By RABIA DURRANI Department of Microbiology QUAID-I-AZAM UNIVERSITY, ISLAMABAD

Preview:

Citation preview

By RABIA DURRANI

Department of MicrobiologyQUAID-I-AZAM UNIVERSITY, ISLAMABAD.

Results

Materials and Methods

Introduction

Objectives of Study

INTRODUCTIONINTRODUCTION

Focus of the study

Disease and it’s causative agents

Focus of the studyFocus of the study

1. Livestock and Poultry sectors are among the major

contributors in the economic growth of Pakistan

2. Both sectors are facing serious problems; among

them are some dangerous diseases like Hemorrhagic

Septicemia (HS) which are posing a huge risk to the

economic development in these sectors

3. The focus of the research was to study the disease

and identify the agents responsible for.

Disease and it’s causative agent(s)Disease and it’s causative agent(s)

Pasteurella multocida is Gram negative, Non-spore forming, cocobacillus bacterium

Commensals of upper respiratory tract of livestock and Poultry

Causes severe Hemorrhagic septicemia (HS)

HS occurs as catastrophic epizootics in Asia and Africa

Several cases of HS reported in Wild animals also.

Common serotypes are Asian B:2 and African E:2

In wild animals B:2,5 strain is most common.

Vaccination is achieved by Whole cell preparations.

Common Vaccines are alum precipitated and Oil adjuvant.

Disease and it’s causative agent(s) (Continued….)

Live Intranasal Vaccine B:3,4 serotype of deer origin found successful in South East Asia. (Muneer and Afzal, 1989).

Common cause of HS disease is Vaccination Failure and that is why death rate of animals is High in South East Asia.

Disease and it’s causative agents (Continued….)

Objectives of StudyObjectives of Study

Comparisons of isolates from clinically diseased animal (animal suffering from Hemorrhagic Septicemia) for their microbiological profiles to explore any gross difference.

Study of molecular profiles to elucidate further proteomics.

To collate and analyze the data obtained and to examine perception of the scientific workers that Pasteurella multocida is an opportunistic pathogen.

MATERIALS AND METHODSMATERIALS AND METHODS

Sample collection & Identification of clinical

isolates

Antibiogram analysis of Pasteurella multocida

Molecular Characterization of P. multocida

P. multocida species specific PCR

HS-associated type B serotype specific PCR

Protein Profile Analysis of P. multocida by SDS-PAGE

Whole Cell Profile of P. multocida

Envelop profile of P. multocida

Restriction enzyme analysis of P. multocida

Samples were collected from National Veterinary Labs Islamabad that were brought into the lab from different cities

Nature of the samples were lungs and spleen tissues of animals.

Gram staining of Organism

Subculturing and Purification

Biochemical characterization Catalase test Oxidase test Growth in the absence of CO2

Sample Collection and Identification of clinical isolates

Urease production test H2S Production Test Nitrate reduction test Motility test

Injecting mice with clinical isolates of clinical Isolate

API 20 NE Test (Biomeurix )

Hyaluronidase Enzyme test for Pasteurella multocida (Smith et al., 1968)

Identification of clinical isolates (Continued….)

Antibiogram analysis of Pasteurella multocida

Differentiation of clinical isolates by microbiological staining dyes:

◦ Crystal violet

◦ Malachite Green

◦ Safranin

◦ Congo Red

Molecular Characterization of Pasteurella multocida

Crude method of DNA extraction

Amplification of Extracted DNA of Pasteurella multocida by Polymerase Chain Reaction (PCR)

P. multocida species specific PCR assay

Primer sequences were:

KMT1SP6 5’ - GCTGTAAACGAACTCGTCGTCGCCAC3-3’

KMT1T7 5’- ATCCGCTATTTACCCAGTGG-3’

P. multocida species specific PCR

PCR Master Mix Preparation

PCR master mix about 20µl was prepared as follows: H2O 13µl MgCl2 02µl dNTPs 01µl Primer 1 01µl Primer 2 01µl PCR Buffer 1.5µl Taq Polymerase 0.5µl

Total Volume: 20µl

Then 5µl –extracted DNA was added, and makes the final volume upto 25µl.

The thermal cycling parameters were as follows:

The initial denaturation at 94°C for 5minutes;

30cycles of:◦ 94°C for 1minute◦ 53°C for 1minute (for primer annealing)◦ 72°C for 1minute (extension)

Final extension at 72°C for 9minutes.

Analysis of PCR product

About 8µl of PCR product were separated by

electrophoresis on 2% High melting Agarose gel in 1X

Tris-Boric acid running buffer (TBE) at 4V/cm for 1

hour .The gel was stained with 1% ethidium bromide

and DNA fragments were viewed by Gel documentation

system.

PCR assay for HS-associated type B serotype Pasteurella multocida

PCR analysis for HS –associated type B serotype P.

multocida identification was performed.

◦ Primer pair used:

KTSP61

KTT72

These primers specifically amplify a product of

approximately 560 base pair (bp) in all HS causing

serotype of P. multocida.

Primer sequences were:

KTT72 5’- AGGCTCGTTTGGATTATGAAG-3’

KTSP61 5’ – ATCCGCTAACACACTCTC-3’

HS causing Type B gene specific PCR test

PCR master mix preparation

PCR master mix about 20ul was prepared as follows:

◦ H2O 13µl◦ MgCl2 02µl◦ dNTPs 01µl◦ Primer 1 01µl◦ Primer 2 01µl◦ Buffer 1.5µl◦ Taq Polymerase 0.5µl◦ Total Volume: 20µl

Then 5ul of extracted DNA was added, and make the final volume upto 25µl.

The thermal cycling parameters were as follows:

The initial denaturation at 94°C for 5minutes;

30cycles of:◦ 94°C for 1minute

◦ 53°C for 1 minute

◦ 72°C for 1minute

Final extension at 72°C for 9minutes.

Protein Profile Analysis of P. multocida by SDS-PAGE

Harvesting of Culture

Washing of Cells

Sonication (Disruption) of Cells for Whole Cell

Preparation

Preparation of Whole-cell for SDS-PAGE

Preparation of Envelope

Staining and Destaining of Gel

Determination of Molecular Weight of Proteins

For the extraction of proteins, thick growth of pure P.

multocida were taken with the help of Pasteur pipette

and dipped in the ependorff tube containing 200µl-

distilled water.

Then they were vortexed with the help of (IKA USA

mixer) thoroughly to dissolve completely.

After dissolving the samples were sonicated in

(dr.hielscher, type UP 400S).

Whole Cell Profile of Pasteurella multocida

Sonicated for: - ◦ 30 second stroke ◦ 30 second cooling ◦ Amplitude 80 to 100◦ Cycle 0.5 to 1

After sonication:◦ centrifugation at 12,000 rpm◦ Time 5 min

The microcentrifuge was used to remove intact cells. The supernatant was taken as whole cell and boiled in boiling water along with 4X sample loading buffer for 5minutes at 100°C before loading on gel

High Energy Probe Sonicator (DR. HEILSCHER Type 2005, Germany)

Envelop profile of Envelop profile of P.multocidaP.multocida

Preparation of Envelope (Irfan et al.,2008)

Thick growth of P. multocida culture was:

◦ Suspended in 2ml of distilled water in eppendorff tube

◦ Centrifuged at 20,000rpm for 30minutes at 8˚C.

◦ The pellet was resuspended in 20mM Tris-HCl buffer and again

centrifuged at 20,000rpm for 30minutes.

◦ The final pellet rich in envelop was resuspended in 20mM Tris-

HCl buffer and stored at –20°C for further SDS-PAGE analysis.

Restriction enzyme analysis of P.multocidaRestriction enzyme analysis of P.multocida

Steps Involved

10 X restriction endonuclease buffer DNA Distilled water Restriction enzyme and then gently mix the contents Centrifuge for few seconds in a microfuge and the

incubate at 37°C for 1-4 hours Heat the reaction at 65°C for 20 minutes Run the digests on gel

RESULTSRESULTS

Characterization of P.multocida Cultural and microscopic

Biochemical

Analytical Profile Index (API) test

Antibiotic sensitivity

Hylouronidase production

Differentiation by microbiological staining dyes

PCR

SDS-PAGE

Cultural Characterization of P.multocida

On Brain Heart Infusion (BHI) agar and Nutrient agar:◦ Convex colonies◦ Entire edges◦ Mucoid and sticky nature ◦ Approximate size of 2-3 mm diameter

On blood agar, all the pure culture showed:◦ Luxuriant growth◦ Translucent grayish or yellowish green colonies◦ No haemolysis

On MacConkey agar:◦ No growth

Staining of P.multocida The Gram staining shows:

◦ Pleomorphic, gram negative, coccobacilli◦ 0.2-0.4 mm in size

Colony morphology of P.multocida

Gram staining of P.multocida

Biochemical test results of P.multocida

Table 1. Common biochemical properties of Table 1. Common biochemical properties of Pasteurella Pasteurella multocidamultocida

API test results of P.multocida

API test results of P.multocida

Table 2. Analytical Profile Index (API) test results of Table 2. Analytical Profile Index (API) test results of Pasteurella Pasteurella multocidamultocida

Antibiotic sensitivity test for P.multocida

Antibiotic sensitivity test for P.multocida

Table 3. Number of clinical isolates sensitive to the Table 3. Number of clinical isolates sensitive to the antibioticsantibiotics

Rapid plate screening test for Hyaluronidase production of P.multocida

Table 4. Results of Hylouronidase production by Table 4. Results of Hylouronidase production by P.multocidaP.multocida

S.No Name of City Number of Isolates

Appearance of white precipitate

Hyaluronidase (+)

Hyaluronidase (-)

01 18 06 12

02 Kahutta 06 04 2

03 Badin 04 03 1

04 05 including B:3,4

04 1

05 Taxila 02 02 0

06 06 04 2

07 Toba Tek Singh 06 05 1

08 04 03 1

09 07 04 3

10 Samundri 03 02 1

11 Faislabad 09 08 1

Differentiation of Clinical strains of P.multocida by different staining dyes

Table 5. Differentiation of Clinical isolates by Table 5. Differentiation of Clinical isolates by Microbiological staining dyesMicrobiological staining dyes

S.No Name of CityNo. of Isolates

Name of Dye (Conc. in µg) Observed zone of Inhibition(mm)

Crystal Violet

Safranin Malachite Green

Congo Red

0.1,1,5 0.1,1,5 0.1,1,5 0.1,1,5

01 37 0 0 0 0 0 0 0 0 0 0 0 0 No zone02 Badin 04 0 0 0 0 0 0 0 0 0 0 0 0 No zone03 Tando Jam 07 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 04 Taxila 05 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 05 12 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 06 Samundri 04 0 0 0 0 0 0 0 0 0 0 0 0 No Zone07 Khurrianwala 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 08 Toba Tek Singh 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 09 Jaranwala 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 10 Bakkar 11 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 11 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 12 12 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 13 10 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 14 15 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 15 Abbotabad 05 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 16 Khushab 06 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 17 Kahutta 08 0 0 0 0 0 0 0 0 0 0 0 0 No Zone 18 Faislabad 03 0 0 0 0 0 0 0 0 0 0 0 0 No Zone

PCR results of P.multocida

  Amplification of Extracted DNA of Pasteurella multocida by PCR

All samples when run on Agarose Gel Electrophoresis

showed:◦ Bands of base pairs 560 and 750

◦ The DNA ladder started from 100 base pairs.

Table 6. PCR results of P.multocida

Whole cell profiles of P.multocida HS and Non-HS (Badin)

Conclusions & Future Prospect

Organism was genetically conserved and there is no demostratable diversity with in the number of samples tested.

Isolates from wild life be included in such studies.

This organisms maintains harmlessly inhealthy animals and causes disease as an opportunistic pathogen in extreme stress to animals.

By further studies we can devise better methods for control against disease caused by this organism.

THANK YOU

YOUR QUESTIONS ????