View
1
Download
0
Category
Preview:
Citation preview
Appendix A. Supplementary data
Long and short chain AHLs affect AOA and AOB microbial community
composition and ammonia oxidation rate in activated sludge
Jie Gao1,2,**, Yu Duan3,**, Ying Liu1,4, Xuliang Zhuang1,2, Yichen Liu5, Zhihui Bai1,2,
Wenlin Ma5, Guoqiang Zhuang1,2,*
1. CAS Key Laboratory of Environmental Biotechnology, Research Center for Eco-
Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China
2. College of Resources and Environment, University of Chinese Academy of
Sciences, Beijing 100049, China
3. Beijing Enterprises Water Group Limited, Beijing 100124, China
4. School of Life Sciences, University of Science and Technology of China, Hefei
230026, China
5. Beijing Climate Change Response Research and Education Center, Department of
Environment and Energy Engineering, Beijing University of Civil Engineering and
Architecture, Beijing 100044, China
------------------------------------
*Corresponding author.: Email: gqzhuang@rcees.ac.cn (Guoqiang Zhuang)
** These authors have contributed equally to this work.
Materials and Methods454 pyrosequencing and sequence analysis
Bacterial 16S rRNA gene fragment, covering the V1–V3 region (506 bp), was
selected to construct community library through tag pyrosequencing. The bar-coded
universal bacterial primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 533R
(5’-TTACCGCGGCTGCTGGCAC-3’) incorporating the FLX Titanium A and B
sequencing adaptors (Roche 454 Life Sciences, USA) were used to amplify bacterial
16S rRNA region. The PCRs were carried out in triplicate independent PCR assays
(20 µL) using TransStart Fastpfu DNA Polymerase (TransGen, China). The bacterial
16S rRNA gene PCR cycling parameter was performed as follows: 95 °C for 2 min;
25 cycles of 30 s denaturation at 95 °C, 30 s annealing at 55 °C, 1 min extension at 72
°C; and a final extension at 72 °C for 10 min. The replicate PCR products of the same
sample were combined after PCR. The amplicons were purified with a DNA gel
extraction kit (TaKaRa Biotechnology, China) and quantified. The products from
different samples were used for pyrosequencing on the Roche 454 FLX Titanium
platform according to the manufacturer’s recommendations.
Raw sequences generated from the pyrosequencing run were denoised by using the
Titanium Pyronoise software. Preliminary quality control steps included: (1) checking
those valid barcodes-sequences in different samples; (2) removing the sequences
shorter than 150 bp, average quality value less than 25, or with ambiguous
nucleotides. The high-quality sequences were aligned in accordance with SILVA
alignment protocols (http://www.arb-silva.de) and clustered into operational
taxonomic units (OTUs). The OTUs clustering was performed by setting a 0.03
distance limit (equivalent to 97% similarity) using the Mothur program
(http://www.mothur.org). On the basis of these clusters, rarefaction curves, richness
(ACE, Chao), and alpha-diversity (Shannon, Simpson) were calculated by using
Mothur. Rarefaction and curves were performed on R (http://www.r-project.org/).
Sequences were phylogenetically assigned to taxonomic classification down to the
phylum level with a set confidence threshold of 80%, and relative abundance of a
given phylogenetic group was calculated.
Table S1. PCR approaches used for characterization of ammonia oxidiser communities in activated sludge samples
Primer set Description Sequences Annealing temperature (°C)
Extension time (s)
Reference
27f-1492r Primary PCR amplification for bacterial 16S rDNA gene
27f: AGAGTTTGATCMTGGCTCAG1492r: TACGGYTACCTTGTTACGACTT
50 90 (Lane, 1991)
CTO189f-CTO654r Nested PCR amplification for AOB
CTO189fAB: GGAGRAAAGCAGGGGATCGCTO189fC: GGAGGAAAGTAGGGGATCGCTO654r: CTAGCYTTGTAGTTTCAAACGC
55 45 (Kowalchuk, et al., 1997)
357f-GC-518r* Final amplification for AOB DGGE analysis
357f-GC: CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG518r: ATTACCGCGGCTGCTGG
55 30 (Muyzer, et al., 1993)
A109f-A1492r Primary PCR amplification for archaeal 16S rDNA gene
A109f: ACKGCTCAGTAACACGTA1492r: GYYACCTTGTTACGACTT
55 90 (Großkopf, et al., 1998, Nicol, et al., 2008)
771f-957r-GC* Nested PCR amplification for AOA DGGE analysis
771f: ACGGTGAGGGATGAAAGCT957r-GC: CGCCCGCCGCGCGCGGCGGGCGGG
55 30 (Muyzer, et al., 1993, Ochsenreiter, et al., 2003)
GCGGGGGCACGGGGGGCGGCGTTGACTCCAATTG
The following thermocycling conditions were used: 5 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at the specified annealing temperature, and the specified extension time at 72°C, followed by a 10 min final extension at 72°C.*: The GC-clamp attached at the 5’ end of primer 357f or 957r for DGGE analysis. Primers 357f-518r or 771f-519r, lacking the GC clamp were used to reamplify AOB and AOA fragments.
Großkopf R, Stubner S & Liesack W, 1998. Novel euryarchaeotal lineages detected on rice roots and in the anoxic bulk soil of flooded rice
microcosms. Appl. Environ. Microbiol. 64, 4983-4989.
Kowalchuk GA, Stephen JR, De Boer W, Prosser JI, Embley TM & Woldendorp JW, 1997. Analysis of ammonia-oxidizing bacteria of the beta
subdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified
16S ribosomal DNA fragments. Appl. Environ. Microbiol. 63, 1489-1497.
Lane D, 1991. 16S/23S rRNA sequencing. Nucleic acid techniques in bacterial systematics,(Stackebrandt E & Goodfellow M, ed. eds.), p. pp.
115-175. John Wiley & Sons, New York, N.Y.
Muyzer G, De Waal EC & Uitterlinden AG, 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis
analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695-700.
Nicol GW, Leininger S, Schleper C & Prosser JI, 2008. The influence of soil pH on the diversity, abundance and transcriptional activity of
ammonia oxidizing archaea and bacteria. Environ. Microbiol. 10, 2966-2978.
Ochsenreiter T, Selezi D, Quaiser A, Bonch-Osmolovskaya L & Schleper C, 2003. Diversity and abundance of Crenarchaeota in terrestrial
habitats studied by 16S RNA surveys and real time PCR. Environ. Microbiol. 5, 787-797.
Table S2 amoA copy numbers of AOA and AOB from activated sludge
amoA gene of AOA (copies/L·sludge)4 days treatment
Control SEa C6+3-O-C6
SE C14+3-O-C14 SE All SE
Sample 1b 3.40E+051.21E+04
2.27E+054.60E+04
4.58E+058.13E+04
1.46E+053.20E+04Sample 2 3.59E+05 1.81E+05 7.21E+05 2.51E+05
Sample 3 3.17E+05 3.36E+05 5.02E+05 1.68E+05
amoA gene of AOB (copies/L·sludge)4 days treatment
Control SEC6+3-O-
C6SE C14+3-O-C14 SE All SE
Sample 1 2.61E+072.30E+06
3.16E+076.14E+06
2.63E+073.79E+06
3.45E+072.92E+06Sample 2 3.31E+07 4.91E+07 2.68E+07 3.93E+07
Sample 3 2.63E+07 2.99E+07 3.79E+07 2.92E+07
amoA gene of AOA (copies/L·sludge)16 days treatment
Control SEC6+3-O-
C6SE C14+3-O-C14 SE All SE
Sample 1 4.29E+052.73E+04
6.10E+051.10E+05
8.81E+055.83E+04
1.03E+068.84E+04Sample 2 3.64E+05 8.30E+05 9.50E+05 1.06E+06
Sample 3 3.37E+05 9.89E+05 1.08E+06 7.81E+05
amoA gene of AOB (copies/L·sludge)16 days treatment
Control SEC6+3-O-
C6SE C14+3-O-C14 SE All SE
Sample 1 2.60E+07 6.68E+06 5.21E+07 4.92E+06 5.81E+07 5.35E+06 7.39E+07 7.03E+06
Sample 2 3.87E+07 3.87E+07 5.08E+07 5.20E+07Sample 3 4.91E+07 3.63E+07 3.97E+07 7.22E+07
a SE: standard errorb All the qPCR experiments were performed in triplicate using the independent samples. Sample 1, 2, 3 represent triplicate treatment cultures.
Figure S1. The AHLs degradation studies in activated sludge by AHLs biosensor A.
tumefaciens A136. The seed sludge samples were respectively incubated with 2 µM solutions
of various AHLs for 1h, 2h, 4h or 14h after which the culture supernatants were either spotted
onto A. tumefaciens A136-agar plate (containing X-Gal).
KB: ethanol control; C14: long-chain AHLs (C14-HSL and 3-oxo-C14-HSL); All: combined
mixture of C6-HSL, 3-oxo-C6-HSL, C14-HSL, and 3-oxo-C14-HSL
Figure S2. Rarefaction analyses of 16S rRNA gene in bacteria communities from different
AHLs treated activated sludge samples. These icons represent treated with KB: ethanol
control; C6: short-chain AHLs (C6-HSL and 3-oxo-C6-HSL); C14: long-chain AHLs (C14-
HSL and 3-oxo-C14-HSL); All: total mixture of C6-HSL, 3-oxo-C6-HSL, C14-HSL, and 3-
oxo-C14-HSL in 4 days or 16 days.
Table S3 Coverage and diversity indices of bacterial 16S rRNA gene libraries of the activated sludge samples
Sample ID Reads0.97
OTU ace chao1 shannon simpsonAll-4d 8912 792 879 883 5.51 0.0138
All-16d 10104 798 943 952 5.34 0.0156C14-4d 10572 883 1010 1024 5.53 0.0118C14-16d 10690 819 950 959 5.41 0.0136C6-4d 11073 872 993 1009 5.6 0.0095
C6-16d 10828 857 981 992 5.41 0.0168KB-4d 11452 872 1013 1031 5.47 0.0133
KB-16d 9683 778 894 897 5.26 0.0193
Figure S3 Hierarchical cluster analysis and relative abundance of bacterial communities from
activated sludge samples classified by Mothur at the phylum level. Sequences that could not
be classified into any known group were assigned as “Unclassified”, and other phylum parts
with the relative abundance lower than 1 % were assigned as “Others”.
Recommended