Polymerase Chain Polymerase Chain Reaction (PCR)Reaction (PCR)

DNADNA

DNA is a nucleic acid that is composed DNA is a nucleic acid that is composed of two complementary nucleotide of two complementary nucleotide building block chains.building block chains.

The nucleotides are made up of a The nucleotides are made up of a phosphate group, a five carbon phosphate group, a five carbon sugar, and a nitrogen base.sugar, and a nitrogen base.

DNADNA

DNA SugarDNA Sugar– Deoxyribonucleic acidDeoxyribonucleic acid

RNA SugarRNA Sugar– Ribonucleic acidRibonucleic acid

DNADNA

DNA has four nitrogen bases.DNA has four nitrogen bases.

Two are purines ( 2 ringed base )Two are purines ( 2 ringed base )– Adenine (Adenine ( A A ), Guanine ( ), Guanine ( G G ))

Two are pyrimidines ( 1 ringed base )Two are pyrimidines ( 1 ringed base )– Cytosine (Cytosine ( C C ), Thymine ( ), Thymine ( T T ))

DNADNA

These four bases are linked in a These four bases are linked in a repeated pattern by hydrogen repeated pattern by hydrogen bonding between the nitrogen bases.bonding between the nitrogen bases.

The linking of the two complementary The linking of the two complementary strands is called hybridization.strands is called hybridization.

DNADNA

Example of bonding pattern.Example of bonding pattern.

Primary strandPrimary strand

CCCCGGAAAATTGGGGGGAATTGGCC

GGGGCCTTTTAACCCCCCTTAACCGG

Complementary strandComplementary strand

DNA MoleculeDNA Molecule

AdenineAdenine

ThymineThymine

GuanineGuanine

CytosineCytosine

DNADNA

A purine always links with a pyrimidine A purine always links with a pyrimidine base to maintain the structure of DNA.base to maintain the structure of DNA.

Adenine ( Adenine ( AA ) binds to Thymine ( ) binds to Thymine ( TT ), with ), with two hydrogen bonds between them.two hydrogen bonds between them.

Guanine ( Guanine ( GG ) binds to Cytosine ( ) binds to Cytosine ( CC ), with ), with three hydrogen bonds between them.three hydrogen bonds between them.

What does PCR need?

• Template (the DNA you are exploring)Template (the DNA you are exploring)• Sequence-specific primers flanking the Sequence-specific primers flanking the target sequence, Forward & Reverse.target sequence, Forward & Reverse.• PolymerasesPolymerases• Nucleotides (dATP, dCTP, dGTP,Nucleotides (dATP, dCTP, dGTP, dTTP)dTTP)• Magnesium chloride (enzyme cofactor)Magnesium chloride (enzyme cofactor)• BufferBuffer• Water, mineral oilWater, mineral oil

PCR RequirementsPCR Requirements

Magnesium chloride: .5-2.5mMMagnesium chloride: .5-2.5mM

Buffer: pH 8.3-8.8Buffer: pH 8.3-8.8

dNTPs: 20-200µMdNTPs: 20-200µM

Primers: 0.1-0.5µMPrimers: 0.1-0.5µM

DNA Polymerase: 1-2.5 unitsDNA Polymerase: 1-2.5 units

Target DNA: Target DNA: 1 µg 1 µg

Steps in PCRSteps in PCR

Denaturation 93 to 95°C 1minDenaturation 93 to 95°C 1min

Annealing 50 to 55°C 45secAnnealing 50 to 55°C 45sec

Elongation 70 to 75°C 1-2minElongation 70 to 75°C 1-2min

How does PCR work?How does PCR work?

• Heat (94Heat (94ooC) to denature DNA strandsC) to denature DNA strands• Cool (54Cool (54ooC) to anneal primers to templateC) to anneal primers to template• Warm (72Warm (72ooC) to activateC) to activateTaqTaq Polymerase, Polymerase, which extends primers and replicates DNAwhich extends primers and replicates DNA• Repeat multiple cyclesRepeat multiple cycles

DenaturationDenaturation

Denaturation is the first step in PCR, in whichDenaturation is the first step in PCR, in which

the DNA strands are separated by heating tothe DNA strands are separated by heating to

95°C. 95°C.

The Hydrogen bonds between the two strandsThe Hydrogen bonds between the two strands

breaks down and the two strands separates.breaks down and the two strands separates.

Annealing Annealing

Annealing is the process of allowing two Annealing is the process of allowing two

sequences of DNA to form hydrogen bonds.sequences of DNA to form hydrogen bonds.

The annealing of the target sequences andThe annealing of the target sequences and

primers is done by cooling the DNA to 55°C.primers is done by cooling the DNA to 55°C.

Time taken to anneal is 45 seconds.Time taken to anneal is 45 seconds.

ElongationElongation

Taq polymerase binds to the template Taq polymerase binds to the template DNADNA

and starts adding nucleotides that are and starts adding nucleotides that are

complementary to the first strand.complementary to the first strand.

This happens at 72°C as it is the This happens at 72°C as it is the optimum optimum

temperature for Taq Polymerase.temperature for Taq Polymerase.

PCR CyclesPCR Cycles

PCR CyclesPCR Cycles

Denaturing TemplateDenaturing Template

Heat causes DNA strands to separateHeat causes DNA strands to separate

3’

5’

5’

3’

Denature DNA strands 94Denature DNA strands 94ooCC

5’

3’

3’

5’

PCR CyclesPCR Cycles

Annealing PrimersAnnealing Primers•Primers bind to the template sequencePrimers bind to the template sequence

•Taq Polymerase recognizes double-stranded substrateTaq Polymerase recognizes double-stranded substrate

3’

5’

5’

3’

Primers anneal 64Primers anneal 64ooCC3’

5’

5’

3’3’ 5’3’5’

PCR CyclesPCR Cycles

Taq Polymerase ExtendsTaq Polymerase Extends

3’

5’3’ 5’3’5’

Extend 72Extend 72ooCC

3’

5’3’ 5’3’5’

5’

3’

5’

3’

•Taq Polymerase extends primerTaq Polymerase extends primer

•DNA is replicatedDNA is replicated

RepeatRepeat denaturing, annealing, and extending denaturing, annealing, and extending 30 cycles30 cycles

PCR CyclesPCR Cycles

The target product is The target product is made in the third cyclemade in the third cycle

3’

5’3’5’3’5’

5’

3’

3’

5’5’

3’

5’

3’

5’3’

Cycle 1

Cycle 2

Cycle 33’

3’

3’

3’5’

5’

5’

5’

PCR Cycles ReviewPCR Cycles Review

Denaturation: 94°- 95°CDenaturation: 94°- 95°C Primer Annealing: 55°- 65°CPrimer Annealing: 55°- 65°C Elongation of DNA: 72°Elongation of DNA: 72° Number of Cycles: 25-40Number of Cycles: 25-40 No target products are made until

the third cycle. At 30 cycles there are 1,073,741,764

target copies (~1×109).

PCR PrimersPCR Primers

A primer is a strand of nucleic acid A primer is a strand of nucleic acid that serves as a starting point for that serves as a starting point for DNA replication. DNA replication.

A primer for each target sequence on A primer for each target sequence on the end of your DNA is needed. This the end of your DNA is needed. This allows both strands to be copied allows both strands to be copied simultaneously in both forward and simultaneously in both forward and reverse directions.reverse directions.

Primer Problems Primers should flank the sequence of interest Primers that match multiple sequences will

give multiple products Repeated sequences can be amplified -but

only if unique flanking regions can be found where primers can bind

A primer may form a dimer with itself or with the other primer.

5´-ACCGGTAGCCACGAATTCGT-3´ |||||||||| 3´-

TGCTTAAGCACCGATGGCCA-5´

Primers That Form Hairpins Primers can have self-annealing regions

within each primer (i.e. hairpin and foldbackloops)

A primer may be self-complementary and be able to fold into a hairpin:

5´-GTTGACTTGATA ||||| T 3´-GAACTCT The 3´ end of the primer is base-paired, preventing it annealing to the target DNA.

PCR Taq DNA PolymerasePCR Taq DNA Polymerase

• Taq stands for Taq stands for Thermus aquaticusThermus aquaticus, , which is a microbe found in 176°F which is a microbe found in 176°F hot springs in Yellow Stone National hot springs in Yellow Stone National Forest.Forest.

• Taq DNA Polymerase (Taq Pol) is Taq DNA Polymerase (Taq Pol) is stable in high temperatures and acts stable in high temperatures and acts in the presence of Mg. in the presence of Mg.

• The optimum temperature for Taq The optimum temperature for Taq Pol is 72°CPol is 72°C

Disadvantages of Taq PolDisadvantages of Taq Pol

Taq Pol lacks 3’ to 5’ exonuclease Taq Pol lacks 3’ to 5’ exonuclease proof reading activity, proof reading activity, commonly present in

other polymerases. Taq mis-incorporates 1 base in 104. A 400 bp target will contain an error

in 33% of molecules after 20 cycles. Error distribution will be random.

Limitations of PCRLimitations of PCR

Need for target DNA sequence informationNeed for target DNA sequence information Primer Designing for unexplored ones.Primer Designing for unexplored ones. Boundary regions of DNA to be amplified must be known.Boundary regions of DNA to be amplified must be known. Infidelity of DNA replication.Infidelity of DNA replication. Taq Pol – no Proof reading mech – Error 40% after 20 Taq Pol – no Proof reading mech – Error 40% after 20

cyclescycles Short size and limiting amounts of PCR product Short size and limiting amounts of PCR product Up to 5kb can be easily amplified .Up to 5kb can be easily amplified . Up to 40kb can be amplified with some modifications.Up to 40kb can be amplified with some modifications. Cannot amplify gene >100kbCannot amplify gene >100kb Cannot be used in genome sequencing projects.Cannot be used in genome sequencing projects.

How to overcome How to overcome Difficulties?Difficulties?

• Pfu DNA Polymerase from Pfu DNA Polymerase from Pyrococcus Pyrococcus furiosusfuriosus possesses 3' to 5' exonuclease possesses 3' to 5' exonuclease proofreading activity.proofreading activity.

• The error rate is only 3.5% after 20 cycles The error rate is only 3.5% after 20 cycles • More amount of primer is added to avoidMore amount of primer is added to avoid

primer dimering.primer dimering.• For unexplored genes, primers used in For unexplored genes, primers used in

closely closely

related species are used.related species are used.

Designing PCR Primers

Primer sequences should be unique Primers should be ~20 bases long. The G/C content should be 45–55%. The annealing temperatures should be

within 1°C of one another. The 3´-most base should be a G or C. The primers must not base pair with each

other or with themselves or form hairpins. Primers must avoid repetitive DNA regions.

Advantages of PCRAdvantages of PCR

Speed Speed Ease of useEase of use Sensitivity Sensitivity RobustnessRobustness

Applications of PCRApplications of PCR

Screening human DNA samples for mutations Screening human DNA samples for mutations associated with genetic diseases such as associated with genetic diseases such as thalassemia and cystic fibrosis.thalassemia and cystic fibrosis.

Can detect the presence of viral DNA before it Can detect the presence of viral DNA before it turns in to a killer.turns in to a killer.

PCR enables rapid amplification of template PCR enables rapid amplification of template DNA for screening of uncharacterized DNA for screening of uncharacterized mutations mutations

Can obtain sequences from hair, blood stain, Can obtain sequences from hair, blood stain, bones, other forensic specimens, other bones, other forensic specimens, other remains preserved at archaeological sites.remains preserved at archaeological sites.

Shanthilal.JShanthilal.J

III B.Tech., Biotechnology,III B.Tech., Biotechnology,

K.S.Rangasamy College of K.S.Rangasamy College of TechnologyTechnology

Tiruchengode.Tiruchengode.

By,By,