produce a varying amount of dissonance against the underlying harmony, for which the next page give a general impression of this continuum.

Melody & Harmony

This schematic shows the continuum of consonance and dissonance with reference tothe chordal context (ie if we are looking at a ii or a iii chord, a I or a IV etc.

There are some exceptions to this, for example the use of the b3(aka #9) in a major context, which is a stylistically perfectly accepted dissonance in many African-

American sourced music forms (Jazz, Blues and by assoiciation Rock, pop, funk etc.)

CTsDiatonic

Non-ClashNCTs

Non-DiatonicNon-Clash

DiatonicClashNCTs

Non-DiatonicClashNCTs

Melody & Harmony

From another perspective we can look at common dissonances - also known as tensions or extensions and have a quick look at what contexts they are accepted,

other than a passing tone or other melodic device.

b9 (aka b2)

Melody & Harmony

b9 (aka b2) This can be sometimes found unresolved when it is a diatonic.

Eg. an F against an Eminor in the key of C, or against an E major in A harmonic minor.It is common against the one chord scales with a b2 eg. Phyrgian (F against E minor in E

phrygian) or in ‘Spanish’ Phrygian (F against E major) and the like. (Caravan, Miserlou for example)

It also appears on a major or dominant chord that is acting as a primary or secondary dominant, particularly (but not exclusively) when resolving to a minor chord. Other than this it

is rare when non-diatonic.

Melody & Harmony

9 This is the most common ‘dissonant’ non chord tone, and appears freely on a major, minor,

dominant, major 7 chord etc. It is only rare when non diatonic e.g. on a iii chord in a major key, but non diatonic examples are found particularly in a parallel context.

Every Breath You Take,(Police) or Twin Peaks Theme shows its diatonic usage, while Castles Made of Sand, Come On Pt.1 (1:16) and Little Wing (Hendrix) has parallel non-diatonic

examples.

Melody & Harmony

#9 Acting as a ‘blue note’ on a major or dominant chord is a commonly accepted melodic dissonance on any resolving dominant chord or over any I major or I dominant chord or

general tonality. It’s use on the IV or IV7 chord is actually quite rare due to the peculiarity of a b6 over b3.

Examples of a b3 in major/dominant context abound.

Melody & Harmony

11(4)Although traditionally a dissonance that requires resolution, the 11th (or 4) is often left

unresolved on a I chord a major or dominant context (being diatonic), and is common on minor chord as there is no clash with the 3rd. It is a little more rare, but still heard, in a non-diatonic form (e.g. on the IV chord in major, the IV chord in blues however tolerates it easily due to the

pentatonic context). All minor chords (and half-diminished chords) happily accept the 4th melodically although non-diatonic uses are a bit more rare.

Melody & Harmony

#11(#4)The #11 is a common NCT on major, major7 and dominant chords.

The least dissonan use is diatonic e.g. Chord IV in major, Chord I in Lydian or bVImaj in a minor (or borrowed minor) context. It is also often used on tritone-substituted dominant chords.

However it is common particular in jazz-tinged styles to include on major, major7 and dominant chords and on minor chords in a Satie-esque exotic moments.

(Blue 7 dominant, Satie minor, Blue in Green Major)

Melody & Harmony

b6(b13)The b6 or b13 with the presence of the 5th is quite a strong dissonance often

quickly resolvedThe exception being on resolving dominant chords (particularly to minor chords)

where it is often supported.

Melody & Harmony

6(13)The 6 or 13 in the melody, unless non-diatonic is readily supported by major, minor and

dominant chords alike.

Giant Steps - John ColtraneNotice how accepted NCTs are used alongside tomarry a memorable melody and a complex chord

sequence

Melody & Harmony

Intervallic Features

Exercise 5 Write a melody devoid of harmony. Harmonise it in 3 ways so that all notes are in example a) All chord tones b) Resolved dissonances c) Accepted NCTs

Melody & Harmony

Intervallic features

Traditional melodies usually have a few leaps using chord tones and devices, and the rest of the material step wise. However it is possible to use less traditional intervals as

important melodic motifs.

Melody & Harmony

Exercise 6 Write a melody based on extended intervals (4th,5ths and 7ths) or interval structures ( for example +2,+7,-1) using accepted NCTs

Melody & Harmony

Pedal Tone/Pitch AxisYou’ll notice that the more angular examples of intervallic tunes had less (or no chords)

Since harmony dictates consonance and dissonance, we can open up melodic possibilitiesby simplifying the harmonic context. For example a drone permits a wide array of scales to

be implied compositionally (or through improvisation). Indian classical music (discussed later) is monophonic and allows an enormous amounts

of expressive melodies unconstrained by even temperament.Even limiting ourselves to a 7 note system, even temperament, only one type of degree and no

b4, Satie’s F-minor chord (on which he uses Dorian #4 and Melodic Minor #4) actually has16 logically accompanying modes and scales.

R b3 5

Melody & Harmony

Pedal Tone/Pitch Axis

R b3 5

PhrygianAeolianDorian

Phrygian #4Aeolian #4Dorian #4

Melodic MinorHarmonic Minor

Harmonic Minor b2

Melodic Minor #4Harmonic Minor #4

Harmonic Minor b2/#4

Dorian b2Mel. Min b2

Dorian b2/#4Mel. Min b2/#4

Melody & Harmony

Ravel’s Bolero (1928) is an orchestral work based almost exclusively on a bass ostinato(bass loop) which includes only a C and G. This allows the insistent melody to

be transformed into several parallel beautiful scales while maintaining musical interest.

French composer Maurice Ravel (1875-1937)

Melody & Harmony

C Major(R,2,3,4,5,6,7)C Mixolydian b6 (Aeolian Major/Hindustani/Mode 5 of MM)(R,2,3,4,5,b6,b7)C Phrygian(R,b2,b3,4,5,b6,b7)C Phrygian Dominant(R,b2,3,4,5,b6,b7)

E Mixolydian b6E Phrygian

Bolero Modes

Melody & Harmony

.Take the bridge of Satch Boogie - Joe Satriani for example

The A acts as a pivot to a menagerie of exotic scales/harmonies.

Or no harmony whatsoever as in Debussy’s Syrinx unpublished in his life time.

Melody & No Harmony

“my favorite music is those few notes an Egyptian shepherd plays on his flute: he is a part of the landscape around him, and he knows harmonies that aren’t in our books.”

The opening phrase elaborates the notes of a whole-tone scale (Bb, Ab, Gb, E). The whole-tone scale is incompatible with common-practice harmony, because it contains no 5ths and no half steps, making traditional cadences impossible and eliminating tonic-dominant polarity. Debussy used whole-tone scales in many works as a way to confound his listeners’ tonal expectations and to explore new harmonic possibilities. Here, though, he does not limit himself to the whole-tone scale. He decorates it with chromatic neighbors and passing tones in the first two measures (A,B,G, F). In measure 4 he exchanges it for an ascending chromatic scale (Bb, B, C, Db).

In measure 11 he turns to a pentatonic scale (Gb, Ab, Bb, Db, Eb) with an added note (F). In measure 15, which begins the middle section of the piece, he uses a fully chromatic scale.

At measure 26 (the recapitulation) he returns to the initial whole- tone scale. Then in the very last measure he switches to the other possible whole-tone scale (B, A, G, F, Eb, Db), which is how the piece ends. In this very short piece Debussy exchanges pitch materials almost compulsively, but he steadfastly avoids the major- minor diatonic scale.

Melody & Harmony

Exercise 7 Write a melody over a 2, 1 or 0 note ostinato, exploring scales which the harmony allows.

Exercise 6 Write a melody based on extended intervals (4th,5ths and 7ths) or interval structures ( for example +2,+7,-1) using accepted NCTs

Exercise 4 Write a 4-bar chord sequence, and an accompanying melody using CTs, create 3 subsequent phrases on the chord sequence

Exercise 5 Write a melody devoid of harmony. Harmonise it in 3 ways so that all notes are in example a) All chord tones b) Resolved dissonances c) Accepted NCTs

Exercise 1 Write two different phrases that share identical resolving endings

Exercise 2 Write two phrases with the same (or no) harmony, but with a different note choices at the ending, creating different degrees of resolution.

Exercise 3a-b Write a melody with specific ideas for the features identified previously. Write another melody from the previous by changing. 2 of the features

MILTONOTES

Chance & Translation

Listening list:

for music and more

This episode

http://open.spotify.com/user/miltonline/playlist/4XZkQfATo0nIycKYL91QTH

This episode we look at approaches to composition, that in some way have delegated

decisions to ‘outside’ influences such as the use of chance and indeterminacy in composition,

cryptograms and the ‘sonification’ of non-musical data and physical processes.

Indeterminacy (like improvisation) and chance could be a component (big of small) of composition. From making a

series of randomised chords, or predetermined motif ‘work’ or the

effective use of a noise wave-form LFO.

The transfer of non-musical data (for example someone’s initials converted to a motif, or a key from another piece) can

act as a form of tribute, signature or aesthetic link. It can also act as a compositional challenge and self-imposed to enhance creativity and

encourage new musical ideas.

The delegation of compositional control, has a philosophical implication. Can a composer create a piece that includes elements out of her control? At what

degree of uncertainty, white noise LFO or level of improvisation does it no longer

become the piece?Can we just point at a sound (like 4’33”)

and claim it as a piece?Which parts are important?

Cadenza to Jazz to Electronica

Chance and AleatoricMusic

The use of chance in composition has a varied and long heritage.

Defining chance or aleatoric music as“music in which some element of the

composition is left to chance”would imply many types and degrees of

chance music.

Chance

Types of randomness

Dotted or Drunk

Chance

Ockeghem’s Missa Culuvsis ToniA composition by Johannes Ockeghem (1410-97)

which allows a choice of modal interpretations.One composition: multiple realisations.

Chance

Determined Left to chance/Indeterminant

Using this very simple system allows a more nuanced and useful understanding

of chance music

Chance

Determined

Melodic contour, rhythms, structure, text etc.

Indeterminate

Which 1 of 4 Modes

Chance

Mozart’s Dice Game (1787)

A Musical game for composing minuets and trios from dice rollshttp://sunsite.univie.ac.at/Mozart/dice/

Chance

Determined

Harmonic structure

Set of motifs

Left to chance

Which of theset of motifsare selected

Mozart’s Dice Game

Chance

DuChamp’s Erratum Musical (1913)Composition by the dadaist artist Marcel DuChamp.

A fixed number of pre-determined notes (and words in the vocal version) from a set of possibilities are randomly selected to form the work.

Chance

Determined

Prepared materials

Number of events

Left to chance

The order and which of the musical fragments are selected

Duchamp’s Erratum Musical

Chance

Cage’s Williams Mix (1952)Environmental sounds collected over 9 months by the Barrons,

then tape-spliced according to a set of rules determined by coin tosses.

Chance

Determined

Prepared environmental materials

Length of piece

Operations

Left to chance

Which operations on which tracks

Cage’s Williams Mix

Chance

Cage’s 4’33 (1952)

Measured ‘Silence’ Focusing attention on unintended sound

Chance

Determined

Duration(s)

Left to chance

Everything else

Cage’s 4’33”

Chance

The Use of Randomness in Synthesis

Noise wave as tone

Noise wave as LFO (with continuous and step values)

Chance

1 Layer of Randomness

Chance

2 Layers of Randomness

Chance

3 Layers of Randomness

Chance

Randomness and Creativity

The forcing of new ideas

Random Word Generator

Chance

Exercise 1 Write a musical passage which divides various musical features into determined, and randomly generated. Render some versions.

Exercise 2 Alter which of the features in Exercise 1 are determined or random and render some versions.

Exercise 3 Create a synth line (or several layers) experimenting with controlling LFOs with step and/or continuous noise functions.

Exercise 4 Randomly generate an adjective and noun, and create the opening (or all) of a work based on the phrase. Repeat with a different randomly generated phrase.

Chance

So compositions can allow areas and degrees of randomness and

indeterminacy. From interpretation, cadenzas, jazz to extremely random.

Pockets of chaos

But they can also includepre-determined material,

(overt or hidden).

The BACH motif

Translation

Cryptogram

(B = Bb H=B S= Eb)

B A C H

Acting as a tribute, or a test of compositional skill, the Bach motif has appeared in 100s of works since the 17th century.

The BACH motif

Contrapunctus V (2:20)

Contrapunctus IV

Translation

Cryptogram

The BACH motif

The unfinished Contrapunctus XIV, C.P.E. Bach’s("At the point where the composer introduces the name BACH [for which the English notation would be B♭-A-C-B ] in the countersubject to this fugue, the composer died."

Translation

Cryptogram

The BACH motif

Schumann: Sechs Fugen über den Namen: Bach No. 4 & 5 (1845)

Translation

Cryptogram

The BACH motif

Webern Tone Row String Quartet Op. 28

Translation

Cryptogram

The BACH motif

Translation

Cryptogram

1845 — Robert Schumann: Sechs Fugen über den Namen: Bach, for organ, pedal piano, or harmonium, Op. 601855 — Franz Liszt: Fantasy and Fugue on the Theme B-A-C-H, for organ (later revised, 1870, and arranged, 1871, for piano)1878 — Nikolai Rimsky-Korsakov: Variations on BACH, for piano1900 — Max Reger: Fantasia and Fugue on B-A-C-H for organ1910 — Ferruccio Busoni: Fantasia contrappuntistica for piano (first version; later versions 1912 and 1922)1926–28 — Arnold Schoenberg: Variations for Orchestra, Op. 311937–38 — Anton Webern: String Quartet (the tone row is based on the BACH motif)1968 - Alfred Schnittke: Quasi Una Sonata 1981 - Schnittke: Symphony No. 3 - used alongside the monograms of several other composers.1856 - Johannes Brahms: Fugue in A-flat minor for organ, WoO 81930 - Marios Varvoglis: Canon, Chorale and Fugue on BACH1932 - Alfredo Casella: Due Ricercari sul nome B-A-C-H, Op. 521932 - Francis Poulenc: Valse-improvisation sur le nom Bach for piano1934 - Hanns Eisler: Prelude and Fugue on B-A-C-H, Op. 46 for string trio1937 - Marios Varvoglis: Prelude, Chorale and Fugue on BACH1942-46 - Charles Koechlin: Offrande musicale sur le nom de B-A-C-H, Op. 1871952 - Jean Coulthard: Variations on BACH for piano1952 - Luigi Dallapiccola: Quaderno musicale di Annalibera for piano1954 - Dallapiccola: Variazioni ("Variations", orchestral version of Quaderno musicale di Annalibera)1951-55 - Dallapiccola: "Canti di liberazione"1964 - Arvo Pärt: Collage over B-A-C-H for strings, oboe, harpsichord and piano1974 - Rudolf Brucci: Metamorfosis B-A-C-H for strings1993 - Ron Nelson: Passacaglia (Homage on B-A-C-H) for concert band

What about other letters/notes?

Translation

Cryptogram

German System

A = AB = BbC = CD = DE = EF = FG = GH = BM = EL = A

R(e) = DS (Es) = Eb

T(i) = BAs = Ab

Ignore the rest

Translation

Cryptogram

French System

A B(or Bb)

C D E F G

H(or B)

I J K L M N

O P Q R S T U

V W X Y Z

Translation

Cryptogram

Alban Berg/Hanna Fuchs-Robettin

A, Bb, B, F

Berg’s Lyric Suite

Translation

Cryptogram

Arnold Schoenberg

A, Eb, C, B, Bb, E, G

Schoenberg’s Seraphita

Translation

Cryptogram

Brahms

Bb, A, B, Eb

Schnittke’s Quasi Una Sonata

Translation

Cryptogram

B, A, D, D, G

Ravel’s Menuet sur le nom d’Haydn

Translation

Cryptogram

Béla Bártok

Bb, E, B, A

Translation

Cryptogram

C, A, G, E

Pauline Oliveros and Simon Jeffes of PCO in Cage Dead

Translation

Cryptogram

Dimitri Schostakovich

D, Eb, C, BIn many of Schostakovich’s work, and tributes to him.

String Quartet No. 8

Translation

Cryptogram

Sacher Hexachord

Swiss conductor and patron Paul Sacher,used by Babbitt and Boulez (Messagequisses)

Eb, A, C, B, E, D

Translation

Cryptogram

Robert Schumann

Used in Schumann’s Carnaval (in SCHA, ASCH and AsCH forms)

Eb, C, B, A

Translation

Cryptogram

Niels Gade

The monogram for Danish composer Niels Gade (1817-1890) is used in Schumann’s Nordische Lied No.41, Op.68

G, A, D, E

Translation

Cryptogram

Cross MotifSymbol from Gregorian Melodies

Franz Lizst (1811-86)

Translation

Cryptogram

Cross MotiveCrucifixion and star-crossed lovers

Tchaikovsky (1840-93)mm1-2 of Pathétique Symphony

Translation

Cryptogram

Exercise 5 Create your own monogram using the German or French system. Compose a phrase/passage/piece of your signature. Experiment with motivic transformations (R, I, RI), phrase constructions, harmonisations etc.

Exercise 6 Generate another cryptogram for someone (or something) else. Compose a phrase/passage/piece interweaving this, and your monogram.

Translation

Cryptogram

Translation

Other Mappings

Lettersin a name

Notenames

Amusical Musical

Translation

Other Mappings

Lettersfrom anywhere

Any pitch

Amusical Musical

Translation

Other Mappings

ASCII to midi note conversion

Translation

Other Mappings

DNA A C T G

ASCII 65 67 84 71

MIDI F3 G3 C5 B3

DNA to midi note conversion

Translation

Other Mappings

Codon permutations

AAAAACAATAAGACAACCACTACGATAATCATTATGAGAAGCAGTAGG

CAACACCATCAGCCACCCCCTCCGCTACTCCTTCTGCGACGCCGTCGG

TAATACTATTAGTCATCCTCTTCGTTATTCTTTTTGTGATGCTGTTGG

GAAGACGATGAGGCAGCCGCTGCGGTAGTCGTTGTGGGAGGCGGTGGG

Translation

Other Mappings

Lettersfrom anywhere

Rhythm

Amusical Musical

Translation

Other Mappings

h q ee xxe xex exx ‰e !x!x !x‰ ‰.x Œ

A B C D E F G H I J K

L M N O P Q R S T U V

W X Y Z

One of countless letter to rhythm mapping templatesLetter frequency and rhythmic sets will play a compositional role

Exercise 7 Create a rhythmic pattern from the given - or your own - mapping template using your name, initials or somesuch.

Exercise 8 Combine a rhythmic with a melodic mapping template, you may want to use two ‘source names’ so that for example all As aren’t the same length.

Translation

Rhythmic Mapping

Translation

Types of Mappings

Discrete/Continuous

One to One

One to Many

Many to One

Parallel

Translation

Villa-Lobos (1857-1959)

Brazilian Composer

Translation

Villa-Lobos’ millimetrization

New York Skyline

Translation

Villa-Lobos’ millimetrization

New York Skyline Melody (1939) and more

Exercise 9 Create a melody from an image. Harmonise.

Translation

Mapping

Translation

Other Mappings

Vertical Pitch

Amusical Musical

Horizontal Time/Rhythm

Translation

Data Sonificiation

Why stop at 2 discrete dimensions?

How much can be extracted?

What data can be used?

Primal Sound (2004,2007)The coronal suture of the skull (which should now be chiefly investigated) has

let us assume a certain similarity to the closely wound line that the needle of a

phonograph cuts into the receptive, revolving cylinder of the machine.

Suppose, for instance, one played a trick on this needle and caused it to

retrace a path not made by the graphic translation of a sound, but self-

sufficing and existing in nature – good, let us say it boldly, if it were (e.g.) even

the coronal suture – what would happen? A sound must come into being, a

sequence of sounds, music…Feelings of what sort? Incredulity, awe, fear,

reverence yes, which of all these feelings prevents me from proposing a name

for the primal sound that would then come to birth?

Ur-Geräusch (Rilke 1919, p 1087)

Translation

Data Sonificiation

Primal Sound (2004,2007)

Angela Palmer’s Inside Out exhibition

•!Ruskin Gallery, Oxford University, UK. 2 February 2004.

•!Royal College of Surgeons, Hunterian Museum, UK. 29 January – 19 May 2007.

Music of the Body exhibition

•!Science Circus, Guildford, Surrey, UK. 20 September 2008.

Translation

Data Sonificiation

Head Music (2004)

Translation

Data Sonificiation

Microcosmos (2007)

Generative Composition Emergent Music

Translation

Data Sonificiation

Exercise 10 Create your own mapping system from a data source and realise it compositionally.