View
6
Download
0
Category
Preview:
Citation preview
8/25/2017
1
Chapter 6 DNA: The Molecule of Life:
• 6.1 DNA intro
• 6.2 DNA replication
• 6.3 DNA directs the production of
proteins
• 6.4 Flow from DNA to RNA to
protein
• 6.5 Transcription
• 6.6 Translation part one
• 6.7 Translation part two
• 6.8 Gene expression regulation
• 6.9 Signal transduction
• 6.10 Mutations effects
© 2017 Pearson Education, Inc.
• 6.11 Cancer part one
• 6.12 Cancer part two
• 6.13 Genetic engineering
• 6.14 DNA manipulation
• 6.15 Genetically modified organisms
• 6.16 PCR
• 6.17 DNA profiles
• 6.18 Genome mapping
• 6.19 Gene therapy
6.1 Opening Questions: What molecule
holds the instructions for living things?
Aquatic Algae
Protist
Elephant
CaterpillarMushroom
Flower Human
Do these organisms all share the same
genetic code? Explain.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.1 DNA is the molecule that holds the
instructions for all living things.
• DNA is shorthand for
Deoxyribose Nucleic Acid
• A DNA molecule is a
double helix with two
strands made up of a long
string of nucleotides.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.1 Each nucleotide consists of a sugar,
a phosphate, and a base.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.1 In a DNA molecule there are four bases
with specific pairing rules.
• Adenine (A) can
only bond with
thymine (T).
• Guanine (G) can
only bond with
cytosine (C).A - T
C - G
Each strand of DNA
in a double helix is
complementary.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.2 Opening Questions: Can you build a
DNA molecule?
• In a DNA double helix,
adenine (A) can only
bond with thymine (T)
and guanine (G) can only
bond with cytosine (C).
• Given a half strand of
DNA, build the other
strand.
A • ?
T • ?
C • ?
A • ?
C • ?
G • ?
C • ?
T
A
G
T
G
C
G
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
2
6.2 What makes DNA a great molecule for
hereditary information?
• DNA strands are complementary!
– If you know ½ of the molecule, you can build
the other.
• To replicate, the DNA molecule unzips.
• Each strand serves as a template to build
a new strand following the base-pairing
rules.
Genetic instructions are passed
down via DNA replication.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.2 During DNA replication, a cell duplicates
its chromosomes.
• New DNA molecules
are made up of one
of the original
parental strands
plus a new half.
• As a result, DNA
replication is called
semi-conservative.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.2 The process of DNA replication:
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.3 Opening Questions: True or false?
• True or false. DNA codes for all the information
needed to make up an organism uses only four
building blocks (A,T,C,G).
• True or false. All the DNA molecules in your
body put end to end would reach from the Earth
to the Sun and back over 600 times.
• True or false. Typing 60 words per minute, eight
hours a day, it would take about 50 years to type
the human genome.
• True or false. Humans and bananas share
about 50% common DNA.
All true!Chapter Table of Contents© 2017 Pearson Education, Inc.
6.3 DNA directs the production of proteins
via an intermediate molecule of RNA.
• RNA is also a nucleic acid (like DNA):
Ribonucleic Acid
• RNA has three major differences:
1. It is single-stranded (not a helix)
2. Sugar in RNA is ribose.
3. Thymine (T) is replaced by
uracil (U).
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.3 DNA holds information on how to
produce proteins.
• DNA is able to act as the molecule of heredity because it can direct the production of proteins.
• DNA first directs the production of RNA, which in turn controls the manufacture of proteins.
• Proteins then perform the majority of cellular functions and control physical traits.
DNA
RNA
Proteins
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
3
6.3 The flow of genetic information.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.4 Opening Questions: How does DNA
make brown eyes?
• What color are your eyes?
• What color are your neighbor’s eyes?
• How might your DNA instructions for eye
color vary from your neighbor’s?
• How are the instructions in DNA turned
into the physical pigment in your eye?
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.4 Genetic information flows from DNA to
RNA to protein in two steps.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.4 Transcription rewrites the DNA code
into RNA, which then leaves the nucleus.
• Transcription follows
the DNA base-pairing
rules with one
exception:
– Uracil (U) is used
instead of thymine (T).
• The molecule that
results from transcription
is called messenger RNA (mRNA).
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.4 In translation, the RNA molecule serves
as instructions for making a protein.
• At the ribosomes in the cytoplasm, each
mRNA codon is translated into an amino
acid to build a protein.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.5 Opening Questions: What is a gene?
• How would you define a gene?
• Write your answer down and then share it
with your neighbor.
• Are your answers the same?
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
4
6.5 Transcription creates a molecule of
RNA from a molecule of DNA.
• During transcription,
the DNA double
helix separates.
• One strand of DNA
is used to generate
a molecule of RNA.
• The RNA is processed to become
messenger RNA, which then exits the
nucleus via a nuclear pore.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.5 Steps of transcription:
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.5 Review Question: What is a gene?
• There is no simple, agreed-upon definition
that accurately describes all known genes.
– Is it a stretch of DNA?
– Does it produce a protein?
– What if a protein is made from two different
genes?
• As we study the genome, it actually becomes
harder to find one definition.
• For now, we can define a gene as a discrete
unit of hereditary information consisting of a
specific nucleotide sequence in DNA.Chapter Table of Contents© 2017 Pearson Education, Inc.
6.6 Opening Questions: DNA and you.
• Would you get a personal DNA
test if you could?
– Why or why not?
• Would you get a personal DNA
test before you had a baby?
– Why or why not?
• Should we run personal DNA
tests on newborn babies?
– Why or why not?
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.6 Translation involves three kinds of
RNA: rRNA, mRNA, and tRNA.
• Translation of the mRNA takes place in
the cytoplasm within ribosomes.
• Ribosomes are made from proteins and
ribosomal RNA (rRNA).
• Transfer RNA (tRNA) molecules carry
amino acids to the ribosome.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.6 Within each ribosomes are binding
sites for the mRNA and for tRNA.
• One end of a tRNA has an anticodon that
matches up with the mRNA.
• The other end holds an amino acid.
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
5
6.6 The genetic code uses triplet codons.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.7 Opening Questions: Can you translate
the genetic code?
• What amino acid would be produced from
an mRNA with the sequence:
AUG-ACU-AAA-GAG-UCA-UAA
Hint: Use your genetic code table!
Met-Thr-Asn-Glu-SerChapter Table of Contents© 2017 Pearson Education, Inc.
6.7 Translation creates a molecule of
protein via the genetic code.
• Translation is divided
into three phases:
– Initiation
– Elongation
– Termination
• Translation begins when two subunits of a
ribosome assemble on an mRNA.
• A tRNA then brings in amino acids that
match the codon in the mRNA.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.7 Translation results in a polypeptide.
• Elongation continues until the ribosome reaches a stop codon on the mRNA.
• The ribosome machinery then disassembles.
• The completed polypeptide is now available to be used or modified by the cell into a functioning protein. Amino acid
Polypeptide
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.8 Opening Questions: Are you your
genes?
• What are ways your physical or behavioral
traits might be influenced by your genes,
your environment, or both?
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.8 Gene expression, the production of
proteins, is regulated in several ways.
• Gene regulation is the process of turning
genes on and off.
• Different cell types express different
genes.
– For example, not all cells need lactase
(an enzyme that digests milk).
In what cell types would you expect
lactase gene expression?
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
6
6.8 X-chromosome inactivation is an
extreme case of gene regulation.
• In female mammals, one X chromosome
in each body cell is highly compacted and
almost entirely inactive.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.8 There are several points along the path
from DNA to protein that can be regulated.
1. Special transcription factors must bind
to DNA to “turn on” transcription.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.8 After transcription, the RNA may be
altered in several ways.
2. Before leaving the nucleus, the RNA is
modified:
– A cap and tail are added.
– Non-coding introns may be removed.
– Protein-coding exons may be rearranged.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.8 Translation offers more opportunities
for gene regulation.
3. The cell can control the
following:
– Whether translation proceeds
– How proteins are modified
after translation
– When proteins are broken
down
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.9 Opening Questions: Are all your cells
the same?
• All the cells in your body contain the same
DNA. But do all the cells make the same
proteins?
• How might the following cell types differ in
the functions of proteins produced? How
might they be similar?
– Liver cell
– Brain cell
– Stomach cell
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.9 Cell-to-cell communication can control
gene expression.
• Multicellular life depends on
cell-to-cell signaling.
• Molecules exit one cell and
bind to a receptor protein on
the outside of another cell.
• This binding triggers a signal
transduction pathway.
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
7
6.9 A signal from another cell can regulate
genes (turn on or off) in the receiving cell.
Signal molecule
from another cell
Chapter Table of Contents© 2017 Pearson Education, Inc.
Gene regulation
New protein made
6.9 Cell-to-cell communication is
particularly important in a developing
embryo.
• Development involves frequent cell
division (to increase body size) that must
be carefully coordinated.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.9 Cell-to-cell communication is
particularly important in a developing
embryo.
• Inductive signals can cause cells to change
shape, migrate, or even destroy other cells.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.9 Cell-to-cell communication is particularly
important in a developing embryo.
• Homeotic genes are master control genes; they
direct the location of the head and body parts.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.10 Opening Questions: What difference
does a letter make?
• We only will make sentences with three-letter words
(triplet). Start with the sentence:
THE CAT ATE THE RAT
• Change one letter (R to H):
THE CAT ATE THE HAT
• Delete letter C and move everything over:
THE ATA TET HER AT
• Add a letter B in the sixth letter place:
THE CAB TAT ETH ERA T
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.10 A mutation is any change in the
nucleotide sequence of DNA.
• Replacing, deleting, or adding a nucleotide
base can have a wide range of effects.
• Mutations are the raw material of evolution
by natural selection.
• However, most mutations are harmful.
What might happen to the protein product
if there is a change in the nucleotide
sequence?
Chapter Table of Contents© 2017 Pearson Education, Inc.
8/25/2017
8
6.10 Mutations in DNA can change the
protein produced.
• Mutations can be:
– Spontaneous
– Induced by mutagens
• High-energy radiation
• Chemicals
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.10 Point mutations occur at a single
nucleotide.
ACA
ACG
UGU CYSTEINE
TCA
UGC CYSTEINE
ACT
AGU SERINE
UGA STOP
DNA RNA Amino Acid
No mutation:
Silent mutation:
Missense:
Nonsense:
Point mutations can have varying effects.
Chapter Table of Contents© 2017 Pearson Education, Inc.
6.10 Frameshift mutations are due to the
addition or deletion of a nucleotide.
Frameshift mutations often result in different
or defective proteins.
Chapter Table of Contents© 2017 Pearson Education, Inc.
Added A
6.11 Opening Questions: What do you
know about cancer?
• List three things you know about cancer.
• List something you want to know about
cancer.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.11 Loss of gene expression control can
result in cancer.
• Mutations can lead to a mass of body cells growing out of control, a tumor.
• If a tumor spreads to other tissues, the
person is said to have cancer.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.11 Genes regulate the cell cycle.
• A cell cycle control system regulates the
timing of cell duplication.
• A proto-oncogene codes for proteins that
tell the cell when to duplicate.
STOPGO
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
9
6.11 Mutations in regulator genes can lead
to an overgrowth of cells.
• A mutated proto-oncogene fails to regulate
cell division and is called an oncogene.
??Cancer is caused by out-of-control cell growth due
to a breakdown of the cell cycle control system.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.11 Cancer can occur when proto-
oncogenes are mutated to oncogenes.
• A mutation in a growth factor
gene can produce a hyperactive
protein that promotes
unnecessary cell division.
• A mutation that deactivates a
tumor suppressor gene may
result in uncontrolled growth.STOP
GO!
XMutations may result in proteins that either don’t stop the cell cycle or stimulate growth.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.12 Opening Questions: What is cancer?
• Imagine your cousin has just texted that
your aunt has just been diagnosed with
cancer.
• Your cousin knows you are taking a
biology course, so she asks, “What is
cancer?”
• Send a text explaining how we define
cancer.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.12 Cancer is the result of unregulated cell
growth that is out of control.
• Cancer begins within a single cell when
proto-oncogenes mutate into oncogenes.
© 2017 Pearson Education, Inc. Chapter Table of Contents
A benign tumor- No spreading
A malignant tumor- Spreading
6.12 A tumor is an abnormally growing
mass of body cells.
• The spread of cancer cells in the body is
called metastasis.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.12 There are several ways to treat cancer.
Surgery can
remove a tumor.
Radiation can
disrupt cell
division locally.
Chemotherapy
drugs can disrupt
cell division
throughout the
body.
What might happen to your
normally dividing cells?© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
10
6.12 There are ways to reduce cancer risk.
Healthy diet Exercise
Sun
protection
Not
smoking
Regular
screenings
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.13 Opening Questions: True or false?
• True or false. You can pay to save a sample of
your dog’s or cat’s DNA for future cloning.
• True or false. Condo associations can use DNA
to identify the proper owner of a poop sample.
• True or false. Some of us are carrying
Neanderthal DNA.
• True or false. The U.S. Supreme Court has ruled
police can take DNA upon arrest.
• True or false. DNA-based computers may one
day hold more data than our fastest server today.
All true! © 2017 Pearson Education, Inc. Chapter Table of Contents
6.13 DNA can be mixed and matched.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.13 DNA can be mixed and matched.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.13 Genetic engineering involves
manipulating DNA for practical purposes.
Biotechnology
is the manipulation
of organisms or
their components
to make useful
products.
DNA technology
is a set of methods
for studying and
manipulating
genetic material.
Genetic
engineering
is the direct
manipulation of
genes for practical
purposes.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.13 Gene cloning is an example of genetic
engineering.
• How can we produce
large quantities of a
protein (such as
human insulin)?
• We can insert DNA
into bacteria and
have them do the
work.PLASMID
A small circular DNA molecule
that replicates separately from
the much larger bacterial
chromosome. (The plasmid
is not drawn to scale here.)
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
11
6.13 Cutting and pasting DNA is an
important step in genetic engineering.
• Restriction enzymes
are proteins that
cut DNA at specific
nucleotide sequences.
• The resulting fragments
are called restriction
fragments.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 Opening Questions: Who owns
genes? (Part 1)
Real-World Case Study: In the 1990s a private
company discovered a set of genes associated
with an increased risk of breast and ovarian
cancers (BRCA1 and BRCA2). They received a
patent for the genes. The company earned
hundreds of millions of dollars, but the cost of
testing was out of reach for many patients.
In June 2013 the U.S. Supreme Court heard the
case about if genetic tests can be patented.
What are some pros and cons of
patenting genetic tests?
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 Opening Questions: Who owns
genes? (Part 2)
• In June 2013, the Supreme
Court’s ruling opinion was that
“a naturally occurring DNA
segment is a product of nature
and not patent eligible merely
because it has been isolated.”
What do you think are some
implications of the Supreme
Court ruling?
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 DNA may be manipulated many ways
within the laboratory.
• Scientists can now answer questions and
solve problems by manipulating DNA.
• Let’s explore some of the tools in the
genetic engineering toolbox.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 DNA can be isolated from a cell and
put into a genomic library.
• A genomic library is a collection of cloned DNA fragments that includes an organism’s entire genome.
• Once created, a genomic library can be used to hunt for and manipulate any gene from the starting organism.
This collection of bacteria
constitutes a genomic
library that can be used
for later experiments.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 DNA can be visualized using nucleic
acid probes.
• In order to find a gene of interest, a researcher can use a nucleic acid probe.
• A complementary molecule made using radioactive or fluorescent building blocks will bind with DNA.
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
12
6.14 DNA can be synthesized from scratch.
• An automated DNA synthesizer machine
can quickly and accurately produce
customized DNA molecules up to lengths
of a few hundred nucleotides.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.14 DNA produced from a cell’s mRNA
• Reverse transcriptase can synthesize
DNA from the mRNAs within the cell.
• The result is complementary DNA
(cDNA) representing the genes that were
being transcribed in the cell at the time.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.15 Opening Questions: What is a GMO?
• Have you ever eaten a genetically
modified organism (GMO)? If yes,
describe what you’ve eaten.
• Write down a question that you have about
GMOs.
• Share your question with your neighbor.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.15 Plants and animals can be genetically
modified.
• Genetically modified organisms
(GMOs) are ones that have acquired one
or more genes by artificial means.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.15 GM plant crops currently make up a
significant part of our food supply.
Bt corn has been
genetically
modified to
express a protein
that acts as
an insecticide,
Hawaii papaya
is genetically
engineered to be
resistant to the
ring-spot virus.
Golden rice is a
transgenic variety,
created with genes
that produce beta-
carotene.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.15 GM animals are not part of our food
supply (yet), but do have other uses.
• Pharmaceutical
companies have
produced various GM
animals that produce
drugs.
• The FDA (Food and Drug Administration)
is considering approval for the first GM
food, a fast-growing transgenic salmon.
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
13
6.15 Pros and cons of GMOs
PROS CONS
Complete the comparison table:
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.16 Opening Questions: What role should
DNA play in the criminal process?
• Should DNA testing of evidence be mandatory?
• Who should pay for DNA testing in trials?
• What do you think is the responsibility of the state
for old cases? Explain.
Real-World Case Study: In 2013, a Texas man convicted in
a 1981 stabbing death was freed by DNA evidence after
serving 29 years in prison. In the original crime, the victim’s
abandoned car was found with several pieces of evidence,
including a black hairnet. In 2011, hair samples preserved
for three decades underwent DNA testing and linked the
samples to someone else. Randolph Arledge’s conviction
was overturned.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.16 Polymerase chain reaction (PCR)
copies target DNA quickly and precisely.
• Heating splits apart DNA helix
into two complementary strands.
• A heat-stable DNA polymerase
(enzyme that synthesizes DNA)
is used to build new strands.
• Billions of gene copies are
generated in just a few hours.
Using PCR, one drop of blood can
provide enough DNA for analysis.© 2017 Pearson Education, Inc. Chapter Table of Contents
6.16 PCR involves cycles of heating and
cooling.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.16 PCR is generally used to amplify one
region of DNA.
• Primers (short, single strands of DNA)
bind to the start and end points of the
segment of DNA being amplified.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.17 Opening Questions: Is your DNA
showing?
• If you knowingly (or unknowingly) provide a DNA
sample, who should have access?
– You?
– Doctor?
– Insurance company?
– Police department?
– Spouse?
– Girlfriend/boyfriend?
Rank the above by their level of access.
Who else would you include or deny?© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
14
6.17 DNA profiling can prove a match
between two samples.
• Imagine that you have a
sample of DNA from a
crime scene and a second
sample from a suspect.
• How can you prove they
match?
• Entire genome matching is
impractical, but we can
compare regions of DNA.
What can be
learned with
just a drop of
blood?
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.17 DNA profilers focus on specific sites
that are known to vary considerably.
• Scattered throughout the genome are
short tandem repeats (STRs) sites.
• At each STR site, a four-nucleotide
sequence is repeated many times in a
row. For example:
AGATAGATAGATAGATAGAT
• The number of repeats varies widely within
the human population.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.17 STR analysis compares 13 sites within
the human genome.
• These sites vary so
widely that no two
humans have ever had
the same number of
repeats at all 13 sites
(except identical
twins).
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.17 Follow a crime scene blood drop.
• STR analysis can determine if the sample
matches the suspect.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.17 Gel electrophoresis provides
comparison of DNA samples.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.18 Opening Questions: What can we learn
from the entire genome?
• In the 1990s, scientists set out on a quest
to map the entire set of human genes.
• This quest was a huge undertaking.
What are at least three things we might be able to learn with knowledge of all the genes in the human genome?
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
15
6.18 Whole genomes can be sequenced
and mapped.
• In 1995, a team of biologists announced
they had determined the DNA sequence of
the entire genome of Haemophilus
influenzae, a disease-causing bacterium.
• This marked the first successful
experiment in genomics, the science of
studying the complete sets of genes
(genomes) and their interactions.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.18 The Human Genome Project was
completed in 2003.
• The human genome
contains 21,000 genes
that encode for 100,000
different proteins.
• The data are providing
insight into development,
evolution, and many
diseases.
Human Genome Facts
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.18 Genome mapping involved several
separate techniques.
• The set of techniques used to sequence
an entire genome from an organism is
called the whole-genome shotgun
method.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.18 The field of proteomics examines the
proteins encoded by a genome.
• The number of
proteins in humans
vastly exceeds the
number of genes.
• Understanding
proteins and their
tasks is at the
forefront of
biological research.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.19 Opening Questions: Can we fix genes?
• From what you’ve learned about DNA and
genetic information, do you think it is
possible to “fix” someone’s genes?
• Several diseases are the result of a single
gene mutation.
• How can we fix genes?
• What might be some benefits?
• What might be some risks?
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.19 Gene therapy aims to cure genetic
diseases.
• Gene therapy is the alteration of a
person’s genes in order to treat or cure a
disease by inserting the “correct” DNA into
the cell.
• As you can imagine, the easiest disorders
to “fix” are those with a single defective
gene.
© 2017 Pearson Education, Inc. Chapter Table of Contents
8/25/2017
16
6.19 Gene therapy aims to cure genetic
diseases.
1. Gene therapy
begins with isolation
of the normal gene
from a healthy
person.
2. Enzymes are used
to produce an RNA
version of the target
DNA gene.
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.19 Gene therapy aims to cure genetic
diseases.
3. The RNA gene is
combined with an
infectious, but
harmless, retrovirus.
4. The virus is used to
infect a patient’s bone
marrow cells,
transferring the proper
gene to a diseased
individual.
A genetically engineered
bone marrow cell carrying
the correct version of the
gene
© 2017 Pearson Education, Inc. Chapter Table of Contents
6.19 Gene therapy in practice
• Gene therapy has
been used to treat a
disease caused by a
defect in the genes of
the immune system.
• Some children were
cured, but others died or developed cancers.
• Although gene therapy remains promising, there
is little evidence of safe and effective application.
© 2017 Pearson Education, Inc. Chapter Table of Contents
Recommended