Download pdf - Irinotecan pharmacokinetic and pharmacogenomic alterations ... · Irinotecan pharmacokinetic and pharmacogenomic alterations induced by methylselenocysteine in human head and neck

Irinotecan pharmacokinetic and pharmacogenomicalterations induced by methylselenocysteinein human head and neck xenograft tumors

Rami G. Azrak,1 Jinsheng Yu,4 Lakshmi Pendyala,2

Patrick F. Smith,2 Shousong Cao,1 Xia Li,4

William D. Shannon,4 Farukh A. Durrani,1

Howard L. McLeod,4 and Youcef M. Rustum1,3

Departments of 1Pharmacology and Therapeutics, 2Medicine, and3Cancer Biology, Roswell Park Cancer Institute, Buffalo, NewYork and 4Department of Medicine, Washington UniversitySchool of Medicine, St. Louis, Missouri

AbstractThe combination of methylselenocysteine and irinotecan(CPT-11) is synergistic against FaDu and A253 xenografts.Methylselenocysteine/CPT-11 increased tumor cure rateto 100% in FaDu and to 60% in A253. In this study, theeffect of methylselenocysteine on pharmacokinetic andpharmacogenetic profiles of genes relevant to CPT-11metabolic pathway was evaluated to identify possiblemechanisms associated with the observed combinationalsynergy. Nude mice bearing tumors (FaDu and A253) weretreated with methylselenocysteine, CPT-11, and a combi-nation of methylselenocysteine/CPT-11. Samples werecollected and analyzed for plasma and intratumor concen-tration of CPT-11 and 7-ethyl-10-hydroxyl-camptothecin(SN-38) by high-performance liquid chromatography. Theintratumor relative expression of genes related to the CPT-11 metabolic pathway was measured by real-time PCR.After methylselenocysteine treatment, the intratumor areaunder the concentration-time curve of SN-38 increased to asignificantly higher level in A253 than in FaDu and wasassociated with increased expression of CES1 in bothtumors. Methylselenocysteine/CPT-11 treatment, com-pared with CPT-11 alone, resulted in a significant decreasein levels of ABCC1 and DRG1 in FaDu tumors and anincrease in levels of CYP3A5 and TNFSF6 in A253 tumors.No statistically significant changes induced by methylse-lenocysteine/CPT-11 were observed in the levels of otherinvestigated variables. In conclusion, the significant in-

crease in the cure rate after methylselenocysteine/CPT-11could be related to increased drug delivery into both tumors(CES1), reduced resistance to SN-38 (ABCC1 and DRG1)in FaDu, and induced Fas ligand apoptosis (TNFSF6) inA253. No correlation was observed between cure rate andother investigated variables (transporters, degradationenzymes, DNA repair, and cell survival/death genes) ineither tumor. [Mol Cancer Ther 2005;4(5):843–54]

IntroductionIrinotecan (CPT-11) is a chemotherapeutic agent widelyused in metastatic colorectal cancer, small cell lung cancer,and several other solid tumors (1). CPT-11 causes celltoxicity by stabilizing ternary complexes between thenuclear enzyme topoisomerase I (Top1) and dsDNA, whichleads to replication fork arrest and dsDNA breaks (2).

Drug efficacy is influenced by nongenetic (age, organfunction, comorbid illnesses, etc.) and genetic (drugmetabolism and transport) factors (3–6). CPT-11 is awater-soluble prodrug that is enzymatically bioactivatedby carboxylesterase to its most active metabolite, 7-ethyl-10-hydroxyl-camptothecin (SN-38; refs. 7–10). Two majorisoforms of carboxylesterase have been identified, carbox-ylesterase-1 (CES1) and carboxylesterase-2 (CES2). CES2is 26-fold more active than CES1 in converting CPT-11 toSN-38 (11). Although only a small percentage (2–5%) ofCPT-11 is converted to SN-38 by liver carboxylesterase (12),clinical data indicate that CPT-11 has substantial antitumoractivity (13). Selective activation of the drug within tumorby CES2 increases therapeutic efficacy and reducessystemic toxicity (11).

Two cytochrome P450 enzymes, CYP3A4 and CYP3A5,degrade CPT-11 to compounds that have significantlyfewer cytotoxic effects in culture than SN-38 (1, 14). Santoset al. reported that CYP3A4 metabolizes CPT-11 to 7-ethyl-10-[4-N-(5-aminopintanoic acid)-1-piper-idino]carbony-loxycamptothecin, 7-ethyl-10-(4-amino-1-piperidino)carbonyloxycamptothecin, and unknown metabolites(M1, M2, and M3). CYP3A5 metabolizes CPT-11 to anew metabolite, M4 (molecular weight, 558), by de-ethylation of the CPT moiety (15). h-glucuronidase UDP-glucuronosyl transferase 1A1 (UGT1A1) converts SN-38 tothe inactive SN-38 glucuronide (ref. 1; Fig. 1).

The ATP-binding cassette (ABC) transporters make upthe largest transporter gene family, have many subfamilies,and bind to a wide array of substrates (16). The energygenerated from ABC binding to ATP is used to transportmolecules across cell membranes (17). There are sevensubfamilies of human ABC genes, which consist of 48characterized human ABC genes that are responsible formultidrug resistance in certain tumor cell lines (1, 16). The

Received 11/29/04; revised 2/11/05; accepted 3/2/05.

Grant support: National Cancer Institute grant CA76561,Pharmacogenetics Research Network GM63340, and InstituteComprehensive Cancer Center Support grant CA 16056.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely toindicate this fact.

Requests for reprints: Youcef M. Rustum, Department of Cancer Biology,Roswell Park Cancer Institute, Elm and Carlton Streets, Buffalo, NY14263. Phone: 716-845-4532; Fax: 716-845-7609.E-mail: [email protected]

Copyright C 2005 American Association for Cancer Research.

843

Mol Cancer Ther 2005;4(5). May 2005

Research. on March 28, 2021. © 2005 American Association for Cancermct.aacrjournals.org Downloaded from

http://mct.aacrjournals.org/

ABCB1 (P-glycoproteins) protein functions as an exportpump to reduce the intracellular level of CPT-11 and SN-38.Multidrug-resistant proteins ABCC1 (MRP1), ABCC2(MRP2), and breast cancer resistance protein (ABCG2;ref. 1) also are export pumps that efflux SN-38 (Fig. 1).

A high level of DNA repair genes in tumor cells has beenassociated with resistance to certain chemotherapeuticagents. Excision repair cross-complementing (ERCC1 ,ERCC2 , and ERCC6), nucleotide excision repair genes(NER), X-ray repair cross-complementing (XRCC1), andbase repair gene (BER) are components of DNA repairpathway that may influence the antitumor activity ofCPT-11. The cell division cycle 45 (CDC45L) is requiredfor the initiation of DNA replication. The ADPRT enzyme,known as poly(ADP-ribose) polymerase, is responsible formaintaining genomic integrity by repairing DNA breaksand altered bases in DNA (Fig. 1).

Motwani et al. (18) showed that developmentallyregulated GTP-binding protein 1 (DRG1) is a marker forCPT-11 resistance in colon cancer and that its inhibitionincreases the sensitivity of colon cancer cells to CPT-11.Furthermore, studies have shown that increased levels offerredoxin reductase may be responsible for initiation ofapoptosis in tumor cells (19, 20). Activation of nuclearfactor-nB1 (NFnB1) has been implicated in promotingtumor growth as well as antiapoptotic and proangiogeniceffects (21, 22). Tumor necrosis factor (ligand) superfamilymember 6 (TNFSF6) is a FAS (cell surface receptor) ligandthat activates apoptosis signal through caspases (23).

Methylselenocysteine is an organic selenium productthat is at various stages of clinical development as achemopreventive agent. Methylselenocysteine is activatedin the liver by h-lyase to its active metabolite methylselenol(24). Methylselenocysteine reportedly induces apoptosisthrough caspase-3 activation and cleavage of poly(ADP-ribose) polymerase (25, 26), down-regulates inhibitors ofapoptosis family proteins, which subsequently enhanceapoptosis through Bax cleavage (25), regulates the cell cycle(block cells in S and G1 phase; refs. 24, 27), and reducesDNA synthesis and cell doubling rate (27–29).

Two head and neck squamous cell carcinomas, A253and FaDu, have been characterized previously in thislaboratory. A253 is well differentiated and p53 null,with a doubling time of 3 to 3.5 days. FaDu is poorlydifferentiated and mutant p53, with a doubling time of2.8 to 3 days. The CES2 protein level is similar in bothuntreated xenografts when detected by immunohisto-chemistry (30).

A recently published study from this laboratory showedthat treatment with oral methylselenocysteine (0.2 mg/mouse) for 28 days, starting 7 days before administration ofi.v. CPT-11 (100 mg/kg) weekly � 4, in FaDu xenografts,increased the complete response rate from 30% (CPT-11alone) to 100% (methylselenocysteine/CPT-11). In A253xenografts, the complete response rate increased from 10%(CPT-11 alone) to 60% (methylselenocysteine/CPT-11;ref. 31). These data showed the therapeutic selectivity andefficacy of methylselenocysteine/CPT-11 in head and necksquamous cell carcinoma. Optimal therapeutic selectivityis achieved only when methylselenocysteine is given atleast 7 days before CPT-11, suggesting that methylseleno-cysteine induces alterations over time that are essential forthe observed curative effect with subsequent treatmentwith CPT-11.

Based on these findings, we designed studies to addressthe following questions: (a) Does methylselenocysteinealter the plasma and intratumor pharmacokinetics ofCPT-11 and SN-38? (b) Does methylselenocysteine/CPT-11have an effect on the intratumor pharmacodynamic ofCPT-11 (expression of drug activation enzymes, trans-porters, degradation enzymes, DNA repair genes, and cellsurvival/death genes)? (c) Is there a correlation betweenthe observed alterations and the enhanced antitumoractivity of CPT-11 by methylselenocysteine?

Materials andMethodsMiceEight- to 12-week-old female athymic nude mice (nu/nu ,

body weight 20–25 g) were obtained from Harlan Sprague-Dawley, Inc. (Indianapolis, IN). The mice were housedfive per cage under specific pathogen-free conditions, withwater and food ad libitum , according to an institutionallyapproved protocol.

TumorsThe head and neck squamous cell carcinoma cell lines

(FaDu and A253) were purchased from American TypeCulture Collection (Rockville, MD) and maintained as amonolayer in RPMI 1640 supplemented with 10% fetalbovine serum (Life Technologies, Grand Island, NY). Thecell lines were free from Mycoplasma as tested every2 months with the Mycoplasma T.C. Rapid DetectionSystem (Gen-Probe, Inc., San Diego, CA).

Xenografts were initially established by implantings.c. 106 cultured cells and passed several generations bytransplanting f50 mg nonnecrotic tumor tissues beforetreatment, which began when the tumors were f200 mgin size (established tumors), f1 week after implantation.

Figure 1. CPT-11 metabolic pathway. CPT-11 converting enzymes; CES1and CES2, SN-38 transporters; ABCC1-2, ABCG2, and ABCB1, CPT-11degradation enzymes; CYP3A4 and CYP3A5 and SN-38 degradationenzyme; UGT1A1.

Irinotecan and Methylselenocysteine in Head and Neck Tumors844




DrugsCPT-11 was supplied by Pharmacia (Kalamazoo, MI) as a

ready-to-use clinical formulation solution in 5 mL vialscontaining 100 mg drug (20 mg/mL). Methylselenocysteinewas supplied by Sigma (St. Louis, MO) as a powder in100 mg/vials and dissolved in 0.9% NaCl for a finalconcentration of 1 mg/mL.

Drug Doses andTreatmentsCPT-11 was given by i.v. injection via the tail vein

of animals. Methylselenocysteine was given orally. Inthis study, CPT-11 was given alone (100 mg/kg) and incombination with methylselenocysteine (0.2 mg/mouse),which was given once daily for 7 days before CPT-11(100 mg/kg).

Preparation of Tumor Sample for High-PerformanceLiquid Chromatography

FaDu and A253 tumors were implanted bilaterally innude mice to eliminate host variability so that both tumorshad the same drug exposure from circulation followingdrug treatment. Five mice, per treatment per time point,with established tumors (f200 mg) were treated withCPT-11 alone (100 mg/kg) and with methylselenocysteine/CPT-11. Tumors were excised and blood was collectedat different times (n = 5 per time point), includinguntreated controls, 0.5, 1, 2, 4, 8, and 12 hours after CPT-11 treatment alone or in combination. Immediately follow-ing collection, ice-cold 5 mL methanol and acetonitrile(1:1) were added to tumor samples and homogenizedusing a Polytron tissue homogenizer (Brinkmann Instru-ments, Westbury, NY). Following centrifugation of thehomogenate, the supernatant was evaporated to dryness,reconstituted to mobile phase, and subjected to high-performance liquid chromatography. Protein measure-ment was done on the pellet using Bradford proteinassay (32). Plasma was obtained at 4jC immediately fol-lowing the blood collection and subjected to the samesolvent extraction procedure and high-performance liquidchromatography.

CPT-11 and SN-38 Measurements by High-Perfor-mance Liquid Chromatography

The lactone forms of CPT-11 and its active metabolite,SN-38, were measured using a validated high-performanceliquid chromatography method with fluorescence detectionas described by Warner and Burke (33). The separationmethod was carried out on a Waters Nova-Pak C18 columnequipped with a A Bondapak C18 guard column, with themobile phase consisting of 20% acetonitrile and 80%triethylamine acetate. Detection was by fluorescence withexcitation at 370 nm and emission at 510 nm. The limit ofquantitation for both was 2.5 ng/mL. Quality assurancewas maintained by simultaneously assaying the qualitycontrol samples prepared in bulk, before assay validation.

Pharmacokinetics Data AnalysisUsing different doses of CPT-11 and many time points,

the pharmacokinetics variables for CPT-11 and SN-38were determined by standard noncompartmental methods(WinNonLin, version 3.3). The elimination rate constant(Ke) was computed by weighed least squares linear

regression of the data points in terminal elimination phase.Half-life was determined as 0.693/Ke. The area under theconcentration-time curve (AUC) was determined by thetrapezoidal rule.

Extraction ofTotal RNAfromTumor XenograftsTwenty-four tumor samples were collected for analysis

(n = 3 per treatment per tumor) from untreated controls,7 days after methylselenocysteine, and 24 hours after sin-gle dose of CPT-11 alone and in combination with meth-ylselenocysteine. The total RNA was isolated from eachf100 mg tumor sample using the Qiagen RNeasy Mini kit(Valencia, CA). RNA samples were suspended in RNase/DNase–free water. The concentration was then measured(0.5–1.2 Ag/AL), and the gel document was made (all hadclear three bands: 5S, 18S, and 28S), all with an Agilent 2100analyzer. A260/280OD was within the range of 1.8 to 2.0 nm.

ReverseTranscriptionTwenty-four RNA samples were placed in a 96-well PCR

plate and incubated in PCR thermocycler block with RNA10 Ag, oligo(dT)20VN (500 ng/AL) 1.0 AL, and RNase-freewater f38 AL at 70jC for 10 minutes and 25jC for 30 min-utes. Then, deoxynucleotide triphosphate (10 mmol/Leach) 5.0 AL, reverse transcription buffer (10�) 5.0 AL,RNaseOUT (40 units/AL) 1.0 AL, and RTase (StrataScript)1.0 AL were added and the reverse transcription reactionswere incubated at 42jC for 2 hours. After completing theRT reaction, the cDNAs were adjusted to a concentrationof 2.5 ng/AL, pipetted into 384-well optical PCR plates(4.0 AL/well), and air-dried overnight.

Quantitative Real-time PCRThe primers and probes for each of the 21 drug path-

way genes have been described previously (34). Thereaction system consisted of cDNA 10 ng, TaqManUniversal PCR Master Mix (2�) 5.0 AL, forward primer(10 Amol/L) 0.6 AL, reverse primer (10 Amol/L) 0.6 AL,TaqMan probe (5 Amol/L) 0.4 AL, and DNase-free waterf10 AL. After incubation at 50jC for 2 minutes and at 95jCfor 10 minutes, 40 of 45 cycles were made at 95jC for 20seconds and at 60jC for 1 minute on ABI Prism SDS System7900HT (Applied Biosystems, Inc., Foster City, CA). Allprimers and TaqMan probes used were designed with thePrimer Express version 1.5 (Applied Biosystems); the nameand primer/probe sequences information is presented inTable 1.

Pharmacogenetics Data AnalysisThe threshold of cycle (CT) value and multicomponent

kinetic data were exported from the real-time PCR programfor each reaction, and the individual PCR amplification ef-ficiency (E) for each reaction (each sample) was calculated.The relative expression level of a gene was then analyzedusing the following formula: Relative level = [(1 + E)CT]reference gene / [(1 + E)CT] target gene (35). Two referencegenes, actin h (ACTB) and glyceraldehyde-3-phosphate de-hydrogenase (GAPDH), were used; average value of thetwo genes was taken to normalize the expression leveland the final relative level was scaled to a 1� sample,which was the lowest expressed sample in the whole dataset (24 samples by 21 pathway genes).

Molecular Cancer Therapeutics 845




Statistical AnalysisThe average value of every evaluated variable and its

SD and the SE of ratios were calculated. Statisticalanalysis was done by comparing the average value ofuntreated control of every evaluated variable of FaDuversus A253 tumors. In addition, a comparison of theaverage value of every evaluated variable after methyl-selenocysteine/CPT-11 treatment with its average valueafter CPT-11 alone treatment was done. The P was calcu-lated by applying two-tailed distribution unpaired t test.The result of the comparisons was considered statisticallysignificant if P < 0.05.

ResultsPharmacokinetic Profiles of CPT-11 and Its Active

Metabolite SN-38 afterTreatment with CPT-11Aloneor in CombinationwithMethylselenocysteine

In the plasma, the AUC of CPT-11 increased from120.84 to 207.65 Amol/L h (72%) after methylselenocys-teine (Table 2), whereas the clearance rate of CPT-11decreased from 0.8 to 0.45 L/h (44%). The data in Table 2indicate that methylselenocysteine had no significantimpact on the AUC, the clearance rate of SN-38, or thehalf-life (t1/2) and maximum concentration (Cmax) ofCPT-11 and SN-38.

In FaDu tumors, the AUC of CPT-11 and SN-38increased from 288.72 to 329.39 ng/mg h (14%) and

from 4.15 to 4.97 ng/mg h (20%), respectively, aftermethylselenocysteine. The clearance rates decreased by14% (0.29–0.25 L/h) for CPT-11 and by 19% (19.78–15.9

L/h) for SN-38 after methylselenocysteine (Table 3).However, the methylselenocysteine treatment had nosignificant impact on the t1/2 and Cmax of CPT-11 andSN-38.

In A253 tumors, the AUC of CPT-11 and SN-38 increasedfrom 273.05 to 349.82 ng/mg h (28%) and from 6.11 to9.91 ng/mg h (62%), respectively, after methylselenocys-teine. The clearance rates decreased by 17% (0.29–0.24 L/h)for CPT-11 and by 33.3% (12.92–8.62 L/h) for SN-38 aftermethylselenocysteine (Table 3). The methylselenocysteinetreatment had no significant impact on the t1/2 and Cmax

of CPT-11 and SN-38.The data in Table 3 indicated that treatment with

methylselenocysteine resulted in significant trend ofincrease in the SN-38 AUC in both FaDu and A253xenografts. Observed changes in other measured varia-bles were not significantly affected by methylselenocys-teine.

Effect of the CombinationTreatment on CPT-11 Acti-vating Enzymes

The expression of CES1 in untreated FaDu tumorswas higher than in A253 untreated tumors, but the ex-pression of CES2 was significantly higher in A253 thanin FaDu (P = 0.006; Table 4).

Table 1. Name and primer/probe sequences of CPT-11 pathway genes and reference genes

Gene symbol Description Forward primer 5V–3V

ABCB1 ATP-binding cassette, subfamily B (MDR/TAP), member 1 (MDR1) GCTGGCACAGAAAGGCATCTABCC1 ATP-binding cassette, subfamily C (CFTR/MRP), member 1 (MRP1) CCAAGACTCAGACTTGCTAAGAATTACGABCC2 ATP-binding cassette, subfamily C (CFTR/MRP), member 2 (MRP2) AGGGCTCTGCTTCGGAAATCABCG2 ATP-binding cassette, subfamily G (WHITE), member 2 (BCRP) CAGGTCTGTTGGTCAATCTCACAADPRT ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) CTGTCCCAGGGTCTTCGGATCDC45L Cell division cycle 45-like (Saccharomyces cerevisiae) TGGACAAGCTGTACCATGGCCES1 Carboxylesterase-1 (monocyte/macrophage serine esterase 1) TGAGTTTCAGTACCGTCCAAGCTCES2 Carboxylesterase-2 (intestine, liver) AATCCCAGCTATTGGGAAGGACYP3A4 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4 TCTCCTTTCATATTTCTGGGAGACACYP3A5 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5 AAGAAACACAGATCCCCTTGAAATTADRG1 Developmentally regulated GTP-binding protein 1 CCGGACGAACCACAACAERCC1 Excision repair cross-complementing rodent repair deficiency,

complementation group 1TACCCCTCGACGAGGATGAG

ERCC2 Excision repair cross-complementing rodent repair deficiency,complementation group 2 (XPD)

TTGGCGTCCCCTACGTCTAC

ERCC6 Excision repair cross-complementing rodent repair deficiency,complementation group 6 (CSB)

ACAAGTGCAATTTTTGCAGGAACT

FDXR Ferredoxin reductase AGCAGGGAAGGGATGAGTGTTNFjB1 Nuclear factor of n light polypeptide gene enhancer in B cells 1 (p105) AGCAAATAGACGAGCTCCGAGATDP1 Tyrosyl-DNA phosphodiesterase AATCTGTCCAAGGCTGCCTGTNFSF6 Tumor necrosis factor (ligand) superfamily, member 6 TGAGCCAGACAAATGGAGGAATop1 Topoisomerase (DNA) I GGCGAGTGAATCTAAGGATAATGAAUGT1A1 UDP-glucuronosyl transferase 1 family, polypeptide A1 TTGGGAGTGCGGGATTCAXRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 GAACACCAGGAGCCTCCTGATACTB Actin, h CCCTGAGGCACTCTTCCAGAPDH Glyceraldehyde-3-phosphate dehydrogenase GAAGGTGAAGGTCGGAGTC

NOTE: ACTB is a reference gene; GAPDH is a reference gene.





In FaDu, methylselenocysteine/CPT-11 treatmentresulted in a statistically significant increase of the relativeexpression level of CES1 but not CES2 when comparedwith CPT-11 alone (P = 0.02 and 0.1, respectively; Fig. 2Aand B). In A253, methylselenocysteine/CPT-11 treatmentsignificantly increased the relative expression level ofCES1 but not CES2 when compared with CPT-11 alone(P = 0.03 and 0.1, respectively; Fig. 2A and B).

The data in Fig. 2A and B showed that the up-regulationof CES1 by methylselenocysteine/CPT-11 treatment wasmore pronounced in FaDu than in A253 tumors. Althoughthe methylselenocysteine/CPT-11 treatment resultedin higher level of CES2 expression, the effect was notstatistically significant in both tumors when comparedwith CPT-11 alone.

Effect of the CombinationTreatment on CPT-11 andSN-38 Degradation Enzymes

In untreated controls, the relative expression levels ofdegradation enzymes CYP3A4 and UGT1A1 were signif-icantly higher in FaDu than in A253 tumors (P < 0.001).The CYP3A5 expression level was similar in both tumors(Table 4).

In both tumors, methylselenocysteine/CPT-11 treatmenthad no statistically significant impact on the geneexpression of CYP3A4 and UGT1A1 when compared withCPT-11 alone (Fig. 2C and D). The relative expression ofCYP3A5 significantly increased after methylselenocys-teine/CPT-11 treatment in A253 tumors (P = 0.01) butnot in FaDu tumors when compared with CPT-11 alone(Fig. 2D).

Table 1. Name and primer/probe sequences of CPT-11 pathway genes and reference genes (Cont’d)

Gene symbol Reverse primer 5V– 3V TaqMan probe 5V–3V

ABCB1 CAGAGTTCACTGGCGCTTTG TCCAGCCTGGACACTGACCATTGAAAABCC1 AATAAATATATGCGTTTTCGCCTAAAAGA CGCCGACTTCAAACCCAGAGAGCATCABCC2 AATGAGGTTGTCTGTCTCTAGATCCA CAGTGGCCTCATCCAGGACCAGGAABCG2 CATATCGTGGAATGCTGAAGTACTG CCATTGCATCTTGGCTGTCATGGCADPRT TTGGCACTCTTGGAGACCATG AAGCGCCCGTGACAGGCTACATGCDC45L CTGGGAGATGACGAGGTTGG CAGCTGCGAGCCACCCAGCACES1 CTCATCCCCGTGGTCTCCTA CTCATCAGACATGAAACCCAAGACGGTGCES2 CTGGCTGGTCGGTCTCAAAC TGGCCTCAAGCCATCCTCCCATCTCYP3A4 GCATCGAGACAGTTGGGTGTT TGTTTCCCTACACCTCTTGCATTCCATCCTCYP3A5 CATCTCTTGAATCCACCTTTAGAACAA ACACGCAAGGACTTCTTCAACCAGAAAAACCDRG1 CTGCCAAAACCAGAAAGAACTG CGTTCCCCATGATCAAGCACCCTACCERCC1 CAGTGGGAAGGCTCTGTGTAGA CCTGGAGTGGCCAAGCCCTTATTCC

ERCC2 CTGGTCCCGCAGGTATTCC CACAGAGCCGCATTCTCAAGGCG

ERCC6 GCTCCAAAGGCTGGTTGAATC ATCAGATGTTCAGACACCCAAATGCCATCTAA

FDXR GGATCAGCAGAGGTGCAAAGT CCACTCAGACGGACCCAGCCCTTNFjB1 GGCACCACTGGTCAGAGACTC CGCCGCTGTCGCAGACACTGTCTDP1 CCAAATGCTGAAGGGAGGAA ACCCAGCTGATGATCCGCTCCTACGTNFSF6 TTTCATGCTTCTCCCTCTTCAC TGGCAGCCCAGAGTTCTATGTTCTTCCGTTop1 TGGATATCTTAAAGGGTACAGCGAA ACCATTTTCCCATCATCCTTTGTTCTGAGCUGT1A1 AGATAAGATTAAAACTGCCATTTGCA TGGTCCCACCGCTGCCCCTAXRCC1 AAGAAGTGCTTGCCCTGGAA TGCCAGTCCCTGAGCTCCCAGATTTACTB GAGTTGAAGGTAGTTTCGTGGATG CCTTCCTTCCTGGGCATGGAGTCCTGAPDH GAAGATGGTGATGGGATTTC CAAGCTTCCCGTTCTCAGCC

Table 2. Plasma pharmacokinetics of CPT-11 and SN-38 after CPT-11 treatment with and without methylselenocysteine

Plasma CPT-11 SN-38

Treatment* CPT-11 Methylselenocysteine/CPT-11 CPT-11 Methylselenocysteine/CPT-11

Cmax (Amol/L)c 44.99 F 4.76 55.29 F 9.89 5.65 F 0.58 6.36 F 0.73t1/2 (h) 2.34 F 0.58 2.21 F 0.64 6.72 F 0.43 5.12 F 1.89AUC0 – 12 h (Amol/L h) 120.84 F 7.12 207.65 F 25.54b 26.60 F 3.4 29.23 F 1.98Clearance rate (L/h) 0.80 F 0.05 0.45 F 0.06b 2.56 F 0.37 2.58 F 0.18

* Five mice per time point.cMaximum concentration.bP < 0.05, compared with CPT-11 alone.





The data in Fig. 2C and D showed that although CYP3A4and UGT1A1 expression levels in untreated FaDu tumorswere significantly higher than in untreated A253 tumorsthe combination treatment of methylselenocysteine/CPT-11 had no significant effect on any of the CPT-11 and SN-38degradation enzymes in both tumors when compared withCPT-11 alone.

Effect of the CombinationTreatment on CPT-11 andSN-38 Transporters

In the untreated controls, the relative expression of ABCC1and ABCG2 was significantly higher in A253 than in FaDu(P < 0.001, in both cases), but there was no statistical differencein ABCB1 expression. In contrast, ABCC2 expression wassignificantly higher in FaDu than in A253 (P < 0.001; Table 4).

Table 3. Intratumor pharmacokinetics of CPT-11 and SN-38 in FaDu and A253 after CPT-11 treatment with and withoutmethylselenocysteine

Tumors FaDu A253

Treatment* CPT-11 Methylselenocysteine/CPT-11 CPT-11 Methylselenocysteine/CPT-11

Cmax (ng/mg) of CPT-11c 46.43 F 5.61 73.86 F 29.69 69.51 F 7.02 62.22 F 21.03Cmax (ng/mg) of SN-38 1.77 F 0.51 1.30 F 0.24 1.42 F 0.81 1.81 F 0.26t1/2 (h) of CPT-11 3.42 F 0.22 3.69 F 0.15 3.47 F 0.14 3.67 F 0.63t1/2 (h) of SN-38 5.78 F 0.95 4.58 F 0.61 5.39 F 0.51 4.37 F 0.46AUC0-12 h (ng/mg h) of CPT-11 288.72 F 104.22 329.39 F 65.55 273.05 F 43.68 349.82 F 68.06AUC0-12 h (ng/mg h) of SN-38 4.15 F 1.24 4.97 F 0.90 6.11 F 1.72 9.91 F 3.68Clearance rate (L/h) of CPT-11 0.29 F 0.09 0.25 F 0.05 0.29 F 0.05 0.24 F 0.06Clearance rate (L/h) of SN-38 19.78 F 4.72 15.90 F 3.51 12.92 F 3.51 8.62 F 2.79

* Five mice per time point.cMaximum concentration.

Table 4. Comparative analysis of relative gene expression in FaDu versus A253 xenografts in untreated control and after thecombinational treatment (n = 3 mice per treatment per tumor)

Variables FaDu/A253 (untreated control) FaDu/A253 (methylselenocysteine/CPT-11 combination)

Anabolic enzymesCES1 (SN-38) 2.28 F 0.57 (0.44)* 3.55 F 0.48c (0.28)CES2 (SN-38) 0.68 F 0.04b (�1.47) 0.82 F 0.06 (1.22)

Catabolic enzymesCYP3A4 (CPT-11) 7.31 F 0.35b (0.14) 8.49 F 0.57c (0.12)CYP3A5 (CPT-11) 2.49 F 1.60 (0.4) 1.37 F 0.44 (0.73)UGT1A1 (SN-38) 5.38 F 1.16b (0.19) 4.90 F 0.77c (0.20)

ABC genesABCB1 (CPT-11) 0.91 F 0.04 (1.09) 0.86 F 0.2 (1.16)ABCC1 (SN-38) 0.17 F 0.004b (�6.04) 0.09 F 0.01c (�11.43)ABCC2 (SN-38) 12.72 F 1.26b (0.08) 14.20 F 1.17c (0.07)ABCG2 (SN-38) 0.42 F 0.02b (�2.38) 0.41 F 0.04c (�2.43)

Target enzymesTop1 (SN-38) 2.07 F 0.18b (0.48) 2.73 F 0.13c (0.37)

DNA repair genesTDP1 3.75 F 0.42b (0.27) 4.98 F 0.27c (0.20)ERCC1 1.32 F 0.07b (0.76) 1.65 F 0.09c (0.61)ERCC2 0.40 F 0.01b (�2.52) 0.35 F 0.05c (�2.90)ERCC6 0.37 F 0.03b (�2.69) 0.31 F 0.02c (�3.25)XRCC1 0.26 F 0.01b (�3.80) 0.20 F 0.02c (�5.10)ADPRT 0.92 F 0.08 (1.09) 1.53 F 0.14c (0.66)CDC45L 0.99 F 0.03 (1.01) 1.46 F 0.21c (0.68)

Cell survival/death genesDRG1 0.31 F 0.02b (�3.19) 0.18 F 0.02c (�5.58)NFjB1 0.43 F 0.08b (�2.32) 0.34 F 0.005c (�2.97)FDXR 0.40 F 0.01b (�2.53) 0.41 F 0.04c (�2.45)TNFSF6 2.64 F 0.85 (0.38) 3.53 F 0.49c (0.28)

* Value of A253/FaDu.cP < 0.05, FaDu combination compared with A253 combination.bP < 0.05, FaDu control compared with A253 control.





The methylselenocysteine/CPT-11 treatment resulted ina statistically significant decrease of the relative expressionof ABCC1 in FaDu but not A253 tumors when comparedwith CPT-11 alone (P = 0.006; Fig. 3B). In both tumors,no statistically significant difference was observed in thelevel of ABCB1, ABCC2, and ABCG2 after methylseleno-cysteine/CPT-11 when compared with CPT-11 alone(Fig. 3A, C, and D).

The data in Fig. 3 indicated that the relative expression ofABCC1 (dominant efflux pump of SN-38) was significantlyhigher in A253 than FaDu untreated tumors. The combi-nation treatment significantly down-regulated the level ofABCC1 in FaDu tumors but had no significant effect onother CPT-11 or SN-38 transporters in both tumors whencompared with CPT-11 alone.

Effect of the Combination Treatment on TargetEnzyme and DNARepair Genes

The basal levels of Top1 and DNA repair genes (TDP1

and ERCC1) were significantly higher in untreated FaDuthan in A253 (P = 0.008, 0.001, and 0.01, respectively). Incontrast, the basal levels of DNA repair genes (ERCC2 ,ERCC6 , and XRCC1) were significantly higher in untreatedA253 (P < 0.001). No significant changes were observed inthe basal levels of ADPRT and CDC45L in both tumors(Table 4).

In both tumors, no statistically significant differenceswere observed in the levels of Top1 and DNA repair genesafter treatment with methylselenocysteine/CPT-11 com-pared with CPT-11 alone (Fig. 4).

The data in Fig. 4 showed that Top1, TDP1 , and ERCC1relative expressions were higher in untreated FaDu tumors,but the relative expressions of ERCC2 , ERCC6 , and XRCC1were higher in untreated A253 tumors. The combinationtreatment of methylselenocysteine/CPT-11 had no signifi-cant effect on any DNA repair genes in both tumors whencompared with CPT-11 alone.

Figure 2. Intratumor relative expression of CPT-11 converting and degrading enzymes; CES1, CES2, CYP3A4, CYP3A5, and SN-38 degrading enzymeUGTA1A in both FaDu and A253 xenografts. 5, Control; n, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after firstmethylselenocysteine/CPT-11. In both xenografts FaDu and A253, the relative expression levels of CPT-11 activating enzymes (CES1 and CES2) werehigher after the combination therapy of methylselenocysteine/CPT-11 than CPT-11 or methylselenocysteine alone. The relative expression levels ofCYP3A4, CYP3A5, and UGTA1A are higher in FaDu than A253 in the control and after combination treatment of methylselenocysteine/CPT-11.





Effectof theCombinationTreatmentonCell Survival/DeathGenes

The basal levels of DRG1 , NFB1 , and ferredoxin reductasewere higher in A253 than in FaDu (P = 0.001, 0.05, and0.002, respectively), but the TNFSF6 level was higher inFaDu (Table 4).

In FaDu, methylselenocysteine/CPT-11 treatment re-sulted in decreased level of DRG1 when compared withCPT-11 alone (P = 0.04; Fig. 5A) but had no significant im-pact on the levels of NFB1 , ferredoxin reductase , andTNFSF6 (Fig. 5B–D). In A253, only the TNFSF6 level hada statistically significant increase after the combinationtreatment when compared with CPT-11 alone (P < 0.005;Fig. 5D).

The data in Fig. 5 indicated that cell survival genes DRG1and NFB1 expression were higher in untreated A253 tu-mors, but cell death gene TNFSF6 level was higher inuntreated FaDu tumors. The combination treatment of meth-ylselenocysteine/CPT-11 resulted in a significant decrease

in the level of DRG1 in FaDu and a significant increase inthe level of TNFSF6 in A253 when compared with CPT-11alone. The combination treatment had no significant effecton NFB1 or ferredoxin reductase expression in both tumors.

DiscussionMethylselenocysteine/CPT-11 treatment increased thecomplete response rate in FaDu xenografts from 30% to100% and in A253 xenografts from 10% to 60%.

The hypothesis of this study is that the observedtherapeutic synergy between methylselenocysteine andCPT-11 is associated in part with enhanced intratumor SN-38 level. This SN-38 enhanced level would be sufficient toaffect downstream targets associated with cell survivaland death. The combination effect to enhance intratumorSN-38 concentration could be achieved by (a) enhance-ment of drug uptake/transport into tumor cells, (b) up-regulation of carboxylesterases (CPT-11 activation

Figure 3. Intratumor relative expression of CPT-11 and SN-38 transporters in FaDu and A253.5, Control;n, 7 d after methylselenocysteine; , 24 h afterfirst dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. The relative expression level of ABCB1, ABCC1, and ABCG2 are higher in the A253control; on the contrary, the relative expression level of ABCC2 is higher in the FaDu control. ABCC1 relative expression level is decreased only in FaDuafter methylselenocysteine/CPT-11.





enzymes), (c) reduction of SN-38 efflux outside the tumorcells, and/or (d) inhibition of enzymes associated with thedegradation of SN-38 or CPT-11. To confirm this hypoth-esis, we evaluated the effect of methylselenocysteine/CPT-11 on the plasma and intratumor pharmacokinetics ofCPT-11 and SN-38 as well as the combinational effect onthe pharmacodynamic of downstream targets in FaDu andA253 xenografts. To eliminate drug pharmacokineticvariability among individual animals, A253 and FaDutumors were bilaterally transplanted into the same animaland subjected to identical treatments, and drugs weregiven at their respective maximum tolerated doses.

The plasma data in Table 2 showed that the AUC ofCPT-11 was increased by 72% after the pretreatment withmethylselenocysteine when compared with CPT-11 alone.This increase was correlated with the effect of methyl-

selenocysteine on the clearance rate of CPT-11 (decreasedby 44%). The plasma AUC of SN-38 also was increasedby 10%, but the clearance rate of SN-38 was not changedafter the combination treatment. The intratumor concen-tration of SN-38 increased in both tumor xenografts afterpretreatment with methylselenocysteine (20% increase inFaDu and 62% increase in A253) when compared withCPT-11 alone.

In FaDu, the observed increase in the AUC of SN-38corresponded with a 43% increase of intratumor relativeexpression of CES1 (P = 0.02) and a 55% decrease in the levelof ABCC1 (P = 0.006) after methylselenocysteine/CPT-11when compared with CPT-11 alone (Table 5). Expressionof ABC transporters is associated with resistance to SN-38in several malignant cell lines (36). In addition, theABCC1 pump has higher affinity to SN-38 than any other

Figure 4. Intratumor relative expression of CPT-11 target enzyme Top1 and DNA repair genes in FaDu and A253 xenografts. 5, Control; n, 7 d aftermethylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. A253 untreated tumors have higher expressionof ERCC2, ERCC6, and XRCC1 than FaDu. In contrast, the expression of Top1, TDP-1, and ERCC1 were higher in untreated FaDu than in A253. Thecombination therapy has no effect on Top1 and DNA repair genes.





transporters. High level in ABCC1 expression couldtranslate into higher resistance to SN-38 (37). Our datasuggest that the increase in the AUC of SN-38 in FaDutumors may be related to the increased conversion of CPT-11 to SN-38 due in part to the increased level of CES1 anddecreased expression of ABCC1. The methylselenocys-teine/CPT-11 treatment had no significant impact ondegradation enzymes of CPT-11 or SN-38.

In the less sensitive A253 tumor, the observed substantialincrease (62%) in the AUC of SN-38 after the methylsele-nocysteine/CPT-11 treatment corresponded with a 31%increase in intratumor expression of CES1 (P = 0.03) whencompared with CPT-11 alone. Methylselenocysteine/CPT-11 treatment had no statistically significant impact on any

of ABC family transporters or on the degradation enzymes,except for CYP3A5. The expression level of CYP3A5increased after treatment with methylselenocysteine/CPT-11 when compared with CPT-11 alone (P = 0.01). However,Santos et al. showed that CYP3A5 catalytic activity(produced a new metabolite, M4) is generally weaker thanthose of CYP3A4 and that CYP3A5 has lower affinity toCPT-11 than CYP3A4 (15). CYP3A5 marginal increasedexpression does not explain the observed increase in SN-38concentration, nor does it have an apparent correlationwith response rate. These data suggest that methylseleno-cysteine/CPT-11 treatment enhanced the conversion ofCPT-11 to SN-38 but had no effect on the SN-38 efflux anddegradation in A253 tumors.

Figure 5. Intratumor level of cell survival/death genes in FaDu and A253.5, Control;n, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11;, 24 h after first methylselenocysteine/CPT-11. The relative expressions of DRG1, NFnB1, and ferredoxin reductase are higher in untreated A253

tumors, but TNFSF6 expression is higher in untreated FaDu tumors. The combination treatment decreased DRG1 level in FaDu tumors but increased theTNFSF6 levels in both tumors.





The methylselenocysteine/CPT-11 treatment had nosignificant effect on the most investigated downstreamtargets (target gene, DNA repair, and cell survival/deathgenes), except for DRG1 in FaDu tumors and TNFSF6 inA253 tumors.

DRG1 is a member of a four DRG gene family (38).Motwani et al. suggest that DRG1 plays a direct role inresistance to CPT-11 and its inhibition could provide amean to increase sensitivity to CPT-11. In this study, theintratumor level of DRG1 decreased by 34% after methyl-selenocysteine/CPT-11 when compared with CPT-11alone (P = 0.04; Table 5). This decrease in the intratumorexpression of DRG1 may play a role in the improvedresponse rate by lowering the resistance to CPT-11 in FaDu.

TNFSF6 is involved in Fas-induced apoptosis. The 24%increased level of TNFSF6 in A253 tumors (P < 0.005) aftermethylselenocysteine/CPT-11 could be related to theobserved increase in response rate (Table 5).

In brief, this study shows that the increase of completeresponse rate in FaDu xenografts from 30% to 100% aftermethylselenocysteine/CPT-11 is associated with multifac-torial alterations induced by the combination. This includes(a) increase in intratumor AUC of SN-38, (b) increase inCES1 level, and (c) decrease SN-38 efflux pump (decreaseABCC1). Collectively, these changes could translate intoincrease in intratumor SN-38 concentration. In part, thisSN-38 concentration increase together with the decrease inDRG1 expression level could be responsible for the en-hanced complete response rate (100%) in FaDu (Table 5).

In A253, the increase of intratumor AUC of SN-38 and theincrease of CES1 level together with the increase of TNFSF6level are favorable alterations, which could be associatedwith the increase of complete response rate to 60% aftermethylselenocysteine/CPT-11 treatment. We reported pre-viously that A253 cells in vitro were f3-fold more resistantto SN-38 than FaDu cells (IC50, 0.35 and 0.1 Amol/L, re-spectively; ref. 39). In addition, the in vivo studies show thatthe heterogeneous A253 xenografts are more resistant toCPT-11 than the homogeneous FaDu with a cure rate of 0%and 30%, respectively (31). This could be a factor explainingthat A253 may need more intratumor drug concentration toachieve the same observed effect in FaDu.

Our data provided clear evidence of difference in somemarkers level between the untreated controls of FaDu andA253. In A253, overexpression of markers like ABCC1,ABCG2, ERCC2, ERCC6, XRCC1, DRG1, and NFnB1 couldserve as poor prognostic indication to CPT-11 treatment.

In conclusion, the molecular alteration reported in thisstudy could be important for the prediction of responseto the combination treatment of methylselenocysteine/CPT-11. Future studies of the effect of methylselenocys-teine/CPT-11 treatment on the function of the genesrelevant to CPT-11 metabolic pathway could provide newand valuable data to further elucidate and verify the basisbehind the observed therapeutic synergy of methylseleno-cysteine/CPT-11 treatment.

Acknowledgments

We thank Elizabeth S. Buyers and Kevin A. Craig for their valuableassistance with this article.

References

1. Ma MK, McLeod HL. Lessons learned from the irinotecan metabolicpathway. Curr Med Chem 2003;10:41–9.

2. Rivory LP. Irinotecan (CPT-11): a brief overview. Clin Exp PharmacolPhysiol 1996;23:1000–4.

3. Evans WE, Relling MV. Pharmacogenomics: translating functionalgenomics into rational therapeutics. Science 1999;286:487–91.

4. Evans WE, Johnson JA. Pharmacogenomics: the inherited basis forinterindividual differences in drug response. Annu Rev Genomics HumGenet 2001;2:9–39.

5. Evans WE, McLeod HL. Pharmacogenomics—drug disposition, drugtargets, and side effects. N Engl J Med 2003;348:538–49.

6. McLeod HL, Evans WE. Pharmacogenomics: unlocking the humangenome for better drug therapy. Annu Rev Pharmacol Toxicol 2001;41:101–21.

7. Lavelle F, Bissery MC, Andre S, Roquet F, Riou JF. Preclinical eval-uation of CPT-11 and its active metabolite SN-38. Semin Oncol 1996;23:11–20.

8. Rivory LP, Bowles MR, Robert J, Pond SM. Conversion of irinotecan(CPT-11) to its active metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38), by human liver carboxylesterase. Biochem Pharmacol 1996;52:1103–11.

9. Wiseman LR, Markham A. Irinotecan. A review of its pharmacologicalproperties and clinical efficacy in the management of advanced colorectalcancer. Drugs 1996;52:606–23.

10. Satoh T, Hosokawa M, Atsumi R, Suzuki W, Hakusui H, Nagai E.Metabolic activation of CPT-11, 7-ethyl-10-[4-(1-piperidino)-1-piperidino]carbonyloxycamptothecin, a novel antitumor agent, by carboxylesterase.Biol Pharm Bull 1994;17:662–4.

11. Senter PD, Beam KS, Mixan B, Wahl AF. Identification and activitiesof human carboxylesterases for the activation of CPT-11, a clinicallyapproved anticancer drug. Bioconjug Chem 2001;12:1074–80.

12. Gupta R, Mick R, Ramirez J, et al. Pharmacokinetic and pharmaco-dynamic evaluation of the topoisomerase inhibitor irinotecan in cancerpatients. J Clin Oncol 1997;15:1502–10.

13. Xu G, Zhang W, Ma MK, McLeod HL. Human carboxylesterase 2 iscommonly expressed in tumor tissue and is correlated with activation ofirinotecan. Clin Cancer Res 2002;8:2605–11.

14. Rivory L, Riou JF, Haaz MC, et al. Identification and properties ofmajor plasmid metabolite of irinotecan (CPT-11) isolated from the plasmaof patients. Cancer Res 1996;56:3689–94.

15. Santos A, Zanetta S, Cresteil T, et al. Metabolismof Irinotecan (CPT-11)by CYP2A4 and CYP3A5 in humans. Clin Cancer Res 2000;6:2012–20.

16. Dean M, Hamon Y, Chimini G. The human ATP-binding cassette(ABC) transporter superfamily. J Lipid Res 2001;42:1007–16.

Table 5. Summary of statistically significant variables changesafter the combination treatment of methylselenocysteine andCPT-11 in comparison with CPT-11 alone

Variables Plasma FaDu A253

CPT-11 AUC Increase (72%) Increase (14%) Increase (28%)SN-38 AUC Increase (10%) Increase (20%) Increase (62%)CES1 — Increase (43%)* Increase (31%)*ABCC1 — Decease (55%)* Increase (4%)DRG1 — Decease (34%)* Increase (6%)TNFSF6 — Increase (37%) Increase (24%)*CYP3A5 — Increase (11%) Increase (50%)*

* P < 0.05, compared with CPT-11 after methylselenocysteine + CPT-11.





17. Chen CJ, Clark D, Ueda K, Pastan I, Gottesman MM, Roninson IB.Genomic organization of the human multidrug resistance (MDR1) gene andorigin of P-glycoproteins. J Biol Chem 1990;5;265:506–14.

18. Motwani M, Sirotnak FM, She Y, Commes T, Schwartz GK. Drg1, anovel target for modulating sensitivity to CPT-11 in colon cancer cells.Cancer Res 2002;62:3950–5.

19. Hwang PM, Bunz F, Yu J, et al. Ferredoxin reductase affects p53-dependent, 5-fluorouracil-induced apoptosis in colorectal cancer cells. NatMed 2001;7:1111–7.

20. Liu G, Chen X. The ferredoxin reductase gene is regulated by the p53family and sensitizes cells to oxidative stress-induced apoptosis. Onco-gene 2002;21:7195–04.

21. Sharma HW, Narayanan R. The NF-nB transcription factor inoncogenesis [review]. Anticancer Res 1996;16:589–96.

22. Rangaswami H, Bulbule A, Kundu GC. Nuclear factor inducing kinaseplays crucial role in osteopontin induced MAPK/IKK dependent nuclearfactor nB-mediated promatrix metalloproteinase-9 activation. J Biol Chem2004;279:38921–35.

23. Embree-Ku M, Venturini D, Boekelheide K. Fas is involved in the p53-dependent apoptotic response to ionizing radiation in mouse testis. BiolReprod 2002;66:1456–61.

24. Ip C. Lessons from basic research in selenium and cancer prevention.J Nutr 1998;128:1845–54.

25. Kim T, Jung U, Cho DY, Chung AS. Se-methylselenocysteine inducesapoptosis through activation in HL-60 cells. Carcinogenesis 2001;22:559–65.

26. Yeo JK, Cha SD, Cho CH, et al. Se-methylselenocysteine inducesapoptosis through caspase activation and Bax cleavage mediated bycalpain SKOV-3 ovarian cancer cells. Cancer Lett 2002;182:83–92.

27. Medina D, Thompson H, Ganther H, Ip C. Se-methylselenocysteine: anew compound for chemoprevention of breast cancer. Nutr Cancer 2001;40:12–27.

28. Thompson HJ, Wilson A, Lu J, et al. Comparison of the effects of anorganic and inorganic form of selenium on a mammary carcinoma cell line.Carcinogenesis 1994;15:183–6.

29. Sinha R, Medina D. Inhibition of cdk2 kinase activity by Se-

methylselenocysteine in synchronized mouse mammary epithelial cells.Carcinogenesis 1997;18:1541–7.

30. Azrak RG, Cao S, Slocum HK, et al. Therapeutic synergy betweenirinotecan and 5-fluorouracil against human tumor xenografts. Clin CancerRes 2004;10:1121–9.

31. Cao S, Durrani FA, Rustum YM. Selective modulation of the thera-peutics efficacy of anticancer drugs by selenium containing compoundsagainst human tumor xenografts. Clin Cancer Res 2004;10:2561–9.

32. Bradford MM. A rapid and sensitive method for the quantitation ofmicrogram quantities of protein utilizing the principle of protein-dyebinding. Anal Biochem 1976;72:248–54.

33. Warner DL, Burke TG. Simple and versatile high-performance liquidchromatography method for the simultaneous quantitation of the lactoneand carboxylate forms of camptothecin anticancer drugs. J Chromatogr BBiomed Sci Appl 1997;691:161–71.

34. Yu J, Shannon WD, Watson MA, McLeod HL. Gene expressionprofiling of the irinotecan pathway in colorectal cancer. Clin Cancer Res2005;11:2053–62.

35. Liu W, Saint DA. A new quantitative method of real time reversetranscription polymerase chain reaction assay based on simulation ofpolymerase chain reaction kinetics. Anal Biochem 2002;302:52–9.

36. Jansen WJ, Hulscher TM, van Ark-Otte J, Giaccone G, Pinedo HM,Boven E. CPT-11 sensitivity in relation to the expression of P170-glycoprotein and multidrug resistance-associated protein. Br J Cancer1998;77:359–65.

37. Chu XY, Suzuki H, Ueda K, Kato Y, Akiyama S, Sugiyama Y. Activeefflux of CPT-11 and its metabolites in human KB-derived cell lines.J Pharmacol Exp Ther 1999;288:735–41.

38. Zhou RH, Kokame K, Tsukamoto Y, Yutani C, Kato H, Miyata T.Characterization of the human gene family: a newly identified member,ndrg4, is specifically expressed in brain and heart. Genomics 2001;73:86–7.

39. Bhattacharya A, Toth K, Mazurchuk R, et al. Lack of microvessels inwell differentiated regions of human head and neck squamous cellcarcinoma A253 is associated with fMR imaging detectable hypoxia,limited drug delivery and resistance to irinotecan therapy. Clin Cancer Res2004;10:8005–17.





2005;4:843-854. Mol Cancer Ther Rami G. Azrak, Jinsheng Yu, Lakshmi Pendyala, et al. and neck xenograft tumorsalterations induced by methylselenocysteine in human head Irinotecan pharmacokinetic and pharmacogenomic

Updated version

http://mct.aacrjournals.org/content/4/5/843

Access the most recent version of this article at:

Cited articles

http://mct.aacrjournals.org/content/4/5/843.full#ref-list-1

This article cites 39 articles, 14 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/4/5/843.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mct.aacrjournals.org/content/4/5/843To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/content/4/5/843.full#ref-list-1

http://mct.aacrjournals.org/content/4/5/843.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

