BIOINFORMATICS II NEXT GENERATION SEQUENCING

By Aayushi Pal

CONTENTS• Introduction to sequencing genome• Genome Sequencing• Sanger Sequencing• Next Generation Sequencing. • Illumina Sequencing• Roche 454 Sequencing• Ion Torrent Sequencing• Summary

INTRODUCTION TO SEQUENCING

• Genome sequencing is figuring out the order of DNA nucleotides, or bases, in a genome – the order of As, Cs, Gs, and Ts that make up an organism’s DNA.

Why is genome sequencing important?• Sequencing the genome is an important step towards understanding it.• To understand how the genome as a whole works – how genes work

together to direct the growth, development and maintenance of an entire organism.

AGTCCGCGAATACAGGCTCGGT

GENOME SEQUENCING• Goal

Figuring out the order of nucleotides across a genome

• Problem Current DNA sequencing methods can

handle only short stretches of DNA at once (<1-2Kbp)

• Solution Sequence and then use computers to

assemble the small pieces

SANGER SEQUENCING• DNA is fragmented • Cloned to a plasmid vector• Cyclic sequencing reaction• Separation by electrophoresis• Readout with fluorescent tags

NEXT GENERATION SEQUENCING

• Next generation sequencing (NGS), also known as high-throughput sequencing, is the catch-all term used to describe a number of different modern sequencing technologies including:

• Illumina (Solexa) sequencing• Roche 454 sequencing• Ion Torrent: Proton/PGM sequencing• SOLiD sequencing

ILLUMINA SEQUENCING• 100-150bp reads are used, somewhat longer fragments

are ligated to generic adaptors and annealed to a slide using the adaptors.

• PCR is carried out to amplify each read, creating a spot with many copies of the same read. They are then separated into single strands to be sequenced.

• The slide is flooded with nucleotides and DNA polymerase. These nucleotides are fluroecently labelled, with the colour corresponding to the base. They also have a terminator, so that only one base is added at a time.

• An image is taken of the slide. In each read location, there will be a fluorescent signal indicating the base that has been added.

ILLUMINA SEQUENCING IN CONTINUATION

• The slide is then prepared for the next cycle. The terminators are removed, allowing the next base to be added, and the fluorescent signal is removed, preventing the signal from contaminating the next image.

• The process is repeated, adding one nucleotide at a time and imaging in between.

ILLUMINA SEQUENCING IN CONTINUATION

• Computers are then used to detect the base at each site in each image and they are used to construct a sequence.

• All of the sequence reads will be the same length, as the read length depends on the number of cycles carried out.

ROCHE 454 SEQUENCING• Roche 454 sequencing can sequence much longer

reads by sequencing multiple reads at once by reading optical signals as bases are added.

• The DNA or RNA is fragmented into shorter reads up to 1kb.

• Generic adaptors are added to the ends and these are annealed to beads, one DNA fragment per bead. The fragments are then amplified by PCR using adaptors specific primers.

• Each bead is then placed in a single well of a slide. So each well will contain a single bead, covered in many PCR copies of a single sequence. The wells also contain DNA polymerase and sequencing buffers.

454 SEQUENCING IN CONTINUATION

• The slide is flooded with one of the four NTP species. Where this nucleotide is next sequence, it is added to the sequence read. If that single base repeats, then more will be added. So if we flood with Guanine bases, and the next in a sequence is G, one G will be added, however if the next part of the sequence is GGGG, then four Gs will be added.

• This NTP mix is washed away. The next NTP is now added and the process repeated, cycling through the four NTPs.

454 IN CONTINUATION• This kind of sequencing generates graphs for each sequence read, showing the

signal density for each nucleotide wash. The sequence can then be determined computationally from the signal density in each wash.

• All of the sequence reads we get from 454 will be different lengths, because different numbers of these bases will be added with each cycle.

ION TORRENT SEQUENCING• Ion torrent and ion proton sequencing do not make

use of optical signals. Instead, they exploit the fact that addition of a dNTP to a DNA polymer releases an H+ ion.

• The input DNA is fragmented about 200 bp. Adaptors are added and one molecule is placed onto a bead. The molecules are amplified on the bead by emulsion PCR. Each bead is placed into a single well of a slide.

• The slide is flooded with a single species of dNTP,along with buffers and polymerase, one NTP at a time. The pH is detected is each of the wells, as each H+ ion released will decrease the pH. The changes in pH allow us to determine if that base, and how many thereof, was added to the sequence read.

ION TORRENT IN CONTINUATION

• The dNTPs are washed away, and the process is repeated cycling through the different dNTP species.

• The pH change, if any, is used to determine how many bases (if any) were added with each cycle.

SUMMARY• Next Generation Sequencing has changed the way we carry out molecular

biology and genomic studies. • It has allowed us to sequence and annotate genomes at a faster rate.• It has allowed us to study , variation, expression and DNA binding at a

genome – wide level.

THANK YOU