YAP-Induced PD-L1 Expression Drives Immune Evasion in BRAFi … · Research Article YAP-Induced PD-L1 Expression Drives Immune Evasion in BRAFi-Resistant Melanoma Min Hwan Kim1, Chang

Research Article

YAP-Induced PD-L1 Expression Drives ImmuneEvasion in BRAFi-Resistant MelanomaMin Hwan Kim1, Chang Gon Kim1, Sang-Kyum Kim2, Sang Joon Shin3,Eun Ah Choe3, Su-Hyung Park1, Eui-Cheol Shin1, and Joon Kim1

Abstract

Activation of YAP, a Hippo pathway effector, is an impor-tant resistance mechanism to BRAF inhibitor (BRAFi) inmelanoma. Emerging evidence also suggests that YAP isinvolved in suppression of the antitumor immune response.However, the potential direct impact of YAP activity oncytotoxic T-cell immune responses has not been explored yet.Here, we show that BRAFi-resistant melanoma cells evadeCD8þ T-cell immune responses in a PD-L1–dependent man-ner by activating YAP, which synchronously supports mela-noma cell survival upon BRAF inhibition. PD-L1 expression iselevated in BRAFi-resistant melanoma cells, in which YAP isrobustly activated, and YAP knockdown decreases PD-L1expression. In addition, constitutively active YAP (YAP-5SA)

increases PD-L1 expression by binding to an upstreamenhancer of the PD-L1 gene and potentiating its transcription.Both BRAFi-resistant and YAP-5SA–expressing melanomacells suppress the cytotoxic function and cytokine productionof Melan-A–specific CD8þ T cells, whereas anti–PD-1 anti-body reverses the YAP-mediated T-cell suppression. Moreover,nuclear enrichment of YAP in clinical melanoma samplescorrelates with increased PD-L1 expression. Our findingsshow that YAP directly mediates evasion of cytotoxic T-cellimmune responses in BRAFi-resistant melanoma cells byupregulating PD-L1, and targeting of YAP-mediated immuneevasion may improve prognosis of melanoma patients.Cancer Immunol Res; 6(3); 255–66. �2018 AACR.

IntroductionBlockade of the immune checkpoint receptor PD-1 by mono-

clonal antibodies (mAbs) leads to remarkable clinical responsesin advancedmelanoma (1, 2). The interaction of PD-1with PD-L1relays inhibitory signals to T cells, resulting in T-cell exhaustion(3, 4). Aberrant expression of PD-L1 on the surface of cancer cellsis a central mechanism by which many cancers escape the anti-tumor immune response (5, 6), and PD-L1 expression serves as apredictive biomarker of a favorable response to immune check-point blockade (7, 8). Although previous studies have reportedincreased expression of PD-L1 in 13% to 72% of tumors inmelanoma, gastric cancer, andnon–small cell lung cancer patients

(9–11), PD-L1 expression patterns are spatially heterogeneousand temporally dynamic (11, 12). PD-L1 expression can beinduced adaptively by continuous exposure to interferon-g(IFNg), which is secreted by tumor-infiltrating T cells (13),and is also driven intrinsically by the activation of severaloncogenic signaling molecules including EGFR, AKT, andALK (14–16). However, factors that modulate dynamic PD-L1expression during tumorigenesis and progression are not yetfully understood.

Activating BRAF mutations occur in roughly half of all mela-nomas, and treatment with BRAF or MEK inhibitors efficientlyinduces tumor shrinkage (17, 18). The antitumor efficacy ofBRAF/MEK inhibitors is dependent, in part, on their immuno-sensitizing effects (19). MAPK pathway inhibition results inincreased antigen presentation (20, 21), decreased immunosup-pressive cytokine production (20), and increased CD8þ T-cellinfiltration intomelanoma tissue (20, 22, 23). Resistance to BRAFinhibitor (BRAFi) invariably arises after amedian of 6 to 8monthsin most patients. Unlike tumors on initial BRAFi therapy, tumorsthat progress after BRAFi therapy exhibit a decrease in both tumor-infiltrating T cells and tumor antigen expression (20, 24), as wellas increased T-cell exhaustion markers, including PD-L1 (20, 22,24–26). These results imply that the acquisition of BRAFi resis-tance in melanoma is linked with suppression of T-cell immuneresponses on multiple fronts, and understanding the evasionmechanism of T-cell antitumor immune response is essential forthe improvement of BRAFi therapy efficacy.

YAP is a transcriptional coactivator that functions as aneffector of the Hippo pathway and plays key roles in controllingtissue growth, regeneration, and stem cell homeostasis (27).YAP becomes activated in cancer cells by deletion of Hippopathway components (28), GNAQ mutations (29), actin

1Graduate School of Medical Science and Engineering, KAIST, Daejeon, Korea.2Department of Pathology, Yonsei University College of Medicine, Seoul, Korea.3Division of Medical Oncology, Department of Internal Medicine, Yonsei Uni-versity College of Medicine, Seoul, Korea.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

M.H. Kim, C.G. Kim, and S.-K. Kim contributed equally to this article.

Corresponding Authors: Joon Kim, KAIST, 291 Daehak-ro, Yuseong-gu, Bio-medical Research Building R5109, Daejeon 34141, Korea. Phone: 82-42-350-4242; Fax: 82-42-350-4240; E-mail: [email protected]; Eui-Cheol Shin, Lab-oratory of Immunology and Infectious Diseases, KAIST, Graduate School ofMedical Science and Engineering, 291 Daehak-ro, Daejeon 34141, Korea. Phone:82-42-350-4236; E-mail: [email protected]; Su-Hyung Park, Laboratory ofTranslational Immunology and Vaccinology, KAIST, Graduate School of MedicalScience and Engineering, 291 Daehak-ro, Daejeon 34141, Korea. Phone: 82-42-350-4248; E-mail: [email protected]

doi: 10.1158/2326-6066.CIR-17-0320

�2018 American Association for Cancer Research.

CancerImmunologyResearch

www.aacrjournals.org 255

on November 8, 2020. © 2018 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst January 30, 2018; DOI: 10.1158/2326-6066.CIR-17-0320

http://crossmark.crossref.org/dialog/?doi=10.1158/2326-6066.CIR-17-0320&domain=pdf&date_stamp=2018-2-15

http://cancerimmunolres.aacrjournals.org/

cytoskeleton rearrangement (30), and oncogenic mutations inAPC and RAS genes (31, 32). Aberrant YAP activation promotestumorigenesis and stem cell-like features of malignant cells(33) and also induces resistance to anticancer agents, includingBRAF/MEK inhibitors (30, 34, 35). Accumulating evidencesuggests an immunomodulatory effect of YAP in malignanttumors. Increased YAP activity leads to changes in the cytokinerepertoire secreted by cancer cells, resulting in the recruitmentof myeloid-derived suppressive cells (MDSC) and type IImacrophages that suppress antitumor immune responses(36–38). These results suggest an interesting link betweenoncogenic YAP activation and immune evasion processes, butthe direct influence of YAP activation on cytotoxic T-cellimmune responses has been largely unaddressed.

Here, we show that YAP promotes PD-L1 expression and YAP-induced PD-L1 drives immune evasion in BRAFi-resistant mela-noma. Increased YAP activity in melanoma cells potently sup-pressed both cytotoxic function and cytokine production oftumor antigen–specific CD8þ T cells. Anti–PD-1 and anti–PD-L1 blockade reversed YAP-mediated T-cell suppression. Ourresults demonstrate that the direct inhibitory effect of YAP oncytotoxic T cells serves as a key mechanism of YAP-mediatedimmune evasion. We also suggest that targeting YAP-mediatedT-cell suppression would be a candidate strategy to improveprognosis of BRAF-mutant melanoma patients.

Materials and MethodsCell culture

SKMEL28 and WM3248 cells were purchased from ATCC andCoriell Institute, respectively. Parental and BRAFi-resistantSKMEL28 and WM3248 cells were generated and maintained asdescribed previously (30). A375SM cells were acquired from theKorean Cell Line Bank and grown in DMEM (Welgene) supple-mentedwith 10%FBS (Welgene).MCF7,MDA-MB231, andA172cells were acquired from ATCC and grown in DMEM supplemen-ted with 10% FBS. HT29, KM12, and A549 cells were acquiredfrom the Korean Cell Line Bank and grown in RPMI1640 (Wel-gene) supplemented with 10% FBS. Melanoma cell lines wereconfirmed for BRAFV600E mutation at the time of purchase bySanger sequencing. Re-authentication of cell lines after purchasewas not performed. BRAFi-resistant A375SM cells were generatedby continuous treatment of 2 mmol/L PLX4032 (vemurafenib;Selleckchem) for 2 months. Established BRAFi-resistant cell linesweremaintained in culture media containing 2 mmol/L PLX4032.BRAFV600E mutation of resistant cell lines was confirmed bySanger sequencing. Cell lines were routinely tested for mycoplas-ma infection. All cell lines were stored in liquid nitrogen andcultured for no longer than 6 months before use.

Reagents, plasmid, and transfectionErlotinib and MK-2206 were purchased from Selleckchem,

PD0325901 from Calbiochem, verteporfin from Sigma-Aldrich,and recombinant human IFNg from R&D Systems. Retroviralvectors were used to generate melanoma cells and HEK293T cellsthat stably express YAP and its mutants. FLAG-YAP wild-type,FLAG-YAP-5SA, and FLAG-YAP-5SA-S94A cDNAs that werecloned into pMSCV-puro vector were provided by Dr. Dae-SikLim (KAIST). Retrovirus particle assembly, transfection, andpuromycin selection were performed as described previously(30). We transfected cells with siRNAs (Supplementary

Table S1) using Lipofectamine RNAiMAX (Invitrogen) accordingto the manufacturer's instructions.

Immunofluorescence, microscopy, and image analysisImmunofluorescence staining andmicroscopy were performed

as described previously (30). The primary antibodies used in thisstudy are described in Supplementary Table S2. ImageJ softwarewas used to analyze acquired images. YAP localization patternswere classified by inspecting at least 150 to 200 cells for eachcondition.

Immunoblotting and quantitative RT-PCRImmunoblotting and quantitative RT-PCR were performed as

described previously (30). iQ SYBR Green Supermix (Bio-Rad)and CFX96 system (Bio-Rad) were used for real-time PCR. Targetgene primers used in this study are described in SupplementaryTable S3. Relative target gene expression levels normalized toGAPDH were determined by the DDC(t) method using CFXManager software (Bio-Rad).

Cell viability assayMelanoma cells were plated on 96-well cell culture plates (SPL)

at 2,500 cells/well and incubated for 24 hours after plating. Cellswere treated with variable doses of PLX4032 (1 nmol/L to100 mmol/L) for 72 hours, and cell viability was determined byCell Counting Kit-8 reagent (Dojindo) according to the manu-facturer's instructions. Cell viability data were fitted to sigmoidaldose–response curves and IC50 values were calculated usingGraphPad Prism (GraphPad Software).

Chromatin immunoprecipitation (ChIP)Candidate YAP–TEAD binding sites near the PD-L1 transcrip-

tion start site were identified by reviewing the ChIP-Seq datadeposited by Zanconato and colleagues (GSE66081; ref. 39). Aprimer pair was designed for a ChIP assay targeting a narrow peakof TEAD4 binding at 13-kb upstream of the PD-L1 transcriptionstart site (hg19, chr9:5,437,232-5,437,617): CATCGGGATTAC-CACGCTGA (Forward) and TTCGTTCCATTAGAGCGCGT(Reverse). ChIP assay was performed in YAP-5SA–expressingSKMEL28 and WM3248 cells using Magna ChIP A/G kit (Milli-pore) according to the manufacturer's instructions. Sheared chro-matin was immunoprecipitated using control mouse IgG or anti-FLAG antibody (Sigma-Aldrich, F1804) overnight at 4�C. YAPinteraction with the 13-kb upstream site was measured by quan-titative PCR using iQ SYBRGreen Supermix (Bio-Rad) and CFX96system (Bio-Rad). The ChIP-qPCR signals from samples treatedwith controlmouse IgGor anti-FLAGantibodies were normalizedto the signals obtained from input samples.

Luciferase assaysA 800-bp fragment of the human genomic DNA sequence

around the YAP–TEAD binding site in the 13-kb upstream fromthe PD-L1 gene was cloned into pGL4.26 luciferase vector (Pro-mega). For luciferase assay, mock and YAP-5SA–expressingHEK293T cells were plated on 96-well cell culture plates (SPL)at 5,000 cells/well. The cells were cotransfected with pcDNA3.1-His-lacZ and pGL4.26:YAP–TEAD binding site for 24 hours usingLipofectamine LTX. Luciferase activity was measured using aluciferase assay kit (Promega) according to the manufacturer'sinstructions. Luciferase activity was normalized to b-galactosidaseactivity measured by a b-galactosidase assay kit (Promega).

Kim et al.

Cancer Immunol Res; 6(3) March 2018 Cancer Immunology Research256




Cytometric bead array (CBA), ELISA, and culture supernatanttransfer

Culture media containing 10% FBS were applied to mock orYAP-5SA–expressing melanoma cells, and culture supernatantswere collected after 72-hour incubation for cytokine analyses andculture supernatant transfer experiments. IL2, IL4, IL7, GM-CSF,IFNa, and IFNg levels in the culture supernatants were measuredby CBA kit (BD Biosciences). IFNb was measured by VerikineELISA kit (PBL Assay Science), and IL15 was measured by Quan-tikine ELISA kit (R&D Systems) according to the manufacturer'sinstructions.

Flow cytometryCells were trypsinized, harvested, and stained using LIVE/

DEAD Fixable Red Dead Cell Stain kit (Thermo Fisher Scien-tific) to exclude dead cells before incubation with fluoro-chrome-conjugated antibodies. For intracellular cytokinestaining, brefeldin A (GolgiPlug, BD Biosciences), monensin(GolgiSTOP, BD Biosciences), and anti-CD107a antibody wereadded to the culture and maintained for 6 hours. After surfacestaining for 15 min at room temperature, the cells wereprocessed using a fixation/permeabilization solution kit(BD Biosciences) and further stained with fluorochrome-conjugated anti-IFNg and anti-TNFa antibodies. All flow cyto-metry analyses were performed using an LSR II instrument (BDBiosciences) and data were analyzed using FlowJo software(TreeStar). The antibodies used for flow cytometry aredescribed in Supplementary Table S2.

Melan-A–specific CD8þ T-cell linesPeripheral blood mononuclear cells (PBMC) were obtained

from HLA-A2 positive healthy donors and CD8þ T cells werenegatively isolated using a magnetic bead separation (MACS) kit(Miltenyi Biotec). Subsequently, Melan-A26-35–specific CD8þ Tcells were positively selected by MACS with phycoerythrin-conjugated HLA-A2-Melan-A26-35 (ELAGIGILTV) pentamers(Proimmune Ltd.) and antiphycoerythrin microbeads (MiltenyiBiotec). Selected CD8þ T cells were expanded in RPMI 1640media containing anti-CD3 (50 ng/mL), IL2 (200 IU/mL), IL7(10 ng/mL), and IL15 (100 ng/mL) for 4 weeks using irradiatedautologous PBMCs as feeder cells. The purity of Melan-A26-35–

specific CD8þ T cells was >95% based on flow cytometry usingHLA-A2-Melan-A26-35 pentamers.

In vitro cytotoxicity assayTarget melanoma cells were labeled with PKH26 dye (Sigma-

Aldrich) according to the manufacturer's instructions andpulsed with 10 mg/mL Melan-A26-35 peptide (ELAGIGILTV;PeproTech) for 1 hours at 37�C in a 5% CO2 incubator.The target cells were cocultured with Melan-A-specific CD8þ

T cells in 12 � 75 mm FACS tubes (Falcon) at variable effector:target ratios in the presence of anti–PD-1 (clone EH12.2H7,BioLegend, Inc.), anti–PD-L1 (clone 29E.2A3, BioLegend,Inc.), anti–PD-L2 (clone MIH18, BioLegend, Inc.) blockingantibodies, or IgG isotype control (clone MOPC-21, Bio-Legend, Inc.). After 6 hours, cells were harvested and stainedwith TO-PRO-3 dye (Thermo Fisher Scientific) to detect deadcells with disintegrative cytoplasmic membrane via flowcytometry. Specific killing was calculated by subtracting thebaseline death rate of target cells from the death rate undervariable conditions.

Immunohistochemistry (IHC) of human melanoma tumorsMelanoma tumor tissues were retrieved from 65 melanoma

patients diagnosed at the Department of Pathology of SeveranceHospital, South Korea (Supplementary Table S4). This study wasreviewed and approved by the institutional review board atSeverance Hospital. Formalin-fixed, paraffin-embedded tumorsamples were used to obtain 5-mm-thick sections. IHC was per-formed with anti-YAP (sc-10119; Santa Cruz Biotechnology;1:100 dilution) and anti–PD-L1 (E1L3N; Cell Signaling Technol-ogy; 1:100 dilution) antibodies in an automated immunohisto-chemical staining instrument (Ventana BenchMark XT; VentanaMedical System) according to the manufacturer's instructions.Ultraview Universal Alkaline Phosphatase Red Detection Kit(Roche Diagnostics) was used for detection. IHC staining of allslides was interpreted by an expert dermatology pathologist(Sang-Kyum Kim). YAP staining was classified as nuclear, nucleo-cytoplasmic (NC), or cytoplasmic according to the subcellularYAP staining pattern, and PD-L1 staining as � (negative), þ(one-positive), or þþ (two-positive) depending on the propor-tion of stained cells and staining intensity.

Meta-analysis of public dataThe RNA-seq data for melanoma samples published by Hugo

and colleagues (GSE65815; ref. 24) were obtained from the GEOdatabase (40). Log2(FPKMþ1) values for CD274 (PD-L1) andIFNG (IFNg) were plotted and linear regression analysiswas performed for both pre-MAPK inhibitor treatment tumors(n ¼ 17) and post-MAPK inhibitor treatment tumors (n ¼ 43).YAP signature enrichment results were retrieved from the refer-ence (24) and compared with the CD274 FPKM values. YAP-enriched tumors were defined as tumors enriched for eitherCORDENONSI_YAP_CONSERVED or YAP_HIPPO_KD_MOH-SENI signature (Molecular Signature database). TCGA RNA-seqdata for 472 melanoma tumors from 469 patients were down-loaded through Firebrowse (Broad Institute). The normalizedcount calculated by RNA-Seq by expectation maximization(RSEM) analysis (41) was inserted into the gene set variationanalysis (GSVA; ref. 42). The enrichment score for the YAP targetgene signature (CORDENONSI_YAP_CONSERVED_SIGNA-TURE in Molecular Signature database) was determined by GSVAfor each tumor sample, and the TCGAmelanoma tumor sampleswere classified into YAPlow (samples with a negative enrichmentscore), YAPmid (sampleswith enrichment score belowmedian), andYAPhigh (samples with enrichment score above median). CD274Log2(RSEM normalized countþ1) values of the three groups werecompared. The GSVA was performed using R version 3.3.1.

Quantification and statistical analysisGraphPad Prism (GraphPad Software) was used for analyzing

data and creating graphs. Significance was set at 0.05 in theMann–Whitney U test or unpaired t test.

ResultsYAP activation induced PD-L1 expression in BRAFi-resistantmelanoma cells

To access the influence of YAP activation on immune check-point pathways, we first examined the surface expression of T-cellcoinhibitory/costimulatory ligands (PD-L1, PD-L2, B7-1, B7-2,Galectin-9, and CD155) in melanoma cells expressing constitu-tively active YAP. We established BRAFV600E-mutant melanoma

YAP Promotes Immune Evasion by PD-L1 Upregulation

www.aacrjournals.org Cancer Immunol Res; 6(3) March 2018 257




cell lines (SKMEL28, WM3248, and A375SM) harboringFLAG-tagged YAP-5SA vector. Previous studies have shown that5SA mutations cause constitutive nuclear localization and tran-scriptional activation of YAP by preventing inhibitory phosphor-ylation of YAP by the Hippo pathway kinases LATS1 and LATS2.Interestingly, melanoma cell lines expressing YAP-5SA displayedgreater PD-L1 and PD-L2 surface expression when compared withparental cells (Supplementary Fig. S1A and S1B). In addition,overexpression of YAP-5SA, but not wild-type YAP, increasedPD-L1 mRNA expression as well as its surface protein expressionin the three melanoma cell lines (Fig. 1A and B; SupplementaryFig. S1C). These results indicate that YAP activation inducedPD-L1 expression in melanoma cells. We also observedYAP-5SA–induced PD-L1 upregulation in breast cancer (MCF7,MDA-MB231), non–small cell lung cancer (A549), colon cancer(HT29), and glioblastoma (A172) cells (Supplementary Fig. S2).However, YAP-5SA expression did not significantly increasePD-L1 levels in KM12 colon cancer cells, suggesting that YAP-mediated PD-L1 induction was dependent on cellular context.

Our group and others have reported robust YAP activationin melanoma cells resistant to BRAFi (30, 34). Therefore,we examined PD-L1 mRNA and protein expression in BRAFi(vemurafenib)-resistant melanoma cells. BRAFi-resistant mela-noma cell lines were generated as previously described (30), andwe confirmed the acquisition of BRAFi resistance (SupplementaryFig. S3A). As expected, SKMEL28, WM3248, and A375SM cellsresistant to BRAFi expressed more PD-L1 mRNA and cell surfaceprotein compared with parental cells (Fig. 1C and D). Moreover,RNAi-mediated knockdown of YAP and its paralog TAZ sup-pressed both PD-L1 transcription and cell surface expression inBRAFi-resistant cells, demonstrating that enhanced YAP/TAZactivity is associated with increased PD-L1 expression (Fig. 1Eand F; Supplementary Fig. S3B). Our previous microarray data(GSE68599; ref. 30) that compared parental and BRAFi-resistantmelanoma cells, as well as YAP/TAZ-depleted resistant cells, alsoconfirm both the upregulation of PD-L1 in resistant cells amongimmune checkpoint ligands and the decline of PD-L1 expressionafter YAP/TAZ knockdown (Supplementary Fig. S3C). Collective-ly, these results indicate that YAP activation upregulated PD-L1expression in melanoma cells.

YAP upregulated PD-L1 independent of the EGFR, AKT, MAPK,and IFNg pathways

Previous studies have reported that oncogenic activation of theEGFR, AKT, and MAPK pathways can induce PD-L1 expression incancer cells (14, 15, 25). To test whether these pathways areinvolved in YAP-mediated PD-L1 expression, we treatedYAP-5SA–expressing melanoma cells with erlotinib (EGFR inhib-itor), MK-2206 (AKT inhibitor), or PD0325901 (MEK inhibitor)and measured PD-L1 expression. Elevated PD-L1 expression waslargely unaffected by suppression of the oncogenic signalingpathways, indicating that YAP-mediated PD-L1 expression doesnot require these pathways (Fig. 2A and B). PD-L1 expression isalso induced by IFNg exposure during prolonged T-cell immuneresponse, eliciting adaptive immune evasion, so we tested wheth-er YAP was involved in IFNg-mediated PD-L1 upregulation.Short-term (48 hours) and long-term (7 days) IFNg treatmentdid not promote YAP nuclear localization, which was an indica-tion of YAP activation (Fig. 2C). In addition, YAP/TAZ depletiondid not affect PD-L1 induction by IFNg (Fig. 2D). We alsoexamined the effect of YAP activation on the JAK/STAT pathway,

the major downstream effector of IFNg signaling. There was nophospho-STAT1 activity both in mock and YAP-5SA–expressingmelanoma cells, but IFNg-treated mock A375SM cells showedhigh phospho-STAT1 (Supplementary Fig. S4A). These resultssuggested that the IFNg pathway and YAP independently regulatePD-L1 expression.

We next examined possible involvement of secretory cytokinesin YAP-mediated PD-L1 upregulation. We measured the concen-trations of IL2, IL4, IL7, IL15, GM-CSF, IFNa, IFNb, and IFNg ,which were previously reported to regulate PD-L1 expression(43), in the culture supernatants of mock and YAP-5SA–expressing melanoma cells. However, no changes in the concen-trations of the examined cytokines were detectable (Supplemen-tary Fig. S4B). Moreover, addition of the culture supernatantsderived from YAP-5SA–expressing melanoma cells did notupregulate PD-L1 expression in parental melanoma cells (Sup-plementary Fig. S4C). These results excluded the possibility thatactivation of an autocrine cytokine signaling is a central mecha-nism by which YAP promotes PD-L1 expression.

YAP bound to the PD-L1 enhancer region and promoted PD-L1transcription

YAP promotes target gene transcription mainly through itsinteraction with TEAD family transcription factors that bind topromoters or enhancers (44). The introduction of a mutation atthe TEAD binding site (S94A) significantly dampened PD-L1upregulation by YAP-5SA in SKMEL28 and WM3248 cells(Fig. 3A and B). Moreover, treatment of YAP-5SA–expressing cellswith verteporfin, an inhibitor of YAP–TEAD interaction,decreased PD-L1 mRNA and surface expression (Fig. 3C andD). Thus, an intact YAP–TEAD interaction was essential for theupregulation of PD-L1 transcription by YAP activity. Next, wesearched for YAP–TEAD binding sites in potential PD-L1 geneenhancer regions by reviewing publicly available ChIP-seq data(39). We found a narrow peak of TEAD4 binding at 13-kbupstream of the PD-L1 transcription start site that may provideYAP–TEAD binding sites. To confirm YAP binding to this region,we performed ChIP analysis. We detected specific binding activityof YAP-5SA to the 13-kb upstream region (Fig. 3E). To validateYAP-driven PD-L1 transcriptional activation by this candidateenhancer region,we cloned the 13-kbupstream sequence (800-bpfragment) into a luciferase vector with minimal promoter. Theluciferase activity driven by the enhancer sequence was signifi-cantly higher in YAP-5SA–expressing HEK293T cells than inmock-transfected HEK293T cells (Fig. 3F). These results suggestthat YAP–TEAD binding to the 13-kb upstream enhancer directlyinduced PD-L1 transcription.

BRAFi-resistant melanoma cells evaded tumor antigen–specificCD8þ T-cell immune responses

Our finding that YAP activation promotes both BRAFi resis-tance (30) and PD-L1 expression suggested that YAP served as amolecular link between BRAFi resistance and immune evasionprocesses. Therefore, we investigated the influence of YAP activa-tion in BRAFi-resistant melanoma cells on the effector functionsof tumor antigen–specific CD8þ T cells. We performed cytotox-icity assays using A375SM cells, which express HLA-A2. NeitherYAP-5SA expression nor BRAFi resistance acquisition affectedHLA-A2 expression (Supplementary Fig. S5A). We establishedCD8þ T-cell lines specific for an HLA-A2–restricted Melan-Apeptide (Melan-A26-35, ELAGIGILTV) from PBMCs of HLA-A2þ

Kim et al.





healthy donors. The resulting cell cultures contained 95.9%Melan-A26-35–specific CD8þ T cells and exhibited minimal PD-1expression (Fig. 4A and B). To mimic T-cell exhaustion in thetumor microenvironment, we cultured the T-cell lines withMelan-A26-35 peptide-pulsed PD-L1þ A375SM melanoma cellsharboring YAP-5SA. After 7 days of coculture, we observed a

strong induction of PD-1 expression on the T cells (Fig. 4B). Next,we examined the cytotoxicity of PD-1þ Melan-A26-35–specificCD8þ T cells against cognate antigen-pulsed parental andBRAFi-resistant A375SM cells. CD8þ T cells successfully killedparental A375SM cells, showing a proportional increase in cyto-toxicity as the effector-to-target ratio increased (Supplementary

Figure 1.

YAP activation induces PD-L1 expression in melanoma cells. A, qRT-PCR analysis of PD-L1 mRNA levels in SKMEL28, WM3248, and A375SM cells. Wild-typeYAP or YAP-5SA was introduced into cells by retroviral transfection, and transfected cells were selected by puromycin treatment. PD-L1 expression was normalizedto GAPDH.B, Flow cytometry analysis of PD-L1 cell surface expression inmock- or YAP-5SA–expressing SKMEL28,WM3248, and A375SM cells.C, qRT-PCR analysisof PD-L1 mRNA levels in parental and BRAFi-resistant SKMEL28, WM3248, and A375SM cells. D, Flow cytometry analysis of PD-L1 cell surface expression inparental and BRAFi-resistant SKMEL28, WM3248, and A375SM cells. E, qRT-PCR analysis of PD-L1 mRNA levels in control or YAP/TAZ siRNA-transfectedBRAFi-resistant SKMEL28, WM3248, and A375SM cells. Cells were harvested 72 hours after siRNA transfection. F, Flow cytometry analysis of PD-L1 cell surfaceexpression in BRAFi-resistant melanoma cells. Cells were harvested 72 hours after siRNA transfection. All qRT-PCR data are presented as mean � SEM of threebiological replicates. P values were determined by the unpaired t test: � , P < 0.05 and �� , P < 0.01.






Fig. S5B). BRAFi-resistant A375SM cells exhibited resistance toCD8þ T-cell cytotoxicity (Fig. 4C), which was restored by PD-1blockade by anti–PD-1 antibody, whereas anti–PD-1 antibodydid not affect the killing of parental cells. We also examined othereffector functions of T cells cocultured with melanoma cells. Weobserved significant decreases in the production of IFNg , tumornecrosis factor-a (TNFa), and the expression of CD107a, amarkerof cytotoxic degranulation activity, in CD8þ T cells coculturedwith BRAFi-resistant melanoma cells (Fig. 4D). This confirmsT-cell exhaustion inBRAFi-resistantmelanoma cells. In agreementwith the cytotoxicity recovery, anti–PD-1 antibody treatmentrestored T-cell effector functions (Fig. 4D). These results demon-strate that BRAFi-resistant melanoma cells induced immune eva-sion via PD-1–dependent exhaustion of CD8þ T cells.

YAPmediates immune evasion of tumor antigen–specific CD8þ

T cells in melanoma cellsWe next examined the impact of YAP activation on PD-1þ

Melan-A26-35–specific CD8þ T-cell immune responses by assayingcytotoxicity againstmock and YAP-5SA–expressing A375SM cells.Melanoma cells expressing YAP-5SA were more resistant than

mock cells, and PD-1 blockade reversed the T-cell cytotoxicitytoward YAP-5SA–expressing A375SM cells (Fig. 5A). Coculture ofMelan-A26-35–specific CD8þ T cells with YAP-5SA–expressingcells decreased their production of IFNg and TNFa, as well asdecreased expression of CD107a (Fig. 5B). Decreases in IFNg ,TNFa, and CD107a expression were restored by PD-1 blockade(Fig. 5B). Because YAP-5SA induced the expression of PD-L2 aswell as PD-L1 (Supplementary Fig. S1A and S1B), we next testedwhether both PD-L1 and PD-L2 contribute to YAP-mediatedT-cell suppression. Similar to anti–PD-1, PD-L1 blocking anti-body restored T-cell cytotoxic function (Supplementary Fig. S6A),IFNg and TNFa production, and CD107a expression (Supple-mentary Fig. S6B and S6C). In contrast, PD-L2 blocking antibodytreatment did not affect cytotoxicity and cytokine production ofCD8þ T cells against YAP-5SA-expressing melanoma cells, sug-gesting that PD-L2 upregulation is dispensable for YAP-mediatedT-cell suppression. Taken together, these results show that YAPactivation in melanoma cells was responsible for promotingPD-1/PD-L1–dependent evasion of cytotoxic T cells.

PD-1 blockade resulted in incomplete restorations of cytotoxicfunction of CD8þ T cells cocultured with YAP-5SA–expressing

Figure 2.

YAP induces PD-L1 expression independent of the EGFR, AKT, MAPK, and IFNg pathways. A, Immunoblots of lysates from YAP-5SA–expressing SKMEL28and WM3248 cells treated with DMSO, Erlotinib, MK-2206, or PD0325901 (2.5 mmol/L each) for 48 hours. B, Flow cytometry analysis of PD-L1 cell surfaceexpression in mock- or YAP-5SA–expressing SKMEL28 and WM3248 cells treated with the indicated drugs as in A. MFI, mean fluorescence intensity; F,fluorescence intensity of PD-L1 stained sample; F0, fluorescence intensity of the isotype control. C, Micrographs of YAP immunofluorescence (green) inWM3248 cells treated with IFNg (10 ng/mL) for 48 hours or 7 days. Nuclei were counterstained with DAPI (blue). Scale bar indicates 40 mm. The graph on theright shows the quantitative values of YAP localization classified as nuclear, NC, or cytoplasmic. D, Immunoblots of lysates from SKMEL28 cells transfectedwith control or YAP/TAZ siRNAs for 24 hours and further treated with IFNg (10 ng/mL) for 48 hours.

Kim et al.





Figure 3.

YAP–TEAD binding to an upstream enhancer promotes PD-L1 transcription. A, Flow cytometry analysis of PD-L1 cell surface expression in mock-, YAP-5SA–, orYAP-5SA-S94A–expressing SKMEL28 and WM3248 cells. B, Immunoblots of lysates from mock-, YAP-5SA–, or YAP-5SA-S94A–expressing SKMEL28 andWM3248 cells. C, qRT-PCR analysis of PD-L1 mRNA levels in YAP-5SA–expressing SKMEL28 and WM3248 cells treated with DMSO or verteporfin (2 mmol/L)for 72 hours. D, Flow cytometry analysis of PD-L1 cell surface expression in YAP-5SA–expressing SKMEL28, WM3248, and A375SM cells treated with DMSO orverteporfin (2 mmol/L) for 72 hours. E,ChIP assay showing YAP interactionwith a potential enhancer located 13-kb upstream from the transcription start site of PD-L1gene. Lysates were prepared from SKMEL28 and WM3248 cells transfected with FLAG-tagged YAP-5SA. YAP–TEAD interacting sequence located 13-kbupstreamof PD-L1 genewas amplified byPCR after immunoprecipitation using IgGor anti-FLAGantibody. The graph on the right is ChIP-qPCR data showing relativelevels of the 13-kb upstream enhancer sequence in the immunoprecipitates. F, Relative luciferase activity of parental or YAP-5SA–expressing HEK293T cellstransfected with luciferase vector containing the 13-kb upstream enhancer. The luciferase activity was normalized to b-galactosidase activity. Data are presentedas mean � SEM of three biological replicates in C, two biological replicates in E, and four biological replicates in F. P values were determined by the unpairedt test: �, P < 0.05 and �� , P < 0.01.






melanoma cells (Fig. 5A). One possibility is that PD-1/PD-L1interaction may not be completely blocked by the additionof anti–PD-1 to the culture. Alternatively, it is also possible thatYAP can elicit PD-L1–independent mechanisms for immuneevasion. We observed suppression of cytotoxic functionand cytokine production in nonexhausted PD-1–negativeMelan-A26-35–specific CD8þ T cells after coculture with YAP-5SA–expressingmelanoma cells (Fig. 5C andD). The suppressionwas not affected by PD-1 blockade. This observation indicatesthat YAP could promotemelanoma cell's immune evasion inbothPD-L1–dependent and PD-L1-independent manner.

YAP activation was associated with higher PD-L1 expression inmelanoma tissues

To validate the clinical significance of YAP-mediated PD-L1expression, we investigated the association between YAP activityand PD-L1 expression in human melanoma tumor samples. We

first analyzed RNA-seq data for 472 melanoma tumors fromTCGA database. We stratified the tumors based on the YAPsignature enrichment score calculated by GSVA (42). Tumorswith high YAP enrichment scores showed significantly higherPD-L1 expression (Fig. 6A) in line with the above findings. Inaddition, we performed immunohistochemical staining of YAPand PD-L1 in tumor specimens from 65 melanoma patients(Supplementary Table S4). As expected, tumors with nuclear orNC YAP staining (defined as high YAP activity) had significantlyhigher PD-L1 expression than tumors with cytoplasmic YAPstaining (defined as low YAP activity; Fig. 6B). We also exploredthe linkage between YAP and PD-L1 in previously published dataon BRAFi-resistant melanoma. Hugo and colleagues comprehen-sively analyzed paired melanoma samples collected before andafter (at progression) BRAFi/MEKi therapy (GSE65185; ref. 24).They found YAP signature activation in a subset of resistanttumors. PD-L1 expression correlated with IFNg expression in the

Figure 4.

BRAFi-resistant melanoma cells evade Melan-A–specific CD8þ T cells by inducing PD-1–dependent T-cell exhaustion. A, Flow cytometry analysis ofHLA-A2-Melan-A26-35 pentamerþ cells in the established T-cell line. B, PD-1 surface expression in a Melan-A26-35–specific CD8þ T-cell line at baseline andafter induction of PD-1 expression by coculturing with Melan-A26-35 peptide-pulsed PD-L1þ A375SM for 7 days. C, Cytotoxic activity of PD-1þ Melan-A26-35–specificCD8þ T cells against parental or BRAFi-resistant A375SM cells pulsed with Melan-A26-35 peptide. Anti–PD-1 antibody or IgG isotype was added to the culture.The graph shows percentage of specific killing ofmelanoma cells with various effector-to-target ratio (E:T ratio)measured by TO-PRO3 staining and flow cytometry.Specific killing was calculated by subtracting baseline death rate without effector cells from death rate on each E:T ratio. D, Intracellular cytokine stainingand flow cytometry showing the production of IFNg and TNFa and the expression of CD107a by PD-1þ Melan-A26-35–specific CD8þ T cells cocultured withparental or BRAFi-resistant A375SM cells pulsed with cognate peptide (E:T ratio ¼ 4:1). Data are presented as mean � SEM of three biological replicatesin C. P values were calculated using the two-way ANOVA: � , P < 0.05 and �� , P < 0.01.

Kim et al.





pretreatment tumors (Fig. 6C). However, the correlation weakensafter acquiring resistance, suggesting that factors other than IFNgplay a key role in controlling PD-L1 expression in BRAFi/MEKi-resistant tumors. PD-L1 was also highly upregulated in a subset(4 out of 17) of YAP signature–enriched BRAFi/MEKi-resistanttumors (Fig. 6D). Taken together, these data provided in vivoevidence for YAP-mediated PD-L1 upregulation in human mel-anoma tumors.

DiscussionThe PD-1/PD-L1 axis is a main target for immune checkpoint

blockade. Previous studies have shown that PD-L1 expression intumor cells is induced by IFNg and oncogenic signals (13–16). Inthe present study, we have demonstrated a mechanism by whichacquisition of BRAFi resistance evokes PD-L1 upregulation. It hasbeen shown that aberrant activation of YAP is an important

Figure 5.

YAP mediates immune evasion from Melan-A–specific CD8þ T cells. A, Cytotoxic activity of PD-1þ Melan-A26-35–specific CD8þ T cells against mock orYAP-5SA–expressing A375SM cells pulsed with Melan-A26-35 peptide. Anti–PD-1 antibody or IgG isotype was added to the culture. The graph showspercentage of specific killing ofmelanoma cells with various E:T ratio. B, Intracellular cytokine staining and flow cytometry showing the production of IFNg and TNFaand the expression of CD107a by PD-1þ Melan-A26-35–specific CD8þ T cells cocultured with mock or YAP-5SA–expressing A375SM cells pulsed with cognatepeptide (E:T ratio¼ 4:1). C, Cytotoxic activity of nonexhausted PD-1�Melan-A26-35–specific CD8

þ T cells against mock or YAP-5SA–expressing A375SM cells pulsedwith Melan-A26-35 peptide. The graph shows percentage of specific killing of melanoma cells with various E:T ratio. D, Intracellular cytokine staining and flowcytometry showing the production of IFNg and TNFa and the expression of CD107a by nonexhausted PD-1� Melan-A26-35–specific CD8þ T cells coculturedwith mock or YAP-5SA–expressing A375SM cells pulsed with cognate peptide (E:T ratio ¼ 4:1). Data are presented as mean � SEM of three biologicalreplicates in A and C. P values were calculated using two-way ANOVA; � , P < 0.05 and �� , P < 0.01.






mechanismof BRAFi resistance inmelanoma (30, 34).Our resultsdemonstrated that enhanced YAP activity in BRAFi-resistant mel-anoma cells directly inhibited cytotoxic T-cell immune responsesby PD-1/PD-L1 immune checkpoint pathways. Thus, YAP-mediated BRAFi resistance acquisition not only indicates resis-tance to apoptotic and antiproliferative effects of BRAFi, but alsoevasion from antitumor T-cell responses in melanoma.

YAP is a versatile player inmalignant processes, receiving inputsfrom the tumor microenvironment and interacting with severaloncogenic pathways, including WNT, GPCR, and KRAS (29, 45,46). YAP activates potent transcriptional programs for cancer cellsurvival, metastasis, stem cell–like properties, and drug resistance(33). The deletion of Hippo pathway components or constitutiveYAP activation sufficiently induces tumorigenesis in mouse mod-els by increasing cell proliferation and stemness (47, 48). Our

finding that YAP-mediated direct suppression of cytotoxic T-cellimmune responses adds another layer to the complexity of therole of YAP in cancer pathogenesis. Because cytotoxic T-cellimmune response is a primary mechanism of immune surveil-lance of tumor cells and a vital target for tumor immunotherapy,the current study provides potential evidence of YAP involvementin antitumor immune responses and susceptibility to immuno-therapy. In addition, YAP can recruit and accumulate MDSCs inprostate and pancreatic cancers by upregulating multiple chemo-kines (37, 38). Therefore, suppression of the tumor immuneresponse is one of the key features of YAP-driven cancer patho-genesis. YAP in tumor cells receives diverse regulatory inputs,including cell polarity, actin cytoskeleton dynamics, extracellularmatrix stiffness, and cell metabolism (27, 33). Thus, we speculatethat tumor-infiltrating lymphocytes are likely under the control of

Figure 6.

YAP activity correlates with PD-L1 expression in human melanoma tumors. A, PD-L1 expression levels in 472 melanoma tumors (TCGA RNAseq data). The tumorswere classified as YAPlow, YAPmid, and YAPhigh based on YAP signature enrichment scores calculated by GSVA. B, Left, Representative images ofimmunohistochemical staining of YAP and PD-L1 according to the subcellular localization (nuclear vs. cytoplasmic) of YAP in human melanoma tissues. Right,Quantification of PD-L1 staining according to YAP subcellular localization (nuclear/NC vs. cytoplasmic) in 65 human melanoma tumor tissues. YAP and PD-L1 werestained in adjacent sections. C, Correlation between PD-L1 and IFNG expression in melanoma tissues. RNAseq data were downloaded from GSE65185 (GEOdatabase). Left, before treatment; right, progression after MAPKi treatment. R and P values were calculated by a linear regression analysis. D, PD-L1 expressionlevels (FPKM) in MAPK inhibitor–resistant tumors classified as YAP signature negatively enriched, YAP signature neutral, and YAP signature positivelyenriched according to a previous publication (22) of RNA-seq data from GSE65185. All data are presented as mean � SEM. P values were calculated using theunpaired t test in A, the Fisher exact test in B, and the Mann–Whitney test in D: � , P < 0.05 and �� , P < 0.01.

Kim et al.





the complex factors that modulate YAP activity in tumor cells.Because a considerable proportion of solid cancers are reported toexpress YAP (49), the influence of YAP on the antitumor immuneresponse and T-cell exhaustion needs to be further investigated invarious clinical and molecular contexts.

Our group and others previously identified YAP as an impor-tant player in BRAFi-resistance establishment in melanoma cells.YAP has been reported to counteract anticancer effects of BRAFinhibition by promoting E2F-related cell cycle progression andalso by upregulating antiapoptotic protein Bcl-xL (30, 34). Thecurrent study proposes another role of YAP in BRAFi resistancethat promotes PD-L1 upregulation and evasion from T-cellimmune responses. Previous studies have reported significantchanges in immunological properties of melanoma tumors pro-gressed on BRAFi, showing decreased T-cell infiltration andincreased T-cell exhaustion markers. Our findings suggest thatactivation of YAP in melanoma cells is a key mechanism thatmediates the interplay between BRAFi resistance and immunemicroenvironment, providing a clue to understand dynamicimmunological changes of melanoma tumors upon BRAFitreatment.

BRAFi-resistant and YAP-5SA–expressing cells become suscep-tible to cytotoxic T-cell attack after anti–PD-1 and anti–PD-L1antibody treatment, with YAP-mediated T-cell suppression revers-ible by PD-1 and PD-L1 blockade, which suggests thatYAP-mediated immune evasion can be targeted by PD-1/PD-L1blockade. In contrast, PD-L2 blocking antibody did not affectYAP-mediated T-cell suppression. Preclinical studies using amelanoma mouse model have reported an increase in antitumoractivity with the BRAFi/anti–PD-1 combination compared withsingle agent therapy (23, 50), and our study further supports therationale for combination or sequential therapy. However, itshouldbe alsonoted that YAP can induce resistance to cytotoxicityof nonexhausted PD-1–negative CD8þ T cells (Fig. 5C). Althoughthe PD-1/PD-L1–mediated immune checkpoint plays a majorrole in melanoma's evasion from CD8þ T-cell immuneresponses, PD-L1–independent mechanisms promoted by YAPmay also contribute to the inhibition of CD8þ T-cell functions.Previous studies have reported a decrease in T-cell infiltration inYAP-activated cancer tissues (37, 38). These findings suggestthat YAP activity inhibits adaptive immune response againsttumors in a complex manner, and YAP–TEAD targeting

agents with or without combination with immune checkpointblockade need to be tested to inhibit YAP-mediated immuneevasion processes.

In summary, our present work demonstrates an interplaybetween drug resistance in molecular targeted therapy and tumorimmune evasion. YAP confers an immune evasionmechanism toBRAFi-resistantmelanoma cells, via contributing to PD-L1 expres-sion and evasion of T-cell immune responses, which can betargeted by anti–PD-1/PD-L1 blockade. We expect that targetingof YAP-mediated immunological changes will improve BRAFitherapy efficacy and melanoma patient survival.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: M.H. Kim, C.G. Kim, S.-H. Park, E.-C. Shin, J. KimDevelopment of methodology: M.H. Kim, C.G. Kim, S.-H. Park, E.-C. ShinAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M.H. Kim, C.G. Kim, S.-K. Kim, S.J. Shin, E.A. Choe,S.-H. ParkAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M.H. Kim, C.G. Kim, S.-K. Kim, S.J. Shin, E.A. Choe,S.-H. Park, J. KimWriting, review, and/or revision of the manuscript: M.H. Kim, C.G. Kim,S.-K. Kim, S.J. Shin, E.A. Choe, S.-H. Park, E.-C. Shin, J. KimAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): C.G. Kim, S.J. Shin, E.A. Choe, J. KimStudy supervision: S.-H. Park, E.-C. Shin, J. Kim

AcknowledgmentsThis study was supported by research grants through the National Research

Foundation of Korea (2014R1A2A1A10053662 and 2016M3A9B4915821),and was also supported by a grant of the Korea Health Industry DevelopmentInstitute (KHIDI) funded by the Ministry of Health and Welfare, Republicof Korea (HI15C2817). We thank Professor Dae-Sik Lim (KAIST) for reagentsand helpful comments on the manuscript.

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received June 25, 2017; revisedOctober 25, 2017; accepted January 19, 2018;published OnlineFirst January 30, 2018.

References1. Robert C, Long GV, Brady B, Dutriaux C, Maio M, Mortier L, et al.

Nivolumab in previously untreated melanoma without BRAF mutation.N Engl J Med 2015;372:320–30.

2. Robert C, Schachter J, Long GV, Arance A, Grob JJ, Mortier L, et al.Pembrolizumab versus ipilimumab in advanced melanoma. N Engl J Med2015;372:2521–32.

3. Park J, Kwon M, Shin EC. Immune checkpoint inhibitors for cancertreatment. Arch Pharm Res 2016;39:1577–87.

4. Okazaki T, Chikuma S, Iwai Y, Fagarasan S,Honjo T. A rheostat for immuneresponses: the unique properties of PD-1 and their advantages for clinicalapplication. Nat Immunol 2013;14:1212–8.

5. Dong H, Strome SE, Salomao DR, Tamura H, Hirano F, Flies DB, et al.Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mecha-nism of immune evasion. Nat Med 2002;8:793–800.

6. Pardoll DM. The blockade of immune checkpoints in cancer immuno-therapy. Nat Rev Cancer 2012;12:252–64.

7. Tumeh PC, Harview CL, Yearley JH, Shintaku IP, Taylor EJ, Robert L, et al.PD-1 blockade induces responses by inhibiting adaptive immune resis-tance. Nature 2014;515:568–71.

8. Garon EB, Rizvi NA, Hui R, Leighl N, Balmanoukian AS, Eder JP, et al.Pembrolizumab for the treatment of non-small-cell lung cancer. N Engl JMed 2015;372:2018–28.

9. Gu L, Chen M, Guo D, Zhu H, Zhang W, Pan J, et al. PD-L1 and gastriccancer prognosis: a systematic review and meta-analysis. PLoS One2017;12:e0182692.

10. Kerr KM, Nicolson MC. Non-small cell lung cancer, PD-L1, and thepathologist. Arch Pathol Lab Med 2016;140:249–54.

11. Madore J, Vilain RE, Menzies AM, Kakavand H, Wilmott JS, Hyman J, et al.PD-L1 expression in melanoma shows marked heterogeneity within andbetween patients: implications for anti-PD-1/PD-L1 clinical trials. PigmentCell Melanoma Res 2015;28:245–53.

12. Sheng J, Fang W, Yu J, Chen N, Zhan J, Ma Y, et al. Expression ofprogrammed death ligand-1 on tumor cells varies pre and post chemo-therapy in non-small cell lung cancer. Sci Rep 2016;6:20090.

13. Taube JM, Anders RA, Young GD, Xu H, Sharma R, McMiller TL, et al.Colocalization of inflammatory response with B7-h1 expression in humanmelanocytic lesions supports an adaptive resistance mechanism ofimmune escape. Sci Transl Med 2012;4:127ra37.






14. Parsa AT, Waldron JS, Panner A, Crane CA, Parney IF, Barry JJ, et al. Loss oftumor suppressor PTEN function increases B7-H1 expression and immu-noresistance in glioma. Nat Med 2007;13:84–8.

15. ChenN, FangW, Zhan J, Hong S, Tang Y, Kang S, et al. Upregulation of PD-L1 by EGFR activation mediates the immune escape in EGFR-DrivenNSCLC: implication for optional immune targeted therapy for NSCLCpatients with EGFR mutation. J Thorac Oncol 2015;10:910–23.

16. Marzec M, Zhang Q, Goradia A, Raghunath PN, Liu X, Paessler M, et al.Oncogenic kinase NPM/ALK induces through STAT3 expression of immu-nosuppressive protein CD274 (PD-L1, B7-H1). Proc Natl Acad Sci USA2008;105:20852–7.

17. Chapman PB, Hauschild A, Robert C, Haanen JB, Ascierto P, Larkin J, et al.Improved survival with vemurafenib in melanoma with BRAF V600Emutation. N Engl J Med 2011;364:2507–16.

18. Flaherty KT, Robert C, Hersey P, Nathan P, Garbe C, Milhem M, et al.Improved survival with MEK inhibition in BRAF-mutated melanoma.N Engl J Med 2012;367:107–14.

19. Knight DA, Ngiow SF, Li M, Parmenter T, Mok S, Cass A, et al. Hostimmunity contributes to the anti-melanoma activity of BRAF inhibitors.J Clin Invest 2013;123:1371–81.

20. Frederick DT, Piris A, Cogdill AP, Cooper ZA, Lezcano C, Ferrone CR, et al.BRAF inhibition is associated with enhanced melanoma antigen expres-sion and a more favorable tumor microenvironment in patients withmetastatic melanoma. Clin Cancer Res 2013;19:1225–31.

21. Boni A, Cogdill AP, Dang P, Udayakumar D, Njauw CN, Sloss CM, et al.Selective BRAFV600E inhibition enhances T-cell recognition of mela-noma without affecting lymphocyte function. Cancer Res 2010;70:5213–9.

22. Wilmott JS, LongGV,Howle JR, Haydu LE, Sharma RN, Thompson JF, et al.Selective BRAF inhibitors induce marked T-cell infiltration into humanmetastatic melanoma. Clin Cancer Res 2012;18:1386–94.

23. Ebert PJ, Cheung J, Yang Y, McNamara E, Hong R, Moskalenko M, et al.MAP kinase inhibition promotes T cell and anti-tumor activity incombination with PD-L1 checkpoint blockade. Immunity 2016;44:609–21.

24. Hugo W, Shi H, Sun L, Piva M, Song C, Kong X, et al. Non-genomic andimmune evolution of melanoma acquiring MAPKi resistance. Cell2015;162:1271–85.

25. Jiang X, Zhou J, Giobbie-Hurder A, Wargo J, Hodi FS. The activation ofMAPK in melanoma cells resistant to BRAF inhibition promotes PD-L1expression that is reversible by MEK and PI3K inhibition. Clin Cancer Res2013;19:598–609.

26. KakavandH,Wilmott JS,Menzies AM, Vilain R, Haydu LE, Yearley JH, et al.PD-L1 expression and tumor-infiltrating lymphocytes define differentsubsets of MAPK inhibitor-treated melanoma patients. Clin Cancer Res2015;21:3140–8.

27. Yu FX, Zhao B, Guan KL. Hippo pathway in organ size control, tissuehomeostasis, and cancer. Cell 2015;163:811–28.

28. Benhamouche S, CurtoM, Saotome I, Gladden AB, Liu CH, Giovannini M,et al. Nf2/Merlin controls progenitor homeostasis and tumorigenesis in theliver. Genes Dev 2010;24:1718–30.

29. Feng X, Degese MS, Iglesias-Bartolome R, Vaque JP, Molinolo AA, Rodri-gues M, et al. Hippo-independent activation of YAP by the GNAQ uvealmelanoma oncogene through a trio-regulated rho GTPase signaling cir-cuitry. Cancer Cell 2014;25:831–45.

30. Kim MH, Kim J, Hong H, Lee SH, Lee JK, Jung E, et al. Actin remodelingconfers BRAF inhibitor resistance to melanoma cells through YAP/TAZactivation. EMBO J 2016;35:462–78.

31. Azzolin L, Panciera T, Soligo S, Enzo E, Bicciato S, Dupont S, et al. YAP/TAZincorporation in the beta-catenin destruction complex orchestrates theWnt response. Cell 2014;158:157–70.

32. Hong X, Nguyen HT, Chen Q, Zhang R, Hagman Z, Voorhoeve PM, et al.Opposing activities of the ras and hippo pathways converge on regulationof YAP protein turnover. EMBO J 2014;33:2447–57.

33. Zanconato F, Cordenonsi M, Piccolo S. YAP/TAZ at the roots of cancer.Cancer Cell 2016;29:783–803.

34. Lin L, Sabnis AJ, Chan E, Olivas V, Cade L, Pazarentzos E, et al. The Hippoeffector YAP promotes resistance to RAF- and MEK-targeted cancer ther-apies. Nat Genet 2015;47:250–6.

35. KimMH, Kim J. Role of YAP/TAZ transcriptional regulators in resistance toanti-cancer therapies. Cell Mol Life Sci 2017;74:1457–74.

36. Guo X, Zhao Y, Yan H, Yang Y, Shen S, Dai X, et al. Single tumor-initiatingcells evade immune clearanceby recruiting type IImacrophages.GenesDev2017;31:247–59.

37. Wang G, Lu X, Dey P, Deng P, Wu CC, Jiang S, et al. TargetingYAP-dependent MDSC infiltration impairs tumor progression. CancerDiscov 2016;6:80–95.

38. Murakami S, ShahbazianD, Surana R, ZhangW, ChenH,GrahamGT, et al.Yes-associated protein mediates immune reprogramming in pancreaticductal adenocarcinoma. Oncogene 2016; doi:10.1038/onc.2016.288.

39. Zanconato F, ForcatoM, BattilanaG, Azzolin L,Quaranta E, Bodega B, et al.Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancersdrives oncogenic growth. Nat Cell Biol 2015;17:1218–27.

40. Barrett T,Wilhite SE, Ledoux P, EvangelistaC, Kim IF, TomashevskyM, et al.NCBI GEO: archive for functional genomics data sets—update. NucleicAcids Res 2013;41:D991–5.

41. Li B, Dewey CN. RSEM: accurate transcript quantification from RNA-Seqdata with or without a reference genome. BMC Bioinformatics 2011;12:323.

42. Hanzelmann S, Castelo R, Guinney J. GSVA: gene set variation analysis formicroarray and RNA-seq data. BMC Bioinformatics 2013;14:7.

43. Chinai JM, Janakiram M, Chen F, Chen W, Kaplan M, Zang X. Newimmunotherapies targeting the PD-1 pathway. Trends Pharmacol Sci2015;36:587–95.

44. Zhao B, Ye X, Yu J, Li L, LiW, Li S, et al. TEADmediates YAP-dependent geneinduction and growth control. Genes Dev 2008;22:1962–71.

45. Gregorieff A, Liu Y, Inanlou MR, Khomchuk Y, Wrana JL. Yap-dependentreprogramming of Lgr5(þ) stem cells drives intestinal regeneration andcancer. Nature 2015;526:715–8.

46. Zhang W, Nandakumar N, Shi Y, Manzano M, Smith A, Graham G, et al.Downstream of mutant KRAS, the transcription regulator YAP is essentialfor neoplastic progression to pancreatic ductal adenocarcinoma. Sci Signal2014;7:ra42.

47. Zhou D, Conrad C, Xia F, Park JS, Payer B, Yin Y, et al. Mst1 and Mst2maintain hepatocyte quiescence and suppress hepatocellular carcinomadevelopment through inactivation of the Yap1 oncogene. Cancer Cell2009;16:425–38.

48. Dong J, Feldmann G, Huang J, Wu S, Zhang N, Comerford SA, et al.Elucidation of a universal size-control mechanism in Drosophila andmammals. Cell 2007;130:1120–33.

49. Steinhardt AA, Gayyed MF, Klein AP, Dong J, Maitra A, Pan D, et al.Expression of Yes-associated protein in common solid tumors. HumPathol 2008;39:1582–9.

50. Hu-Lieskovan S, Mok S, HometMoreno B, Tsoi J, Robert L, Goedert L, et al.Improved antitumor activity of immunotherapy with BRAF and MEKinhibitors in BRAF(V600E) melanoma. Sci Transl Med 2015;7:279ra41.


Kim et al.




2018;6:255-266. Published OnlineFirst January 30, 2018.Cancer Immunol Res Min Hwan Kim, Chang Gon Kim, Sang-Kyum Kim, et al. BRAFi-Resistant MelanomaYAP-Induced PD-L1 Expression Drives Immune Evasion in

Updated version

10.1158/2326-6066.CIR-17-0320doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2018/01/30/2326-6066.CIR-17-0320.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/6/3/255.full#ref-list-1

This article cites 49 articles, 15 of which you can access for free at:

Citing articles

http://cancerimmunolres.aacrjournals.org/content/6/3/255.full#related-urls

This article has been cited by 4 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/6/3/255To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-17-0320

http://cancerimmunolres.aacrjournals.org/content/suppl/2018/01/30/2326-6066.CIR-17-0320.DC1

http://cancerimmunolres.aacrjournals.org/content/6/3/255.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/content/6/3/255.full#related-urls

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/6/3/255


Documents

YAP-Induced PD-L1 Expression Drives Immune Evasion in BRAFi … · Research Article YAP-Induced PD-L1 Expression Drives Immune Evasion in BRAFi-Resistant Melanoma Min Hwan Kim1, Chang