Infection, Genetics and Evolution 20 (2013) 177–187

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier .com/locate /meegid

Monitoring of influenza viruses in Western Siberia in 2008–2012

1567-1348/$ - see front matter � 2013 Published by Elsevier B.V.http://dx.doi.org/10.1016/j.meegid.2013.08.025

⇑ Corresponding author at: Novosibirsk State University, Pirogov St., 2, Novosi-birsk 630090, Russia. Tel.: +7 383 3367540; fax: +7 383 3367540.

E-mail addresses: ilyichev@mail.ru, alex@fen.nsu.ru (T. Ilyicheva).

T. Ilyicheva a,b,⇑, I. Sobolev a,b, I. Susloparov b, O. Kurskaya a,b, A. Durymanov a,b, K. Sharshov a,b,A. Shestopalov b

a Novosibirsk State University, Pirogov St., 2, Novosibirsk 630090, Russiab State Research Center of Virology and Biotechnology ‘‘Vector’’, Koltsovo, Novosibirsk 630559, Russia

a r t i c l e i n f o

Article history:Received 16 July 2013Received in revised form 23 August 2013Accepted 27 August 2013Available online 5 September 2013

Keywords:Human anti-H5 antibodiesInfluenza virusMolecular epidemiologic monitoringWestern Siberia

a b s t r a c t

Western Siberia is of great importance in ecology and epidemiology of influenza. This territory is nestingarea for great amount of bird species. Territorial relations of Western Siberian birds that are establishedduring seasonal migration are extremely wide since this region is an intersection point of bird migrationflows wintering in different regions of the world: Europe, Africa, Middle East, Central Asia, Hindustan, andSouth East Asia. Reassortant influenza viruses that can cause outbreak among population may emerge inWestern Siberia with high probability. Thus, it is extremely important to carry out widespread study ofcirculated viruses, their molecular biological properties, phylogenetic links in this region, as well as herdimmunity to influenza virus serotypes with epidemic potential.

� 2013 Published by Elsevier B.V.

1. Introduction

Western Siberia is of great importance in ecology and epidemi-ology of influenza. The South of this region (the Ob and Irtysh rivervalleys, Ob–Irtysh interfluves) is replete with rivers and lakes thatlie in migration paths of many bird species. Thus, this territory isnesting area for great amount of bird species ecologically con-nected with water. Forest steppe of Western Siberia representsboth huge ‘‘incubator’’ where millions of nestlings are broughtout in nesting periods, and vast ‘‘station’’ where even more amountof birds stop during their migration and nest in boreal coniferousforests and Arctic prairie. Territorial relations of Western Siberianbirds that are established during seasonal migration are extremelywide since this region is an intersection point of bird migrationflows wintering in different regions of the world: Europe, Africa,Middle East, Central Asia, Hindustan, and South East Asia. Further-more, the South of Western Siberia is a region with extended infra-structure and relatively high (for Siberia) population density.Therefore, there is high probability of emergence of reassortantstrains between human and animal influenza viruses, as well asemergence of local outbreaks of human morbidity caused byuncommon variants of influenza viruses.

In view of the above facts, it seems obvious that it is necessaryto carry out widespread study of circulating viruses, their molecu-lar biological properties, and phylogenetic links in Western Siberia.

We have studied epizootology and ecology of avian influenzaviruses since 2002. We showed large variety of influenza A virusesamong different wild bird species (Marchenko et al., 2012;Sharshov et al., 2010; Sivay et al., 2013, 2012). It was revealed thatduring 10 years influenza A/H3N8 and A/H4N6 virus subtypesprevail among birds (Marchenko et al., 2012; Sivay et al., 2012).Genome reassortation was detected in a number of influenzaviruses (Marchenko et al., 2012; Sivay et al., 2013). Interestingly,we isolated in Western Siberia reassortant influenza H15N4 virussubtype, previously having isolated only in the Southernhemisphere (Marchenko et al., 2012). Additionally, we showed thatseveral Western Siberian lakes are of key importance in highlypathogenic influenza A/H5N1 epizootology. Therefore research ofcirculating influenza virus strains and herd immunity in WesternSiberia is of great importance, since it enables to detect nontypicalvirus variants that are likely to emerge in this region.

The objective of this work is to analyze results of molecularepidemiologic monitoring of influenza in human population ofWestern Siberia in 2008–2012.

2. Materials and methods

2.1. Biosafety

Work with influenza A/H1N1, A/H1N1pdm, and A/H3N2 wascarried out in BSL-2 virological laboratories. All studies of influenzaA/H5N1 viruses were conducted in BSL-3 lab. The use of clinicalsamples (nasopharyngeal swabs, autopsy material, blood sera)

178 T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187

was approved by Ethics Committee IRB 00001360 (protocol #2 d.d.20.05.2008).

Nasopharyngeal swabs and autopsy material were collected inhospitals of Novosibirsk, Tomsk, Omsk, Krasnoyarsk, Barnaul, andin hospitals from several towns of Novosibirsk region: Dovolnoe,Zdvinsk, Karasuk (230, 280, and 400 km to the South–West ofNovosibirsk, respectively), and Koltsovo (the nearest suburb). In to-tal 1132 samples were collected. Ten percent of patients were vac-cinated. Google map (Appendix A) demonstrates collection sites.

Virus was isolated from nasopharyngeal swabs collected frompatients with provisional diagnosis of ‘‘influenza’’ or from autopsymaterial (10% homogenate in Hanks’ solution). Homogenate ortransport medium containing clinical material was centrifuged at400g for 10 min and inoculated into culture plates with a mono-layer MDCK cells. Virus reproduction was checked visually on thebase of cytopathic effect in the hemagglutination of goose and hu-man erythrocytes. All nasopharyngeal swabs and isolated influenzavirus strains were tested in PCR.

Blood sera were collected in towns Dovolnoe, Zdvinsk, Karasuk,Kogalym, Novoagansk, Khanty–Mansiysk, and Rostov-on-Don. Intotal 2282 blood sera samples were collected.

Sera from participants were tested for antibodies to H5 virus bymicroneutralization assay (MN) and hemagglutinin inhibition test(HI). In test work we used A/Commongull/Chany/06 (HPAI H5N1)(clade 2.2) virus isolated in Western Siberia from dead Commongull – European and Asian subspecies of Larus canus (Sharshovet al., 2010).

Sera were also tested for antibodies to human influenza Aviruses of the H1 and H3 subtypes for control purposes (data notshown). Ferret antisera raised against homologous viruses wereused as positive control sera for the assays. Human antisera weretested at a starting dilution of 1:10.

2.2. Hemagglutination-inhibition test

Presence of antibodies to influenza A/H5N1 in blood sera wasdetected according to WHO recommendations in HI test with horse

Primers for amplification of HA gene (segment 4) of iSW-HA-F1 TGTAAAASW-HA-F351 TGTAAAASW-HA-F736 TGTAAAASW-HA-R943 CAGGAAASW-HA-R1204 CAGGAAASW-HA-R1340 CAGGAAASW-HA-R1541 CAGGAAASW-HA-R1778 CAGGAAAPrimers for amplification of NA gene (segment 6) of iSW-NA-F0 TGTAAAASW-NA-F318 TGTAAAASW-NA-F536 TGTAAAASW-NA-F941 TGTAAAASW-NA-R740 CAGGAAASW-NA-R1063 CAGGAAASW-NA-R1346 CAGGAAASW-NA-R1452 CAGGAAAPrimers for amplification of HA gene (segment 4) of iHA_F_1BM13 TGTAAAAHA_R_589M13 CAGGAAAHA_F_453BM13 TGTAAAAHA_R_975M13 CAGGAAA

erythrocytes as described in (Rowe et al., 1999). Before study alltested sera were treated with RDE (Denka Seiken, Tokyo, Japan)that destroys non-specific inhibitors. After that twofold sera dilu-tions were mixed with four HAU of inactivated by b-propiolactonevirus (Rowe et al., 1999) and incubated for 60 min at room temper-ature. Then equal amount of one percent erythrocytes suspensionwas added in each well of the plate. Sera were considered positiveif the antibody titer was equal to or greater than 40.

2.3. Microneutralization test

Sera were analyzed in microneutralization assay as described in(Rowe et al., 1999). Twofold sera dilutions previously heated for30 min at 56 �C were mixed with 100 TCID50/100 ll of virus, keptfor 60 min at 37 �C in 5% CO2 atmosphere. After that we added1.5 � 104 MDCK cells and incubated for 18–20 h. Then cells werefixed; presence of virus antigen in cells was detected using ELISA.Mice anti-NP monoclonal antibodies (CDC) were used as the firstantibodies, goat antimouse IgG conjugated by horseradish peroxi-dase (Sigma) – as the second ones. Sera were considered positive ifthe antibody titer was equal to or greater than 80.

Influenza virus RNA isolation was carried out with the kit PROME-GA SV Total RNA Isolation System (Promega Corporation, Madison,WI, USA) in compliance with the manufacturer’s recommendations.

To type and subtype influenza virus strains we used a set of re-agents for the detection of influenza A and influenza B virus RNA inclinical materials using PCR with hybridization-fluorescence detec-tion AmpliSens� Influenza virus A/B-FL and the kit for typing (sub-type identification of H1N1 and H3N2) of influenza A virusesAmpliSens� Influenza virus A-type-FL made by Central researchinstitute of epidemiology of the Ministry of health of Russia (Mos-cow, Russia).

To produce cDNA from influenza virus RNA matrix reversetranscription was carried out with the kit Fermentas RevertAid(Fermentas International Inc., Vilnius, Lithuania).

To amplify certain gene segments encoding influenza virussurface glycoproteins PCR with gene-specific primers was used(Ghedin et al., 2005). We used the following primer sequences:

nfluenza A/H1N1pdm09CGACGGCCAGTATACGACTAGCAAAAGCAGGGGCGACGGCCAGTACRTGTTACCCWGGRGATTTCACGACGGCCAGTAGRATGRACTATTACTGGACCAGCTATGACCGAAAKGGGAGRCTGGTGTTTACAGCTATGACCTCTTTACCYACTRCTGTGAACAGCTATGACCTTCTKCATTRTAWGTCCAAACAGCTATGACCTCATAAGTYCCATTTYTGACAGCTATGACCGTGTCAGTAGAAACAAGGGTGTTT

nfluenza A/H1N1pdm09CGACGGCCAGTAGCAAAAGCAGGAGTCGACGGCCAGTTACACAAAAGACAAYAGCCGACGGCCAGTGGTCAGCAAGCGCATGYCATG ACGACGGCCAGTTAGGATACATCTGCAGTGGCAGCTATGACCGGRCCATCGGTCATTATGCAGCTATGACCCATATYTGTATGAAAACCCAGCTATGACCGCTGCTYCCRCTAGTCCAGATCAGCTATGACCAGTAGAAACAAGGAG

nfluenza A/H3N2CGACGGCCAGTAGCARAAGCAGGGGACAGCTATGACCTTGTTTGGCATRGTCACGTTCCGACGGCCAGTTTCRAYTGGRCTGGRGTCRCCAGCTATGACCTTTTGAAADGGYTTGTCATTGG

HA_F_872M13 TGTAAAACGACGGCCAGTAAGCTCRATAATGAGRTCAGATHA_R_1425M13 CAGGAAACAGCTATGACCAGTCAGTYAGATSAATTGTATGTTGHA_F_1300M13 TGTAAAACGACGGCCAGTTTCAGGACCTCGAGAAATAYGHA_R_1778BM13 CAGGAAACAGCTATGACCAGTAGAAACAAGGGTGTTTTPrimers for amplification of NA gene (segment 6) of influenza A/H3N2NA_F_1M13 TGTAAAACGACGGCCAGTAGCRAAAGCAGGNA_R_560M13 CAGGAAACAGCTATGACCTCGTGACAACTTGAGCTGGACNA_F_415M13 TGTAAAACGACGGCCAGTTATCAATTTGCMCTTGGRCAGGNA_R_984M13 CAGGAAACAGCTATGACCAAGYCCTGAGCACACATARCNA_F_880BM13 TGTAAAACGACGGCCAGTTCAGATGTRTHTGCMGAGACNA_R_1465BM13 CAGGAAACAGCTATGACCAGTAGAAACAAGGAGTTTTT

T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187 179

Amplification was carried out with DNA Engine Dyad PeltierThermal Cycler (Bio-Rad, USA). In order to extract gene segmentsobtained by PCR which were coding NA and HA of studied influ-enza A/H3N2 virus strains a set of reagents QIAquick Gel ExtractionKit (Qiagen GmbH, Hilden) was used.

Sequence analysis was conducted with BigDye terminator cyclesequencing ready reaction kit (Applied BioSystems, USA). Amplifi-cation passed in accordance with the manufacturer’s recommenda-tions. To purify the product the BigDye XTerminator purificationkit (Applied BioSystems, USA) was used. Automatic sequenator310 Genetic Analyzer (Applied BioSystems, USA) was used for theanalysis of products.

Analysis of nucleotide sequences was carried out with the pro-gram package SeqMan (Lasergene) and specific Influenza Virus Re-source (Bao et al., 2008) and BLAST (National Center forBiotechnology Information, U.S. National Library of Medicine). Tocarry out multiple sequence alignment and nucleotide sequencetranslation as well as to analyze obtained amino-acid sequenceswe used BioEdit sequence alignment editor.

Phylogenetic trees based on adjusted nucleotide sequences werebuilt with the program MEGA5 using the neighbor-joining method(model: maximum composite likelihood) (Saitou and Nei, 1987). Tovalue certainty bootstrap test (1000 replications) was used.

3. Results

In summer, 2005 highly pathogenic influenza A/H5N1 virus wasisolated and described for the first time in Russia (Onishchenkoet al., 2006). It seems that the virus was carried by migrating birdsduring spring migration from South East Asia. The first outbreakamong poultry was registered in the South of Western Siberia.After that the virus spread up to Caspian–Black Sea region and fur-ther – to the South of West Europe. During 2005–2007 in the Southof Western Siberia there were numerous HPAI outbreaks caused byA/H5N1 virus serotype among poultry and wild birds.

Since August, 2005 we have studied clinical samples and au-topsy material from people that were suspected to have an illnesscaused by avian influenza A/H5N1 virus. We analyzed 289 samplesusing PCR, presence of virus was verified by inoculation in embry-onated chicken eggs and MDCK cell culture (at least three pas-sages). We did not detect A/H5N1 virus in samples.

We made permanent serological monitoring among populationin adverse regions to detect antibodies to A/H5N1 virus in humanblood sera. From August, 2005 to December, 2007 we collected1115 samples. From 2007 to April, 2009 we collected 1167 bloodsera samples in several regions differed by level of risk of avianinfluenza A/H5N1 contamination. Among them 33 samples werecollected in August, 2005 from residents of Suzdalka (Novosibirskregion) where HPAI A/H5N1 was isolated for the first time in Rus-sia. All samples were obtained from farmers whose poultry died.We collected 1880 samples in different localities of Novosibirsk

region where outbreaks among birds caused by A/H5N1 wereregistered. We also collected 350 samples from people inKhanty–Mansi Autonomous Area (KMAA). We did not detect avianinfluenza A/H5N1 viruses. However, a lot of residents of that areaare hunters; thus, they could belong to risk group. Finally, we col-lected 51 samples from poultry farm personnel in Rostov-on-Donwhere avian influenza outbreak of A/H5N1 occurred (see Table 1).

Sera from all age groups older than 18 were analyzed. All serawere tested in HI and MN assays. There were no sera positive toA/H5N1 before 2008. We detected antibodies to A/H5N1 virus in2008 in blood sera of residents from KMAA, and in 2009 – fromKMAA and Novosibirsk region. The results are shown in Table.

As shown in Table in 31 (2.66%) samples we detected antibodiesto HPAI A/H5N1 serotype in HI test, and in 8 (0.69%) samples anti-bodies to A/H5N1 were detected with the use of HI and MN assays.Since it is unknown who contacted with A/H5 virus serotype andwhen, it is difficult to suppose why neutralizing antibodies are ab-sent on low level in sera. It is also possible that we sometimes gotfalse-positives results in HI test. But even in that case part of serawas positive both in HI test and MN assay. In accordance withWHO recommendations (Katz et al., 1999), this fact is sufficientto prove the presence of antibodies to influenza virus serotype A/H5 in human sera. So far, this is the first and the only case of detec-tion of antibodies to A/H5N1 virus serotype in human sera in Rus-sia. Since 2009 among 4266 samples we have not detected anyserum positive to H5.

3.1. Epidemic season of 2008–2009

During the last pre-pandemic season of 2008–2009 we ana-lyzed 149 samples (pharyngeal swabs), collected in February–March, 2009 in different areas of Novosibirsk region: Dovolnoe,Zdvinsk (both 350 km to the West of Novosibirsk), Koltsovo (thenearest suburb), and Novosibirsk. In MDCK cell culture we isolated17 influenza virus strains, which include 9 influenza A/H1N1 virusstrains, 5 – A/H3N2, and 3 – influenza B.

We obtained full nucleotide sequences of hemagglutinin andneuraminidase genes of all isolated strains. Analysis revealed thatHA protein of A/H1N1 virus strains and gene, that codes thisprotein, are structurally close to the reference A/Brisbane/59/2007(H1N1). All A/H3N2 strains were variations of the referenceA/Brisbane/10/2007(H3N2). All sequences were deposited intoGenBank (CY053650–CY053676). Analysis of nucleotide sequencesof HA revealed a number of substitutions, homology withreference-strains was 98.2–99.9%. Nonsynonymous substitutionsdominated, yielding amino-acid changes: protein homology was96.5–99.6%. I.A. Wilson and N.J. Cox (Wilson and Cox, 1990) believethat drift variant of epidemiologic importance has generally hadfour or more amino-acid substitutions located in two or more ofthe antigenic sites on subunit HA1. Among A/H1N1 viruses havingcirculated in the South of Western Siberia we isolated three strains

Table 1HI and MN of human sera against A/H5N1. 2282 blood sera were collected in Western Siberia where outbreaks among birds caused by A/H5N1 were registered in 2005–2007. 350 samples were collected from people in KMAA. 28 human sera from KMAA and 2 from Novosibirskregion were positive in HI test against A/H5 (titer P40) and 8 human sera from KMAA were positive in MN against A/H5N1 (titer P80).

Seraa Data of blood sampling HI testb Microneutralizationb

A 15.08.2008 640 <20A, contact 1 28.08.2008 640 20A, contact 2 28.08.2008 1280 40B, 12.08.2008 640 40B, contact 1 27.08.2008 640 1280B, contact 2 27.08.2008 1280 1280B, contact 3 29.08.2008 640 320C 12.09.2008 1280 320C, contact 1 28.08.2008 <20 <20D 20.08.2008 640 <20E 24.02.2009 160 <20F 19.03.2009 160 <20G 16.03.2009 160 40H 16.03.2009 320 <20I 17.03.2009 320 320J 18.03.2009 160 <20K 19.03.2009 160 40L 20.03.2009 160 40M 23.03.2009 320 <20N 23.03.2009 160 20O 23.03.2009 320 320P 25.03.2009 160 <20Q 25.03.2009 160 <20R 19.03.2009 160 80S 24.02.2009 160 <20T 24.02.2009 160 40U 27.01.2009 160 <20V 02.03.2009 160 <20W 19.03.2009 160 80X 22.02.2009 160 <20Y 24.02.2009 160 40Ferret positive serac 10240 1280

a All sera are paired, with 7 days interval. Date of the first blood sampling is indicated. Sera titers in pair differed not more than 2times. We indicated less titer.

b When analyzing we used highly pathogenic influenza A/Commongull/Chany/06 (H5N1) virus (clade 2.2) (Sharshov et al., 2010).c Ferret sera to A/H5N1 virus kindly furnished by WHO Collaborating Centre for influenza (Atlanta, USA).

180 T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187

(A/Novosibirsk/2/2009, A/Novosibirsk/4/2009, and A/Novosibirsk/7/2009) with four amino-acid changes in the antigenic sites Ca,Cb, and Sb. A/H3N2 strains had only two changes in HA antigenicsites: P194L – in the site B, and R174Q – in the site E. Nevertheless,it should be noted that substitution in position 174 is unique; vac-cine strains of 2005–2009 did not have this change.

3.2. Pandemic of 2009

Contrary to predictions of experts that new influenza pandemicshould be caused by strain on the base of avian influenza A/H5N1virus, pandemic of 2009 was caused by influenza A/H1N1pdm09.The first case of human infection with pandemic influenza virusin Russia was identified in a tourist having returned from theUSA on May 18, 2009. The virus spread over the country within ashort period of time. By July, confirmed human cases were re-ported in Yekaterinburg, Tomsk, Barnaul, and Vladivostok. At thebeginning of the pandemic, the virus was only isolated from recenttravelers and their close contacts. Later the virus was detected inpeople without direct contact with travelers who had returnedfrom abroad. Soon after, human cases of influenza infection withsevere outcome were detected. The first fatal cases were registeredin the neighboring Chita and Amur regions, with the highest mor-bidity rate from pandemic influenza infection reported in the Amurregion (Ilyicheva et al., 2011).

Using 106 clinical samples and autopsy material collected inWestern Siberia during 2009–2010, we isolated 20 influenza A/H1N1pdm09 virus strains that were antigenically close to vaccinestrain A/California/07/2009.

Comparison of nucleotide sequences of surface proteins geneswith corresponding sequences of reference-strain of pandemicinfluenza A/California/07/2009(H1N1)pdm09 virus revealed eightamino-acid changes in HA, and four changes in NA.

In hemagglutinin of A/Karasuk/01/2010 strain we detectedaspartic acid to glycine substitution in position 222 (D222G). Thisstrain was isolated from autopsy material (fragment of lung). Thissample was obtained in late December, 2009 from woman born in1952 who was treated in hospital. This mutation is often connectedwith severe course of a disease (Antón et al., 2010; Miller et al.,2010).

Phylogenetic trees (Fig. 1) represent phylogenetic relationsbetween strains on the basis of gene nucleotide sequences. Asshown in Fig. 1, all isolated in 2009 strains on phylogenetic treesare located near to trunk, which is explained by few mutations:from 3 to 6 in HA, and from 0 to 2 – in NA in relation to prototypestrain A/California/07/2009. Consequently, nucleotide and amino-acid sequences of pandemic influenza virus strains isolated in2009 in Western Siberia are identical (99% or more) to referencestrain A/California/07/2009(H1N1)pdm09.

3.3. Post-pandemic period

In 2010–2011 epidemic increase of influenza morbidity andacute respiratory viral infection in Russia was registered since lateNovember, 2010 with the highest rate in the fifth week of 2011(31.01.11–06.02.11). From January to March, 2010 we collected258 pharyngeal swabs in Novosibirsk, Koltsovo (5 km from Novo-sibirsk), Dovolnoe, and Tomsk (250 km to the North East from

Fig. 1. Phylogenetic relationships of the HA gene segment (1701 nucleobases) (1A) and NA gene segment (1410 nucleobases) (1B) of influenza A/H1N1pdm09 viruses inWestern Siberia in 2009–2011. The trees were rooted with the vaccine strain A/California/07/2009 as outgroup. Phylogenetic trees were constructed by the neighbor-joiningmethod and bootstrap analysis to determine the best-fitting tree for the gene. For the comparison, we have included strains reported from GenBank.

T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187 181

Fig. 1 (continued)

182 T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187

T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187 183

Novosibirsk). From those samples in MDCK cells we isolated: 47influenza A/H1N1pdm09 virus strains, 3 A/H3N2 strains, and 19influenza B virus strains.

Isolated strains were typed and subtyped in HI test. PCR withreal-time results detection was used to verify HI test results.Molecular genetic analysis showed that isolated strains A/H1N1pdm09 are close to vaccine strain A/California/7/2009(H1N1)pdm09, despite a number of amino-acid substitutionsin HA and NA surface proteins (GenBank accession numbers:CY103841–CY103856, JQ041354–JQ041361). When comparingHA amino-acid sequences we detected eight changes specific toall studied strains, as well as a number of unique changes specificto individual strains. Some of detected changes located in determi-nants of HA: changes S203T (antigenic site Ca1) and S185T (anti-genic site Sb) are specific to all studied influenza A/H1N1pdm09virus strains, and change E235 K (Ca1) was observed in HA ofstrains A/Novosibirsk/53k/2011, A/Novosibirsk/89d/2011, and A/Tomsk/29/2011. Phylogenetic analysis (Fig. 1) showed that dueto antigenic drift of influenza A/H1N1pdm09 there were seven ge-netic clades in tree in 2011. All described strains according to theirHA and NA belonged to the seventh genetic clade.

We performed molecular genetic analysis of nucleotide se-quences of HA and NA of influenza A/H3N2 virus strains (GenBankaccession numbers: JN940427–JN940432). In primary structure ofHA protein of analyzed strains we detected changes that are spe-cific to vaccine strain of 2009–2011 A/Perth/16/2009 and differ thisprotein from previous epidemic seasons vaccine strain A/Brisbane/10/2007: E78K, N160K, K174N, K189Q, N205K, I377R. Further-more, in HA gene structure of isolated strains we found amino-acidsubstitutions that differ them from vaccine strain A/Perth/16/2009(E66K, P178S, S230I, I276M, and R277Q in all strains). We also de-tected several unique substitutions: T183I, S416L in A/Novosibirsk/76k/2011 strain and S140N, I538M – in A/Novosibirsk/1927/2011strain. The interested reader is advised to consult our previousstudy with detailed molecular genetic analysis of those strains(Sobolev et al., 2012). Analysis of influenza B virus strains showedthat they belong to Victoria lineage and are close to vaccine strainB/Brisbane/60/2008.

Hence, in the 2010–2011 epidemic season in Western Siberiawe observed mixed etiology of influenza: morbidity was causedby influenza A/H1N1pdm09 virus strains, A/H3N2, and influenzaB virus strains, but A/H1N1pdm09 was dominant.

3.4. Epidemic season of 2011–2012

In Russia epidemic increase of morbidity of influenza and acuterespiratory viral infection was registered in the beginning ofMarch, 2012, i.e., significantly later than in previous years, andits course was of low intensity. The highest rate of morbidityoccurred in 15–16 weeks of 2012 (09.04.2012–22.04.2012). Naso-pharyngeal and pharyngeal swabs were collected from Decemberof 2011 to June of 2012. In total we analyzed 619 samples; wheninfecting MDCK cells we isolated 104 influenza virus strains,including eight influenza B virus strains and 96 influenza A/H3N2ones.

Among eight influenza B virus strains isolated in 2011–2012 inWestern Siberia seven strains belonged to Yamagata lineage andantigenically were close to B/Wisconsin/01/2010. Only one strainbelonged to Victoria lineage and antigenically was close to B/Bris-bane/60/2008. It is worth noting that during the last three epi-demic seasons in Western Siberia only Victoria lineage influenzaB virus strains were isolated.

During the 2011–2012 season in Western Siberia influenza A/H3N2 virus was predominant. Carrying out molecular genetic anal-ysis we detected full nucleotide sequences of NA and HA genescoding corresponding surface glycoproteins of influenza virus.

We also carried out comparative analysis of amino-acid sequencesof HA and NA of influenza A/H3N2 virus strains isolated in WesternSiberia in the 2011–2012 epidemic season, as well as of strains iso-lated and described in 2009–2011. Using nucleotide sequences ofHA and NA genes we built phylogenetic trees (Fig. 2).

Phylogenetic analysis and analysis of amino-acid changes in HAprimary structure showed close relation of influenza A/H3N2 virusstrains isolated in Western Siberia in 2011–2012 to vaccine strainA/Victoria/361/2011; strains belonged to genetic groups 3B and 3Cfrom Victoria/208 clade. Most changes (85%) detected in amino-acid sequences of HA in all analyzed strains sampling were local-ized in antigenic determinants. It is associated with antigenic driftthat enables seasonal strains to evade host immune pressing andstrengthen respective amino-acid changes in antigenic determi-nants of influenza virus hemagglutinin.

Amino-acid structure of neuraminidase protein of studiedstrains from the 2011–2012 epidemic season differed from bothearlier vaccine strains A/Brisbane/10/2007 and A/Perth/16/2009,and from strain A/Novosibirsk/76k/2011 isolated in Novosibirsk re-gion in the 2010–2011 epidemic season, and was close to vaccinestrain A/Victoria/361/2011. There were no mutations account forresistance to oseltamivir in amino-acid sequence of NA protein ofstrains isolated in the 2011–2012 epidemic season.

Thus, 2011–2012 influenza epidemic season in the South ofWestern Siberia was polyetiologic, however, circulation of influ-enza A/H3N2 virus was predominant.

4. Discussion

Until 2009 avian influenza A/H5N1 virus was considered as amain candidate that could cause a future pandemic. Since 2005 tillthe present day we have permanently monitored markers of influ-enza viruses in human sera. In 2008–2009 we collected 1167 bloodsera from Western Siberian residents. In 31 (2.66%) samples we de-tected antibodies to HPAI A/H5N1 serotype in HI test, and in 8(0.69%) samples antibodies to A/H5N1 were detected with theuse of HI test and MN assay. All positive sera were collected frompatients whose case history did not include illness caused by HPAIA/H5N1 and who did not contact with poultry. Our data show thatamount of seropositives is still low, although HPAI A/H5N1 viruseshave been isolated in Russia since 2005. Since 2009 we have notdetected any serum positive to H5 in people from Western Siberia(4266 samples were analyzed).

Data from other countries concerning human sera that are posi-tive to H5 virus are consistent with our results. Thus, in Vietnam in2001 seroprevalence of H5 antibodies was 4% in poultry workersand 1% in non-poultry workers (Uyeki et al., 2012). In China, inMarch, 2011, 1741 participants were recruited from commercialduck-breeding farms, private duck-breeding farms, and duck-slaughtering farms. Blood samples were collected from subjectsfor antibody testing against H5 virus; none of the subjects wereseropositive to H5 virus (Yang et al., 2012).

Human infection with A/H5N1 virus is unlikely to happen, andherd immunity to this pathogen is still low. It should be noted thatin Russia human blood sera positive to H5 were detected only inWestern Siberia. This fact confirms importance of this region inecology and epidemiology of influenza A virus.

The 2008–2009 epidemic season was the last one before thebeginning of new influenza pandemic. According to Russian Na-tional Center of influenza, in epidemic season of 2008–2009 influ-enza A/H3N2 viruses were predominant (58.7%) and were isolatedin 19 cities in different regions of Russia. Antigenic analysisshowed that majority of viruses were drifting variants of referencestrain A/Brisbane/10/07 included in the compound of vaccines for2008–2009 season. There were 15.7% of A/H1N1 viruses among

Fig. 2. Phylogenetic relationships of the HA gene segment (1701 nucleobases) (2A) and NA gene segment (1410 nucleobases) (2B) of A/H3N2 viruses in Western Siberia in2009–2012. Phylogenetic trees were constructed by the neighbor-joining method and bootstrap analysis to determine the best-fitting tree for the gene. For the comparison,we have included strains reported from GenBank.

184 T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187

Fig. 2 (continued)

T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187 185

186 T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187

all isolated strains. As for influenza B, we observed monocircula-tion of Victoria lineage virus in the season of 2008–2009. All iso-lated strains reacted effectively with sera to B/Brisbane/33/08(Konovalova et al., 2010).

Out data showed that in 2008–2009 in Western Siberia influ-enza A/H1N1 viruses were dominant or, at least, their circulationwas equal to A/H3N2. All A/H3N2 strains were variants of referencestrain A/Brisbane/10/2007(H3N2), A/H1N1 virus strains were closeto reference strain A/Brisbane/59/2007(H1N1). Influenza B viruseswere isolated occasionally and belonged to Victoria lineage.

Thus, epidemic process just before influenza pandemic was ofclear polyetiologic nature. Influenza A/H1N1, A/H3N2, and influ-enza B viruses of two genetic lineages were isolated worldwide(FluNet). Percent of isolation of A/H1 and A/H3 strains wereapproximately similar around the world with some differences atregional levels. Somewhat below there were indices of isolationof influenza B viruses. Low intensity and relatively low mortalitywere typical for two last epidemics both in the world, and in Russia(Konovalova et al., 2010).

At the end of epidemic season of 2008–2009, on April 24, 2009World Health Organization was informed about emergence of newvirus isolated in Mexico and the USA. Pandemic virus rapidlyspread over all North America, after that – in Europe and otherparts of the world. As a result emergency in public health occurred,and on June 11, 2009 WHO declared influenza pandemic. In mostEuropean countries in spring and summer the first wave of influ-enza was observed. Disease attack rate decreased for short whilein summer, and then increased again at the beginning of fall whenschool opened. At that time fall–winter wave spread west-to-eastover all European countries, brought severe course of disease andlasted about 14 weeks.

Out data is consistent with information from other countries.Before fall, 2009 we detected the virus mainly in people who hadreturned from abroad or their close contacts. In November, 2009we began to detect pandemic influenza virus in human who didnot have direct contact with people having returned from abroad.Severe outcome and the first fatal cases were registered. At thattime severe outcomes were also registered in other Russian re-gions. Most fatal cases were caused by primary virus pneumonia;disorder of microcirculation resulted in hemorrhages and bleedingwas the main indicator of pathogenicity (Yatsyshina et al., 2010).

In Western Siberia in fall, 2009 there were no significant pan-demic influenza outbreaks, although we isolated virus from clinicalsamples obtained from all big cities of the region. All strains wereclosely related to pandemic strain A/California/07/2009.

In 2010 pandemic influenza morbidity began to decreaseworldwide, and on August 10, 2010 WHO declared the pandemicover and the beginning of post-pandemic period. In Asian northernareas the 2010–2011 epidemic season (the first post-pandemicseason) began in late October–early November, 2010. At the begin-ning of epidemic season in Mongolia and Northern China vastmajority of cases were caused by A/H3N2 viruses. During the2010–2011 season the first cases of A/H1N1pdm09 isolation inChina and Mongolia were registered in the end of 2010 and atthe beginning of 2011, correspondingly. That subtype was com-monly registered during next several weeks (National InfluenzaCenter, 2013; Hong Kong Center for Health Protection, 2011).

According to Russian National centers of influenza, influenzapandemic in Russia in the 2010–2011 began in the first calendarweek of 2011 (December 27–January 2) in Siberia. Epidemic mor-bidity increased during 14 weeks. Influenza epidemic of 2011 wasmixed and caused by predominant A/H1N1pdm09 viruses andinfluenza B viruses. Influenza A/H1N1pdm09 was predominant inEuropean Russia (58.3–79.2%), and influenza B – in Russian south-ern areas, Siberia and the Far East (45.2–80.6%). Influenza A/H3N2viruses were isolated sporadically (Karpova et al., 2011).

Our results somewhat disagree with those ones obtained byRussian National centers of influenza, but correlate well withWHO analysis of epidemic situation in countries with commonborders with Russian Asia. Thus, we showed that in the 2010–2011 epidemic season in the South of Western Siberia influenza in-deed was polyetiologic: diseases were caused by A/H1N1pdm09,A/H3N2, and influenza B virus strains, but influenza A/H1N1pdm09was significantly predominant.

Influenza epidemic season of 2011–2012 in majority of coun-tries began significantly later compared to previous years. In accor-dance with WHO data, in the 2011–2012 season in differentNorthern hemisphere countries different influenza virus typesand subtypes dominated. Thus, in Northern China and Mongoliaat the beginning of the season influenza B virus was predominantfollowed by joint circulation of A/H3N2 virus. The opposite situa-tion was observed in Republic of Korea and Japan: initially A/H3N2 virus was predominant, and then influenza B virus enteredthe circulation. At the beginning of epidemic season the major partof studied viruses were antigenically close to vaccine strains, how-ever, from the middle of the season both in Europe, and Americathere were considerable increase of amount of influenza A/H3N2viruses with low cross-reactivity with vaccine strain. As far asinfluenza B virus is concerned, both Yamagata and Victoria lineagescirculated in the season with varying predominance in differentcountries.

In Russia epidemic increase of influenza morbidity was regis-tered only in early March, 2012. The highest morbidity rate oc-curred in 15–16 weeks of 2012 (09.04.2012–22.04.2012). Weregistered low level of influenza morbidity in Western Siberia (only20% higher than in interepidemic seasons). Our data revealed thatthe 2011–2012 influenza epidemic season in Siberia was polyetio-logic with predominant circulation of influenza A/H3N2 virus andco-circulation of influenza B virus. Interestingly, both Victoriaand Yamagata genetic lineages of influenza B virus strains wereisolated. There were no influenza A/H1N1pdm09 virus strains inthe studied season.

5. Conclusions

During the 2008–2009 epidemic season in Western Siberiainfluenza A/H1N1, A/H3N2, and influenza B viruses circulated. Per-centage of isolation of A/H1 was approximately equal to that of A/H3 strains. Influenza A/H1N1pdm09 virus pandemic began in Rus-sia in the summer of 2009. During summer and fall of 2009 we didnot register large outbreaks in Western Siberia, although viruswere isolated from clinical samples collected in all major cities.All strains were similar to pandemic strain A/California/04/2009.Epidemic season of 2010–2011 matched criteria of post-pandemicseason, first of all due to circulation of several etiologic agents andinitiate antigenic drift of A/H1N1pdm09 virus. However, pandemicinfluenza strains dominated in epidemic process. In the 2011–2012season A/H1N1pdm09 virus did not already dominate. Moreover,in the South of Western Siberia in 2011–2012 we did not isolateany of strains of this subtype.

Acknowledgement

This study was supported by the Russian Federation Program,Project No. RNP 14.B37.21.1927.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.meegid.2013.

T. Ilyicheva et al. / Infection, Genetics and Evolution 20 (2013) 177–187 187

08.025. These data include Google maps of the most importantareas described in this article.

References

Antón, A., Marcos, M.A., Martínez, M.J., Ramón, S., Martínez, A., Cardeñosa, N.,Godoy, P., Torner, N., De Molina, P., Isanta, R., Jiménez de Anta, M.T., Pumarola,T., 2010. D225G mutation in the hemagglutinin protein found in 3 severe casesof 2009 pandemic influenza A (H1N1) in Spain. Diagn. Microbiol. Infect. Dis. 67(2), 207–208.

Bao, Y., Bolotov, P., Dernovoy, D., Kiryutin, B., Zaslavsky, L., Tatusova, T., Ostell, J.,Lipman, D., 2008. The influenza virus resource at the National Center forBiotechnology Information. J. Virol. 82 (2), 596–601.

Ghedin, E., Sengamalay, N.A., Shumway, M., Zaborsky, J., Feldblyum, T., Subbu, V.,Spiro, D.J., Sitz, J., Koo, H., Bolotov, P., Dernovoy, D., Tatusova, T., Bao, Y., StGeorge, K., Taylor, J., Lipman, D.J., Fraser, C.M., Taubenberger, J.K., Salzberg, S.L.,2005. Large-scale sequencing of human influenza reveals the dynamic nature ofviral genome evolution. Nature 437 (7062), 1162–1166.

Hong Kong Center for Health Protection, 2011. Flu Express. 8 (5). Available from:<http://www.chp.gov.hk/files/pdf/flu_express_week5_2_2_2011.pdf>.

Ilyicheva, T., Susloparov, I., Durymanov, A., Romanovskaya, A., Sharshov, K.,Kurskaya, O., Ignashkina, M., Shestopalov, A., 2011. Influenza A/H1N1pdmvirus in Russian Asia in 2009–2010. Infect. Genet. Evol. 11, 2107–2112.

Karpova, L.S., Burtseva, E.I., Popovtseva, N.M., Stolyarova, T.P., 2011. Comparison ofinfluenza epidemics in Russia 2009 and 2011, caused by pandemic influenzaA(H1N1). Epidemiol Vaccin. 5, 6–15.

Katz, J.M., Lim, W., Bridges, C.D., Rowe, T., Hu-Primmer, J., Lu, X., Abernathy, R.A.,Clarke, M., Conn, L., Kwong, H., Lee, M., Au, G., Ho, Y.Y., Mak, K.H., Cox, N.J.,Fukuda, K., 1999. Antibody response in individuals infected with avianinfluenza A (H5N1) viruses and detection of anti-H5 antibody amonghousehold and social contacts. J. Infect. Dis. 180, 1763–1770.

Konovalova, N.I., Eropkin, M.Iu., Gudkova, T.M., Grigorieva, V.A., Danllenko, D.N.I.,Ivanova, A.V., Smimova, T.S., Lobova, T.G., Shchekanova, S.M., 2010. Etiologicalcharacteristics of the influenza epidemics of 2006–2009 in the RussianFederation according to the data of the Research Institute of Influenza, North-Western Branch, Russian Academy of Medical Sciences). Vopr. Virusol. 55 (4),9–16.

Marchenko, V.Y., Alekseev, A.Y., Sharshov, K.A., Petrov, V.N., Silko, N.Y., Susloparov,I.M., Tserennorov, D., Otgonbaatar, D., Savchenko, I.A., Shestopalov, A.M., 2012.Ecology of influenza virus in wild bird populations in Central Asia. Avian Dis. 56(1), 234–237.

Miller, R.R., MacLear, A.R., Gunson, R.N., Carman, W.F., 2010. Occurrence ofhaemagglutinin mutation D222G in pandemic influenza A(H1N1) infected

patients in the West of Scotland United Kingdom, 2009–10. Euro. Surveill. 15(16).

National Influenza Center. Influenza surveillance, 2013. Available from: <http://www.flu.mn/eng/index.php?option=com_content⁄⁄task=section⁄⁄id=5⁄⁄Itemid=51>.

Onishchenko, G.G., Shestopalov, A.M., Ternovoi, V.A., Evseenko, V.A., Durymanov,A.G., Rassadkin, Y.N., Razumova, Y.V., Zaikovskaya, A.V., Zolotykh, S.I., Netesov,S.V., Sandakhchiev, L.S., 2006. Highly pathogenic influenza virus H5N1 found inwestern Siberia is genetically related to viruses that circulated in Southeast Asiain 2003–2005. Dokl. Biol. Sci. 406, 63–65.

Rowe, T., Abernathy, R.A., Hu-Primer, J., Thompson, W.W., Lu, X., Lim, W., Fukuda, K.,Cox, N.J., Katz, J.M., 1999. Detection of human serum antibody to avianinfluenza A (H5N1) virus using a combination of serologic assays. J. Clin.Microbiol. 37, 937–943.

Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method forreconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406–425.

Sharshov, K., Silko, N., Sousloparov, I., Zaykovskaya, A., Shestopalov, A., Drozdov, I.,2010. Avian influenza (H5N1) outbreak among wild birds, Russia, 2009. Emerg.Infect. Dis. 16 (2), 349–351.

Sivay, M.V., Sayfutdinova, S.G., Sharshov, K.A., Alekseev, A.Y., Yurlov, A.K.,Runstadler, J., Shestopalov, A.M., 2012. Surveillance of influenza A virus inwild birds in the Asian portion of Russia in 2008. Avian Dis. 56 (3), 456–463.

Sivay, M.V., Baranovich, T., Marchenko, V.Y., Sharshov, K.A., Govorkova, E.A.,Shestopalov, A.V., Webby, R.J., 2013. Influenza A (H15N4) virus isolation inWestern Siberia. Russia J. Virol. 87 (6), 3578–3582.

Sobolev, I., Kurskaya, O., Susloparov, I., Ilyicheva, T., Shestopalov, A., 2012. Moleculargenetic analysis of influenza A/H3N2 virus strains isolated in Western Siberia inthe 2010–2011 epidemic season. Infect. Genet. Evol. 12 (8), 1694–1698.

Uyeki, T.M., Nguyen, D.C., Rowe, T., Lu, X., Hu-Primmer, J., Huynh, L.P., Hang, N.L.,Katz, J.M., 2012. Seroprevalence of antibodies to avian influenza A (H5) and A(H9) viruses among market poultry workers, Hanoi, Vietnam, 2001. PLoS ONE 7(8), e43948.

Wilson, I.A., Cox, N.J., 1990. Structural basis of immune recognition of influenzavirus hemagglutinin. Annu. Rev. Immunol. 8, 737–771.

Yang, P., Ma, C., Shi, W., Cui, S., Lu, G., Peng, X., Zhang, D., Liu, Y., Liang, H., Zhang, Y.,Zhang, L., Seale, H., Wang, Q., 2012. A serological survey of antibodies to H5, H7and H9 avian influenza viruses amongst the duck-related workers in Beijing.China PLoS One 7 (11), e50770.

Yatsyshina, S.B., Minenko, A.N., Kushakova, T.E., Praded, M.N., Kudriavtseva, A.V.,Shipulin, G.A., Maleev, V.V., Pokrovskiı̆, V.I., 2010. Pandemic influenza A/H1N1(sw2009) in Russia: epidemiology, diagnosis, clinical picture, and treatment.Ter. Arkh. 82 (11), 10–14.