Detection of P-glycoprotein in the Golgi apparatus of drug-untreated human melanoma cells

DETECTION OF P-GLYCOPROTEIN IN THE GOLGI APPARATUSOF DRUG-UNTREATED HUMAN MELANOMA CELLSAgnese MOLINARI1, Annarica CALCABRINI 1, Stefania MESCHINI1, Annarita STRINGARO1, Donatella DEL BUFALO3,Maurizio CIANFRIGLIA 2 and Giuseppe ARANCIA1*1Laboratorio di Ultrastrutture, Istituto Superiore di Sanita`, Rome, Italy2Laboratorio di Immunologia, Istituto Superiore di Sanita`, Rome, Italy3Laboratorio di Chemioterapia Sperimentale Preclinica, Istituto Regina Elena—CRS, Rome, Italy

The intracellular location of the MDR1 gene product,known as P-glycoprotein (P-gp), has been detected by flowcytometry in 3 stabilized human melanoma cell lines whichhad never undergone cytotoxic drug treatment and did notexpress P-gp on the plasma membrane. In addition, MDR1mRNA expression was revealed by RT-PCR in the same celllines. Immunofluorescence microscopy, performed by usingthe same 2 monoclonal antibodies (MM4.17 and MRK-16) asemployed in the flow-cytometric analysis, revealed the pres-ence of P-gp intracytoplasmically, in a well-defined peri-nuclear region. Double immunofluorescence labelling andimmunoelectron microscopy strongly suggested the locationof the transporter molecule in the Golgi apparatus. The sameobservations have been obtained on a primary culture from ametastasis of human melanoma. Analysis of the expression ofanother membrane transport protein, the multidrug-resis-tance-related protein (MRP1), showed that it was present inthe cytoplasm of all the melanoma cell lines examined. MRP1also showed Golgi-like localization. The study by laser scan-ning confocal microscopy on the intracellular localization ofthe anti-tumoral agent doxorubicin (DOX) during the drug-uptake and -efflux phases, indicated the Golgi apparatus as apreferential accumulation site for the anthracyclinic antibi-otic. P-gp function modulators (verapamil and cyclosporin A)were able to modify DOX intracytoplasmic distribution andto increase drug intracellular concentration and cytotoxiceffect in melanoma cells. On the contrary, MRP1 modulators(probenecid and genistein) did not significantly influenceeither DOX efflux and distribution or the sensitivity ofmelanoma cells to the cytotoxic drug. Int. J. Cancer 75:885–893, 1998.r 1998 Wiley-Liss, Inc.

The P-glycoprotein (P-gp) molecule, encoded in humans by theMDR1 gene, is a member of the evolutionary highly conservedfamily of the ATP-binding cassette (ABC) transporters. The role ofthis molecule in altered drug translocation across tumor-cellmembrane has been extensively studied, and several models havebeen discussed. Among these, P-gp has been proposed as anenergy-dependent drug-efflux pump, extruding a broad spectrum ofstructurally unrelated compounds from the cells, thus decreasingtheir intracellular concentration below their active cytotoxic thresh-old. When P-gp molecules are over-expressed on the plasmamembrane of various tumor cells, the emergence of a multidrug-resistance (MDR) phenotype can occur after initial chemotherapy,often accounting for its failure. However, P-gp molecules werefound to be expressed and functionally active in normal cells, suchas epithelial cells of liver and kidney or immune-competent cellssuch as NK cells, macrophages and T-lymphocytes, where theyhave a de-toxifying function (Gottesman and Pastan, 1993).Published data suggest that several cellular compartments may bepotential sites for P-gp functional activity: in MDR cells, P-gp hasbeen found in the nucleus (Baldiniet al., 1995) and in the Golgiapparatus (Willinghamet al., 1987; Molinari et al., 1994), andhighly expressed in the plasma membrane. Nuclear P-gp may beinvolved in the active removal of cytotoxic drugs from theirintranuclear target (DNA), whereas P-gp located in the Golgiapparatus may play a role in intracellular drug transport from thenucleus to the cell periphery.

However, tumor cells can exhibit the MDR phenotype withoutover-expression of P-gp. This non P-gp-mediated MDR is gener-ally caused by over-expression of a second multidrug-resistance-associated-protein (MRP) gene encoding a 190-kDa membrane-bound glycoprotein (Coleet al.,1992). The possible association ofMRP with clinical drug resistance has not yet been fully estab-lished.

In an earlier study (Molinariet al., 1994), we identified theintracellular compartment expressing P-gp in MDR human breast-cancer cells (MCF-7), by using either MAb MM4.17 (Cianfrigliaetal., 1994), which recognizes a defined human-specific epitope onthe P-glycoprotein extracellular domain, or the well-known MAbMRK-16. We also used laser scanning confocal microscopy(LSCM) to examine the intracellular distribution of the anti-tumoral compound doxorubicin (DOX), in the presence andabsence of energy metabolism inhibitors or the multidrug-transportblocker verapamil. We found that a significant level of P-gp wasexpressed intracellularly in MDR MCF-7 cells and that the drugtransporter was located in the Golgi apparatus, which was wherethe DOX molecules mainly accumulated. Further LSCM investiga-tions (Meschiniet al.,1994) confirmed the Golgi apparatus as thepreferential intracytoplasmic site of DOX accumulation.

In the present study we demonstrate the presence of P-gp in theGolgi apparatus in several human melanoma cell lines, which donot express the transporter on the plasma membrane. The intrinsicMDR1 gene and P-gp expression in up to 76% of 33 humanmelanoma cell lines was reported by Bergeret al. (1994). Incontrast, other authors reported that P-gp expression in melanomacells is a rare event and probably not responsible for the knowndrug resistance of melanoma (Schadendorfet al., 1995). Inaddition, various levels ofMRPmRNA were detected in a numberof melanoma cell lines, and inverse correlation was found betweencell sensitivity to anthracyclines andMRP-gene expression (Bergeret al., 1997). Thus, controversial opinions exist on the P-gp-mediated MDR in malignant melanoma.

Results here reported show that cultured human melanoma cellsexpress intracellularly both the drug transporters P-gp and MRP1and strongly suggest that P-gp in the Golgi apparatus seems to playa pivotal role in intracellular drug transport.

MATERIAL AND METHODS

Cell cultures

Established human melanoma cell lines (M14, H14, JR8) andhuman primary-culture melanoma cells (CS), obtained from thebiopsy of a patient at the Surgery Department of Regina Elena

Contract grant sponsor: National Research Council (CNR); Contractgrant number: 95.00468.39. Special Project ACRO.

*Correspondence to: Laboratorio di Ultrastrutture, Istituto Superiore diSanita, Viale Regina Elena 299, 00161 Rome, Italy. Fax: (39) 6 49387140.E-mail: arancia@ul.net.iss.it

Received 24 July 1997; Revised 5 November 1997

Int. J. Cancer:75,885–893 (1998)

r 1998 Wiley-Liss, Inc.

Publication of the International Union Against CancerPublication de l’Union Internationale Contre le Cancer

Cancer Institute (Rome, Italy), were grown in RPMI-1640 medium(Flow, Irvine, UK) supplemented with 1% non-essential aminoacids, 1% L-glutamine, 100 IU/ml penicillin, 100 IU/ml streptomy-cin and 10% FCS (Flow) at 37°C in a 5%-CO2 humidifiedatmosphere in air.

The parental drug-sensitive human breast-cancer MCF-7 cellline (MCF-7 WT) and its derivative MDR variant (MCF-7 DX)were kindly provided by Dr. K. Cowan (NCI, Bethesda, MD).These cells grow as monolayers in RPMI-1640 medium supple-mented with 10% FCS, 1% L-glutamine and 0.1% gentamicin at37°C in a 5%-CO2 humidified atmosphere in air. MCF-7 DX cellswere grown in complete medium containing 10 µM DOX(Adriblastina, Pharmacia, Milan, Italy).

The parental drug-sensitive human adenocarcinoma LoVo cellline (LoVo WT) and its derivative MDR variant (LoVo MDR) weregrown in Ham’s F12 medium (Flow) supplemented with 10% FCS,1% L-glutamine and 1% BME vitamin solution 1003 at 37°C in a5%-CO2 humidified atmosphere in air.

Cytotoxicity studiesThe clonogenic survival test was used to determine cell sensitiv-

ity to DOX, DOX plus P-gp modulators (verapamil, cyclosporin A)or DOX plus MRP1 modulators (probenecid, genistein). We plated400 cells in tissue-culture dishes (60 mm) and allowed them toattach for 24 hr before treatment with 1.7 µM DOX (Pharmacia) for1 hr in the presence or in the absence of 10 µM verapamil, 5 µMcyclosporin A, 1 mM probenecid or 200 µM genistein (all fromSigma, St. Louis, MO). After 8 days of incubation, cell colonieswere fixed with 95° ethanol for 15 min and stained with a solutionof methylene blue in 80° ethanol for 1 hr. Only colonies composedof more than 50 cells were evaluated. The surviving fraction wascalculated by dividing the absolute survival of cells treated with thedrugs, in the presence or in the absence of the transportermodulators, by the absolute survival of cells treated with P-gp orMRP1 modulators alone.

MAb reagentsFor P-gp detection, MAbs MM4.17 (Cianfrigliaet al.,1994) and

MRK-16 (Kamiya, Thousand Oaks, CA), which recognize 2distinct human-specific epitopes of extracellular domains of theMDR1-P-glycoprotein isoform, were used in this study. MM4.17 isan IgG2ak

monoclonal immunoglobulin reacting with a continu-ous-linear epitope on the apical part of the fourth loop ofP-glycoprotein. MRK-16 is an IgG2ak

monoclonal immunoglobulinreacting with a conformational epitope distributed on the first andfourth loops of P-glycoprotein. These MAbs specifically recognizeliving human MDR cells.

For MRP1 detection, MAb MRP1r1 (Kamiya) was employed.This MAb is a rat IgG2a which reacts with an internal epitope ofMRP1 and does not cross-react with the humanMDR1-geneproduct (Flenset al.,1994).

The optimal concentrations for flow-cytometry and immunocyto-chemistry studies was 10 µg/ml for anti-P-gp antibodies and 1µg/ml for anti-MRP1 antibody.

Flow cytometryAll flow-cytometric analyses were carried out on cell suspen-

sions (106 cells/ml) obtained by incubating cell cultures with EDTAand trypsin solutions.

For determination of cell-surface P-glycoprotein, the cells wereincubated for 30 min at 4°C with MAb MM4.17 (working dilution1:100). After washing with ice-cold PBS containing 10 mM NaN3,1% BSA (Sigma) and 0.002% EDTA, cells were incubated for 30min at 4°C with a F(ab8)2 fragment of goat anti-mouse IgGfluorescein-conjugate (Sigma) at a working dilution of 1:50. Afterwashing, cells were immediately analyzed.

For positive control, the MDR variants of the human breast-cancer cells MCF-7, which express high levels of surface P-gp(Molinari et al.,1994), were used.

To detect intracellular expression of P-glycoprotein or MRP1,cell suspensions were fixed with 2% paraformaldehyde in PBS for10 min at 4°C. Then the samples were permeabilized by adding0.05% Triton X-100 for 10 min at 4°C. Incubation with primaryantibodies (MAbs MM4.17 or MRK-16 for P-gp detection; MRP1r1for MRP1 detection) and with secondary antibody [F(ab8)2 frag-ment of goat anti-mouse IgG fluorescein-conjugate for P-gplabelling; goat anti-rat IgG fluorescein-conjugate for MRP1 label-ling] (Sigma) were performed for 30 min at 4°C. For both surfaceand intracellular P-gp- and MRP1-labelling experiments, negativecontrols were obtained by incubating the samples with mouse IgG2aisotypic globulins (Sigma) and rat IgG2aisotypic globulins (Sigma),respectively.

For drug-efflux studies, cell cultures were treated with 1.7 µMDOX for 4 hr at 37°C, washed with ice-cold PBS, then re-incubatedat 37°C in drug-free medium, with or without modulators asdescribed above. After various incubation times, cells were har-vested, washed in ice-cold PBS and immediately analyzed.

Fluorescence was analyzed with a FACScan flow cytometer(Becton Dickinson, Mountain View, CA) equipped with a 15-mW,488-nm air-cooled argon-ion laser. The fluorescence emissions offluorescein and doxorubicin were collected through 530-nm and575-nm band-pass filters, respectively, and acquired in log mode.For DOX accumulation and efflux studies, drug fluorescenceintensity was expressed as the mean channel and plotted againsttime.

Fluorescence microscopyTo detect intracellular expression of P-glycoprotein and MRP1,

cells were fixed with freshly prepared 3.7% formaldehyde in PBS(pH 7.4) for 10 min at room temperature. After washing in the samebuffer with 2% BSA (Sigma) added cells were permeabilized with0.5% Triton X-100 in PBS for 5 min, then incubated with specificMAbs at 37°C for 30 min. After several washes in PBS, cells wereincubated again for 30 min with goat anti-mouse (for P-gp) or goatanti-rat (for MRP1) IgG-FITC, at a working dilution of 1:50.Irrelevant mouse or rat immunoglobulins were used in negativecontrol samples.

For Golgi-apparatus staining, after 3 washes in PBS (pH 7.4), thecells were fixed and permeabilized with methanol at220°C for 10min, then incubated with 50 mg/ml in PBS of wheat-germagglutinin-fluorescein linked (WGA-FITC; Sigma) for 30 min atroom temperature.

For the double-labelling of Golgi apparatus and P-glycoprotein,the cells were first labelled for the Golgi apparatus, following themethod described above. After washing with PBS, the cells wereincubated with MAb MM4.17 for 30 min at room temperature and,following several washes in PBS, incubated with a rhodamine-linked goat anti-mouse IgG (Sigma) (working dilution 1:30). Afterwashing, coverslips were mounted with glycerol-PBS (1:2) contain-ing 2.5 mg/ml propyl gallate.

For the Golgi apparatus-DOX co-localization, cells were treatedwith 1.7 µM DOX for 1 hr, recovered in drug-free medium for 24hr, then stained with WGA-FITC (Sigma) following the methoddescribed above.

The observations were made with a Nikon Microphot-SAfluorescence microscope (Nikon, Tokyo, Japan).

Confocal microscopyThe analysis of the intracellular distribution of DOX was carried

out on living cells, grown on coverslips and mounted on glassmicroscope slides, in the presence of the culture medium. Cellswere incubated with 1.7 µM DOX at 37°C for times ranging from 5min to 30 hr. For P-gp and MRP1 functionality studies, melanomacells were treated as described in ‘‘Flow cytometry’’ above.

In order to avoid cell damage, the image acquisitions, recordedas section series, were made quickly on several cells present ondifferent coverslips for each sample, acquiring signals from onefield per coverslip. The observations were carried out with a

886 MOLINARI ET AL.

Sarastro 2000 confocal scanning laser microscope (MolecularDynamics, Sunnyvale, CA). The excitation and emission wave-lengths employed were 488 nm and 510 nm, respectively. Theacquisition parameters were: objective 603/1.40, image size of10243 1024 pixels, pixel size of 0.17 µm, step size of 1.1 µm. Toshow both surface and internal cell structures, the section serieswere processed by look-through projection method. Voxel intensi-ties along projection rays were summed: the rays lay perpendicularto the plane of the monitor screen. This method is also termed‘‘extended focus’’, since the resulting images appear to have beengathered from a transparent specimen by a lens with large depth of

focus. The acquisitions were recorded employing the pseudo-colorintensity representation.

Immunoelectron microscopyMelanoma cells were fixed with 3% paraformaldehyde and 1%

glutaraldehyde in PBS for 2 hr at room temperature. After 3 washesin PBS, the cells were dehydrated in N,N-methylformammide(Eurobase, San Giuliano Milanese, Italy) gradient and embedded inLowicryl K4M (Electron Microscopy Sciences, Fort Washington,PA). The resin was polymerized under U.V. light for 2 hr at 4°C andfor 22 hr at room temperature (25°C).

For P-gp immunolocalization in the post-embedding procedure,thin sections, collected on gold grids, were treated for 5 min withPBS containing 0.15% (w/v) glycin. After washing by quicklyfloating the grids on PBS drops containing 0.4% (w/v) gelatin and0.1% (w/v) BSA, the sections were incubated with MAb MM4.17diluted up 1:100, overnight at 4°C. After washing by floating thegrids on PBS drops containing 0.1% (w/v) BSA for 1 hr at roomtemperature, the sections were pre-incubated with PBS plus 0.4%

FIGURE 1 – (a) Flow-cytometric analysis of cell-surface P-gp. Thedegree of P-gp expression is indicated by the fluorescence intensity (onthe abscissa) of the antibodies bound to the cells. The ordinate showsthe number of cells. The fluorescence profile of MM4.17-labelled M14cells and that of the negative control (CTR) are indistinguishable.MCF-7 DX peak shows the positive control, obtained by labelling withMAb MM4.17 the MDR variants of MCF-7 cells which express highlevels of cell-surface P-gp.(b) Flow-cytometric analysis of P-gpexpression in permeabilized M14 cells. Both MRK-16 and MM4.17MAbs bound to intracellular epitopes of P-gp molecules. MAbMM4.17 supplied a fluorescence signal more intense than that obtainedby using MAb MRK-16.

FIGURE 2 – Double staining of P-gp and Golgi apparatus in M14cells. P-gp was labelled with MAb MM4.17, followed by rhodamine-linked goat anti-mouse IgG, whereas Golgi apparatus was stained withwheat-germ agglutinin, fluorescein-linked (WGA-FITC). The rhoda-mine signal(a) and the fluorescein signal(b) arising from the samecells, are strikingly coincident. Bar, 10 µm.

887P-gp IN THE GOLGI OF MELANOMA CELLS

(w/v) gelatin and 0.1% (w/v) BSA for 10 min, washed in PBScontaining 0.1% (w/v) BSA, labelled with goat anti-mouse IgG-10nm gold conjugate (1:10 diluted; Sigma) for 20 min, then washed inPBS containing 0.1% BSA for 20 min at room temperature. Fornegative control, the sections were incubated with an irrelevant IgGMAb or with goat anti-mouse IgG-gold alone. Ultra-thin sections,obtained with a LKB Ultratome Nova (LKB, Bromma, Sweden),were stained with uranyl acetate and lead citrate and examined witha Zeiss EM10C (Zeiss, Oberkochen, Germany) transmission elec-tron microscope.

RT-PCRMDR1 mRNA was analyzed by the RT-PCR technique. Total

cellular RNA was isolated from lines harvested in exponentialphase using guanidium isothiocyanate (Chomczynski and Sacchi,1987). RNA preparations were treated with DNase I-RNase free(1U/5 µl, Boehringer-Mannheim, Milan, Italy) before cDNAsynthe-sis. cDNA was synthesized with 1 µg of total cellular RNA and 20ng of random hexanucleotide primer (Boehringer-Mannheim) in 20µl solution containing 50 mM TrisHCL (pH 8.3), 75 mM KCl, 3mM MgCl2, 10 mM DTT, 500 µM each dNTP, and 200 units ofMoloney-murine-leukemia-virus reverse transcriptase (Boehringer-Mannheim). PCR was carried out in a DNA thermal cycler (model480, Perkin-Elmer, Cetus, Norwalk, CT) using 2 µl cDNA in 25 µlreaction mixture containing 10 mM Tris-HCl (pH 8.3), 50 mMKCl, 15 mM MgCl2, 200 µM each NTP, 100 ng each primer and 1unit of AmpliTaq Polymerase (Boehringer-Mannheim). After an

initial de-naturation step at 94°C for 3 min, the cycling profile was:94°C, 45 sec denaturation; 54°C, 45 sec annealing; 72°C, 1 minextension. A total of 40 cycles were performed. MDR1-specificsequences were amplified using the sense-strand primer CCCAT-CATTGCAATAGCAGG (residues 2596–2615) and the anti-sense-strand primer GTTCAAACTTCTGCTCCTGA (residues 2733–2752), which yield a 167-bp product (Noonanet al., 1990). ThePCR products were fractionated in a 2% agarose gel and visualizedby ethidium-bromide staining. As positive control, MCF-7 DXcells expressing high level of P-gp were employed. Severalnegative control reactions were included in each experiment. Somenegative controls contained water instead of cDNA, while othercontrol-reaction mixtures contained aliquots of cDNA-reactionmixtures prepared without the addition of RNA.

RESULTS

P-gp expression and localization

Flow-cytometric determination of cell-surface P-gp proved thatall the established human melanoma cell lines analyzed (M14,H14, JR8) and the human primary-culture melanoma cells (CS)were negative for both MM4.17 and MRK-16 antibodies. Figure 1ashows that the fluorescence profile of MM4.17-labelled M14 cellsand that of negative control cells (CTR) are indistinguishable. Thepositive control has been performed by labelling with MAbMM4.17 the MDR variants of MCF-7 cells (MCF-7 DX), whichexpress high levels of cell-surface P-gp. H14, JR8 and CS cellsshowed the same pattern of expression (data not shown).

The intracellular expression and localization of P-gp wereanalyzed on fixed and permeabilized cells by flow cytometry andfluorescence microscopy.

Flow-cytometric analysis of P-gp expression in permeabilizedM14, H14, JR8 and CS cells revealed intracellular reactivity toboth MRK-16 and MM4.17 MAbs, recognizing 2 different epitopesof the transporter molecule. Figure 1b shows the fluorescenceintensity of the antibodies bound to intracellular epitopes of P-gpmolecule. The MM4.17 MAb reacted with virtually all themelanoma cells, and the fluorescent signal (full hystogram) was 2

FIGURE 3 – Immunoelectron microscopy performed by post-embedding technique using MAb MM4.17 and anti-mouse IgGconjugated with 10 nm gold particles. Gold particles were detectedinside the lumen of vesicles in proximity to the nuclear cleft (arrows).Weak positivity was also observed inside the nuclear matrix (arrowheads). Bar, 0.1 µm.

FIGURE 4 – Detection ofMDR-1 mRNA. PCR amplification prod-ucts (40 cycles) fractionated by a 2% agarose gel and visualized byethidium-bromide staining for M14, H14 and JR8 cells. DNA markerand a positive control (MCF-7 DX) are also reported.

888 MOLINARI ET AL.

logs or more, different from the control sample (grey peak). Asimilar pattern of reactivity was observed with MAb MRK-16,though its signal of positivity (black peak) was about 1 log lowerthan that obtained with MAb MM4.17.

Immunofluorescence microscopy observations allowed us tolocalize the intracellular P-gp epitopes in the cytoplasm of mela-noma cells, confirming the data obtained by flow-cytometricanalysis. MAb MM4.17 reacted with epitopes present in a cytoplas-mic perinuclear region in all the tested melanoma cells. A similarresult was obtained with MAb MRK-16.

The intracytoplasmic fluorescence observed in permeabilizedcells suggested that P-gp could be located in the Golgi apparatus ofthe tested human melanoma cells. In order to verify this, M14 cellswere double-stained with fluorescein-linked WGA and with MAbMM4.17 followed by rhodamine-linked goat anti-mouse IgG. Thedouble immunofluorescence labelling showed that rhodamine (Fig.2a; P-glycoprotein) and fluorescein (Fig. 2b; Golgi apparatus)signals were strikingly superimposed upon one another in the sameperinuclear region. The same co-localization of the MM4.17 andWGA signals was also observed in the other melanoma cell lines(H14, JR8) used in this study (data not shown).

Immunoelectron microscopy, performed by post-embeddingtechnique using MAb MM4.17 and immunogold conjugates,showed the labelling of P-gp epitopes inside the lumen of vesicularstructures in proximity of the nuclear cleft (arrows in Fig. 3). Fewparticles were also observed inside the nuclear matrix (arrow headsin Fig. 3). Such labelling appeared to be detectable only on samplesembedded in Lowicryl resin and without osmium fixation.

RT-PCRThe expression ofMDR1 mRNA in H14, M14 and JR8

melanoma cell lines was evaluated. Total cellular RNA was isolatedfrom lines harvested in logarithmic phase. Figure 4 shows theexpression ofMDR1 mRNA determined by RT-PCR. The H14,M14 and JR8 cell lines expressMDR1mRNA. In fact, the specificproduct bands forMDR1(167-bp) sequences are well evident in all3 cell lines examined.

MRP1 expression and localizationFigure 5a shows the flow-cytometric determination of the

intracellular MRP1 expression in melanoma cells, carried out byusing the MRP1r1 antibody (Flenset al.,1994). The fluorescenceintensity due to the binding of this antibody to intracellular epitopesof MRP1 molecules appeared to be significantly higher than thatobtained in negative controls.

The immunofluorescence observations performed by laser scan-ning confocal microscopy (LSCM) on fixed and permeabilizedmelanoma cells confirmed the intracytoplasmic location of theMRP1r1-reactive epitopes. Similarly to P-gp, MRP1 was localizedmainly in a distinct perinuclear area and, in some cells, also aroundthe nucleus (Fig. 5b). The plasma membranes and the nuclei werealways negative. These observations were confirmed followingfixation conditions described by Flenset al.(1994).

Intracellular localization of doxorubicinTo investigate whether MAb-reactive P-gp and MRP1 epitopes

corresponded to functioning drug pumps actually playing a role indrug distribution in melanoma cells, the intracellular localization ofdoxorubicin (DOX) was investigated by LSCM, taking advantageof the inherent fluorescence of the anthracyclinic antibiotics.

M14 cells were exposed to 1.7 µM DOX and observed in livingconditions, at different time intervals. During the first minutes oftreatment, the early phase of the drug uptake can be observed. At 5min, the DOX molecules had not yet entered the nucleus andappeared to be concentrated cytoplasmically in a perinuclear area(Fig. 6a), whereas the plasma membrane displayed weak positivity.By prolonging the exposure time (15 min) a strong fluorescentsignal came from the Golgi apparatus, and the drug was alsolocated inside the nucleus (Fig. 6b). M14 cells treated with DOX

for 1 hr (Fig. 6c) showed all the nuclei strongly fluorescent; most ofthe cells also displayed the drug concentrated in well-definedplasma membrane zones, and residual fluorescent positivity stillcame from perinuclear regions. After 24 hr of treatment (Fig. 6d)the drug appeared to be localized all around the cells. However, themaximum intensity of fluorescent signal (white spots) appeared tobe still localized mainly in the nuclei and in the perinuclear regions.

When DOX-treated cells were allowed to recover in drug-freemedium, a slow drug efflux occurred. After 1-hr recovery, thenuclei still showed fluorescent (Fig. 6e) and only after about 24 hrdid the nuclei appear to be scarcely positive (Fig. 6f ). In this lastexperimental condition, the intracellular drug distribution is compa-rable to that observed at the beginning of DOX treatment (Fig. 6b);in fact, in both cases the drug appears located almost exclusively inthe cytoplasm, close to the nucleus. This finding suggests that whenDOX concentration is low, the drug molecules are preferentiallyaccumulated in the acidic vesicular structures of the Golgi appara-tus, where the transporter molecules were principally found. Toverify this hypothesis, M14 cells treated with DOX and thenincubated in drug-free medium for 24 hr were stained withWGA-FITC. Figure 7a,bshow the same group of cells in which the

FIGURE 5 – MRP1 expression.(a) Flow-cytometric analysis ofMRP1 in permeabilized M14 cells detected with MAb MRP1r1.(b)Intracellular localization of MRP1 in fixed and permeabilized M14cells. The protein shows a Golgi-like localization; in some cells MRP1appears to be distributed all around the nucleus. Bar, 10 µm.

889P-gp IN THE GOLGI OF MELANOMA CELLS

FIGURE 6 – Intracellular localization of DOX performed by laser scanning confocal microscopy. M14 cells were exposed to 1.7 µM DOX andobserved, under living conditions, during the uptake phase(a–d)and the efflux phase(e, f).In cells treated with DOX for 5 min(a) and 15 min(b),the drug appeared to be concentrated in a perinuclear region, whereas the nuclei showed to be still weakly(b) or not at all(a) positive. After 1 hr oftreatment(c), DOX appeared to be mainly localized inside the nuclei; large areas of the plasma membrane also displayed strong positivity, andresidual fluorescence still came from the perinuclear regions. After 24 hr of treatment(d), the drug appeared to be localized all around the cells.However, the maximum intensity (white spots) showed as still localized into the nuclei and the perinuclear regions. When DOX-treated cells wereallowed to recover in drug-free medium, after 1 hr the nuclei still showed fluorescent(e),while after 24 hr DOX was exclusively concentrated inthe cytoplasm(f). Bar, 10 µm.

890 MOLINARI ET AL.

signal of the DOX molecules (Fig. 7a) and that of WGAfluorescein-linked (Fig. 7b) come from the same well-defined perinuclearregion,i.e., the Golgi apparatus.

P-gp and MRP1 functional assaysThe functional role of the 2 transporter proteins located in the

Golgi apparatus was investigated by studying the effects ofwell-known modulators on the intracellular distribution of DOX aswell as on the drug efflux rates. In particular, verapamil (VP) (Safaet al., 1987) and cyclosporin A (CsA) (Saekiet al., 1993) wereused for P-gp analysis, while probenecid (Felleret al., 1995) andgenistein (Versantvoortet al., 1993) were employed to assay thefunctional activity of MRP.

CsA (or VP) clearly impaired transit through the Golgi appara-tus, during the drug efflux towards the plasma membrane. In fact,while in cells recovered in drug-free medium (Fig. 6f ) DOX waslocated preferentially in the Golgi region, after recovery in thepresence of CsA DOX was mainly retained into the nucleus (Fig.8a). The intracellular DOX distribution, however, did not change inresponse to MRP1 modulators. Figure 8b shows that in cellsrecovered in the presence of probenecid the drug distribution wasvery similar to that observed after recovery in drug-free medium.

The time-course efflux of DOX in M14, JR8 and H14 cells wasstudied by flow cytometry in the presence or in the absence ofvarious modulators (Fig. 9). CsA and VP were able to increaseretention of the drug inside the cells, whereas the 2 MRP1modulators did not significantly affect drug efflux. In our experimen-tal conditions, probenecid and genistein appeared to favor drugefflux, particularly during the first hour of recovery. Figure 9 showsthe average values obtained from 3 different experiments relative toM14 cells; similar results were obtained with H14 and JR8 cells.

In addition, VP and CsA were able to sensitize melanoma cells toDOX. Figure 10 shows the percentage cell survivals of the 3established melanoma cell lines after treatment with 1.7 µM DOXor DOX plus CsA. These values are compared with those obtainedon wild-type-sensitive (LoVo WT) and MDR LoVo cells (LoVoMDR) in the same treatment conditions. After exposure to DOXalone, all the melanoma cell lines showed a survival fractionsignificantly higher than that of LoVo WT and much lower than thatof LoVo MDR cells, confirming the intrinsic resistance of themelanoma cells to the cytotoxic effect of the anthracycliniccompound. When DOX treatment was performed in associationwith CsA, a reduction in cell survival was detected in melanoma

FIGURE 7 – Co-localization of DOX and Golgi apparatus in M14cells treated with DOX, incubated in drug-free medium for 24 hr andthen stained with WGA-FITC. DOX signal(a) was detected in thesame areas of the WGA-positive organelles(b). Bar, 10 µm.

FIGURE 8 – Effect of cyclosporin A and probenecid on the DOXdistribution. (a) Cyclosporin A impaired the location of DOX in theGolgi apparatus during the drug efflux phase.(b) Cells recovered in thepresence of probenecid showed a fluorescence pattern similar to thatshowed by cells recovered in drug-free medium. Bar, 10 µm.

891P-gp IN THE GOLGI OF MELANOMA CELLS

cells and in MDR colon-carcinoma cells, whereas, as expected, noeffect of the MDR modulator was observed in LoVo WT cells.

Finally, no appreciable effect on cell survival was revealed whenDOX was administered in association with genistein or probenecid.

DISCUSSION

Malignant melanoma in its metastatic stage is highly unrespon-sive to chemotherapy (Garbe, 1993). Freshly isolated melanomacells from metastases in patients without any previous exposure tochemotherapeutic drugs, as well as melanoma cells culturedin vitrofor several passages, are known to exhibit a high level of intrinsicchemoresistance to various cytostatic agents (Schadendorfet al.,1994). However, the mechanisms underlying intrinsic MDR ofmalignant melanoma are still not well understood. The involve-ment of transport-associated proteins, such as MRP (multidrug-resistance-related protein) (Coleet al.,1992), LRP (lung resistanceprotein) (Scheperet al., 1993) and the well-known multidrug-resistance marker P-gp, was investigated by Schadendorfet al.(1995). These authors found thein vitro expression of MRP andLRP on RNA and protein level in a large proportion of humanmelanoma cell lines not previously exposed to chemotherapeuticdrugs. However, P-gp was not detectable on the protein level in the10 cell lines analyzed. On the other hand, by applying variousdetection methods, Bergeret al. (1994) showed intrinsic-MDR1-gene expression in up to 76% of the investigated cell lines. Due tothe modulating effect by verapamil, a P-gp-transporting activitywas also supposed. Recently, MRP expression was detected in mostof 40 established melanoma cell lines, and an inverse correlationwas found betweenMRP-gene expression and cell sensitivity(Bergeret al.,1997). Thus, a possible role of MRP in chemoresis-tance of human melanoma cells has been postulated. After all, themolecular mechanisms and the involvement of the various trans-porter proteins in the chemoresistant phenotype of melanoma cellsremain to be elucidated.

In the present study, we report the detection of P-gp and MRP1,obtained by flow cytometry and immunocytochemical methods, in thecytoplasm of 4 melanoma cell lines which do not express the transport-ers on the cell surface. In addition,MDR1 mRNA expression wasrevealed by RT-PCR in the same cell lines. P-gp intracellular localiza-tion was performed by using the MRK-16 (Hamada and Tsuruo, 1986)and MM4.17 (Cianfrigliaet al., 1994) MAbs, which recognize 2different epitopes of the transporter molecule. However, the FACSdetermination of cell surface P-gp was negative for both the MAbs. Theresults obtained employing MAb MM4.17 in double-staining experi-ments with WGA-FITC, a lectin which is a marker of the Golgicompartments (Coanet al., 1993), clearly indicated that intracellularP-gp was located in the Golgi apparatus. Immunoelectron microscopyshowed MM4.17-reactive epitopes inside the cytoplasmic vesicleslocalized near the nucleus. Such a distribution was described in MDRtumor cells expressing P-gp on the plasma membrane (Willinghametal., 1987). The preferential location of extracellular epitopes of P-gp,recognized by MAb MM4.17 (Cianfrigliaet al.,1994), in the lumen ofthe vesicles suggests that the drug pump is oriented in such a way as tosequester the anthracyclinic antibiotic inside the organelles, as showedby LSCM observations. Our earlier investigations (Molinariet al.,1994)showed that both epitopes recognized by MAbs MM4.17 and MRK-16were present on the membrane of the Golgi elements of drug-inducedMDR cells which did express P-gp on the cell surface. The Golgiapparatus was also the cytoplasmic organelle where DOX mainlyaccumulated (Meschiniet al., 1994; Molinari et al., 1994). Theseobservations correlate well with those reported (Willinghamet al.,1987;Rutherford and Willingham, 1993) and are in agreement with the‘‘functioning hypothesis’’ proposed by Willinghamet al. (1987). Afunctional role of P-gp located in the cytoplasmic organelles, such as theGolgi apparatus, working together with that located on the plasmamembrane was proposed. However, the drug-efflux-pump activity ofthe MDR1 molecule was difficult to ascertain in MDR cells expressingboth the plasma-membrane and the Golgi-transporter.

The human melanoma cells investigated in this study represent auseful cell model for obtaining insight into this question. Theintracellular drug distribution investigated by LSCM showed thetransit of DOX in a perinuclear region before entering the nucleus.In addition, during the efflux phase, when DOX came out of thenuclei, its presence in the perinuclear region was clearly detectable.

FIGURE 9 – Kinetics of DOX efflux in M14 cells in the presence ofP-gp and MRP1 modulators.

FIGURE 10– Effect of CsA on DOX sensitivity of human melanomacells (M14, JR8, H14). As control cells, human adenocarcinoma cells(LoVo) and their MDR variants (LoVo MDR) were employed.

892 MOLINARI ET AL.

The co-localization experiments performed by labelling DOX-treated cells with WGA-FITC indicated that DOX moleculesaccumulated preferentially in the vesicular structures of the Golgiapparatus. In another study (Calcabriniet al.,1997), we interpretedthe preferential location of DOX in the perinuclear region of M14cells, observed during the initial period of the drug uptake andduring the efflux phase, to be due to the DOX molecules beingweak bases. Following diffusion across the porous nuclear enve-lope, DOX molecules, owing to their positive electric charge,localized in acidic vescicles of thetrans Golgi elements (Ruther-ford and Willingham, 1993), which bind and are transported alongmicrotubules towards the cell surface (Hindenburget al.,1989).

In the light of the results here reported, involvement of P-gp localizedin the Golgi apparatus in sequestration of the drug molecules inside thelumen of vesicles should be considered. P-gp functionality studiesperformed by FACS indicated that both MDR-modifiers verapamil(Saekiet al.,1993) and cyclosporin A (Safaet al.,1987) increase thedrug retention of DOX in M14 cells. These findings appear to be inagreement with cytotoxicity studies indicating the increase of M14 drugsensitivity induced by VP and CsA. Moreover, LSCM observationsshowed that both P-gp modulators impaired the exit of the DOXmolecules from the nuclei, during the drug efflux phase.As far as MRP1is concerned, our observations confirmed its expression in humanmelanoma cells (Schadendorfet al.,1995; Bergeret al.,1997). As with

P-gp, we found MRP1 intracellularly in our drug-untreated cell models,whereas it was shown that MRP1 resides predominantly at the cellsurface of drug-induced MDR cells (Flenset al.,1994). Indeed, MRP1was localized differently in various cell types, and it is not clear whetherand how it is responsible directly for drug intracellular redistribution andefflux. In our melanoma cells and in our experimental conditions, therole of intracytoplasmic MRP1 in the DOX distribution and accumula-tion, and then in the intrinsic chemoresistance, is as yet unclear.

In conclusion, the Golgi apparatus confirms its role of important‘‘road junction’’ involved in the intracellular traffic of DOX. P-gplocated in this organelle, either in drug-induced-MDR cells (Molinarietal.,1994) or in intrinsically drug-resistant cells, such as melanoma cells,seems to exert a transport activity, as supported by the effects of MDRmodifiers. Thus, the high therapeutic resistance of human malignantmelanoma (Garbe, 1993), as well as its markedin vitro intrinsicchemoresistance (Schadendorfet al., 1994), appear to support thehypothesis that P-gp in the Golgi apparatus represents, if a not decisive,then a complementary protective mechanism against toxic agents inchemotherapy-refractory malignant melanoma.

ACKNOWLEDGEMENTS

This work was partially supported by National Research Council(CNR), Special Project ACRO, contract 95.00468.39 (G.A.).

REFERENCES

BALDINI , N., SCOTLANDI, K., SERRA, M., SHIKITA , T., ZINI, N., OGNIBENE, A.,SANTI, S., FERRACINI, R. and MARALDI , N.M., Nuclear immunolocalizationof P-glycoprotein in multidrug-resistant cell lines showing similar mecha-nisms of doxorubicin distribution.Europ. J. Cell Biol.,68,226–239 (1995).BERGER, W., ELBLING, L., MINAI-POUR, M., VETTERLEIN, M., PIRKER, R.,KOKOSCHKA, E.-M. and MICKSCHE, M., IntrinsicMDR1-gene and P-glycoproteinexpression in human melanoma cell lines.Int. J. Cancer,59,717–723 (1994).BERGER, W., HAUPTMANN, E., ELBLING, L., VETTERLEIN, M., KOKOSCHKA,E.M. and MICKSCHE, M., Possible role of the multidrug-resistance-associated protein (MRP) in chemoresistance of human melanoma cells.Int. J. Cancer,71,108–115 (1997).CALCABRINI , A., VILLA , A.M., MOLINARI, A., DOGLIA, S.M. and ARANCIA,G., Influence of N-methylformamide on the intracellular transport ofdoxorubicin.Europ. J. Cell Biol.,72,61–69 (1997).CHOMCZYNSKI, P. and SACCHI, N., Single-step method of RNA isolation byacid-guanidium-thiocyanate-phenol-chloroform extraction.Anal. Bio-chem.,162,156–159 (1987).CIANFRIGLIA , M., WILLINGHAM , M.C., TOMBESI, M., SCAGLIOTTI, V., FRASCA,G. and CHERSI, A., P-glycoprotein mapping. I. Identification of a linearhuman-specific epitope in the fourth loop of the P-glycoprotein extracellu-lar domain by MM4.17 murine monoclonal antibody to human multi-drug-resistant cells.Int. J. Cancer,56,153–160 (1994).COAN, D.E., WECHEZACK, A.R., VIGGERS, R.F. and SAUVAGE, L.R., Effect ofshear stress upon localization of the Golgi apparatus and microtubuleorganizing center in isolated cultured endothelial cells.J. Cell Sci.,104,1145–1153 (1993).COLE, S.P.C., BHARDWAJ, G., GERLACH, J.H., MACKIE, J.E., GRANT, C.E.,ALMQUIST, K.C., STEWART, A.J., KURZ, E.U., DUNCAN, A.M.V. and DEELEY,R.G., Over-expression of a transporter gene in a multidrug-resistant humanlung-cancer cell line.Science,258,1650–1654 (1992).FELLER, N., BROXTERMAN, H.J., WAHRER, D.C.R. and PINEDO, H.M.,ATP-dependent efflux of calcein by the multidrug-resistance protein(MRP): no inhibition by intracellular glutathione depletion.FEBS Lett.,368,385–388 (1995).FLENS, M.J., IZQUIERDO, M.A., SCHEFFER, G.L., FRITZ, J.M., MEIJER, C.J.L.M.,SCHEPER, R.J. and ZAMAN, G.J.R., Immunochemical detection of the multidrug-resistance-associated protein MRP in human multidrug-resistant tumor cells bymonoclonal antibodies.Cancer Res.,54,4557–4563 (1994).GARBE, C., Chemotherapy and chemo-immunotherapy in disseminatedmalignant melanoma.Melanoma Res.,3, 291–299 (1993).GOTTESMAN, M.M. and PASTAN, I., Biochemistry of multidrug resistancemediated by the multidrug transporter.Ann. Rev. Biochem.,62,385–427 (1993).HAMADA , H. and TSURUO, T., Functional role of the 170-180 kD glycopro-tein specific to drug-resistant tumor cells as revealed by monoclonalantibodies.Proc. nat. Acad. Sci. (Wash.),83,7785–7789 (1986).

HINDENBURG, A.A., GERVASONI, J.E. JR., KRISHNA, S., STEWART, V.J., ROSADO,M., LUTZKY, J., BHALA, K., BAKER, M.A. and TAUB, R.N., Intracellulardistribution and pharmacokinetics of daunorubicin in anthracycline-sensitive and-resistant HL60 cells.Cancer Res.,49,4607–4614 (1989).MESCHINI, S., MOLINARI, A., CALCABRINI , A., CITRO, G. and ARANCIA, G.,Intracellular localization of the antitumor drug adriamycin in living cultured cells:a confocal microscopy study.J. Microsc.,176,204–210 (1994).MOLINARI, A., CIANFRIGLIA , M., MESCHINI, S., CALCABRINI , A. and ARAN-CIA, G., P-glycoprotein expression in the Golgi apparatus of multidrug-resistant cells.Int. J. Cancer,59,789–795 (1994).NOONAN, K.E., BECK, C., HOLZMAYER, T.A., CHIN, J.E., WUNDER, J.S.,ANDRULIS, I.L., GADZAR, A.F., WILLMAN , C.L., GRIFFITH, B., VON HOFF,D.D. and RONINSON, I.B., Quantitative analysis ofMDR1 (multidrug-resistance)-gene expression in human tumors by polymerase chain reaction.Proc. nat. Acad. Sci. (Wash.),87,7160–7164 (1990).RUTHERFORD, A.V. and WILLINGHAM , M.C., Ultrastructural localization ofdaunomycin in multidrug-resistant cells with modulation of the multidrugtransporter.J. Histochem. Cytochem.,41,1573–1577 (1993).SAEKI, T., UEDA, K., TANIGAWARA , Y., HORI, R. and KOMANO, T., HumanP-glycoprotein transport cyclosporin A and FK506.J. biol. Chem.,268,6077–6080 (1993).SAFA, A.R., GLOVER, C.J., SEWELL, J.L., MEYERS, M.B., BIEDLER, J.L. andFELSTED, R.L., Identification of the multidrug-resistance-related membraneglycoprotein as an acceptor for calcium blocker.J. biol. Chem.,262,7884–7888 (1987).SCHADENDORF, D., MAKKI , A., STAHR, C., VAN DICK, A., WANNER, R.,SCHEFFER, G.L., FLENS, M.J., SCHEPER, R. and HENZ, B.M., Membranetransport proteins associated with drug resistance expressed in humanmelanoma.Amer. J. Pathol.,147,1545–1552 (1995).SCHADENDORF, D., WORM, M., ALGERMISSEN, B., KOHLMUS, C.M. andCZARNETZKI, B.M., Chemosensitivity testing of human melanoma cells:retrospective analysis of clinical response andin vitro drug sensitivity.Cancer,73,103–108 (1994).SCHEPER, R.J., BROXTERMAN, H.J., SCHEFFER, J.L., KAAIJK, P., DALTON,W.S., VAN HEININGEN, T.H.M., VAN KALKEN, C.K., SLOVACK, M.L., DEVRIES, E.G.E., VAN DE VALK , P., MEIJER, C.J.L.M. and PINEDO, H.M.,Over-expression of a 110-kD vesicular protein in non-P-glycoprotein-mediated multidrug resistance.Cancer Res.,53,1475–1479 (1993).VERSANTVOORT, C.H.M., SCHUURHUIS, G.J., PINEDO, H.M., EEKMAN, C.A.,KUIPER, C.M., LANKELMA , J. and BROXTERMAN, H.J., Genistein modulatesthe decreased drug accumulation in non-P-glycoprotein-mediated multidrug-resistant tumour cells.Brit. J. Cancer,68,939–946 (1993).WILLINGHAM , M.C., RICHERT, N.D., CORNWELL, M.M., TSURUO, T., HA-MADA , H., GOTTESMAN, M.M. and PASTAN, I.H., Immunocytochemicallocalization of P170 at the plasma membrane of multidrug-resistant humancells.J. Histochem. Cytochem.,35,1451–1456 (1987).

893P-gp IN THE GOLGI OF MELANOMA CELLS