DNA Barcoding and Biochemical Profiling of Medicinal Plants of Northern and Desert Areas of...

Preview:

DESCRIPTION

Presented on February 10th, 2013 at the Second Research Competitive Grants Conference in Islamabad, Pakistan.

Citation preview

 

DNA barcoding and biochemical profiling of medicinal plants of Northern and desert areas of Pakistan: Improving socio-economic standard of people of these regions

Principal Investigator: Prof Amer Jamil

Dept of Chemistry and BiochemistryCo-Principal Investigator: Prof Muhammad Ashfaq

Director, Institute of Agricultural and Resource Economics

University of Agriculture, Faisalabad

Core issues Associated with Medicinal Plants

Lack of cultivation; mostly wild collection Inaccurate identification of medicinal plants Substitution or adulteration of the raw ingredients - decreased product’s efficacy - could prove fatal Poor socio-economic condition of the local people

residing around this valuable resource

Threat of losing our native medicinal plant species

Threats to the medicinal plants

1. Habitat degradation2. Poverty

Collection of medicinal herbs without any consideration of their regeneration

3. Negative exploitation– illegal extraction and transport of the plant material to other

regions without any permission

4. Lack of awareness– Not well aware of the modern values of the medicinal plants

and the environmental consequences of loss of biodiversity

PROBLEM STATEMENT

• Biodiversity conservation– A step towards conservation of natural plant resources and endangered

species of this region• Most of the local people of the targeted areas are living

below poverty line – Lack of awareness about actual potential of such valuable resource;

medicinal plants – No ownership

• Many medicinal plants are being used due to health benefits however,– no proper documentation– active ingredients of the plants are mostly unknown

The local people therefore are unable to exploit the valuable resource that exists in their vicinity

HYPOTHESIS

Project will help delivering concrete guidelines to develop implementable policies for conservation of natural resources (medicinal plants), providing ownership of the indigenous material to the local people and strengthening of the rural economies of the targeted regions

Targets to be Achieved During First Six Months

Field Visits for the collection of Medicinal Plants

Flow of Medicinal Plants

Designing of the primers

Optimization of the PCR conditions for DNA

barcoding

Progress During First Six Months of the Project

Selection of Two Regions of Pakistan Covering Northern

and Desert Areas

Main objectives of these visits:

to identify the marketable species of medicinal plants

to check the flow of medicinal plants

to diagnose the problems, facing in performing their activities

to explore pre and post conflict socioeconomic conditions and

their impact on livelihood

Questionnaires Questionnaires were

designed for Farmers,

pickers, shopkeepers and hakeems (herbal medicine practitioners)

Questions concerning the utility of different plants, types of plants, quantity of plants used, mode of purchase, rate of consumption, availability, profit ratio, economic/ market value were asked

Questionnaire for Farmers

Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) Farming Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) Extended Land (kanals)Owned area________ Rented in ________ rented out_________ Shared in_______________Shared out__________ Operational holding____________

Particulars Name of Medicinal Plants

Area ( kanal)A ( )

B ( )

C ( )

Seed QuantityCost (Rs)

Land Preparation(Culti+Sohagas)

No.Cost

Sowing Rs.Hoeing No.

Cost (Rs)Irrigation Type

No.Cost

Fertilizers Type/Qty

Price/bag

Pesticide/Chemicals

Type

Qty

Cost

Harvesting/processing

Cost

Other Costs(Specify)

Output (kg)( Fresh)

Price per kgFresh

Output (kg) (Dry)

Price per kg (Dry)

Sowing and harvesting time

Type Family labour Hired labour Permanent labour

Working hours

Value of family labour

Working hours

Wages per Day

Working hour

Monthly Wages

MenWomen Childrenother

Labor Cost

To whom do you sell?i) Assembler/shopkeeper ii) Medicinal companies iii) Collector iv) Hakim v) others (Specify)_______In which form you sell?•Fresh ii) Dry iii) other ( Specify) _______What problems you face during Production/Marketing etc of product? (Specify) What solutions you suggest to resolve these problems? (Specify)

Questionnaire for Picker (Collector)

Family labour No. of hours for collection (per month)

How many days spent in a year

Men

Women

Children

Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) picking Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) ExtendedWhat types of plants you collect (Name)?1 ____________ 2 _____________ 3 ____________ 4 ____________ 5 _______From where you collect? 1) Private farms 2) Naturally grown 3) others (specify) _______

In which form do you sell the plants?•Fresh ii) Dry iii) After processing iv) other (Specify) …………….What is over time population of these plants?•Increasing ii) Decreasing iii) SameIf decreasing, give reasons;i…………………………………………ii)………………………………………….To whom do you sell the plants?i) Hakim ii) Assembler/shopkeeper iii) Send other cities iv) Consumer v) Others ( Specify)……. Price per kg received for different plants? i)___________ ii) ______________ iii) _____________ iv) ____________ v) _______What is total quantity you sell in a year (Kgs)i)___________ ii) ______________ iii) _____________ iv) ____________ v) _______Have you any other business (job)? Yes _______, No_______, if Yes (Specify)_______Income per month from the job________________ Income of family from all sources………….Rs/monthWhat problems you face during Selling/Collection? (Specify) What solutions you suggest to resolve these problems? Time of picking for different plants1 ____________ 2 _____________ 3 ____________ 4 ____________ 5 _______

Questionnaire for Assembler (Shopkeeper)

Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) Assembling Experience________ (Years) Schooling Years_______ Family Members__________ Family type: i) Nuclear ii) Joint iii) ExtendedWhat types of plants you Assemble?1 _______ 2 _______ 3 _______ 4 _______ 5 _______From where you purchase? i) Collector ii) private farm iii) other (Specify) _______What is your mode of purchase?i) Go yourself ii) People Come to Sell iii) Hired Collectors iv) Other (Specify) _______ What price per kg you pay for different plants?•_____________ ii) ___________ iii) _____________ iv) ___________ v) _______

Ownership of shop? Yes……………..No……………, if No then rent of shop…………./month No. of employees ………….. Salaries of employees ……………….. (Rs/month)Chowkidar charges …………..(Rs/month)Avg. Electricity bill ………….(Rs/month), Ave. phone bill ………….(Rs/month)Other costs………………..(Rs/month)In which form do you sell?•Fresh ii) Dry iii) After processing iv) other ( Specify) _______To whom do you sell?i) Hakim ii) Medicinal companies iii) export iv) Consumer v) other (Specify) _______ Per kg selling price of these plants?i) ______________ ii) _____________ iii) ______________ iv) ____________ v) _______If other business is also carried out, what is % of medicinal plant to total business ……….. What is your perception about the population of these plants?•Increasing ii) Decreasing iii) SameIf decreasing, give reasons;Is it your full time job? Yes _______, No _______ if No Then what is your other Business (Job)? (Specify) _______Income from other business______________ (Rs/month) What problems you face during Selling/Purchasing etc? (Specify) What solutions you suggest to resolve these problems? (Specify)

Questionnaire For Hakim (The herbal medicine practitioner)

Name_____________Village_____________Tehsils_____________District________________Age_______ (Years) Hikmat Experience________ (Years) Schooling Years_______ What type of plants you Purchase from local market (top 5)?i) _________________ ii) ______________ iii) _____________ iv) ________ v) ________Source?•Collector ii) Shopkeeper/Retailer iii) Other (Specify) _________________What price per kg you pay for different plants (Top 5)? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______ Quantity of plants ( kg) used per month?i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______Price of one unit of medicine you charge from customer? i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______ Most common diseases cured by these plants?i) _____________ ii) _____________ iii) ____________ iv) ___________ v) _______

Ownership of shop? Yes……………..No……………, if No then rent of shop…………./month No. of employees ………….. Salaries of employees ……………….. (Rs/month)Chowkidar charges …………..(Rs/month)Avg. Electricity bill ………….(Rs/month), Ave. phone bill ………….(Rs/month)Other costs………………..(Rs/month)Total sale of shop (Income of Hikmat)…………………….(Rs/month) What problems you face during Selling/Purchasing of these local medicinal plants? (Specify)

What solutions you suggest to resolve these problems? (Specify)

Visit to Northern AreaDate News Headlines

4 April,

2012

At least 14 people were killed and over 50 others injured in sectarian violence in Gilgit-Baltistan region of northern Pakistan

9 April,

2012

PAF evacuates 120 foreigners trapped in Giglit-Baltistan curfew

16 Aug,

2012 

DIG Gilgit Ali Sher confirmed the attack on passengers and killing of about 20 passengers in the attack of armed terrorists near at Gilgit. 

17 Aug, 2012 

[News] Killing People of Giglit-Baltistan – Another Dark DayThis is the second time in a span of three months, Armed terrorist of Taliban killed 43 people from Gilgit-Baltistan on the basis of sectarian affiliations.

18 Aug, 2012

Two truck drivers killed in Chalt Hunza Nagar

23 Aug, 2012 

Gilgit Under Curfew:Gilgit (Monitoring Desk): In the post FC man killing and reported abductions of Truck drivers in various parts of Giglit-Baltistan, and due to the tense environment the law enforcement agencies have imposed an unannounced curfew in Giglit-City. It has caused sever problem form many people who where visiting for many important official and business related tasks to the Capital City of Gilgit.

28 Aug, 2012 

Two men including a policeman were killed and another was injured in shootings in the restive town of Gilgit on Saturday.

28 Aug, 2012 

Criminals running toward GB: Interior Minister Rehman Malik

07 Sep, 2012

Aug 16: Terrorists ambushed four buses, pulled out the passengers and shot at least 19 of them dead in the Babusar Top area of Mansehra district on Thursday.“More than 50 terrorists wearing commando uniform intercepted a convoy going from Rawalpindi to Gilgit-Baltistan before 7am, hauled off passengers from four vans, identified them through their national identity cards and shot 19 of them dead,” District Coordination Officer Dr Amber Ali Khan said

07 Sep, 2012

Gilgit Baltistan Legislative Assembly in a unanimous resolution on Tuesday condemned the recent terrorist attacks killing innocent people

12 Dec, 2012

Terror attacks increased in GB:Advocate Yawar was seriously injured at Domail locality, after attacked by a hand-grenade

12 Dec, 2012

Violence in Gilgit: two killed several injured

The Northern region included Gilgit-Baltistan.

Switched to Swat Valley due to Security reasons as the contact person in GB did not recommend the visit at that time.

Visit to Swat

Collection, Photography and Preservation of Medicinal Plants

More than 50 fresh medicinal plants were collected from the Swat valley

About 35 dry Medicinal Plant Parts were also collected

Special thanks to Dr Hassan Sher for providing help

Diagrammatic Representation of Medicinal Plants’ Flow in the Swat Valley

Picker/ Collectors

Shopkeeper Middlemen

Consumers Pansaars Traders

Pharma and other Industries

Hakeems Export

Sr. No Name Parts Collected1 Buntal (Impatiens glandulifera) Seeds2 Khakshir Seeds3 Onion Seeds4 Rehan Seeds5 Tudari Surkh Seeds6 Kehoon Seeds7 Methi Seeds8 Serala Seeds9 Smaq dana Seeds

10 Kasoos Seeds11 Curfus Seeds12 Persosha Weeds13 Aconitum heterophyllum Weeds14 Guchi (Mushroom) Weeds15 Anjabaar Weeds16 Kakora Weeds17 Kabab e khaddan Weeds18 Berg e Bensa Weeds19 Dar e hild/ Darishk/ Zarishka/ Kornay Weeds20 Ephedra Weeds21 Damasa Weeds22 Gidder tobacco Weeds23 Gul e banafsha Weeds24 Noor Alum/ Shakakal Weeds25 Zakhm e hayat Weeds26 Gul e Tesu Weeds27 Discoria Weeds28 Mamekh Weeds29 Mater Jer (Roots) Weeds30 Mushk e Bala/ Asaroon Weeds31 Kuth Weeds32 Ratan Jo Weeds33 Mushk e bala Weeds34 Afsateeen/ Arae Weeds35 Materikeria Weeds

List of Medicinal Plants (in Dry Form) collected from Swat valley

Medicinal Plants from Swat

Visit to desert area (Cholistan desert)

Yazman, Channer Pir and Derawer fort were visited

About 50 medicinal plants were collected

Special thanks to Cholistan Institute of Desert Studies for providing help during the visit

Medicinal Plants collection from the Cholistan desert

S. No. Botanical Name Common Name

1 Acacia ampliceps  

2 Acacia nilotica  

3 Capparis decidua Karir

4 Cenchrus biflorus  

5 Cenchrus ciliaris  

6 Cymbopogon jwarancusa Khawi

7 Ficus benghalensis  

8 Ficus religiosa  

9 Panicum turgidum  

10 Sporobolus violadas  

11 Vetiveria zizanioides Dhaman

Seeds of medicinal plants collected from the Cholistan desert

Sr No Botanical Name Common Name Medicinal Use, if known

1 Suaeda fruticosa Kali Lani  

2 Salsola foetida Lani  

3 Haloxylon salicornicum Lana  

4 Crotalaria burhia Chag  

5 Haloxylon recurvum Khar Treatment of intestinal ulcer

6 Fagonia cretica Dhamasha  

7 Dipterygium glaucum Thuma  

8 Cenchrus prorate Durban  

9 Leptadenia pyrotechnica Khip  

10 Calotropis procera Ak Against inflammation, snake bite, digestive tract infections, etc

11 Cymbopogon jwarancusa Khavi To treat cough and as blood purifier

12 Capparis decidua Karir Against rheumatism, pain and wounds

13 Aerva javanica Bui-Kaltan Against diarrhea and haematuria in cattle

14 Tamarix dioica Lai  

15 Calligonum polygonoides Phog  

16 Prosopis cineraria Jandi/Kandi Treatment of rheumatism in animals

Medicinal Plants (Fresh) collected from the Cholistan Desert

• The local collectors provide the desert medicinal plants to the wholesale dealers and hakims at a very cost because of lack of awareness about the importance of medicinal plants.

• No market is available for the sale/purchase of medicinal plants.

• No policy by the Provisional or Federal Government exists regarding Pricing, Selling, Purchasing, Marketing, Distribution, Export and Sustainability of medicinal plants found naturally in Cholistan desert.

• Cholistan Institute of Desert Studies (CIDS) has taken some initiative to make the farmers, collectors and Hakims aware of the importance of the medicinal plants.

Preservation of medicinal plants

Visit to the market of medicinal plants in Lahore

Central Market of Pakistan for selling/purchase/ export of the Medicinal Plants

Usually peoples were reluctant to answers, they were afraid because they were considering as tax officer

After detailed introduction and showing the visiting cards and ID card, some of them agreed and Few gave information due to references

Suspicions prevailing in the market

A few plants have been discovered recently with antidiabetic and/or anticancer potential. Price is up to Rs. 4000/kg, but are exported without acknowledging their real value; there is no export policy.

Wholesalers Name Name of plants (they deal)

Locality of M. Plants

Comments

1.Shakoor Sahib(Papar Market)

Banafsha, Reetha,Brooza, Koor, Bhman Surkh, Puth Patri, Malathi, etc.

Swat Valley > No Adulteration in Swat Traders> Adulteration is here>If we go there (e,g in Swat, etc) our bargaining power becomes weak

2.Mr. Naeem(Paper Mandi)

Banafsha Jungles/ Mountains > Majority of the traders about 150 in are working in Akbari Mandi while only 35-40 in Papar Mandi

3.Mr Asif(Papar Mandi)

6-7 Major Plants From Local market and resell to Retailer/ Processor

>Incredible margins exist due to lack of price Policy

4.Mr. Shahbaz (Akbari Mandi)

Matar Jarri (Doodh Bacha), Asheesh

From different Localities

> In Akbari Mandi genuine traders of M. Plants are only 25-30 (Out of 150); Rest are doing mix business of karyana and medicinal plants> There is no export policy or price system> Hamdard, Marhaba, Ajmal, Hakeems, etc purchase to use

5.Wahab Traders (Akbar Mandi)

5-6 Medicinal Plants Export from local market as well as from Swat

D-S based price system

An overview of visit to Medicinal Plant Market in Lahore

DNA Barcoding Discriminatory power

Low intra-species variability

Species level genetic variability

Short sequence length: 400-800

Universality

Collection of Specimens (Leaves, roots, shoots or flowers of medicinal plants)

DNA isolation

Amplification of selected DNA regions by PCR

(ITS2 of nuclear genome; matK, psbA-trnH, rbcL of cpDNA)

Sequencing of amplified products

(Sanger Method)

Sequencing matching & alignment

(BLAST and Reference database of NCBI)

Omitted step; replaced with an advanced method: Phire Plant Direct PCR kit (Thermo Scientific)

Species identification & Phylogenetic study

(various bioinfomatics tools)

DNA Barcoding and Conservation of Plant Biodiversity

A standardized library of barcodes will enable

- identification of rare, native or invasive, endangered species- systematic and conservation-based studies- track ancient divergences between basal lineages- trace organism's evolutionary history and systematic/taxonomic relationships

Authentication of the status of our biodiversity

Adulterated herbal medicinal materials

Establish the evolutionary links of the plant species that are

missing at the moment

DNA barcoding analysis Primers designing and optimization of PCR conditions

Selection of four genes ITS, rbcL, trnH-psbA, and matK

Primers’ detail used for DNA barcoding studies

S. No. Primer Name SequenceAmplicon length

(bp)

1.   ITS 5F 5′GGAAGTAAAAGTCGTAACAAGG 700

2.   ITS 4R 5′TCCTCCGCTTATTGATATGC 700

3.   rbcL 1f 5′ATGTCACCACAAACAGAAAC 750

4.   rbcL 724r 5′TCGCATGTACCTGCAGTAGC 750

5.   trnH-psbA psbAF 5′GTTATGCATGAACGTAATGCTC 400-600

6.   trnH-psbA trnH2 5′CGCGCATGGTGGATTCACAATCC 400-600

7.   matK 390F 5′CGATCTATTCATTCAATATTTC 850

8.   matK 1326R 5′TCTAGCACACGAAAGTCGAAGT 850

*Annealing temperatures: ITS 51 oC, rbcL 56 oC, trnH-psbA 55 oC, matK 52 oC

PCR conditions for different regions of DNA from the Plants

Agarose gel for amplified fragments after PCR. Lane 1 ITS, Lane 2 rbcL, Lane 3 DNA ladder, Lane 5 trnH-psbA, Lane 7 matK1

PCR reaction Cycling Protocol

Component 25 µL reaction Cycle step3 step protocol

CyclesTemp. Time

H2O 9.5 µLInitial

denaturation98 ˚C 5 min

1

Phire plant PCR buffer 12.5 µL

Denaturation 98 ˚C 5 sec

30Annealing Variable* 1 minExtension 72 ˚C 1 min

Primer F and Primer R 1.3 µL each Final Extension 72 ˚C 7 min

1DNA polymerase 0.5 µL

Seed sample 0.5 mm punch

Conclusions

~100 plants collected and preserved from both the regions; another visit will be made to the desert area during March (best season) for further collection of the plants and in May to the Swat valley.

No valid price system for the sale/purchase of the medicinal plants was found in the main markets.

Wholesalers buy the medicinal plants from different collectors at a very low rate and sell in bulk amount at higher rates to the bigger markets.

The PCR based method for DNA barcoding is optimized and ready to be applied on the medicinal plants.

Conclusion….continued

It was noted that the local people could not exploit the medicinal plants due to the following reasons:

• Lack of awareness regarding time of harvesting of the medicinal plants

• Roots and/or shoots that are grazed and collected for medicinal purpose are a threat for their regeneration

• Lack of skills for using medicinal plants as economic opportunity

• Lack of knowledge about the marketing of available medicinal plants species

Conclusion….continued

• Poor management of medicinal plants such as uncontrolled and unsystematic grazing, improper harvesting and mismanagement

• Pickers suffer the problems including low price paid by dealers, lack of appropriate tools and equipments, etc., as well as no proper market for sale.

Work in progress/future work

Identification of the unidentified plants by a taxonomist

Amplification of the desired DNA sequences from the

collected medicinal plants followed by sequencing and

phylogenetic analysis

Detailed socio-economic analyses of the regions with

respect to the medicinal plants

Biochemical analysis on selected plants of both the regions

to assess their real economic importance and value

Organization of awareness workshops in both the regions

Development of policy guidelines for implementation in

the regions for conservation of medicinal plants and

improving economic condition of the local people

Documentation of medicinal plants on molecular basis is necessary for conservation of biodiversity, and to provide ownership of the important plants to the respective region, ultimately leading to improve the socio-economic condition of the neglected communities

THANK YOU…

Recommended