Reducing agents inhibit rhinovirus-induced up-regulation of the rhinovirus receptor intercellular...

The FASEB Journal express article 10.1096/fj.02-0118fje. Published online October 4, 2002.

Reducing agents inhibit rhinovirus-induced up-regulation of the rhinovirus receptor intercellular adhesion molecule-1 (ICAM-1) in respiratory epithelial cells Alberto Papi,*,� Nikolaos G. Papadopoulos,*, � Luminita A Stanciu,*,§ Cinzia M. Bellettato, �,§

Silvano Pinamonti,¶ Klaus Degitz,** Stephen T. Holgate,* and Sebastian L. Johnston*,§ *University Medicine, University of Southampton, Southampton, UK; �Research Center on Asthma and COPD, University of Ferrara, Italy; �Allergy Unit, 2nd Department of Pediatrics, University of Athens, Greece; §Department of Respiratory Medicine, National Heart and Lung Institute, Imperial College of Science, Technology & Medicine, London, UK; ¶Department of Cell Biology, University of Ferrara; **Department of Dermatology, Ludwig-Maximilians University, Munchen, Germany Corresponding author: Alberto Papi, Research Centre on Asthma and COPD, Via Savonarola, 44100 Ferrara, Italy. E-mail: ppa@dns.unife.it ABSTRACT Rhinoviruses are the major cause of common colds and of asthma exacerbations. Intercellular adhesion molecule-1 (ICAM-1) has a central role in airway inflammation and is the receptor for 90% of rhinoviruses. Rhinovirus infection of airway epithelium induces ICAM-1. Because redox state is directly implicated in inflammatory responses via molecular signaling mechanisms, here we studied the effects of reducing agents on rhinovirus-induced ICAM-1 expression, mRNA up-regulation, promoter activation, and nuclear factor activation. To investigate the effects of rhinovirus infection on the intracellular redox balance, we also studied whether rhinovirus infection triggers the production of reactive oxygen species. We found that reduced (GSH) but not oxidized (GSSG) glutathione (1�100 µM) inhibited in a dose-dependent manner rhinovirus-induced ICAM-1 up-regulation and mRNA induction in primary bronchial and A549 respiratory epithelial cells. GSH but not GSSG also inhibited rhinovirus-induced ICAM-1 promoter activation and rhinovirus-induced NF-κB activation. In parallel, we found that rhinovirus infection induced a rapid increase of intracellular superoxide anion that was maximal at the time of NF-κB activation. This oxidant generation was completely inhibited by GSH. We conclude that redox-mediated intracellular pathways represent an important target for the therapeutic control of rhinovirus-induced diseases. Key words: asthma • rhinitis • oxidants • nuclear factor κB

R

hinoviruses are the major cause of common colds, the most common acute infectious disease in humans, and the complications of otitis, sinusitis, and bronchitis (1). Rhinoviruses also have been recently associated with the majority of exacerbations of

asthma (2) and chronic obstructive pulmonary disease (3). No licensed effective antiviral is available at the moment for the treatment of common colds (4). Also, the mainstay of asthma treatment, inhaled steroids, are poorly effective in both the treatment and the prevention of virus-induced asthma exacerbations (5, 6). Recent observations suggest that the host inflammatory response plays an important role in the pathogenesis of the common cold (7). We have recently demonstrated that asthmatic subjects have

more severe lower respiratory symptoms and reductions in lung function when infected with rhinoviruses than do normal individuals (8), indicating that the same is true of the pathogenesis of virus-induced asthma exacerbations. Although the precise mechanisms underlying virus-induced asthma exacerbations are not completely clarified, rhinoviruses are currently believed to induce asthma exacerbations by directly infecting airway epithelium (9, 10), which in turn leads to the recruitment and activation of inflammatory cells, resulting in airway inflammation (11, 12). Intercellular adhesion molecule-1 (ICAM-1) is a cell surface glycoprotein involved in leukocyte trafficking and recruitment at the site of inflammation. ICAM-1 is known to play a pivotal role in the pathogenesis of asthma (13). ICAM-1 is also the cellular receptor for the major group of rhinoviruses, which includes 90% of rhinovirus serotypes (14, 15), and its expression in bronchial epithelium is increased by rhinovirus infection both in vivo and in vitro (16, 17). These data place ICAM-1 as a central mediator of rhinovirus-induced asthma exacerbations and have lead to a search for the molecular mechanisms involved in its induction by rhinoviruses in the hope of aiding development of new therapies. We have previously shown that rhinovirus-induced ICAM-1 up-regulation in bronchial and lung epithelium is critically dependent on the activation of an NF-κB binding element in the ICAM-1 promoter (17). Oxidants are directly implicated in inflammatory responses via signaling mechanisms, including the redox-sensitive activation of transcription factors such as NF-κB (18, 19). Here, we studied whether the reducing agent glutathione prevents rhinovirus-induced up-regulation of its own cellular receptor ICAM-1 in respiratory epithelial cells and the molecular pathways affected by reducing agents. In a search of the molecular mechanisms, we also evaluated whether rhinovirus infection increases oxidant production in epithelial cells and thus modifies intracellular redox state. MATERIALS AND METHODS Cell culture Ohio HeLa cells were obtained from the Medical Research Council Common Cold Unit (Salisbury, UK), and A549 cells, a type II respiratory cell line, were obtained from the American Type Culture Collection (ATCC, Rockville, MD). Primary human bronchial epithelial cells (HBEC) were obtained by bronchial brushing from normal volunteers, as previously described (17). These cells are more than 95% cytokeratin 18-immunoreactive as assessed by immunofluorescence microscopy. Cells were split weekly and cultured as described previously (17). Virus stocks Rhinovirus type 16 (RV16) (a major group rhinovirus) was obtained from the Medical Research Council Common Cold Unit and was used for all studies described. Viral stocks were prepared by infection of sensitive cell monolayers (Ohio HeLa) as described previously (17). TCID50/ml values were determined and rhinovirus serotype was confirmed as RV16 by neutralization with serotype-specific antibodies (ATCC) as previously described (20). Virus at multiplicity of infection (MOI) of 1 was used for all the experiments. Flow cytometric analysis of ICAM-1 surface expression Flow cytometry was used to quantify the level of ICAM-1 surface expression on resting and rhinovirus-infected A549 or primary bronchial epithelial cells in the presence or in the absence of reduced (GSH) or oxidized (GSSG) glutathione (0.1�100 µM). The antioxidant dimethylsulfoxide

(DMSO, 0.1% v/v to 2% v/v) was also tested. In brief, 2×105 cells were cultured in 12-well plates. When cells were confluent, GSH, GSSG, or DMSO were added before 8 h RV16 or sham infection. The optimal time of infection for the detection of rhinovirus-induced ICAM-1 up-regulation was adopted according to previous studies (17). Primary bronchial epithelial cells were pretreated with 10 µM GSH, 10 µM GSSH, or 1% DMSO. Cells were harvested, incubated for 30 min at 4°C with saturating amounts of FITC antihuman ICAM-1 antibody (Serotec, Oxford, UK) or isotype-specific control antibody and analyzed for fluorescence by single color flow cytometry on a FACScan analyzer (Becton Dickinson, San Jose, CA) as described previously (17). Mean fluoresence intensity was measured and calculated after subtraction of background staining. The effects of either GHS or GSSG (1�100 µM) were also evaluated on ICAM-1 up-regulation induced by tumor necrosis factor (TNF)-α (200 units/ml) or IFN-γ (100 units/ml) in A549 cells. Reverse transcriptase-polymer chain reaction (RT-PCR) analysis of ICAM-1 mRNA expression RT-PCR was used to evaluate ICAM-1 mRNA expression in resting and rhinovirus-infected cells. Experiments on A549 cells were conducted in the presence or absence of 1�100 µM GSH and GSSG or 0.1�1% v/v DMSO. Primary bronchial epithelial cells were pretreated with either 10 µM GSH, 10 µM GSSG, or medium alone. Cells were harvested, and RNA was extracted and used for a quantitative estimation of ICAM-1 mRNA expression by specific RT-PCR as previously described (17). PCR products (10 µl) were electophoresed, densitometry was performed using a scanning densitometer (Epson scanner), and densitometric analysis was obtained with an appropriate program (Phoretic, Biomerea, UK). In parallel, PCR for adenine phosphoribosyltransferase mRNA (APRT) was performed in each sample to evaluate uniformity of loading and of RT-amplificable RNA (17). These methods were previously shown to give linear quantification of input mRNA and have been shown to give good quantification of mRNA in the experimental conditions adopted here (17, 21). ICAM-1 promoter activation An ICAM-1 promoter-chloramphenicol acetyltransferase (CAT) construct containing the full-length sequence (�1160 bp) of the ICAM-1 5'-flanking region linked to the coding region of the CAT reporter gene was used for transfection (22). A549 cells were transfected with the reporter construct (10 µg) by the calcium phosphate coprecipitation technique as previously described (17). Transfected cells were cultured in 10% MEM overnight. GSH or GSSG (both 10 µM) or 1% v/v DMSO were added before the addition of RV16 or medium alone. Twenty-four hours later, cells were harvested, proteins were extracted, and protein-equivalent aliquots were assayed for CAT activity (17). Acetylated and unacetylated forms of chloramphenicol were resolved by thin-layer chromatography, visualized by autoradiography, and measured on a scintillation counter. CAT activity was expressed as percentage conversion of chloramphenicol into its acetylated derivatives. Electrophoretic mobility shift assay (EMSA) Confluent A549 or primary bronchial epithelial cells were pretreated with 10 µM GSH or 10 µM GSSG before the addition of RV16 or medium alone for 30 min. The optimal time of infection for the evaluation of NF-κB activation was adopted according to previous studies (17). Nuclear extracts were obtained as previously described (17).

A double-stranded oligonucleotide sequence of ICAM-1 (�199 to �170 5'ATTGCTTTAGCTTGGAAATTCCGGAGCTGA [17]) containing the �187/�178 NF-κB-binding site was used as probe (Oswell DNA Service, Southampton, UK). ΝF-κΒ and AP-1 consensus double-stranded oligonucleotides were obtained commercially (Promega, Madison, WI). Probes were labeled and incubated with 5 µg of nuclear protein as previously reported (17). Fiftyfold molar excess unlabeled oligonucleotides were used for cold competition. Complexes were resolved on 5% nondenaturing polyacrylamide gels. Dried gels were autoradiographed at �70°C overnight. Intracellular oxidant production The intracellular production of superoxide anion (O2

�) after rhinovirus infection was evaluated, in the presence or absence of 10 µM GSH, by superoxide dismutase (SOD)-inhibited cytochrome c reduction kinetics as previously described (23). Confluent A549 or HBEC cells were pretreated with 10 µM GSH before the addition of RV16 or medium alone for different time intervals (from 20 min to 8 h). For selected experiments, filtration of the virus from inoculum, to remove viral particles, was performed as previously described in the evaluation of the effects of RV16 on ICAM-1 up-regulation (17), and filtered virus stocks were used as negative control. Cells were then washed three times in cold phosphate-buffered saline and harvested. The cell pellet was resuspended in phosphate buffer (10 mM, pH 7.2), and cell lysis was obtained by repeated (three times) freezing and thawing. The cell homogenate was then ultracentrifuged at 20,000g for 30 min, cell membrane fragments were precipitated, and the supernatant (cytosol) was used for cytochrome c reduction assay. Protein content was determined photometrically using the BioRad (Hercules, CA) protein assay. Cytochrome c reduction kinetics Kinetics were carried out in 2-ml quartz cuvettes at 37°C for 20 min in a Uvikon 860 (Kontron Instruments, Milan, Italy) spectrophotometer in the presence or in the absence of 500 IU/ml SOD. Concentration of cytochrome c from beef heart (Sigma, St. Louis, MO) was 10�5 M. Absorbance readings were taken at 550 nm (peak of reduced cytochrome). Newly generated O2

� was measured in each sample and expressed as micromolar, according to standardized procedures (24). Measurements were based on absorbance differences in the presence or absence of SOD, after 5 min of kinetics, when the kinetic slope of cytochrome c reduction was steepest. Data were normalized per milligram of protein. Statistical analysis Data were expressed as mean ±SE, and comparison between groups was performed by paired and unpaired Student�s t tests. All experiments were carried out at least four times except where indicated. RESULTS ICAM-1 surface expression on A549 respiratory epithelial cells ICAM-1 was constitutively expressed on A549 cells (mean fluorescence intensity 15.2 ± 2.1), and its expression was significantly increased by 8 h RV16 infection (4.2 ± 0.8-fold over control noninfected cells; P<0.01) according to previous reports (17, 21). Pretreatment with GSH and DMSO, but not with GSSG, inhibited rhinovirus ICAM-1 induction in a dose-response manner (Fig. 1a).

Both TNF-α and IFN-γ increased ICAM-1 surface expression (5.3 ± 1.2 and 6.4 ± 0.8-fold over control nonstimulated cells, respectively; P<0.01). Pretreatment with GSH, but not with GSSG, inhibited TNF-α−induced ICAM-1 up-regulation in a dose-response manner (Fig. 1b). In contrast, GSH only partially inhibited IFN-γ-induced ICAM-1 up-regulation at the highest concentration used (mean fluorescence intensity 12.7 ± 1.9 in control samples; mean fluorescence intensity 80.4 ± 10.1 and 57.3 ± 9.6 in IFN-γ-stimulated and IFN-γ-stimulated and 100 µM GSH pretreated samples, respectively; P<0.05) ICAM-1 surface expression on primary bronchial epithelial cells ICAM-1 was constitutively expressed on primary bronchial epithelial cells (mean fluorescence intensity 13.5 ± 2.1). As previously reported (17, 21), 8 h RV16 infection significantly increased ICAM-1 surface epithelial expression to 6.1 ± 1.8-fold over control noninfected cells (P<0.01). Pretreatment of primary bronchial epithelial cells with 10 µM GSH or 1% v/v DMSO significantly inhibited rhinovirus-induced ICAM-1 up-regulation (44 ± 3.3% rhinovirus-induced ICAM-1 and 48 ± 3.8% rhinovirus-induced ICAM-1, respectively, P<0.05). Conversely, 1 µM GSSG was ineffective (data not shown). ICAM-1 mRNA analysis Uniform processing was confirmed by adenine phosphoribosyltransferase (APRT) RT-PCR performed in parallel. Densities of APRT products showed <10% variability among all samples, and ICAM-1 product densities were normalized according to the APRT values. In basal conditions, A549 and HBEC cells expressed very low levels of ICAM-1 mRNA. RV16 strongly induced ICAM-1 mRNA expression after 8 h infection. GSH and DMSO, but not GSSG, inhibited rhinovirus induction of ICAM-1 mRNA (Fig. 2a and 2b) in a dose-dependent manner. ICAM-1 promoter activation As previously demonstrated (17, 21) and as shown in Figure 3, RV16 induced ICAM-1 promoter activity, compared with media-inoculated cells (acetylation 3.4 ± 0.8% and 39.4 ± 6.5% for control and infected cells respectively, P<0.001). GSH (10 µM) or 1% v/v DMSO pretreatment, but not pretreatment with GSSG, completely inhibited rhinovirus induction of ICAM-1 promoter activity. Effect of reducing agents on rhinovirus-induced NF-κB activation As we previously showed that rhinovirus induction of ICAM-1 promoter activity was critically dependent on up-regulation of NF-κB proteins binding to the �187/�178 NF-κB-binding site on the ICAM-1 promoter, studies were undertaken to investigate whether reducing agents inhibited the binding activity of NF-κB in nuclei extracted from infected A549 lung epithelial cells, using labeled probes containing the ICAM-1 �187/�178 NF-κB-binding site in EMSAs. As previously documented and as shown in Figure 4a (lane 3), two protein-DNA complexes were induced in nuclear extracts from rhinovirus-infected A549 cells compared with noninfected cells (Fig. 4a, lane 2). Competition experiments (Fig. 4a, lanes 4 and 5) confirmed the specificity of the NF-κB binding. GSH (10 µM) (Fig. 4a, lane 6), but not GSSG (10 µM) (Fig. 4a, lane 7), clearly reduced rhinovirus induction of the NF-κB binding to control levels. Similar results were obtained in primary bronchial epithelial cells. (Fig. 4b)

Intracellular oxidant production O2

� production was measured at different time points, including the time interval that immediately follows rhinovirus infection, that is, when the molecular activation of NF-κB occurs. No spontaneous O2

� production was observed in control samples at any time point. O2� production

rapidly increased in the cytosol of A549 cells after RV16 infection. Significant O2� generation was

detectable at 20 min, was maximal at 1 h, and was still significantly increased at 8 h in A549 cells (Fig. 5). To investigate virus specificity of the induction of superoxide (as we have previously confirmed for induction of ICAM-1 and NF-κB by rhinovirus [17, 21]), induction of superoxide was investigated with an inoculum from which virus had been removed by molecular weight filtration as previously described (17, 21). Filtered virus did not induce any O2

� production, confirming the virus specificity of the induction observed (Fig. 5). GSH (10 µM) pretreatment completely inhibited the O2

� production induced by rhinovirus at each time point. Similar results were obtained in primary bronchial epithelial cells, although induction occurred to a lesser extent. Interestingly, at variance with A549 cells, a baseline O2

� production was observed in resting conditions (2.1 ± 0.3 µM/mg protein). A significant increase of O2

� production was found after 20 min infection (4.9 ± 0.5 µM/mg protein, P<0.05) DISCUSSION ICAM-1, the receptor of 90% of rhinoviruses, is an adhesion protein that has a central role in inflammatory cell recruitment following rhinovirus infection. We have previously demonstrated that rhinovirus infection of respiratory epithelial cells increases cell surface expression of ICAM-1 via a mechanism that is critically NF-κB-dependent. In this study, we investigated the effects of reducing agents on rhinovirus-induced ICAM-1 expression. We have demonstrated that reducing agents inhibited rhinovirus induction of surface ICAM-1 on both primary bronchial epithelial cells and the type II respiratory epithelial cell line A549. Reducing agents exerted dose-dependent inhibition of rhinovirus-induced ICAM-1 mRNA expression and completely suppressed rhinovirus-induced ICAM-1 promoter activation and NF-κB activation. Induction of ICAM-1 by another NF-κB mediated stimulus, TNF-α, was also completely inhibited by reducing agents. Finally, we demonstrated that rhinovirus infection rapidly induced intracellular oxidant levels with a kinetic similar to the time course of induction of NF-κB activation. Reducing agents completely inhibited rhinovirus induction of oxidant formation. The fact that the reduced, but not the oxidized, form of glutathione protects against rhinovirus induction of ICAM-1, as well as the results obtained with a different reducing agent, DMSO, demonstrates that these results are not related to the chemical structure of the compounds but to their effect on redox state. In this study, we have shown that extracellular redox state changes influence the intracellular mechanisms regulating rhinovirus induction of protein expression, including mRNA expression as well as transcription factor and promoter activation. The negative modulation by a reducing agent on virus-induced gene promoter activation has not been described before. Epithelial cells take up environmental glutathione by a redox-dependent mechanism (25), and this transport system influences intracellular glutathione and its reducing activity, depending on the presence of reduced thiols or disulfides in the extracellular environment (26). Note that the concentrations of GSH used in this study are those present in the fluid that line respiratory epithelial cells (27). The ICAM-1 promoter contains several potential transcription factor binding sites (17, 28). We have recently reported that the �187/�178 NF-κB site on the ICAM-1 promoter is necessary and sufficient for rhinovirus induction of ICAM-1 promoter activity (17). These data strongly suggest that GSH inhibition of rhinovirus-induced ICAM-1 up-regulation occurs via inhibition of NF-κB

activation. This interpretation is supported by the data in Figure 4b indicating that GSH inhibits rhinovirus induction of NF-κB binding to a probe containing the �187/�178 NF-κB binding site on the ICAM-1 promoter, indicating that this compound is effective in reducing rhinovirus-induced NF-κB activation. Furthermore, the critical role of the redox state in the regulation of NF-κB activation is well-documented (29, 30). With the identification of signaling intermediates along the cascade that leads to NF-κB activation, the number of redox-sensitive sites is rapidly increasing. Redox-sensitive steps are likely to depend on the nature of the NF-κB activator, the type of oxidants involved, as well as the cell type under investigation (18, 19). Here, we found that highly reactive O2

� is produced within minutes after rhinovirus infection, documenting for the first time that the intracellular oxidant production that follows rhinovirus infection has a a rapid early spike followed by a slow decline but that increased production lasts for hours. Interestingly, this kinetic fits well with the kinetic we have previously described (17) for the induction of NF-κB binding to the �187/�178 NF-κB binding site on the ICAM-1 promoter, in accordance with the involvement of oxidant stress in the activation of NF-κB-dependent induction of ICAM-1. The fact that GSH blocks both oxidant production and NF-κB binding and promoter activation in response to rhinovirus infection further supports this hypothesis. The inhibition exerted by GSH on the up-regulation of ICAM-1 induced by another stimulus that involves the activation of the NF-κB pathway, namely TNF-α (31, 32), and the lower level of GSH inhibition of the induction by a stimulus, such as IFN-γ, that acts on ICAM up-regulation through a pathway that is more dependent on transcription factors other than NF-κB (33, 34), also indirectly supports this hypothesis. The prevention or treatment of rhinovirus infections has been attempted in many clinical trials since the discovery of the virus. Despite the effort and resources expended, no antiviral drugs are currently marketed for the prevention or treatment of rhinovirus infection (4). Given the known role of ICAM-1 in inflammatory cell recruitment and activation at sites of allergic inflammation (13), the lymphocyte and eosinophil infiltration observed during experimental rhinovirus infection (11), it�s role as a rhinovirus receptor (14), and the fact that rhinovirus infection up-regulates respiratory epithelial ICAM-1 expression (17), ICAM-1 is likely to play a critical role in promoting airway inflammation during virus-induced asthma exacerbations. Our demonstration that reducing agents inhibit this induction indicates that they represent attractive options for the development of treatment for rhinovirus-induced diseases, including the common cold and exacerbations of respiratory diseases such as asthma. The mechanisms we have identified may also help to explain the partial efficacy of another reducing agent, vitamin C, in reducing the clinical severity of common colds (35). ACKNOWLEDGMENTS These studies were supported by the National Asthma Campaign grant no. 332; the University of Ferrara, Italy; the Deutsche Forschungsgemeinschaft Grant no. 405/5 (KD); and Schering Plough. We are grateful to Dr. Stephen Wright Caughman for the generous donations of the reporter plasmid. REFERENCES

1. Stanway, G. (1994) Rhinoviruses. In Encyclopedia of Virology (Webster, R., and Granoff, A., eds) Vol. 3 pp. 1253�1259, Academic Press, London

2. Johnston, S. L., Pattemore, P. K., Sanderson, G., Smith, S., Lampe, F., Josephs, L.,

Symington, P., O'Toole, S., Myint, S. H., Tyrrell, D. A., and et al. (1995) Community study

of role of viral infections in exacerbations of asthma in 9-11 year old children. Br Med J 310, 1225�1229

3. Seemungal, T., Harper-Owen, R., Bhowmik, A., Moric, I., Sanderson, G., Message, S.,

Maccallum, P., Meade, T. W., Jeffries, D. J., Johnston, S. L., and Wedzicha, J. A. (2001) Respiratory Viruses, Symptoms, and Inflammatory Markers in Acute Exacerbations and Stable Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med 164, 1618�1623

4. Jefferson, T. O., and Tyrrell, D. (2001) Antivirals for the common cold (cochrane review).

Cochrane Database Syst Rev 3

5. Doull, I. J., Lampe, F. C., Smith, S., Schreiber, J., Freezer, N. J., and Holgate, S. T. (1997) Effect of inhaled corticosteroids on episodes of wheezing associated with viral infection in school age children: randomised double blind placebo controlled trial [see comments]. Bmj 315, 858�862

6. Wilson, N. M., and Silverman, M. (1990) Treatment of acute, episodic asthma in preschool

children using intermittent high dose inhaled steroids at home. Arch Dis Child 65, 407�410

7. Winther, B., Gwaltney, J. M., Jr., Mygind, N., and Hendley, J. O. (1998) Viral-induced rhinitis. Am J Rhinol 12, 17�20

8. Corne, J. M., Marshall, C., Smith, S., Schreiber, J., Sanderson, G., Holgate, S. T., and

Johnston, S. L. (2002) Frequency, severity, and duration of rhinovirus infections in asthmatic and non-asthmatic individuals: a longitudinal cohort study. Lancet 359, 831�834

9. Gern, J. E., Galagan, D. M., Jarjour, N. N., Dick, E. C., and Busse, W. W. (1997) Detection

of rhinovirus RNA in lower airway cells during experimentally induced infection. Am J Respir Crit Care Med 155, 1159�1161

10. Papadopoulos, N. G., Bates, P. J., Bardin, P. G., Papi, A., Leir, S. H., Fraenkel, D. J., Meyer,

J., Lackie, P. M., Sanderson, G., S.T., H., and S.L., J. (2000) Rhinoviruses infect the lower airways. J Infect Dis 181, 1875�1884

11. Fraenkel, D. J., Bardin, P. G., Sanderson, G., Lampe, F., Johnston, S. L., and Holgate, S. T.

(1995) Lower airways inflammation during rhinovirus colds in normal and in asthmatic subjects. Am J Respir Crit Care Med 151, 879�886

12. Calhoun, W. J., Dick, E. C., Schwartz, L. B., and Busse, W. W. (1994) A common cold

virus, RV16, potentiates airway inflammation after segmental antigen bronchoprovocation in allergic subjects. J Clin Invest 94, 2200�2208

13. Wegner, C. D., Gundel, R. H., Reilly, P., Haynes, N., Letts, L. G., and Rothlein, R. (1990)

Intercellular adhesion molecule-1 (ICAM-1) in the pathogenesis of asthma. Science 247, 456�459

14. Greve, J. M., Davis, G., Meyer, A. M., Forte, C. P., Yost, S. C., Marlor, C. W., Kamarck, M.

E., and McClelland, A. (1989) The major human rhinovirus receptor is ICAM-1. Cell 56, 839�847

15. Uncapher, C. R., DeWitt, C. M., and Colonno, R. J. (1991) The major and minor group receptor families contain all but one human rhinovirus serotype. Virology 180, 814�817

16. Grunberg, K., Sharon, R. F., Hiltermann, T. J., Brahim, J. J., Dick, E. C., Sterk, P. J., and

Van Krieken, J. H. (2000) Experimental RV16 infection increases intercellular adhesion molecule-1 expression in bronchial epithelium of asthmatics regardless of inhaled steroid treatment. Clin Exp Allergy 30, 1015�1023

17. Papi, A., and Johnston, S. L. (1999) Rhinovirus infection induces expression of its own

receptor intercellular adhesion molecule 1 (ICAM-1) via increased NF-kappaB- mediated transcription. J Biol Chem 274, 9707�9720

18. Li, N., and Karin, M. (1999) Is NF-kappaB the sensor of oxidative stress? FASEB J 13,

1137�1143

19. Janssen-Heininger, Y. M., Poynter, M. E., and Baeuerle, P. A. (2000) Recent advances towards understanding redox mechanisms in the activation of Nuclear Factor kappaB. Free Radic Biol Med 28, 1317�1327

20. Johnston, S. L., and Tyrrell, D. A. J. (1997) Rhinoviruses. In Diagnostic procedures of viral,

rickettsial and clamydial infections. (Lennette, E. H., and Schmidt, N. J., eds) pp. 553�563, American Public Health Association, Washington, DC

21. Papi, A., Papadopoulos, N. G., Degitz, K., Holgate, S. T., and Johnston, S. L. (2000)

Corticosteroids inhibit rhinovirus-induced intercellular adhesion molecule-1 up-regulation and promoter activation on respiratory epithelial cells. J Allergy Clin Immunol 105, 318�326

22. Muller, S., Kammerbauer, C., Simons, U., Shibagaki, N., Li, L. J., Caughman, S. W., and

Degitz, K. (1995) Transcriptional regulation of intercellular adhesion molecule-1: PMA- induction is mediated by NF kappa B. J Invest Dermatol 104, 970�975

23. Pinamonti, S., Muzzoli, M., Chicca, M. C., Papi, A., Ravenna, F., Fabbri, L. M., and

Ciaccia, A. (1996) Xanthine oxidase activity in bronchoalveolar lavage fluid from patients with chronic obstructive pulmonary disease. Free Radic Biol Med 21, 147�155

24. Halliwell, B., and Gutteridge, J. (1999) Free Radical Biology & Medicine, Oxford

University Press, Oxford, UK

25. van Klaveren, R. J., Hoet, P. H., Demedts, M., and Nemery, B. (1999) Investigation of the transport of intact glutathione in human and rat type II pneumocytes. Free Radic Res 30, 371�381

26. Iantomasi, T., Favilli, F., Marraccini, P., Magaldi, T., Bruni, P., and Vincenzini, M. T.

(1997) Glutathione transport system in human small intestine epithelial cells. Biochim Biophys Acta 1330, 274�283

27. Rahman, I., and MacNee, W. (2000) Oxidative stress and regulation of glutathione in lung

inflammation. Eur Respir J 16, 534�554

28. Ledebur, H. C., and Parks, T. P. (1995) Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells. Essential roles of a variant NF-kappa B site and p65 homodimers. J Biol Chem 270, 933�943

29. True, A. L., Rahman, A., and Malik, A. B. (2000) Activation of NF-kappaB induced by

H2O2 and and TNF-alpha and its effects on ICAM-1 expression in endothelial cells. Am J Physiol Lung Cell Mol Physiol 279, L302�311

30. Cho, S., Urata, Y., Iida, T., Goto, S., Yamaguchi, M., Sumikawa, K., and Kondo, T. (1998)

Glutathione downregulates the phosphorylation of I kappa B: autoloop regulation of the NF-kappa B-mediated expression of NF-kappa B subunits by TNF-alpha in mouse vascular endothelial cells. Biochem Biophys Res Commun 253, 104�108

31. Krunkosky, T. M., Fischer, B. M., Martin, L. D., Jones, N., Akley, N. J., and Adler, K. B.

(2000) Effects of TNF-alpha on expression of ICAM-1 in human airway epithelial cells in vitro. Signaling pathways controlling surface and gene expression. Am J Respir Cell Mol Biol 22, 685�692

32. Chen, C., Chou, C., Sun, Y., and Huang, W. (2001) Tumor necrosis factor alpha-induced

activation of downstream NF-kappaB site of the promoter mediates epithelial ICAM-1 expression and monocyte adhesion. Involvement of PKCalpha, tyrosine kinase, and IKK2, but not MAPKs, pathway. Cell Signal 13, 543�553

33. Look, D. C., Pelletier, M. R., and Holtzman, M. J. (1994) Selective interaction of a subset of

interferon-gamma response element-binding proteins with the intercellular adhesion molecule-1 (ICAM-1) gene promoter controls the pattern of expression on epithelial cells. J Biol Chem 269, 8952�8958

34. Jahnke, A., and Johnson, J. P. (1994) Synergistic activation of intercellular adhesion

molecule 1 (ICAM-1) by TNF-alpha and IFN-gamma is mediated by p65/p50 and p65/c-Rel and interferon-responsive factor Stat1 alpha (p91) that can be activated by both IFN-gamma and IFN-alpha. FEBS Lett 354, 220�226

35. Atmar, R. L., and Turner, R. B. (2001) Previously conducted trials to evaluate new avenues

of therapy. In Asthma and respiratory infections (Skoner, D. P., ed) Vol. 154 pp. 259�266, Marcel Dekker AG, New York

Received February 6, 2002; accepted August 13, 2002.

Fig. 1

Figure 1. A) Effects of reducing agents on rhinovirus 16-induced ICAM-1 surface expression on A549 respiratory epithelial cells. ICAM-1 expression was measured by flow cytometry. Data are mean ± SE of at least four separate experiments. ** P<0.01, *** P<0.001 vs. samples infected but not pretreated. RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione; DMSO, dimethyl sulfoxide. B) Effects of glutathione on tumor necrosis factor α-induced ICAM-1 surface expression on A549 respiratory epithelial cells. ICAM-1 expression was measured by flow cytometry. Data are mean ±SE of at least four separate experiments. ** P<0.01, *** P<0.001 vs. samples stimulated but not pretreated. TNFα, tumor necrosis factor α; GSH, reduced glutathione; GSSG, oxidized glutathione.

Fig. 2

Figure 2. A) Effect of reducing agents on rhinovirus 16-induced ICAM-1 mRNA expression in A549 cells. Representative ethidium bromide-stained gel electrophoreses of products of four separate RT-PCR for APRT (housekeeping gene) and ICAM-1 in A549 respiratory epithelial cells. RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione; DMSO, dimethyl sulfoxide. B) Effect of 10 µM glutathione on rhinovirus 16-induced ICAM-1 mRNA expression in primary bronchial epithelial cells. Representative ethidium bromide-stained gel electrophoreses of products of three separate RT-PCR for APRT (housekeeping gene) and ICAM-1. RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione.

Fig. 3

Figure 3. Inhibition by reducing agents of rhinovirus 16-induced ICAM-1 promoter activation in A549 respiratory epithelial cells. ICAM-1 promoter activation is expressed as percentage of chloramphenicol acetylation. Data are mean ±SE of at least five separate experiments. ***P<0.001 vs. control noninfected cells. RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione; DMSO, dimethyl sulfoxide.

Fig. 4

Figure 4. A) Inhibition by reduced glutathione of rhinovirus-induced binding of NF-κB to the –187/–178 NF-κB site in the ICAM-1 promoter. Representative autoradiograph of two separate electrophoretic mobility shift assays of nuclear lysates prepared from uninfected (lane 2) or rhinovirus 16-infected A549 cells in the absence (lane 3) or in the presence of 10 µM GSH (lane 6) or 10 µM GSSG (lane 7). Cold competition with NF-κB (lane 4) and irrelevant (AP-1) (lane 5) consensus competitors were performed to confirm the NF-κB specificity of the signal. RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione. B) Inhibition by reduced glutathione of rhinovirus-induced binding of NF-κB to the –187/–178 NF-κB site in the ICAM-1 promoter. Representative autoradiograph of two separate electrophoretic mobility shift assays of nuclear lysates prepared from uninfected (lane 2) or rhinovirus 16-infected primary bronchial epithelial cells in the absence (lane 3) or in the presence of 10 µM GSH (lane 4) or 10 µM GSSG (lane 5). RV16, rhinovirus type 16; GSH, reduced glutathione; GSSG, oxidized glutathione.

Fig. 5

Figure 5. Cytosolic superoxide anion (O2

–) production by A549 respiratory epithelial cells cultured for different intervals in the absence (open circles) or in the presence of either rhinovirus (closed circles) or inoculum from which rhinovirus had been filtered (gray circles). ***P<0.001 vs. control noninfected cells.