F tools of genetic engineering

  • View
    19

  • Download
    3

Embed Size (px)

Text of F tools of genetic engineering

  1. 1. TOOLS OF GENETIC ENGINEERING Pravin V Jadhav, PhD Assistant Professor, Biotechnology Centre, Dr. PDKV, Akola [email protected]
  2. 2. ONTARGET PART-I What is gene cloning? What are steps involved in it? What are restriction enzymes? What they do? Modifying enzymes: what functions they do have? What is DNA ligase and polymerase? PART-II Cloning Vectors 1 2 3 4 5 1 2
  3. 3. ONTARGET Gene Cloning The process of inserting a piece of DNA molecule of interest into a DNA carrier (vector) in order to make multiple copies of the DNA of interest in a host cell such as bacteria. Purposes of molecular cloning Separate a gene from the other genes Amplification of modified forms of genetic materials Manipulation of a piece of DNA for further experiments 3
  4. 4. ONTARGET 4 Strategy: DNA Cloning I. Recombinant DNA Technology Restriction Enzyme DNA Ligase I. Polymerase Chain Reaction
  5. 5. ONTARGET I. Recombinant DNA Technology Steps in gene cloning Step 1 Isolation of gene Step 2 Cleave/cut Step 3 Insertion Step 4 Transformation and amplificationStep 5 Screening 5
  6. 6. ONTARGET Cloning 6 Requirement: Key enzymes for cutting and joining of DNA fragments in to vector Cloning vehicles or vector Bacterial transformation and selection of transformed cells
  7. 7. ONTARGET Cloning a Piece of DNA AvaI Cut plasmid vector with AvaI AvaI AvaI 5 3 Excise DNA insert of interest from source using Ava I Ligate the insert of interest into the cut plasmid
  8. 8. ONTARGET Performing the Restriction Digests You will need to set up a restriction digest of your plasmid vector and your DNA of interest Restriction enzymes all have specific conditions under which they work best. Some of the conditions that must be considered when performing restriction digest are: temperature, salt concentration, and the purity of the DNA
  9. 9. ONTARGET Purify your DNA Fragments The insert of interest that you want to clone into your plasmid needs to be separated from the other DNA You can separate your fragment using Gel Electrophoresis You can purify the DNA from the gel by cutting the band out of the gel and then using a variety of techniques to separate the DNA from the gel matrix
  10. 10. ONTARGET Ligation Ligation is the process of joining two pieces of DNA from different sources together through the formation of a covalent bond. DNA ligase is the enzyme used to catalyze this reaction. DNA ligation requires ATP.
  11. 11. ONTARGET Transforming Bacteria After you create your new plasmid construct that contains your insert of interest , you will need to insert it into a bacterial host cell so that it can be replicated. The process of introducing the foreign DNA into the bacterial cell is called transformation.
  12. 12. ONTARGET Competent Host Cells Not every bacterial cell is able to take up plasmid DNA. Bacterial cells that can take up DNA from the environment are said to be competent. Can treat cells (electrical current/divalent cations) to increase the likelihood that DNA will be taken up Two methods for transforming: heat shock and electroporation
  13. 13. ONTARGET Selecting for Transformants The transformed bacteria cells are grown on selective media (containing antibiotic) to select for cells that took up plasmid. For blue/white selection to determine if the plasmid contains an insert, the transformants are grown on plates containing X-Gal and IPTG. (See notes for slide 11.)
  14. 14. ONTARGET Recombinant DNA Technology Recombinant DNA (rDNA) contains DNA from two or more different sources Requires: A vector introduces rDNA into host cell Plasmids (small accessory rings of DNA from bacteria) are common vectors Two enzymes are required to introduce foreign DNA into vector DNA A restriction enzyme - cleaves DNA, and A DNA ligase enzyme - seals DNA into an opening created by the restriction enzyme 14
  15. 15. ONTARGET Drug Resistance Gene Transferred by Plasmid Plasmid gets out and into the host cell Resistant Strain New Resistance Strain Non-resistant Strain Plasmid Enzyme Hydrolyzing Antibiotics Drug Resistant Gene mRNA Juang RH (2004) BCbasics 15
  16. 16. ONTARGET Target Genes Carried by Plasmid 1 plasmid 1 cell Target Gene Recombination Restriction Enzyme Restriction Enzyme ChromosomalDNA Target Genes DNA Recombination Transformation Host Cells Juang RH (2004) BCbasics 16
  17. 17. ONTARGET Amplification and Screening of Target Gene 1 1 cell line, 1 colony X100 X1,000 Plasmid Duplication Bacteria Duplication Plating Pick the colony containing target gene=100,000 Juang RH (2004) BCbasics 17
  18. 18. ONTARGET Key Enzyme : I. Restriction Enzyme Cuts DNA at specific points. Cleaves vector (plasmid) and foreign (human) DNA. Cleaving DNA makes DNA fragments ending in short single- stranded segments with sticky ends. The sticky ends allow insertion of foreign DNA into vector DNA. Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. DNA duplex "sticky ends" restriction enzyme A T A T A T A T A T C G C CG G C G A T A T A T A T A T C G C CG G C G 18
  19. 19. ONTARGET 19
  20. 20. ONTARGET Key Enzyme : II. DNA Ligase Seals the foreign gene into the vector DNA Treated cells (bacteria) take up plasmids Bacteria and plasmids reproduce. Many copies of the plasmid and many copies of the foreign gene. 20 Action: It acts on DNA substrates with 5 terminal phosphate groups and form the phosphodiester bond between two DNA sequences (vector and insert) to join them together
  21. 21. ONTARGET 21
  22. 22. ONTARGET Animation 22
  23. 23. ONTARGET Amplifies a targeted sequence of DNA Create millions of copies of a single gene or a specific piece of DNA in a test tube Requires: DNA polymerase Withstands the temperature necessary to separate double-stranded DNA. A supply of nucleotides for the new, complementary strand DNA Cloning: Polymerase Chain Reaction (PCR) 23
  24. 24. ONTARGET 24 PCR Copyright The McGraw-Hill Companies, Inc. Permission required for reproduction or display. PCR cycles DNA copies first 1 second 2 third 4 old old old strand new new new strand DNA double strand fourth 8 fifth 16 and so forth
  25. 25. ONTARGET 25
  26. 26. ONTARGET 26
  27. 27. ONTARGET 27
  28. 28. ONTARGET Applications of PCR: Analyzing DNA Segments DNA fingerprinting is the technique of using DNA fragment lengths Treat DNA segment with restriction enzymes A unique collection of different fragments is produced Gel electrophoresis separates the fragments according to their charge/size Produces distinctive banding pattern Usually used to measure number of repeats of short sequences Used in paternity suits, rape cases, corpse ID, etc. 28
  29. 29. Restriction Endonucleases
  30. 30. ONTARGET What are restriction enzymes? Molecular scissors that cut double stranded DNA molecules at specific points. Found naturally in a wide variety of prokaryotes An important tool for manipulating DNA. 30
  31. 31. ONTARGET Why Restriction Enzymes? Why would bacterial cells contain proteins that cleave DNA at specific sequences? Generally restriction enzymes are thought to protect bacterial cells from phage (bacterial virus) infection. Bacterial cells that contain restriction enzymes can cut up invasive viral DNA without damaging their own DNA. 31
  32. 32. ONTARGET Discovery In 1962, Werner Arber, a Swiss biochemist, provided the first evidence for the existence of "molecular scissors" that could cut DNA. He showed that E. coli bacteria have an enzymatic immune system that recognizes and destroys foreign DNA, and modifies native DNA to prevent self-destruction. In 1970 Smith and colleagues purified and characterized the cleavage site of a Restriction Enzyme. Werner Arbor, Hamilton Smith and Daniel Nathans shared the 1978 Nobel prize for Medicine and Physiology for their discovery of Restriction Enzymes. 32
  33. 33. ONTARGET Biological Role Most bacteria use Restriction Enzymes as a defence against bacteriophages. Restriction enzymes prevent the replication of the phage by cleaving its DNA at specific sites. The host DNA is protected by Methylases which add methyl groups to adenine or cytosine bases within the recognition site thereby modifying the site and protecting the DNA. 33 Therefore, the restriction enzyme within a cell doesnt destroy its own DNA. However the restriction enzyme can destroy foreign DNA which enters the cell such as bacteriophage.
  34. 34. ONTARGET Types of Restriction Enzymes Cleavage site Location of methylase Examples Type I Random, Recognition site is of 15bp in length Methylate A* in rec site Cleavage site is around 1000bp away from recognition site Endonuclease and methylase located on a single multifunctional protein molecule Require Mg++, ATP and S- adenocyle methionine as cofactor EcoK I EcoA I CfrA I Type II Specific palindromic sequences Within the recognition site Simple enzymes of single polypeptide, Endonuclease and methylase are separate entities Very stable and require only Mg+ + as cofactor EcoR I BamH I Hind III Type III Random, non-palindromic sequences 24-26 bp downstream of the recognition site Endonuclease and methylase located on a single protein molecule Require Mg++ & ATP as cofactor EcoP I Hinf III EcoP15 I 34
  35. 35. ONTARGET Enzyme Activity GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT Scanning GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT Recognition Sequence GGACGCTAGCTGATG CCTGCGATCGACTACTTAA Cleavage AATTCGCATCGGATCCGAATCCGCTCTTTCAA GCGTAGCCTAGGCTTAGGCGAGAAAGTT 35
  36. 36. ONTARGET Diversity of Enzymes EcoRI Esherichia coli R G/AATTC BamHI Baccilu amyloliquefaciens H G/G

Search related