View
218
Download
0
Category
Tags:
Preview:
Citation preview
Evolution
Evolution as Theory and Fact
Rodin’s “The Thinker”
• Confusion sometimes arises as to whether Evolution is a theory or a fact. Actually it is both!
• The theory of Evolution deals with how Evolution happens. Our understanding of this process is always changing.
• Evolution is also a fact as there is a huge amount of indisputable evidence for its occurrence.
LAMARCK
The lowest forms of life, such as bacteria, formed by spontaneous generation from lifeless matter, and each species would slowly change (i.e., evolve) into the next higher species on the scale
Use-Disuse model-if an organism used a body part it grew, if it didn’t, then it fell off
Whenever ADAPTATION was discovered, Lamarck attributed it to the effects of use and disuse under each individual's voluntary control
DARWIN'S IDEAS
Darwin's ideas were formulated principally during the voyage of H.M.S. Beagle.
Darwin saw many tropical habitats much richer in species than those he knew.
He noticed that the same habitat often produced different species on different continents: the savannahs (grasslands) of East Africa and the pampas (grasslands) of Argentina have almost no species in common.
Darwin traveled around the world in H.M.S. Beagle
Animals and Plants of South America are vastly different from those found in Africa or Australia
South American Mammals-these species are very different from the mammals found on other continents, even where climates are similar
Darwin noticed that islands (like the Galapagos) always had inhabitants whose nearest relatives were on the nearest continent
For example, the Galapagos Islands had birds and plants related to those of South America, while the Cape Verde Islands (volcanic, geologically similar to the Galapagos) had species related to those of Africa and unlike those of the Galapagos
• Population-all the individuals of a species that live together in one place at one time
Galapagos Islands
Darwin’s Finches – land birds
Look at these pictures
First a few definitions
• Adaptation-changing of a species that results in its being better suited to its environment
DARWIN”S FINCHES FROM THE GALAPAGOS ISLAND
DARWIN”S FINCHES FROM THE GALAPAGOS ISLAND
BRANCHING DESCENT WITH MODIFICATION
Darwin's was not the first evolutionary theory, but it was the first that emphasized BRANCHING descent (in treelike patterns), which Darwin called "descent with modification".
Descent with modification explained why classifications should have "groups within groups": families of related species, orders and classes made of related families, etc.
THE PATTERN OF BRANCHING DESCENT
Methods for Species
• Isolation-when two populations of the same species cannot breed with one another
• Extinct-when species disappear from the planet forever
Charles Darwin (1809-1882)
Origin Of Species by Means of Natural Selection
2 major hypotheses
First major hypotheses, Branching descent – species alive today came from species that lived in earlier times and that the lines of descent form a branched pattern resembling a tree
Second major hypotheses, (natural selection) – parents having genotypes that favor survival and reproduction leave more offspring, on average, than parents having less favorable genotypes for the same traits.
Natural Selection
Agents of selection can include predators, diseases, environmental extremes, ability to obtain food, and potential mates (of the opposite sex).
Natural Selection
Survival of the fittest
Selection by potential mates is called SEXUAL SELECTION.
FITNESS DEFINED: The relative number of viable offspring left by each genotype.
A GREAT DEAL OF EVIDENCE SUPPORTS
DARWIN'S IDEAS
Evidence
• Earth is 4.5 Billion years old
• Organisms have inherited Earth for most of its history
• All organisms living today evolved from earlier, simpler life-forms
Evidence
• Paleontologists-scientists who study fossils and can determine the age of fossils– They have dated these fossils to get an accurate
evolutionary pattern
Evidence
• Vestigial structures-structures that are evidence of an organisms evolutionary past, but are not used today– Appendix, Tail bone, gills in human embryoes
Evidence
• Homologous structures-structures that share a common ancestry– Limbs in mammals
How does this evolution occur?
• Gradualism-model of evolution in which gradual change over a long period of time leads to species formation
• Punctuated Equilibrium-Periods of evolution marked by periods of little or no change and then an explosion of change
Darwin's theory became accepted because it explained the available evidence better than any previous theory.
Natural selection can explain MIMICRY while earlier theories could not: many species survive because they resemble other, unrelated species that predators avoid.
Selection by predators perpetuates the best mimics and eliminates the less effective ones.
Industrial melanism among moths demonstrates natural selection:
The frequency of dark-colored moths varies geographically with levels of soot pollution.
Experiments with bird predators confirms that predators eat the non-camouflaged moths much more often than those which resemble their background.
Industrial Melanism
Mimicry –Warning Coloration
Branching descent with modification explained the facts of geographic distribution much better than any previous theory
The theory also explained HOMOLOGIES structures which resembled one another in their construction among related species, despite differences in adaptive use in many cases; earlier theories could not explain homologies so well
Some homologies include embryonic characters; others include functionless VESTIGIAL organs
Homology
Shared similarities are evidence that the organisms in question share a common ancestry
Homologies among mammalian forelimbs
The fossil record was poorly known in Darwin's time, but fossils discovered since then have in most cases fit well into branching patterns of descent with modification.
The ages of fossils are determined by both relative and absolute dating methods.
As an example: mollusks of the class Cephalopoda (squids, octopus, extinct ammonites, etc.) all fit into a pattern of branching descent, and their shared adaptations and anatomical features are all consistent with this pattern of descent.
REPRODUCTIVE ISOLATION consists of all biological mechanisms (not mere geographical separation) that prevent the interbreeding of natural populations.
REPRODUCTIVE ISOLATING MECHANISMS can act either before or after mating.
These mechanisms include isolation by differences in ecology, differences in mating seasons, differences in behavior, differences which prevent sexual parts from fitting together, or incompatibilities that make gametes, fertilized eggs, embryos, larvae, or adult hybrids inviable or sterile.
HOW NEW SPECIES ORIGINATE
Most new species originate after a period of geographic separation by an extrinsic barrier.
If the barrier lasts long enough for the populations on either side to diverge, then one or more reproductive isolating mechanisms will result.
GEOGRAPHIC SPECIATION- THE EVOLUTION OF REPRODUCTIVE ISOLATION DURING
GEOGRAPHIC ISOLATION
There is good evidence that evolution continues to take place
Natural selection brings about seasonal fluctuations in the characteristics of fruit flies and Galapagos finches
Agricultural and industrial societies have greatly changed the selective forces operating on human populations
Evolution continues to take place wherever natural selection occurs, meaning whenever mortality differs according to genotype or phenotype
Discovery (1) Fixed speciesMichelangelo’s fresco on the ceiling of the Sistine Chapel
en.wikipedia.org/wiki/The_Creation_of_Adam
From Classical times until long after the Renaissance, species were considered to be special creations, fixed for all time.
Discovery (2): Transmutation
en.wikipedia.org/wiki/Image:Giraffe_standing.jpgcommons.wikimedia.org/wiki/Image:Jean-baptiste_lamarck2.jpg
Jean Baptiste de Lamarck
• Around 1800, scientists began to wonder whether species could change or transmute.
• Lamarck thought that if an animal acquired a characteristic during its lifetime, it could pass it onto its offspring. • Hence giraffes got their long necks through generations of straining to reach high branches.
Discovery (3): Fossils and Stratahttp://en.wikipedia.org/wiki/ImageWilliam_Smith.g.jpg
http://en.wikipedia.org/wiki/Image:Geological_map_of_Great_Britain.jpg
http://en.wikipedia.org/wiki/Image:Smith_fossils2.jpg
William Smith, his geology map & some of his fossil specimens
At about the same time, geologists like William Smith weremapping the rocks and fossils of Britain. He and others showed that different species existed in the past compared with today.
Discovery (4): Darwin’s Voyage
en.wikipedia.org/wiki/Image:Charles_Darwin_by_G._Richmond.jpgen.wikipedia.org/wiki/Image:HMS_Beagle_by_Conrad_Martens.jpg
Voyage of the Beagle
• From 1831-1836, a young naturalist called Charles Darwin toured the world in HMS Beagle.
• He was dazzled by the amazing diversity of life and started to wonder how it might have originated
Discovery (5): Survival of the Fittest
en.wikipedia.org/wiki/Image:Darwin%27s_finches.jpeg
• In his Origin of Species, published in 1859, Darwin proposed how one species might give rise to another.
• Where food was limited, competition meant that only the fittest would survive.
• This would lead to the natural selection of the best adapted individuals and eventually the evolution of a new species.
Darwin in 1860
Natural Selectionexplains adaption
Discovery (6): Huxley v. Wilberforce
www.bbc.co.uk/religion/galleries/spiritualhistory/images/9.jpg
• Darwin’s idea of Evolution by Natural Selection was met with huge controversy.
• A famous debate in 1860 pitted Bishop Wilberforce against Darwin’s bulldog, Thomas Henry Huxley.Bishop Wilberforce v. T. H. Huxley
• Evolutionists got the better of the debate, but few were convinced by Darwin’s idea of Natural Selection.
Discovery (7): Genetics
en.wikipedia.org/wiki/Image:Mendel.pngen.wikipedia.org/wiki/Image:Doperwt_rijserwt_peulen_Pisum_sativum.jpg
Mendel and his peas • From 1856-63, a monk called Gregor Mendel cultivated 29,000 pea plants to investigate how evolution worked i.e., how characteristics were passed down the generations.
• He figured out the basic principles of genetics. He showed that offspring received characteristics from both parents, but only the dominant characteristic trait was expressed. Mendel’s work only came to light in 1900, long after his death
Discovery (8): Making Sense
• In the early 20th century, scientist started to make sense of how evolution worked.
• Building on Mendel’s genetics, studies showed how characteristics in a population could be selected by environmental pressures.
• This Modern Synthesis, as Julian Huxley called it, brought Darwin’s Natural Selection back to the centre of evolutionary theory.
en.wikipedia.org/wiki/Image:Hux-Oxon-72.jpg
Julian Huxley and the Modern Synthesis
Discovery (9): Opposition
www.templeton-cambridge.org/fellows/vedantam/publications/2006.02.05/eden_and_evolution/
• Despite the achieval of scientific consensus on evolution, some Christian groups continued to oppose the concept.
• In 1925, the teaching of evolution was outlawed in Tennessee, USA, resulting in the infamous Scopes Monkey Trial
Outside the Scopes Trial
Discussion: Should Creationism and Evolution be given equal time in science lessons?
science.kukuchew.com/wp-content/uploads/2008/01/stop_following_me_creationist.jpg
Mechanism (1): All in the Genes
commons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
• The genetic make-up of an organism is known as its genotype.
• An organism’s genotype and the environment in which it lives determines its total characteristic traits i.e. its phenotype.
PhenotypeGenotype
Mechanism (2): DNA
Watson and Crick and their model of DNA
www.chem.ucsb.edu/~kalju/chem110L/public/tutorial/images/WatsonCrick.jpgen.wikipedia.org/wiki/DNA
DNA replication
• The double-helix structure of DNA was discovered in 1953.
• This showed how genetic information is transferred from one cell to another almost without error.
Mechanism (3): Mutation
upload.wikimedia.org/wikipedia/commons/7/79/Types-of-mutation.png humansystemstherapeutics.com/bb.htm
Types of mutation
Mutant fruitfly
• However, occasional mutations or copying errors can and do occur when DNA is replicated.
• Mutations may be caused by radiation, viruses, or carcinogens.
• Mutations are rare and often have damaging effects. Consequently organisms have special enzymes whose job it is to repair faulty DNA.
Mechanism (4): Variation
majorityrights.com/index.php/weblog/comments/racial_variation_in_some_parts_of_the_skull_involved_in_chewing/
• Nevertheless, some mutations will persist and increase genetic variation within a population.
• Variants of a particular gene are known as alleles. For example, the one of the genes for hair colour comprises brown/blonde alleles.
Mechanism (5): Natural Selection
en.wikipedia.org/wiki/Image:Mutation_and_selection_diagram.svg
• Mutant alleles spread through a population by sexual reproduction.
• If an allele exerts a harmful effect, it will reduce the ability of the individual to reproduce and the allele will probably be removed from the population.
• In contrast, mutants with favorable effects are preferentially passed on
Selection of dark gene
Mechanism (6): Peppered Moth
http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpgen.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpgen.wikipedia.org/wiki/J._B._S._Haldane
• The Peppered Moth is an example of Natural Selection in action discovered by Haldane
• During the Industrial Revolution the trees on which the moth rested became soot-covered.
Haldane and the peppered moth
• This selected against the allele for pale colour in the population (which were poorly camouflaged from predators) and selected for the dark colour allele.
Mechanism (7): Microevolution
www.puppy-training-solutions.com/image-files/dog-breed-information.jpg
• The dog is another example of how selection can change the frequency of alleles in a population.
• Dogs have been artificially selected for certain characteristics for many years, and different breeds have different alleles. • All breeds of dog belong to the same species, Canis lupus (the wolf) so this is an example of Microevolution as no new species has resulted.Dogs are wolves
Mechanism (8): Macroevolution
www.ingala.gov.ec/galapagosislands/images/stories/ingala_images/galapagos_take_a_tour/small_pics/galapagos_map_2.jpg
Galapagos finches
• However, if two populations of a species become isolated from one another for tens of thousands of years, genetic difference may become marked.
• If the two populations can no-longer interbreed, new species are born. This is called Macroevolution.
• Darwin’s Galapagos finches are an example of this process in action.
Mechanism (9): Speciation Today?
en.wikipedia.org/wiki/Image:Gb-lu-Angel-southbound.jpgen.wikipedia.org/wiki/Culex
London Underground Mosquito
• The mosquito was introduced to the London Underground during its construction around 1900.
• It became infamous in the War for attacking people sheltering from the Blitz.
• Studies indicate several genetic differences from its above-ground ancestors. Interbreeding between populations is difficult suggesting that speciation may be occurring.
Activity
Natural Selection in the Peppered Moth
http://en.wikipedia.org/wiki/Image:Biston.betularia.7200.jpgen.wikipedia.org/wiki/Image:Biston.betularia.f.carbonaria.7209.jpg
Evidence (1): Biochemistry
en.wikipedia.org/wiki/Image:ATP-xtal-3D-sticks.png
DNA for Information
Transfer
ATP for Energy Transfer
• The basic similarity of all living things suggests that they evolved from a single common ancestor.
• As we have already seen, all living things pass on information from generation to generation using the DNA molecule.
• All living things also use a molecule called ATP to carry energy around the organism.
Evidence (2): Similar GenesHUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGACHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGAGORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
• If evolution is true then we might also expect that closely related organisms will be more similar to one another than more distantly related organisms.
• Comparison of the human genetic code with that of other organisms show that chimpanzees are nearly genetically identical (differ by less than 1.2%) whereas the mouse differs by ≈15%.
Genetic code of chimps and gorillas is almost identical to humans
Evidence (3): Comparative Anatomy
en.wikipedia.org/wiki/Image:Primatenskelett-drawing.jpg
Human and Gorilla
• Similar comparisons can be made based on anatomical evidence.
• The skeleton of humans and gorillas are very similar suggesting they shared a recent common ancestor, but very different from the more distantly related woodlouse…
yet all have a common shared characteristic: bilateral symmetry Woodlouse
Evidence (4): Homology
en.wikipedia.org/wiki/Image:Evolution_pl.png
The pentadactyl limb is ancestral to all vertebrates…
but modified for different uses
Evidence (5): Vestigial Structures
en.wikipedia.org/wiki/Image:Illu_vertebral_column.jpg
The coccyx is a vestigial tail
• As evolution progresses, some structures get side-lined as they are not longer of use. These are known as vestigial structures.
• The coccyx is a much reduced version of an ancestral tail, which was formerly adapted to aid balance and climbing.
• Another vestigial structure in humans is the appendix.
Evidence (6): Fossil Record
dinosaurs humansbacteriaorigins
http://en.wikipedia.org/wiki/Geologic_time_scale
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png© World Health Org.
© NASA
complex cells
The fossil record shows a sequence from simple bacteria to more complicated organisms through time and provides the most compelling evidence for evolution.
Evidence (7): Transitional fossils
en.wikipedia.org/wiki/Image:Archaeopteryx_lithographica_paris.JPG
Archaeopteryx
• Many fossils show a clear transition from one species, or group, to another.
• Archaeopteryx was found in Germany in 1861. It share many characteristics with both dinosaurs and birds.
• It provides good evidence that birds arose from dinosaur ancestors
Evidence (8): Geography
evolution.berkeley.edu/evosite/lines/IVCexperiments.shtmlen.wikipedia.org/wiki/Image:Kangaroo_and_joey03.jpg
Marsupials• Geographic spread of organisms also tells of their past evolution.
• Marsupials occur in two populations today in the Americas and Australia.
• This shows the group evolved before the continents drifted apart
Evidence (9): Antibiotic resistance
http://en.wikipedia.org/wiki/Image:Antibiotic_resistance.svgen.wikipedia.org/wiki/Image:Staphylococcus_aureus%2C_50%2C000x%2C_USDA%2C_ARS%2C_EMU.jpg
Staphylococcus• We are all familiar with the way that certain bacteria can become resistant to antibiotics
• This is an example of natural selection in action. The antibiotic acts as an environmental pressure. It weeds out those bacteria with low resistance and only those with high resistance survive to reproduce.
Evolution
commons.wikimedia.org/wiki/Image:Charles_Darwin_1881.jpgcommons.wikimedia.org/wiki/Image:DNA_double_helix_vertikal.PNG
Recommended