View
7
Download
0
Category
Preview:
Citation preview
Chapter 6
Antibiofilm activity and quorum sensing inhibitory potential of phytochemicals
113
Chapter 6. Antibiofilm activity and quorum sensing inhibitory potential of
phytochemicals
6.1. Introduction
Quorum sensing is a cell density dependent mechanism used by the bacteria to
regulate gene expression. It is an essential component of biofilm physiology, as
biofilms have a high concentration of bacterial cells (Parsek and Greenberg, 2005).
Quorum sensing or cell to cell communication is utilized by bacteria for biofilm
initiation, maturation and dispersal and also for regulating metabolic activity and
population density within the biofilm (Asad and Opal, 2008). Therefore, anti-biofilm
strategies can be developed based on inhibition or interruption of quorum sensing
mechanism in bacteria (Simoes et al., 2010).
Apart from their role in biofilm formation, quorum sensing mechanism is
known to modulate virulence and spoilage phenotypes in foodborne bacteria at the
molecular level. Signaling molecules belonging to the autoinducer-1 (acyl-
homoserine lactones) and autoinducer-2 group have been identified in various food
products (Pinto et al., 2008). The acyl-homoserine lactones (AHLs) have been
detected in foods heavily contaminated with spoilage microflora belonging to
enterobacteriaceae members and pseudomonads (Rasch et al., 2005). The enzymes
protease, lipase, cellulase and pectinase involved in food spoilage are regulated by
AHL mediated quorum sensing systems in a number of spoilage bacteria (Liu et al.,
2007). The food-borne pathogens E. coli and Salmonella lack the ability to produce
AHLs, but, respond to exogenously available AHLs by utilizing the sdiA encoded
AHL receptor for the production of virulence factor and in pathogenesis (Ahmer
2004; Smith et al., 2004). Thus, the mechanism of quorum sensing is employed by
food-borne bacteria for regulating spoilage phenotypes, virulence factor production
114
and biofilm formation. Therefore, potential quorum sensing inhibitors could be
developed as preservatives against the food spoilage flora and as anti-infectives
against the food-borne pathogens.
The phytochemicals having structural analogy to that of the AHLs, compete
with the signaling molecules to bind to the quorum sensing receptors. Hence, these
compounds have the potential to be used as quorum sensing inhibitors (Teplitski et
al., 2011). Phytochemicals such as furocoumarins have inhibited quorum sensing and
biofilms in the pathogenic Vibrio harveyi, E. coli O157:H7, S. enterica serovar
Typhimurium and P. aeruginosa. Purified plant derived compounds, furocoumarins
and berggamottin were shown to inhibit signal molecule production by 94.6–97.7%
and modulate quorum sensing regulated phenotypes (Girinnevar et al., 2008). Thus,
compounds derived from plants and other dietary phytochemicals generally
considered as safe can be screened for their effect on quorum sensing regulated
phenotypes and further developed as quorum sensing inhibitors against the food-borne
pathogens.
In the present study, phytochemicals phellandrene, caryophyllene, berberine,
and quercetin were studied for the biofilm inhibitory activity against the food-borne
pathogens Escherichia coli, Salmonella enterica serovar Typhimurium and Vibrio
parahemolyticus at sub-inhibitory concentrations. These phytochemicals were
comparatively assessed for inhibition of quorum sensing regulated phenotypes in
bacteria. Further, their effect on virulence gene expression in S. enterica serovar
Typhimurium was also determined. All the phytochemicals tested exhibited
significant biofilm inhibitory and anti-quorum sensing activity. Berberine was used
for further studies as it inhibited biofilms and demonstrated anti-virulence activity at
minimal concentration of 0.019 mg/ml. As the phytochemicals used in the study are
115
generally recognized as safe with relevance to foods, they have the potential to be
developed into preservatives and sanitizers in the food processing industry based on
their biofilm and quorum sensing inhibitory strategy.
6.2. Materials and Methods
6.2.1. Bacterial strains
Food-borne pathogens Escherichia coli (MTCC 7410), Salmonella enterica
serovar Typhimurium (MTCC TA100) and Vibrio parahemolyticus (MTCC 451) and
food spoilage Pseudomonas fluorescens (MTCC 9856) were used in the biofilm
inhibition studies. The bacteria were grown and maintained in nutrient broth at 37ºC.
Chromobacterium violaceum (ATCC 12472) and Pseudomonas aeruginosa PAO1
were used for determining the quorum sensing inhibitory potential of the
phytochemicals. The strains were grown in Luria Bertiani media at 28ºC.
6.2.2. Phytochemicals
The phytochemicals used in the experiments phellandrene, caryophyllene,
berberine, and quercetin were purchased from Sigma-Aldrich, India.
6.2.3. Determination of MIC against biosensors and food-borne bacteria
The minimum inhibitory concentration of the phytochemicals was determined
in the Mueller-hinton broth using a broth microdilution method as described by
Jadhav et al. (2013). The MIC of the phytochemicals against the food-borne
pathogens were assessed in the concentration ranging from 1.250 to 0.019 mg/ml. The
MIC was recorded as the lowest concentration exhibiting complete inhibition of
visible growth and confirmed by the addition of tetrazolium trichloride dye. All the
experiments in the present study were performed at sub-MIC of the phytochemicals.
116
6.2.4. Antibiofilm activity of phytochemicals – inhibition of biomass and
metabolic activity in biofilms
The biofilm inhibitory activity of berberine was studied in Pseudomonas
aeruginosa PAO1, P. fluorescens, E. coli, S. enterica serovar Typhimurium and
V. parahemolyticus. The ability of the phytochemicals to inhibit biofilm formation at
0.5 MIC was assessed by the crystal violet assay and the XTT [2,3-bis-(2-methoxy-4-
nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] assay (Sandasi et al., 2010).
In brief, 100 µl of 0.5 MIC equivalent phytochemical and 100 µl of bacteria
cultures (absorbance of 0.4 at 600 nm) grown in tryptic soy broth was added to
individual wells of a sterile flat-bottomed 96-well polystyrene microtitre plates
microlitres. The plates were incubated for 24 h at 37ºC for biofilm formation. The
experiment was carried out in triplicates.
6.2.4.1. Biofilm biomass assay by modified crystal violet technique
The planktonic loosely adherent cells from the wells were removed by
washing the wells thrice with 200 µl of sterile distilled water and stained with 125 µl
of crystal violet solution (0.1%) and incubated for 30 minutes at room temperature.
Excess stain was removed by washing the wells thrice with 200 µl of sterile distilled
water. The dye was solubilized by addition of 200 µl of ethanol (95%) to each well
and incubating for 15 min at 4ºC. The crystal violet/ethanol solution from each well
was transferred to a separate well and the biofilm biomass was quantified by
measuring the intensity of crystal violet absorbed at the wavelength of 595 nm
(Vandeputte et al., 2010).
6.2.4.2. Biofilm metabolic activity assay
The effect of 0.5 MIC phytochemicals on metabolic activity of the biofilm was
assessed by XTT assay. After biofilm formation, the planktonic cells were removed
by washing thrice with sterile distilled water. Briefly, 100 µl physiological saline and
117
100 µl XTT-menadione solution were added to the wells and incubated in the dark for
5 h at 37°C. Further, the contents of the wells were centrifuged at 13000 rpm for
4 min to remove residual cells. The absorbance of the supernatant was measured at
486 nm to quantify the metabolic activity of the cells (Peeters et al., 2008).
6.2.4.3. Quantification of exopolysaccharide production by ruthenium red staining
The developed biofilms were washed thrice with phosphate buffer saline and
treated with 200 µl of 0.01% ruthenium red (Sigma-Aldrich) and incubated for 60 min
at room temperature. The absorbance of the residual stain was measured at 450 nm
and the amount of dye bound to the biofilm was quantified by measuring the
absorbance for the blanks, control and the phytochemical treated wells (Borucki et al.,
2003).
6.2.5. Fluorescence microscopy analysis
In situ visualization of biofilms was carried out by the fluorescence
microscopy studies. Bacterial cells (108 CFU ml-1) grown in tryptic soy broth was
dispensed into sterile petriplates (90 mm) containing sterilized coverslips (22 x 48
mm, Bluestar) treated with and without sub-MIC of the phytochemicals. The plates
were incubated at 37 ºC under static conditions for the development of biofilms. After
the 24 h incubation period, the coverslips were stained with 20 µl acridine orange dye
(1%) (Sigma-Aldrich, Switzerland). The stained glass cover slips were incubated for
30 mins under dark condition, rinsed with sterile water to remove excess stain, air
dried and further visualized with fluorescence microscopy at 40x air objective and
100x oil objectives (Axio scope-Carl Zeiss, Germany). The software AxioVision 4.6
was used for digital processing of the images (Carl Zeiss, Germany).
118
6.2.6. Quorum sensing inhibitory activity of phytochemicals
6.2.6.1. Inhibition of violacein production in Chromobacterium violaceum
Quorums sensing inhibitory activity of the phytochemicals were quantified by
measuring the inhibition of violacein production in C. violaceum (ATCC 12472)
(Blosser et al., 2004). LB broth supplemented with sub-inhibitory concentration of the
phytochemicals was inoculated with 200 µl of bacterial culture and incubated for 24
hours at 28 ºC. Violacein extraction was carried out from the phytochemical treated
culture and control sample by adding 200 µl of 10% SDS, vortexing for 15 s and
incubated at room temperature for 5 min. The cell lysate was treated with 900 µl of
water-saturated butanol (50 ml of n-butanol mixed with 10 ml distilled water),
vortexed for 5 s and centrifuged at 13 000 g for 5 min. The absorbance of butanol
phase containing violacein was measured at 585 nm. The inhibition of violacein
production by the phytochemical was calculated using the following method:
Inhibition of violacein production (in %) = Absorbance of control - Absorbance of sample X 100 Absorbance of control Control: Untreated C. violaceum culture; Sample: Bacterial culture treated with phytochemical
6.2.7. Inhibition of swarming motility
Motility assay was carried out by adding sub-inhibitory concentration of
phytochemicals into the motility media and inoculating with 5 µl of bacterial broth
culture (108 CFU ml-1). The diameters of the swarming motility zones were measured
after incubation at 37°C for 24 h (O’May and Tufenkji, 2011).
6.2.8. Semiquantitative RT-PCR
After overnight incubation at 37ºC, S. enterica serovar Typhimurium culture
was diluted 1: 100 and inoculated in 20 ml nutrient broths (Nesse et al., 2011). The
inoculated culture broth were treated with 1 µM/ml of the quorum sensing signal
molecule N-hexanoyl-DL-homoserine lactone (C6-AHL) and the sub-inhibitory
119
concentration of the phytochemical berberine (0.009-0.019 mg/ml) and incubated for
3 h at 37ºC. Distilled water treated S. enterica serovar Typhimurium culture was used
as the control. After the incubation period, 5 ml of 95% ethanol were added to the
culture broth and placed on ice for 20 min to stabilize the mRNA. The mixture was
then centrifuged at 4°C, 2330 × G for 20 min, and the pellet resuspended in the 1 ml
of supernatant. Further, it was centrifuged at 14 000 g for 1 min at room temperature.
The supernatants were discarded and the pellets were used for isolation of RNA. Total
RNA was isolated from the pellets using a HiPurA Bacterial RNA Purification kit
(Himedia, India). cDNA was synthesized after RNA isolation and PCR was
performed using the One Step M-MuLV RT-PCR Kit (Genei, India). PCR was
performed in 25 µl reaction volumes using 1 µl cDNA, 0.5 µl of each primer, 0.5 µl of
RNasin, 12.5 µl of 2X RT-PCR reaction mix and 0.5 µl RT-PCR enzyme mix, and
thermocycled by 5 min initial denaturation at 95°C, followed by 30 cycles of 94°C
40s, 60°C 30s and 72°C 40s, and 7 min final extension at 72°C. The gyrB gene was
used as the reference gene or internal control. The primers used are listed in Table 6.1.
The PCR fragments were separated by gel electrophoresis and quantitative differences
were observed using ImageJ analysis software.
Table 6.1. Primers used in the semi-quantitative RT-PCR studies for srgE genes in Salmonella.
Gene Accession No./ locus tag Primers 5’-3’
F: forward R: reverse
srgE
AE006468.1/STM1554 F: GTAATGTCAATTGCGGCATGG
R: CGGAGCAGTTGGTCAAGGATT
gyrB -- F:GTCGAATTCTTATGACTCCTCC
R: CGTCGATAGCGTTATCTACC
120
6.2.9. Statistical analysis
All the experiments were performed in triplicates and the data were reported
as means + standard deviation. Student's t test was used to analyze the differences
between control and test. One-way analysis of variance (ANOVA) was used in
analyzing differences in the different assays. The p values < 0.05 were considered
statistically significant. IBM SPSS Statistics 18 was used to conduct the statistical
analysis.
6.3. Results and Discussion
Biofilms are a major and persistent problem in food industries and clinical
settings due to their high tolerance to microbiocides. Hence, their efficient removal
requires strategies which can effectively target their resistance mechanisms. The
present study determined the biofilm inhibitory and anti-quorum sensing effect of the
phytochemicals and evaluated their effect on virulence of S. enterica serovar
Typhimurium under in vitro conditions. These phytochemicals are generally used in
the food industry as antimicrobials based on their bactericidal property. But here the
phytochemicals were studied for their effect on biofilm formation and quorum sensing
regulated virulence factor production at sub-inhibitory concentrations.
6.3.1. Determination of minimum inhibitory concentration
In the present study, the food-grade phytochemicals phellandrene,
caryophyllene, berberine, and quercetin were studied for the quorum sensing
modulatory and anti-biofilm activity. The MIC of the phytochemicals against
P. aeruginosa and the food-borne bacteria were determined at a concentration ranging
from 0.019 to 2.50 mg/ml. For the quorum sensing inhibitory activity against
C. violaceum, the MIC of the phytochemicals were tested in the range of 0.4, 0.8, 1.2
and 1.6 mg/ml. Sub-inhibitory concentration of the phytochemicals were used in the
121
study as they are known to inhibit quorum sensing regulated phenotypes, without
affecting the growth of the bacteria.
6.3.2. Antibiofilm activity of phytochemicals
6.3.2.1. Biofilm biomass - Crystal violet assay
The phytochemicals were screened for their anti-biofilm potential in the
pathogenic bacteria using crystal violet microtitre plate assay (CV-MTP) at 0.5 xMIC
(Figure 6.1). Phellandrene at a concentration of 0.156 mg/ml exhibited significant
anti-biofilm activity against P. aeruginosa. However, it failed to inhibit biofilm
formation in V. parahemolyticus. Caryophyllene had anti-biofilm activity against all
the tested bacteria. It had significant activity against P. fluorescens by 75.56 % at
0.039 mg/ml. Quercetin was able to inhibit biofilm formation in P. fluorescens and E.
coli by 57.60 and 57.97 %, respectively. It had low inhibitory activity towards biofilm
formation in S. enterica serovar Typhimurium and V. parahemolyticus, and prevented
biomass formation by 22.62 and 35.99 %, respectively. Berberine showed significant
anti-biofilm potential against all the tested pathogens. Berberine showed significant
inhibitory activity against attachment and biofilm formation in P. fluorescens,
V. parahemolyticus, P. aeruginosa PA01 and E. coli by 71.70, 71.25, 62.27 and
62.72 %, respectively. It inhibited biofilms of S. enterica serovar Typhimurium by
31.20%. Thus, it is clear from the above study that the phytochemicals tested were
capable of significantly inhibiting biofilms in the food spoilage P. fluorescens and
E. coli and had moderate activity against the food-borne pathogens (p<0.05). Based
on the above results and due to low MIC exhibited against the food-related bacteria,
the phytochemical berberine were studied for its effect on metabolic activity and EPS
production in the bacterial biofilms.
122
Figure 6.1. Anti-biofilm activity of phytochemicals assessed by CV-MTP method. Berberine and phellandrene exhibited significant anti-biofilm activity against all the tested bacteria.
Figure 6.2. Berberine exhibited antibiofilm activity due to its effect on the metabolic activity in Pseudomonas species biofilms.
123
6.3.2.2. Biofilm metabolic activity – XTT assay
Berberine had significant effect on the metabolic activity in biofilms of Vibrio
parahemolyticus. It reduced metabolic activity in the V. parahemolyticus biofilm by
71.18 %. Berberine had moderate effect on the metabolic activity of P. aeruginosa
PA01 and E. coli biofilms, as it reduced the metabolic activity by 58.53 and 58.40 %,
respectively. Berberine had least effect on the metabolic activity of P. fluorescens and
S. enterica serovar Typhimurium biofilms by 55.93 % and 28.96 % inhibition,
respectively (Figure 6.2).
6.3.2.3. Exopolymeric substance production - ruthenium red assay
Berberine was capable of preventing exopolymeric substance production in
the biofilms of all the tested bacteria. Berberine significantly inhibited EPS
production in E. coli biofilms by 62.07 and 60.52 %, respectively. Similar to the
reduction of metabolic activity, berberine reduced EPS production in S. enterica
serovar Typhimurium by 44.42 % and showed minimal effect on EPS production in
P. fluorescens biofilms (Figure 6.3).
6.3.3. Fluorescence microscopy analysis
Microscopy studies revealed the effect of the phytochemicals berberine on
bacterial attachment, colonization of surface and formation of mature biofilms. At
0.019 mg/ml, berberine did not affect attachment or adherence of E. coli cells but was
capable of preventing their colonization onto the substratum (Figure 6.4). Similarly,
berberine inhibited the colonization of P. fluorescens and V. parahemolyticus cells at
0.625 mg/ml and 0.312 mg/ml, respectively (Figure 6.6 & 6.8). Berberine was able to
inhibit attachment of P. aeruginosa PA01 cells but at a higher concentration of 1.250
mg/ml (Fig 6.7). Though, the phytochemicals did not exhibit significant antibiofilm
activity against S. enterica serovar Typhimurium by inhibiting initial cell attachment,
yet they were capable of disrupting the pre-formed biofilms (Figure 6.8).
124
Figure 6.3. Berberine exerted antibiofilm activity by inhibiting EPS production in the pathogenic and spoilage bacteria.
Figure 6.4. Biofilm formation by E. coli in presence of 0.5X MIC of berberine (A) and untreated control (B).
125
Figure 6.5. Biofilm formation by S. enterica serovar Typhimurium in presence of 0.5X MIC of berberine (A), and untreated control (B).
Figure 6.6. Biofilm formation by P. fluorescens in presence of 0.5X MIC of berberine (A) and untreated control (B).
126
Figure 6.7. Biofilm formation by P. aeruginosa in presence of 0.5X MIC of berberine (A), and untreated control (B).
Figure 6.8. Biofilm formation by V. parahemolyticus in presence of 0.5X MIC of berberine (A) and untreated control (B).
127
Berberine at a concentration of 0.019 mg/ml disrupted colonies of S. enterica
serovar Typhimurium and prevented them from developing into mature biofilms. The
disruption of microcolony formation of S. enterica serovar Typhimurium was
prominent in berberine treated bacterial cells as observed by fluorescence microscopy
(Figure 6.5). The phytochemicals at less than growth inhibitory concentrations
significantly inhibited biofilm formation in the pathogens and food spoilers by
inhibiting adherence to substratum, interfering with EPS production and by reducing
metabolic activity leading to prevention of biofilm maturation. Though their activity
on initial attachment of S. enterica serovar Typhimurium to the microtitre plate was
low in comparison to the reduction in metabolic activity and EPS production, they
could disrupt biofilm formation during maturation stage. This is probably due to the
inhibition of EPS production. Quorum sensing mechanism is known to be involved
not only in the initiation but also in the maturation of bacterial biofilms. EPS
production in biofilms required for the development of biofilm architecture and
maturation has been demonstrated to be under quorum sensing regulon (De Kievit et
al., 2001). Therefore, it can be concluded that the phytochemical berberine at sub-
inhibitory concentrations inhibited attachment of cells to substratum and further
colonization in P. aeruginosa, P. fluorescens, V. parahemolyticus and E. coli and
disrupted S. enterica serovar Typhimurium biofilms due to their quorum sensing
inhibitory potential.
6.3.4. Quorum sensing inhibitory activity of phytochemicals
6.3.4.1. Inhibition of violacein production in C. violaceum
The phytochemicals used in the study were capable of inhibiting production of
the pigment violacein in the biosensor strain C. violaceum 12472 (Figure 6.9).
Berberine reduced violacein production by 62.67 % at a concentration of 1.6 mg/ml.
The phytochemical quercetin had a low MIC of 1.6 mg/ml, and could prevent
violacein production only by 46.61 %.
128
Figure 6.9. Anti-QS activity of Phytochemicals. Phytochemicals inhibited QS regulated violacein pigment production in C. violaceum.
Figure 6.10. Inhibition of swarming motility in P. aeruginosa PA01 by phellandrene (A) & quercetin (B) and by beberine in E. coli (C). Untreated P. aeruginosa PA01 (D), S. Typhimurium (E) and E. coli (F) exhibiting swarming motility.
129
Phellandrene and caryophyllene exhibited significant QS inhibitory activity in
Chromobacterium violaceum as seen by inhibition of violacein pigment production by
62.67 % and 72.22 %, respectively (p<0.05).
The quorum sensing inhibitory potential of the phytochemicals was screened
using the biosensor C. violaceum. Violacein pigment production in C. violaceum is
regulated by the CviIR-an acylhomoserine lactone based quorum sensing system. The
compounds capable of inhibiting violacein production at sub inhibitory concentration
are potential quorum sensing inhibitors as they interfere with the CviR-AHL complex
and prevent expression of the vio genes required for the production of violacein
(Swem et al., 2009). Previously, it has been shown that the phytochemical
cinnamaldehyde at minimal concentration was capable of inhibiting acyl homoserine
lactone (3-oxo-C6-HSL and 3-oxo-C12-HSL) and autoinducer 2 mediated quorum
sensing (Niu et al., 2006). Similarly, curcumin at concentrations ranging from 25-100
µg/ml has been shown to inhibit hexanoyl homoserine lactone mediated quorum
sensing in C. violaceum and formation of biofilms by uropathogens (Packiavathy et
al., 2012). However, there are no reports of the quorum sensing inhibitory potential of
the compounds berberine and quercetin. On comparative analysis, the phytochemical
caryophyllene followed by berberine showed significant inhibition of quorum sensing
in C. violaceum at low concentrations (p<0.05). Phytochemicals having structural
homology to the acyl homoserine lactones may act as competitive inhibitors and
prevent the signal reception or decrease the expression of the signal synthases, and
thus inhibit expression of quorum sensing regulated phenotypes (Vattem et al., 2007).
130
6.3.5. Inhibition of swarming motility in P. aeruginosa PA01, S. enterica serovar
Typhimurium and E. coli
Berberine showed significant inhibition of swarming motility in the pathogens
Pseudomonas aeruginosa PA01 and S. enterica serovar Typhimurium by 99.44 %
(p<0.05). It was also capable of inhibiting motility in E. coli by 75.56 % (Figure
6.10). The other phytochemicals used in the assay inhibited swarming motility only
in P. aeruginosa PA01 and did not interfere with motility in case of S. enterica
serovar Typhimurium and E. coli. Quercetin affected swarming motility in
Pseudomonas aeruginosa PA01 by 75.56 %.
The antibacterial activities of the tested phytochemicals have been asserted
previously. However, there are no reports to date on their effect on virulence factor
production in pathogenic bacteria. In bacteria, motility is required for microbial
surface colonization, biofilm formation and pathogenesis. Motility is known to be
regulated by the mechanism of quorum sensing in Pseudomonas aeruginosa (O’May
and Tufenkji, 2011). All the phytochemicals exerted inhibitory effect on swarming
motility in P. aeruginosa PA01. However, they had no effect on swarming motilities
in E. coli and S. enterica serovar Typhimurium. Quorum sensing inhibitory
compounds such as halogenated furanones are known to inhibit swarming motility in
pathogenic bacteria (Givskov et al., 1996). The phytochemicals capable of affecting
bacterial motility can be used to prevent bacterial surface colonization in food
processing lines.
6.3.6. Semi-quantitative RT-PCR analysis to assess expression level of srgE
virulence gene
SdiA, the quorum sensing signal receptor is known to activate two loci,
namely, the rck operon, located on the virulence plasmid and containing six genes and
the second locus located on the chromosome encoding a single gene, srgE (390 bp).
131
In the present study, S. enterica serovar Typhimurium strain displayed an increased
expression of the srgE virulent gene in presence of 1 µM of C6-AHL. On exogenous
addition of 0.009 – 0.019 mg/ml of berberine, there was a decrease in the expression
of srgE genes by two folds on quantification (Figure 6.11). The low level of
expression of srgE observed in presence of the phytochemicals, clearly indicated that
the compound berberine was capable of interacting with the transcriptional regulator
SdiA of S. enterica serovar Typhimurium. This implies that berberine modulated the
expression of acylhomoserine lactone dependent SdiA encoded srgE virulence gene,
resulting in its low expression level.
Although Salmonella does not produce AHL, it has a LuxR homologue termed
SdiA. SdiA subsequently activates two Salmonella specific loci, srg (SdiA-regulated
gene), located on the chromosome and the rck (resistance to complement killing)
operon, present in Salmonella virulence plasmid. Srg locus consists of a single gene,
srgE, which is predicted to encode a protein containing a coiled- coil domain (Firouzi
et al., 2014). Computational studies have shown that SrgE belongs to type III
secretion system effector which is essential for the pathogenicity in S. enterica
serovar Typhimurium (Habyarimana et al., 2014). SdiA upregulates the expression of
srgE and rck genes in presence of the AHL signals. Berberine significantly repressed
the quorum sensing regulated SdiA dependent srgE virulent gene expression. This
implies that SdiA is a valid drug target and berberine has the potential to be developed
and used as an anti-infective drug to target S. enterica serovar Typhimurium
pathogenicity. Similarly, subinhibitory concentrations of punicalagin, a
phytochemical isolated from pomegranate reduced Salmonella virulence gene
expression and invasion due to its anti-quorum sensing ability (Li et al., 2014).
132
Figure 6.11. Semiquantitative reverse transcriptase-PCR. Effect of berberine on expression of quorum sensing regulated virulence genes in Salmonella enterica serovar Typhimurium. Lane 1: 100 bp DNA ladder; Lane 2: S. enterica serovar Typhimurium treated with 0.018 mg/ml berberine; Lane 3: S. enterica serovar Typhimurium treated with 0.009 mg/ml berberine; Lane 4: S. enterica serovar Typhimurium treated with 1mM C6-AHL; Lane 5: S. enterica serovar Typhimurium (Control).
133
Berberine is an isoquinolone alkaloid present in plants of the genus Coptis,
Hydrastis and Berberis and these plants have been consumed as a food source and
used for their medicinal properties (Siow et al., 2011). The present study,
demonstrates that berberine has biofilm inhibitory and anti-quorum sensing property,
apart from other therapeutic potentials.
As biofilms are resistant to antimicrobials and their persistence is a challenge
to safety and quality in food processing units, novel strategies are required for their
elimination (Simoes et al., 2009). Therefore, the phytochemicals used in the study can
be used as biofilm inhibitory agents in food industries based on their anti-quorum
sensing property.
Recommended