View
14
Download
0
Category
Preview:
Citation preview
Mechanisms of colistin resistance
Laurent Poirel
Emerging Antibiotic Resistance Unit, Medical and Molecular Microbiology, Department of Medicine, University of Fribourg, Fribourg, Switzerland
French INSERM European Unit, University of Fribourg (LEA-IAME), Switzerland
National Reference Center for Emerging Antibiotic Resistance (Switzerland) ESCMID eLibrary
©
by author
Colistin (Polymyxin E)
- Synthesis by Bacillus polymyxa spp colistinus- Discovered in the 1940’s- High rates of toxicity (mainly nephrotoxicity) : replacement by newer
antibiotics in 1980s- Renewed interest in mid-1990s to treat MDR Gram-negative
bacteria ESCMID eLibrary
©
by author
Colistin
Colistin is a cationic antibiotic that is composed of a cyclic heptapeptide covalently attached to a fatty acyl chain
+ -
Lipopolysacharide (LPS) of Gram-negative bacteria is composed by :- Lipid A- Core- Oligosaccharide O
Lipid A
Mechanism of action
ESCMID eLibrary
©
by author
Mechanism of action (2)
1. Fixation
2. Displacement of divalent cation (Ca2+ et Mg2+)
4. Penetration throughout the inner membrane and inhibition of the respiratory enzymes NDH2
3. Destabilisation of the outer membrane of Gram negatives
Falagas et al, Clin Infect Dis. 2005Deris et al, J Antibiot. 2013
ESCMID eLibrary
©
by author
Susceptible bacteria :
Pseudomonas aeruginosa, A. baumannii, E. coli, Klebsiella spp., Enterobacter spp.
H. influenza, Bordetella pertussis
Salmonella spp., Shigella spp.
Legionella, Stenotrophomonas maltophilia
Some Mycobacterium species, and in particular M. tuberculosis
Non-susceptible bacteria :
All gram positives
Gram neg cocci: N. gonorrhoeae, N. meningitidis
Proteus group, Serratia spp., Burkholderia spp., Brucella spp.
Anaerobes
Spectrum of activity
ESCMID eLibrary
©
by author
Capsule
LPS
Outer
membrane
Efflux
pump
Porin
Mechanisms of polymyxin resistance
ESCMID eLibrary
©
by author
Interaction between periplasmic proteins (YdeI and YgiW) and porins OmpD and OmpF, described in Salmonella enterica
Pilonieta et al, J Bacteriol. 2009
Role of porins in polymyxinresistance
ESCMID eLibrary
©
by author
Potassium antiport system, described in Yersinia pseudotuberculosis
Mutant acrAB significanty more susceptible to polymyxin B thanthe wild-type strain, described in K. pneumoniae
Bengoechea et al, Mol Microbiol. 2000
Padilla et al, AAC. 2010
Role of efflux in polymyxin resistance
Mutant KpnEF significanty more susceptible to colistin than the wild-type strain, described in K. pneumoniae
Srinivasan et al, AAC. 2010 ESCMID eLibrary
©
by author
Hyperproduction of CPS :
Upregulation of capsular biosynthesis genes reduce the interactions of polymyxins with its binding sites on the LPS,described in Klebsiella pneumoniae
Release of CPS :
Release of CPS is able to trap or bind to polymyxins reducingthe quantity of polymyxins that reaches the bacterial cellsurface, described in Klebsiella pneumoniae
Campos et al, Infect immun. 2004
Llobet et al, Microbiology. 2008
Role of capsule in polymyxin resistance
ESCMID eLibrary
©
by author
Role of LPS in polymyxin resistance
Loss of LPS :
Inactivation of lipid A biosynthesis genes (lpxA, lpxC and lpxD) cause loss of LPS and prevent the interactions of polymyxins withits binding sites on the LPS, described in A. baumannii
LPS modifications : the main mechanism of resistance to colistin :
Addition of 4-amino-4-deoxy-L-arabinose (LAra4N) and / or phosphoethanolamine (pEtN) to lipid A Increase of positive charges decreased affinity for LPS
Synthesis of L-Ara4N and pEtN mediated by PmrA / PmrB, PhoP / PhoQ, and mgrB gene
Moffatt et al, AAC. 2010-2011
ESCMID eLibrary
©
by author
Modification of the chemical structure of the LPS
Modifications :
- Addition of phosphoethanolamine(pEtN)
- Addition of 4-amino-4-deoxyl-L-arabinose (Ara4N)
Adaptation against hostile environment
Lower affinity for cationic moleculessuch as colistin :
polymyxin resistance ESCMID eLibrary
©
by author
Interplay of resistance mechanisms in Klebsiella pneumoniae
Poirel et al., Clin Microbiol Reviews 2017
ESCMID eLibrary
©
by author
phoP
Heteroresistance to colistin in K. pneumoniae
Colistin-resistant subpopulation
NETCSΔ25ntAsp191Tyr CS RCS S CS S
CS HeteroR ESCMID eLibrary
©
by author
Plasmid-mediated resistance
MCR : Mobilizable Colistin Resistance Phosphoethanolamine transferase (permanent modification of the lipid A)
ESCMID eLibrary
©
by author
The MCR-1 protein; a phosphoethanolamine transferase
- A 16-fold increase in MIC of polymyxins (colistin and polymyxin B)
- From 0.5 µg/ml (recipient E. coli) to 8 µg/ml (transconjugant) ESCMID eLibrary
©
by author
Emergence of plasmid-mediated carbapenem and colistin resistance in
E. coli in Europe
- Patient hospitalized in Switzerland, December 2015
- No history of travel abroad
- No colistin-based treatment
- Urinary tract infection
- E. coli isolate being resistant to carbapenems, fluoroquinolones, aminoglycosides (except amikacin), chloramphenicol, trimethoprim-sulfamethoxazole, and colistin (MIC of 4 µg/ml)
- Metallo-ß-lactamase VIM-1 + phosphoethanolamine transferase MCR-1
Poirel, Kieffer, Liassine, Thanh, Nordmann, Lancet Infect Dis 2016
ESCMID eLibrary
©
by author
- 7 clonally-unrelated colistin-resistant E. coli isolates recovered from clinical samples in South Africa
- All mcr-1 positive
- Different plasmids were described- Two different plasmids fully sequenced and
assembled ESCMID eLibrary
©
by author
mcr-1 is located on different plasmid backbones
An identical 2,600 bp DNA sequence was systematically identified onto the different plasmid backbones, comprising mcr-1
Insertion sequence ISApl1 was located uptsream of the mcr-1 gene, but not systematically
Comparative analysis of sequenced plamids
IncX4
IncI2
IncI2
IncP
ESCMID eLibrary
©
by author
Identification of the mcr-1 promoter
Identification of the +1 of transcription by 5’RACE-PCR
The promoter of mcr-1 was deduced in sillico
ESCMID eLibrary
©
by author
Identification of the +1 of transcription by 5’RACE-PCR
The promoter of mcr-1 was deduced in sillico
Identification of the mcr-1 promoter
ESCMID eLibrary
©
by author
MCR-1
MCR-2
Campylobacter jejuni EptA
Acinetobacter baumannii EptA
Pseudomonas aeruginosa EptA
Vibrio cholerae EptA
Enterobacter cloacae EptA
Klebsiella pneumoniae EptA
Kluyvera ascorbata EptA
Escherichia coli EptA
Pasteurella multocida EptA
Neisseria gonorrhoeae LptA
Neisseria meningitidis LptA
Moraxella osloensis MCR-OSL
Enhydrobacter aerosaccus EptA
Moraxella porci MCR-POR
Moraxella lincolnii MCR-LIN
Moraxella catarrhalis MCR-CAT
Morganella morganii EptA
Enterobacter cloacae EptB
Moraxella species as sources of MCR-like determinants
Kieffer, Nordmann and Poirel, Antimicrob Agents Chemother; in press
ESCMID eLibrary
©
by author
Moraxella species as sources of MCR-like determinants
MCR-1 MCR-2 MCR-POR MCR-OSL MCR-LIN
MCR-2 81%
MCR-POR 63% 62%
MCR-OSL 63% 64% 62%
MCR-LIN 59% 60% 59% 59%
MCR-CAT 59% 60% 59% 59% 99%
Kieffer, Nordmann and Poirel, Antimicrob Agents Chemother; in press
ESCMID eLibrary
©
by author
ISApl1 mcr-1 ISApl1orf
ISApl1 blaTEM-1 ISApl1orf
BamHIEcoRISacI
NheI
ISApl1 orf
ISApl1 mcr-1 ISApl1orf
blaTEM-1
blaTEM-1 ESCMID eLibrary
©
by author
ISApl1 ISApl1orf
GCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAGGCTGAATTTACAAT TTTGACAATTCAAG
CTACCGGCGCGATG
CTACCGGCGCGATG
TTTATTCCGCTAAAAAACTGGTATAAGAATGGAAAAATTTGAAATCCGCGTTTAAAAAGGACTAATAACA
CTGAAAATACATTTTCAAAACTGATTTTTGATGATATTAAAATAATTTTGGAGTTTTTATCTGATTATTG
IRL IRRDR DR
Tn6330.2
blaTEM-1
mcr-1 is mobilized through a composite transposon
Poirel, Kieffer, & Nordmann, Antimicrob Agents Chemother; in press
ESCMID eLibrary
©
by author
Contribution of MCR-1 in resistance to colistin
Jayol et al., Submitted for publication
p41331; plasmid carrying the mcr-1 gene
ESCMID eLibrary
©
by author
Need for a selective medium allowing selection of
bacteria being resistant to polymyxins
ESCMID eLibrary
©
by author
Bacterial colonies on the SuperPolymyxin medium
EMB medium :
- distinguish lactose fermenters (colored colonies) of lactose non-fermenters (colorless or light lavender colonies)
- lactose positive E. coli : characteristic metallic green sheen
Polymyxin-resistant K. pneumoniae.
Polymyxin-resistant lactose-positive E. coli.
Polymyxin-resistant lactose-negative E. coli.
Mix of a heavy inoculum of P. mirabilis anda low inoculum of polymyxin-resistant K. pneumoniae.
ESCMID eLibrary
©
by author
Strains tested
Gram negative strainsN=88
Colistin-susceptible(CS MICs ranging from
0.12 to 2 mg/l)N=36
Colistin-resistant(CS MICs ranging from
4 to > 128 mg/l)N=52
Intrinsic resistance(Proteus, Morganella, Providencia,
Serratia, Burkolderia)N=7
Acquired resistance(various mechanisms of resistance)
(E. coli, Klebsiella, Enterobacter, Hafnia,Acinetobacter, Pseudomonas, Stenotrophomonas)
N=45 ESCMID eLibrary
©
by author
Results
Polymyxin-resistant strains grow on the SuperPolymyxin mediumin 24h, except P. aeruginosa, S. maltophilia and Burkolderia spp.that grow in 24 to 48h.
Lowest limit of detection of the tested strains :
- below the cut-off value of 103 CFU/ml for all the polymyxin-resistant strains
- higher than 106 CFU/ml for all the polymyxin-susceptible strains
Sensitivity and specificity of the SuperPolymyxin medium : 100%,regardless of the nature of the polymyxin resistance mechanism(intrinsic, chromosomally or plasmid-encoded) and of its level(high or moderate). ESCMID eLibrary
©
by author
SuperPolymyxin medium = screening medium aimed to detect anypolymyxin-resistant Gram negative bacteria regardless of itsresistance mechanism and of its level.
May be used in :
- human medicine for detecting carriers (stools, rectal swabs)
- in veterinary medicine for epidemiological surveys
- May be used for isolated bacteria, but also clinical samplesincluding tools
Will be commercialized soon (ELITech company, France)
Might help to contain outbreaks due to polymyxin-resistantisolates and thus at least in part preserve the efficacy ofpolymyxins as last resort antibiotics.
Nordmann P, Jayol, Poirel L. A universal culture medium for screening polymyxin-resistant gram negatives. J Clin Microbiol. 2016
ESCMID eLibrary
©
by author
Need for a rapid test that maycategorize (even before MIC
determination) or confirm (in case of growth onto the SuperPolymyxin
medium) the occurrence of polymyxin resistance
ESCMID eLibrary
©
by author
• This test is based on the detection of the glucosemetabolization related to bacterial growth in presence of adefined concentration of colistin.
• Formation of acid metabolites consecutive to the glucosemetabolization was evidenced by a color change (orange toyellow) of a pH indicator (red phenol).
• In the Polymyxin NP solution with colistin :
- Strains susceptible to colistin are dead : test
- Strains resistant to colistin are alive : test
Test principle
neg
pos ESCMID eLibrary
©
by author
Lecture and interpretation
NaCl alone
CS S bacterial
suspension (control -)
CS R bacterial
suspension (control +)
Bacterial suspension
to test
Colistin-free solution
Colistin-containing solution
The strain tested is colistin resistant
• Visual inspection of the tray every hour during 2 hours.
ESCMID eLibrary
©
by author
Strains tested
Enterobacterial strainsN=200
Colistin-susceptible(CS MICs ranging from
0.12 to 2 mg/l)N=65
Colistin-resistant(CS MICs ranging from
4 to > 128 mg/l)N=135
Intrinsic resistance(Proteus, Morganella, Providencia, Serratia)
N=5
Acquired resistance(E. coli, Klebsiella, Enterobacter)
N=130
Chromosomally-encoded(pmrAB, phoPQ, mgrB alterations)
N=23
Plasmid-mediatedmcr1-gene
N=7
Unknown mechanismN=22 ESCMID eLibrary
©
by author
Results
• Isolates intrinsically resistant to colistin :
Positive results.
• Isolates with acquired resistance to colistin :
Positive results, except a single colistin-resistant E. coli isolate withCS MIC at 8 mg/l and an unknown mechanism of resistance.
• Isolates susceptible to colistin :
Negative results, except for 3 isolates with CS MICs of 1 to 2 mg/l.
• Results within 2 hours.
• High correlation between colistin resistance and positivity ofthese Rapid Polymyxin NP and conversely, colistin susceptibilityand negativity of the test :
Sensitivity = 99.3 % and Specificity = 92.3 %, compared to Brothmicrodilution method.
ESCMID eLibrary
©
by author
Rapid Polymyxin NP test directly from blood cultures
T = 4h
Positive blood culture
PROTOCOL:
- Ten-fold dilution of the positive
blood culture in NaCl 0.9%
- Polymyxin NP test
NEGATIVE
T = 4h
Colistin-susceptible strain Non enterobacterial strain
GRAM: Gram negative rods
In 450 µl of
NaCl 0.9 %
50 µl of
blood culture
Aerobic or
anaerobic
vial
50 µl of
ten-fold dilution
UNINTERPRETABLE
T = 2-4h
Colistin-resistant strain
POSITIVE
ESCMID eLibrary
©
by author
Conclusion
Multiple advantages of the Rapid Polymyxin NP test :
• Reliable
• Detects colistin-resistant enterobacterial strains from any speciesregardless the molecular mechanism of resistance to polymyxins(intrinsic, chromosomic and/or plasmid-mediated).
• Easy to perform
• Rapid (within 2 hours from bacterial colonies and within 4 hoursfrom blood cultures)
• Now available as an industrial product (ELITech MICROBIO,France)
Nordmann P, Jayol, Poirel L. Rapid detection of polymyxin resistance in ENterobacteriaceae. Emerg Infect Dis. 2016.
ESCMID eLibrary
©
by author
General conclusion
- Multiplicity of resistance mechanims
- Plasmid-mediated resistance to polymyxins represents the main threat nowadays
- Monitoring the resistance rates to colistin is crucial
- This must be done for human but also animal isolates
- Adequate breakpoints must be defined accurately
- Available screening media and detection techniques must beimplemented ESCMID eLibrary
©
by author
Recommended