Millennium Technology Prize Winner Frances Arnold 25.5.2016

  • Published on
    12-Apr-2017

  • View
    207

  • Download
    0

Embed Size (px)

Transcript

<ul><li><p>Pasadena, California</p></li><li><p>Imag</p><p>es c</p><p>ourt</p><p>esy </p><p>of </p><p>Shutters</p><p>tock</p></li><li><p>What do enzymes do for us?</p></li><li><p>Enzymes break down proteins and fatsuse in laundry lowers energy costs</p></li><li><p>Green chemistry</p></li><li><p>Green chemistry</p></li><li><p>Green chemistry</p></li><li><p>Fe</p><p>O</p><p>S</p><p>Cys</p><p>+</p><p>Fe</p><p>C</p><p>S</p><p>Cys</p><p>RR</p><p>AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC</p><p>CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTCCGGCGACA</p><p>CATGTGTCTCTCACTCCGAGAGATCGGTTAGAGTCTCGGTTAACCACACG</p><p>TCCCGGATATATTTAATTGGCCGGAGAGTCTCCCGCGCGACATAAGGAGT</p><p>CCTCGTTTCGAGATACGTACGGCATGGTGACACCAGTTGCCCTCTGATTC</p><p>CCGGAGCCTCTTTGAAAACGTCGGGACAAATCCCGATTTGATCGTGTGCG</p><p>CGACATGTCTTCCGGCGACACATGTGTCTCTCACTCCGAGAGATCGGTTA</p><p>GAGTCTCGGTTAACCACACGTCCAATAGCCGTTATTTCCGGATGTGCATAG</p><p>Programmable, green chemistry machines</p></li><li><p>But the catalysts are not designed to make what we want.</p><p>And they are complicated!</p></li><li><p>AATAGCCGTTATTTCCGGATGTGCAT</p><p>AGCTGATTTGACCCATCCGGTACAC</p><p>CAATDACAAATCCCGATTTGATCGTG</p><p>TGCGCGACATGTCTTCCGGCGACAC</p><p>ATGTGTCTCTCACTCCGAGAGATCG</p><p>GTTAGAGTCTCGGTTAACCACACGT</p><p>CCCGGATATATTTAATTGGCCGGAGA</p><p>GTCTCCCGCGCGACATAAGGAGTCC</p><p>TCGTTTCGAGATACGTACGGCATGGT</p><p>GACACCAGTTGCCCTCTGATTCCCG</p><p>GAGCCTCTTTGAAAACGTCGAGTCG</p><p>AATCGAAGTTCGAACCCCGGATCGG</p><p>GTCCACCAACTTAGAGATGTGTGTG</p><p>CGCTGACTCAGTCATTTTGACCCATC</p><p>CGGTACACCAATGGGTCGGACAAAT</p><p>CCCGATTTGATCGTGTGCGCGACAT</p><p>GTCTTCCGGCGACACATGTGTCTCT</p><p>CACTCCGAGAGATCGGTTAGAGTCT</p><p>CGGTTAACCACACGTCCCGGATATAT</p><p>TTAATTGGCCGGAGAGTCTCCAATAG</p><p>CCGTTATTTCCGGATGTGCATAGCTG</p><p>ATTTGACCCATCCGGTACACCAATGG</p><p>GTCGGACAAATCCCGATTTGATCGT</p><p>GTGCGCGACATGTCTTCCGGCGACA</p><p>CATGTGTCTCTCACTCCGAGAGATC</p><p>GGTTAGAGTCTCGGTTAACCACACG</p></li><li><p>AATAGCCGTTATTTCCGGATGTGCAT</p><p>AGCTGATTTGACCCATCCGGTACAC</p><p>CAATDACAAATCCCGATTTGATCGTG</p><p>TGCGCGACATGTCTTCCGGCGACAC</p><p>ATGTGTCTCTCACTCCGAGAGATCG</p><p>GTTAGAGTCTCGGTTAACCACACGT</p><p>CCCGGATATATTTAATTGGCCGGAGA</p><p>GTCTCCCGCGCGACATAAGGAGTCC</p><p>TCGTTTCGAGATACGTACGGCATGGT</p><p>GACACCAGTTGCCCTCTGATTCCCG</p><p>GAGCCTCTTTGAAAACGTCGAGTCG</p><p>AATCGAAGTTCGAACCCCGGATCGG</p><p>GTCCACCAACTTAGAGATGTGTGTG</p><p>CGCTGACTCAGTCATTTTGACCCATC</p><p>CGGTACACCAATGGGTCGGACAAAT</p><p>CCCGATTTGATCGTGTGCGCGACAT</p><p>GTCTTCCGGCGACACATGTGTCTCT</p><p>CACTCCGAGAGATCGGTTAGAGTCT</p><p>CGGTTAACCACACGTCCCGGATATAT</p><p>TTAATTGGCCGGAGAGTCTCCAATAG</p><p>CCGTTATTTCCGGATGTGCATAGCTG</p><p>ATTTGACCCATCCGGTACACCAATGG</p><p>GTCGGACAAATCCCGATTTGATCGT</p><p>GTGCGCGACATGTCTTCCGGCGACA</p><p>CATGTGTCTCTCACTCCGAGAGATC</p><p>GGTTAGAGTCTCGGTTAACCACACG</p></li><li><p>MTIKEMPQPKTFGELKNL...</p><p>KETSPIPQPKTFGPLGNL...</p><p>KQASAIPQPKTYGPLKNL...</p><p>WRRRGIPGPLGYPLVGSF...</p><p>WIRKGVKGPRGLPFLGVI...</p><p>FIRKGIKGPRGFPGIGML...</p><p>WIRKGVKGPRGFPFFGVI...</p><p>WIRKGVKGPRGFPFFGVI...</p><p>WMRKGIKGPRGLPFFGII...</p><p>WMRKGVKGPRGRPFVGVL...</p><p>WRRRGVVGPMGFPVLGVF...</p><p>REKIGLSGPEPHWFLGNL...</p><p>REKIGLTGPEPHWFMGNL...</p><p>RSSIGIPGPPVHWLWGNL...</p><p>KVSKYPKGPLPLPFIGNI...</p><p>...</p><p>Enzyme families are the products of millions of years of </p><p>mutation and natural selection.</p><p>mutation and selection</p><p>Ancestral enzyme</p><p>Evolution makes new enzymes extremely well.</p><p>Each one is well adapted to its biological role.</p></li><li><p>Humans have altered the biological world using evolution by artificial selection for </p><p>thousands of years. </p></li><li><p>Natural mechanisms for generating sequence diversity are limited.</p></li><li><p>Not so in the test tube.</p></li><li><p>Protein space:</p><p>VASTLY (Very much more than astronomically) large</p><p>Mostly empty</p><p>sequences20 450</p><p>20 natural amino acids</p><p>EVOLUTION IS HARD!</p><p>~ 450 amino acids long </p></li><li><p>Directed evolution is a molecular optimization on a fitness landscape, where fitness is performance, defined by the user. </p><p>Fitn</p><p>ess</p></li><li><p>Evolution works because</p><p>?</p><p>the regions that life</p><p>has discovered and</p><p>explored are rich in</p><p>function.</p><p>And, at least in some of its </p><p>many dimensions, the </p><p>fitness landscape is smooth. </p><p>This allows adaptation, one </p><p>step (one mutation) at a </p><p>time.</p></li><li><p>select/screen for </p><p>improvements</p><p>(cells)</p><p>~10</p><p>(a few) </p><p>random </p><p>mutations</p><p>4</p><p>~10 ~10715</p><p>NO</p><p>Parent gene</p><p>(= parent protein)</p><p>Directed evolution exploits smooth paths in the fitness landscape.</p></li><li><p>select/screen for </p><p>improvements</p><p>YES</p><p>repeat</p><p>(cells)</p><p>~10</p><p>(a few) </p><p>random </p><p>mutations</p><p>4</p><p>~10 ~10715</p><p>NO</p><p>Parent gene</p><p>(= parent protein)</p><p>Evolved gene</p><p>(= evolved protein)</p><p>Directed evolution exploits smooth paths in the fitness landscape.</p></li><li><p>Performance</p><p>Generation</p><p>0</p><p>10</p><p>20</p><p>30</p><p>40</p><p>50</p><p>60</p><p>70</p><p>0 1 2 3 4 5 6 7</p><p>0 0 Gen1 Gen2 Gen3 Gen4 Gen5</p><p>Directed evolution by iterative mutagenesis and screening can re-optimize the enzyme</p><p>Evolved enzyme doing a new job</p><p>Native enzyme doing its native job</p><p>Native enzyme doing a new job</p></li><li><p>Diabetes affects 422 million people(5.9%) of the worlds population in 2014.5 </p></li><li><p>Sit</p><p>Sitagliptin synthesis</p><p>Solvent waste</p><p>Multi-step chemical process </p><p>is expensive and generates </p><p>a lot of waste.</p><p>Toxic heavy metals</p></li><li><p>Sit</p><p>Rela</p><p>tive p</p><p>roductivity</p><p>Directed enzyme evolution </p><p>Savile et al. Science, 2010, 329, 5989</p><p>Replace all that with a single enzyme step!</p><p>Round of Evolution</p><p>1</p><p>10</p><p>100</p><p>1000</p><p>10000</p><p>100000</p><p>1 2 3 4 5 6 7 8 9 10 11 12</p><p>100000</p><p>10000</p><p>1000</p><p>100</p><p>10</p><p>1</p><p>Improved</p><p>70,000 fold </p><p>Started here</p></li><li><p>Sit</p><p>Rela</p><p>tive p</p><p>roductivity</p><p>Solvent waste </p><p>reduced 60%</p><p>Increased yield</p><p>from starting </p><p>materials</p><p>Directed enzyme evolution </p><p>Replace all that with a single enzyme step!</p><p>Round of Evolution</p><p>1</p><p>10</p><p>100</p><p>1000</p><p>10000</p><p>100000</p><p>1 2 3 4 5 6 7 8 9 10 11 12</p><p>100000</p><p>10000</p><p>1000</p><p>100</p><p>10</p><p>1</p><p>Improved</p><p>70,000 fold Toxic heavy metals</p><p>eliminated</p><p>Savile et al. Science, 2010, 329, 5989</p></li><li><p>Sit</p><p>Replace all that with a single enzyme step!</p><p>FDA Approval in 2012</p><p>AWARDThomas Edison </p><p>Patent Award</p><p>Toxic heavy metals</p><p>eliminated</p><p>Solvent waste </p><p>reduced 60%</p><p>Increased yield</p><p>from starting </p><p>materials</p><p>Savile et al. Science, 2010, 329, 5989</p><p>PRESIDENTIAL</p></li><li><p>We need better cellulases to break </p><p>down biomass and generate sugars </p><p>for microbial chemicals and fuel production.</p></li><li><p>MTIKEMPQPKTFGELKNL...</p><p>KETSPIPQPKTFGPLGNL...</p><p>KQASAIPQPKTYGPLKNL...</p><p>WRRRGIPGPLGYPLVGSF...</p><p>WIRKGVKGPRGLPFLGVI...</p><p>FIRKGIKGPRGFPGIGML...</p><p>WIRKGVKGPRGFPFFGVI...</p><p>WIRKGVKGPRGFPFFGVI...</p><p>WMRKGIKGPRGLPFFGII...</p><p>WMRKGVKGPRGRPFVGVL...</p><p>WRRRGVVGPMGFPVLGVF...</p><p>REKIGLSGPEPHWFLGNL...</p><p>REKIGLTGPEPHWFMGNL...</p><p>RSSIGIPGPPVHWLWGNL...</p><p>KVSKYPKGPLPLPFIGNI...</p><p>...</p><p>We can also use products of natural evolution to breed new enzymes by recombination (molecular sex)</p></li><li><p>Sexual recombination populates fitness peaks (conservative of structure and function while making large jumps in sequence)</p><p>Parent proteins, found in nature</p></li><li><p>Chimeric progeny can be better than their parents.</p><p>Sexual recombination populates fitness peaks (conservative of structure and function while making large jumps in sequence)</p></li><li><p>We used recombination and random mutations to make thermostable cellulases that hydrolyze more biomass at </p><p>elevated temperatures</p><p>0,0</p><p>0,1</p><p>0,2</p><p>0,3</p><p>0,4</p><p>0,5</p><p>0,6</p><p>0,7</p><p>0,8</p><p>0,9</p><p>1,0</p><p>35 45 55 65 75 85 95</p><p>Cel</p><p>lob</p><p>iose</p><p>(mM</p><p>)</p><p>Temperature (C)</p><p>3C6P</p><p>HJPlus</p><p>HICel6</p><p>HJCel6</p></li><li><p>Enzymes (and other proteins) are highly evolvable</p><p>Proteins can adapt via simple uphill walks</p><p>New functions by changing tiny fractions of</p><p>(</p></li><li><p>How can we create whole new enzymes to expand the chemistry of the biological world? </p><p>(catalyze reactions not known in nature)</p></li><li><p>How can an inherently conservative process like this create novelty? </p><p>At any given time, nature takes the most probable paths </p><p>(the fewest mutational steps).</p></li><li><p>(Molecular)</p></li><li><p>Evolution does it: the internet of living things</p><p>Crowd-sourcing problem solving for 3+ billion years: trillions of organisms at work 24/7</p></li><li><p>Atrazine</p><p> 19501993 non-biodegradable; accumulated in soil</p><p> From 1993 onwards, fast degradation observed</p></li><li><p>Novelty is often already there.</p><p>Access to new features relies on some (even very small) functional </p><p>overlap that can be drawn out and optimized during evolution.</p><p>Native reaction New reaction</p></li><li><p>Natural oxene </p><p>transfer</p><p>Non-natural</p><p>Fe-carbene</p><p>Non-natural</p><p>Fe-nitrene</p><p>We evolved heme proteins that catalyze reactions not known in nature</p><p>Ser</p><p>Ser</p><p>O </p><p>O </p></li><li><p>Heme enzyme</p><p>Cyclopropane-containing serotonin-norepinephrine </p><p>reuptake inhibitor (SNRI) used to treat clinical depression</p><p>Jane Wang, Hans Renata et al., ACIE (2014)</p><p>http://www.google.com/url?sa=i&amp;rct=j&amp;q=&amp;esrc=s&amp;source=images&amp;cd=&amp;cad=rja&amp;uact=8&amp;docid=u72S8fSSSgqW1M&amp;tbnid=oP9tjboAw-W1lM:&amp;ved=0CAUQjRw&amp;url=http://www.drugdevelopment-technology.com/projects/-fetzima-levomilnacipran-major-depressive-disorder/-fetzima-levomilnacipran-major-depressive-disorder1.html&amp;ei=IcqyU-jJH8TFoASGtYCwCA&amp;bvm=bv.70138588,d.cGU&amp;psig=AFQjCNHyNKKkrArsfrNgjzuaK3abH4siSA&amp;ust=1404312468253688http://www.google.com/url?sa=i&amp;rct=j&amp;q=&amp;esrc=s&amp;source=images&amp;cd=&amp;cad=rja&amp;uact=8&amp;docid=u72S8fSSSgqW1M&amp;tbnid=oP9tjboAw-W1lM:&amp;ved=0CAUQjRw&amp;url=http://www.drugdevelopment-technology.com/projects/-fetzima-levomilnacipran-major-depressive-disorder/-fetzima-levomilnacipran-major-depressive-disorder1.html&amp;ei=IcqyU-jJH8TFoASGtYCwCA&amp;bvm=bv.70138588,d.cGU&amp;psig=AFQjCNHyNKKkrArsfrNgjzuaK3abH4siSA&amp;ust=1404312468253688</p></li><li><p>Second most </p><p>abundant element </p><p>in the Earths crust</p><p>Si14</p><p>28.0855</p><p>Silicon</p><p>...the literature is void of examples of biologically synthesized, either in vivo or in vitro, </p><p>silicon-carbon bonds.</p><p>Silicon 2009, 1, 147.</p></li><li><p>NH</p><p>Si</p><p>OH</p><p>RR</p><p>catalysts / ligands</p><p>SiR3</p><p>reagents for cross-coupling</p><p>Si</p><p>18F-acceptors for </p><p>PET imaging</p><p>Si(i-Pr)3</p><p>Si(i-Pr)3</p><p>materials for organic LED</p><p>biological probes </p><p>and drug leads</p><p>O</p><p>NH</p><p>H2N</p><p>Me3Si O</p><p>OH</p><p>18F</p><p>RR</p><p>3</p></li><li><p>Rhodothermus marinus cytochrome c</p><p>SiH</p><p>MeMe</p><p>N2</p><p>Me</p><p>O</p><p>OEtMe</p><p>O</p><p>OEtSi</p><p>MeMeRma cyt c+</p></li><li><p>Physically possible molecules</p><p>Relevant to biology</p><p>Freed from the constraints of biological </p><p>function, we can explore the physically </p><p>possible proteins to find new capabilities.</p></li><li><p>Bacterial enzymes that mimic human drug metabolism so that we can test the toxicity of new drug candidates</p></li><li><p>New human enzymes to treat cancer</p></li><li><p>Proteins to monitor brain chemistry or enable brain </p><p>stimulation with light</p></li><li><p>A palette of fluorescent sensor proteins for imaging</p></li><li><p>Better agricultural practices: combat crop pests, effects of climate change</p></li><li><p>Fe</p><p>O</p><p>S</p><p>Cys</p><p>+</p><p>Fe</p><p>C</p><p>S</p><p>Cys</p><p>RR</p><p>AATAGCCGTTATTTCCGGATGTGCATAGCTGATTTGACCCATCCGGTACAC</p><p>CAATDACAAATCCCGATTTGATCGTGTGCGCGACATGTCTTCCGGCGACA</p><p>CATGTGTCTCTCACTCCGAGAGATCGGTTAGAGTCTCGGTTAACCACACG</p><p>TCCCGGATATATTTAATTGGCCGGAGAGTCTCCCGCGCGACATAAGGAGT</p><p>CCTCGTTTCGAGATACGTACGGCATGGTGACACCAGTTGCCCTCTGATTC</p><p>CCGGAGCCTCTTTGAAAACGTCGGGACAAATCCCGATTTGATCGTGTGCG</p><p>CGACATGTCTTCCGGCGACACATGTGTCTCTCACTCCGAGAGATCGGTTA</p><p>GAGTCTCGGTTAACCACACGTCCAATAGCCGTTATTTCCGGATGTGCATAG</p><p>The future of production (the bioeconomy)</p></li></ul>