Chromosome Gene DNA So when a cell divides, the new cells have a complete set of DNA instructions

DNA Replication

Review DNA Hierarchy

Chromosome

Gene

DNA

Why does DNA need to replicate?Hint: Think about our cell division activity.

So when a cell divides, the new cells have a complete set of DNA instructions.

Let’s quickly review DNA structure in prokaryotes and eukaryotes.

PROKARYOTES Double stranded Single ring Found in cytoplasm A-T C-G

EUKARYOTES Double stranded Double helix Found in nucleus A-T C-G

Nucleotide

From the videos, what differences did you see in the replication of DNA in prokaryotes vs. eukaryotes?

DNA Strands are Antiparallel

DNA is read 5’ to 3’

Strand on the left 5’ TTCAGT 3’

Strand on the right 5’ ACTGAA 3’

Replication of DNA

PROKARYOTES

Begins at a single point in the chromosome

Proceeds in two directions until the entire chromosome is separated

EUKARYOTES

Replication can be occurring at hundreds of places along the same DNA strand

vs

How does DNA replicate?

What has to happen to the DNA strand first?

Double stranded DNA must be separated!How does this happen?

An enzyme called DNA

Helicase breaks the hydrogen

bonds between the strands!

Enzymes help the double strand unwind

Once strands are separated and unwound, what happens?

NucleotideDNA Polymerase adds

free nucleotides that pair up to the exposed original strand (using Base Pairing Rules!!!)

DNA polymerase binds the free nucleotides to the original strand.

DNA Polymerase

DNA polymerase also checks for errors.

It can only add nucleotides if the previous nucleotide is correctly paired. If there is an error, it backtracks to make the correction.

DNA Replication is Semi-Conservative

During replication, existing DNA strands serve as templates for new complementary strands

Parent (original) strand present in all daughter (new) strands

Complementary Base Pairing Practice

Remember -- A-T C-G

5’ 3’ 5’ 3’ ATGGCGTCATGCTTAGATTA3’ 5’

TACCGCAGTA

3’ 5’

CGAATCTAAT